US 2012O11467OA1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2012/0114670 A1 Land et al. (43) Pub. Date: May 10, 2012
(54) METHODS AND COMPOSITIONS RELATED Publication Classification TO SYNERGISTC RESPONSESTO (51) Int. Cl ONCOGENC MUTATIONS A 6LX 39/395 (2006.01) GOIN 33/566 (2006.01) (75) Inventors: Hartmut Land, Rochester, NY C40B 30/04 (2006.01) (US); Helene R. McMurray, A638/17 (2006.01) Rochester, NY (US); Erik R. 48. 424, 38:8: Sampson, Holden, MA (US) A63L/65 (2006.015 A6II 3/66 (2006.01) (73) Assignee: UNIVERSITY OF ROCHESTER, A6II 3/565 (2006.01) Rochester, NY (US) A63L/43 (2006.01) A6II 3/545 (2006.01) A63L/506 (2006.01) (21) Appl. No.: 13/011,901 A6II 3/52 (2006.01) A63L/485 (2006.01) 22) Filed: Jan. 23, 2011 A63L/365 (2006.01) (22) File al. As A6IP35/00 (2006.01) A6IP35/02 (2006.01) Related U.S. Application Data A6IP35/04 (2006.01) CI2O I/68 (2006.01) (63) Continuation-in-part of application No. 12/678.351, (52) U.S. '571.36AE. s'. s' filed on Jun. 16, 2010, filed as application No. PCT/ 514/196514/34. 51444 A. 514/152, 514/159. US08/11375 on Oct. 2, 2008. 514/182: 514/197; 514/226.2: 514/252.15; 514/263.2: 514/289; 514/450 (60) Provisional application No. 60/977,052, filed on Oct. (57) ABSTRACT 2, 2007, provisional application No. 61/044,372, filed Disclosed are compositions and methods related to new tar on Apr. 11, 2008. gets for cancer treatment. Patent Application Publication May 10, 2012 Sheet 1 of 32 US 2012/011.4670 A1
? 3Signal Transduction (32%) Transcription Regulation (12%) Ex Metabolism & Transport (20% E3 Apoptosis 5% ) EUnknown Function (16%) Ed Other (3%) 3 Cell Adhesion & Cytoskeleton (13%)
Cooperation Response Genes
¿
01?¢ººººººººººººººººººººººººººººººººººººººººº
Rpr
Figure 1 Patent Application Publication May 10, 2012 Sheet 2 of 32 US 2012/011.4670 A1
A
Sod3 (d (d. Oaf Sc1431 (d Ankrd1 or'e Hmga2
10
(y -2 -10 5 ( Elawl2 Gca d Prkg1. MM15 Abat g Dgka (elda col9as sis: R. s. O Rab4Ob
sis: s s
t-statistic (mp53/Ras vs. YAMC)
Figure 2 Patent Application Publication May 10, 2012 Sheet 3 of 32 US 2012/011.4670 A1
Signal Transduction Metabolism & Transport Unknown Function 8 Cell Adhesion & Cytoskeleton e Transcription Regulation Apoptosis
Non-Cooperatively Regulated Genes
Non-Cooperatively Regulated Genes
Figure 3 Patent Application Publication May 10, 2012 Sheet 4 of 32 US 2012/011.4670 A1
83:38: 8:888:838.
Patent Application Publication May 10, 2012 Sheet 5 of 32 US 2012/011.4670 A1
E.sessessessessssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssss
8: 8.
8:
Patent Application Publication May 10, 2012 Sheet 6 of 32 US 2012/011.4670 A1
A Re-expression of Down-Regulated CRG in mp53/Ras Cells
Dffb FaS 1000 100
100 s
9. &XX 9. 10 8X:x: I t X 9 x : 1 - 1 XX: 1. Y xx: 0.1 &XX O.1 YAMC Expt 1 Expt 2 YAMC Expt 1 Expt 2 Injections (n) 3, 4 3, 4 Injections (n) 3, 8 10, 2 mp53/Ras-Vector mp53, Ras-Dfb mp53/Ras-Vector mp53/Ras-FasR
HOXC13 10
s g X. g & d 1 & g & 2 Xx:XX c t xxXx: ? x Xx:X Xx: 0.1 x: YAMC Expt 1 Expt2 Expt 3 Expt 4 Injections (n) 2, 2 2, 2 2, 2 2, 2 mp53/Ras-Vector mp53/Ras-HoxC13
1000
100
X. 10 : : O.1 YAMC Expt 1 Expt2 Expt 3 Injections (n) 2, 2 2, 2 4, 2 mp53/Ras-Vector mp53/Ras-ld2 Figure 6 Patent Application Publication May 10, 2012 Sheet 7 of 32 US 2012/011.4670 A1
A Re-expression of Down-Regulated CRG in mp53/Ras Cells
d4 10000
1OOO .9
:c 100 O 88 a. x: XI XX& g 10 KXx: c xXX gY XX& 1 - &x: XXX: 0.1 YAMC Expt 1 Expt2 Expt 3 Injections (n) 4, 2 2, 2 2, 2 mp53/Ras-Vector mp53/Ras-ld4
Jag2 1000 Noxa 10000
s 100 s 1000
10 gis 100- X.x g X 2 g 10- xxX d t & dr 1 c Y KXxx 1 - & XXX. 0.1 YAMC Expt 1 Expt2 YAMC Expt 1 Injections (n) 8, 6 4, 2 Injections (n) 6, 8 mp53/Ras-Vector mp53/Ras-Jag2 Dmp53/Ras-Vector mp53/Ras-Noxa
Perp PXCC2 1000 1000
s 100 3 100
f5 10 x:X. s 10 - g &X. .2cy 1 - &XX wc c x 1 - 1. x 0.1 X: YAMC Expt 1 Expt2 Expt 3 O.1 niecti 2.8 3.4 3.4 YAMC Expt 1 Expt2 Expt 3 JeCIOS (n) y y y Injections (n) 2, 2 2, 2 2, 2 mp53/Ras-Vector mp53/Ras-Perp mp53/Ras-Vector mp53/Ras-Pixdc2
Figure 6 Patent Application Publication May 10, 2012 Sheet 8 of 32 US 2012/011.4670 A1
A Re-expression of Down-Regulated CRG in mp53/Ras Cells
Rprm Sema3d
OO 100
10 10 3 8 g x s & I 2 & g 1 w 1 x: XXX gce 1. x:XX 0.1 x:Xx: O.1 YAMC Expt 1 Expt 2 YAMC Expt 1 Expt2 Expt 3 Injections (n) 2, 8 3, 4 Injections (n) 2, 2 2, 2 2, 2 mp53/Ras-Vector mp53/Ras-Rprm mp53/Ras-Vector mp53/Ras-Sema3d
Sfrp2 Wnt3a 10000 1000
1000 -
3 3 100 3f 100 - 3
g if 10 g 10 - S. t i: 1 - 2 1 -
O1 0.1 YAMC Expt 1 Expt 2 Expt 3 YAMC Expt 1 Expt2 Expt 3 Expt 4 Injections (n) 3,4 3, 4 2, 2 Injections (n) 4, 2 4, 2 2, 2 2, 2 mp53/Ras-Vector mp53/Ras-Sfrp2 mp53/Ras-Vector mp53/Ras-Wnt9a
Zfp385 100
.9 3 10 - s X I d . s d 1 1.
0.1 YAMC Expt 1 Expt2 Expt 3 Expt 4 Injections (n) 2, 2 4, 2 2, 2 2, 2 Dmp53/Ras-Vector mp53/Ras-Zfp385 Figure 6
Patent Application Publication May 10, 2012 Sheet 12 of 32 US 2012/011.4670 A1
D shRNA Knock-Down of Up-Regulated non-CRG in mp53/Ras Cells
YAMC Injections (n) mp53/Ras-Vector mp53/Ras-Bnip3-3 mp53/Ras-Bnip3-6
Dap 1.2
1 - 9. 33. 0.8 s i 0.6 ..a S: O.4 O.2 : O YAMC Expt 1 Expt2 Expt 3 Injections (n) 4, 4 4, 4 6, 6 Dmp53/Ras-Vector mp53/Ras-Dap-1 mp53/Ras-Dap-4
EtV1 1.2
1 9 : 0.8 s X 0.6 did 2 as 0.4 Y 0.2 O.0004
O YAMC Expt 1 Expt 2 YAMC Expt1 Injections (n) 4, 3, 2 4, 4, 4 Injections (n) 8, 6 Omp53/Ras-Vector mp53/Ras-Etv 1-1003 mp53/Ras-Vector mp53/Ras-lgfbpashB47 mp53/Ras-Etv1-1686
Figure 6 Patent Application Publication May 10, 2012 Sheet 13 of 32 US 2012/011.4670 A1
D shRNA Knock-Down of Up-Regulated non-CRG in mp53/Ras Cells Kf2 Nrp2 12 12
1 - 1 .9 8f O.8 - 8f O8 s s n 0.6 - 0.6 d gld 0.4 > 0.4 D 02 : Cl3 o2 O O YAMC Expt 1 Expt2 YAMC Injections (n) 2, 4 4, 6 Injections (n) mp53/Ras-Vector mp53/Ras-Kf2sh932 mp53/Ras-Vector mp53/Ras-Nrp2sh 1 3 mp53/Ras-Nrp2sh2 Smp53/Ras-Nrp2sh3
PaX3 TmcC3 1.2 12
1 - 1 9. f 0.8 30.8id f 9. gld 0.6 0.6 > did 2 is 0.4 c. 0.4 1. i 0.2 : 0.2 O O YAMC Expt 1 YAMC Expt 1 Expt 2 Injections (n) 10, 8, 10 Injections (n) 4, 2, 2 6, 4 mp53/Ras-Vector mp53/Ras-Pax3sh 1897 Omp53/Ras-Vector 8 mp53/Ras-Pax3sh2339 mp53/Ras-Tmcc3sh450 Emp53/Ras-Tmcc3sh251
E Combined Re-expression of Down-Regulated CRG in mp53/Ras Cells Fas Expression Rprm Expression 100 1OOO
EYAMC YAMC 100 - 10 - mp53/Ras mp53/Ras Vect--Vect Wect-Wect mp53/Ras mp53/Ras Vect+Rprm Fas--Vect ::8 8 3 mp53/Ras 8 3 mp53/Ras Fas--Rprm 8 3 Fas+Rprm O.1 O.1 Injections (n) 10, 10, 8 Injections (n) 10, 12, 8 Expt 1 Expt 1 Figure 6
Patent Application Publication May 10, 2012 Sheet 15 of 32 US 2012/011.4670 A1
B ShrNA Knock-DOWn in HT-29 Human Colon Cancer Cells PlaC8 O1 O 6 O4
0.2 Š O Expt 1 Injections (n) 6, 1, 4 HT-29-Wector HT-29-. Plac8Sh259 -29-Plac8sh464
C Combined Expression of Murine Fas and Murine Rprm in DLD-1 Human Colon CanCer Cells Fas Expression Rprm Expression 1.E+06 1OOO
1.E+05 1E-04 100 1E--O3 1O -
O.1 Expt 1 Expt 1 Injections (n) 16, 13, 6 Injections (n) 16, 18, 6 DLD1-Wect--Vect DLD1-Wect--Vect DLD1-Vect-Fas DLD1-Vect+Rprm 83DLD1-Fas+Reprimo DLD1-Fas--Rprm
Figure 7 May 10, 2012 Sheet 16 of 32 US 2012/011.4670 A1
-?~);dild;--
Figure 8 Patent Application Publication May 10, 2012 Sheet 17 of 32 US 2012/011.4670 A1
&
Patent Application Publication May 10, 2012 Sheet 18 of 32 US 2012/011.4670 A1
Me Lum Basal Mel Lum Basal Colon Panc Prost Me Mets Lund BrCa BrCa Colon Panc Prost
Mel Mets Lung BrCa BrCa s f f f f f Mmp 15 & $$$ MOO7 Š Mr15 f | Š Š Ms4a 10 f f f f f $ MtuS 1 : f
Parwb f
& Prkcm f f
Š Šiš $ Rai2 88 f 8 rirr Ras11a | 1 f f Š $ $ | $ Š f Šiš Sbsin f
Sema3d Semafa Serpinb2.l. f f Šiš sicialSf Š Š SC27a3 $ Sms
$ $
ex15 f f f nfrsf18 f f f nnt2
KCtd 15 LaSS4
Figure 10 Patent Application Publication May 10, 2012 Sheet 19 of 32 US 2012/011.4670 A1
A a E “’s 69 genes
g3g 9. , " ? F2r1 ...,Eno3 chist1P. Fgft 33 match direction is 20 ...... 20 25 p<0.05 in human r .9 S3 Pit pp. 1. Rab40 S2 i. &82&
-3.J. t-statistic (mp53/Ras vs. YAMC)
8
d 6
W E 4 & Sa?: C , 47 genes Sema7a T2
f :st 25. -20. - Noxa. -o Nbea. -5 . . 10 15. 20." 25 31 matched direction 23 p<0.05 in human g k:gs is t
t-statistic (mp53/Ras vs. YAMC)
Figure 11 Patent Application Publication May 10, 2012 Sheet 20 of 32 US 2012/011.4670 A1
?*************
Figure 12
Patent Application Publication May 10, 2012 Sheet 21 of 32 US 2012/011.4670 A1
A. 9.0 UT 25.0 - NB 8.0 SWA 20.0 - 7.0
6.O 15.0 - 5.0
4.O 10.0 - 3.0
20 5. O 1.O
YAMC
50.O 6.0 450 UT NB 5.0 40.O SWA 35.0 4.0 30.0 25.0 3.0 2O.O 2.0 15.0 10.0 1.0 50 O.O YAMC Mp53/Ras
1OOO 600 UT NB 500
6 O. O
300
2OO
100
12345 OOOOO OO O. O YAMC Mp53/Ras Figure 13 Patent Application Publication May 10, 2012 Sheet 22 of 32 US 2012/011.4670 A1
Figure 14 Patent Application Publication May 10, 2012 Sheet 23 of 32 US 2012/011.4670 A1 §3.3×3×3{{}}:}******* 38: S:-388:8; 3.83888
3::::::::::::::
g|aumôi+ Patent Application Publication May 10, 2012 Sheet 24 of 32 US 2012/0114670 A1
LOQ
Patent Application Publication May 10, 2012 Sheet 25 of 32 US 2012/011.4670 A1
50
O
Figure 17 Patent Application Publication May 10, 2012 Sheet 26 of 32 US 2012/011.4670 A1
assasssssssressessessers s :
Patent Application Publication May 10, 2012 Sheet 28 of 32 US 2012/011.4670 A1
:: :
:
Figure 20 Patent Application Publication May 10, 2012 Sheet 29 of 32 US 2012/011.4670 A1
Patent Application Publication May 10, 2012 Sheet 30 of 32 US 2012/011.4670 A1
ity erosious Patent Application Publication May 10, 2012 Sheet 31 of 32 US 2012/011.4670 A1
- Serum - Serum
alone
Ras alone
f.
Figure 23 Patent Application Publication May 10, 2012 Sheet 32 of 32 US 2012/011.4670 A1
& & - ::::::::::::: x: US 2012/01 14670 A1 May 10, 2012
METHODS AND COMPOSITIONS RELATED (A) and CRG synergy scores (B). Bars are coded for gene TO SYNERGISTC RESPONSESTO associated biological processes according to Gene Ontology ONCOGENC MUTATIONS (GO) database. C) Table summarizing co-regulation of CRGs in mp53/Ras cells and human cancer based on literature sur Vey for a variety of human cancers and two independent 0001. This work was supported in part by NIH grants expression analyses of primary human colon cancers. Up- or CA90663, CA120317, GMO75299; T32 CA09363; NCI down-regulation of CRG expression vs. controls is indicated, RO1-CA138249-02, NCIP30-CA147880-01, and NLMR00 lack of CRG representation on arrays by (/). Arrows indicate LM009477-02. The government has certain rights in the genes perturbed in this study. invention. 0007 FIG. 2 shows the assessment of co-regulation for 0002 This application claims priority to U.S. application CRG expression in human colon cancer and murine colon Ser. No. 12/678,351 which is a 371 National Stage Applica cancer cell model. T-statistics of CRG expression for a total of tion of PCT Application No. PCT/US08/11375, filed on Oct. 75 out of 95 genes are shown for human colon cancer, as 2, 2008, which claims the benefit of U.S. Provisional Appli compared to normal tissue samples plotted against t-statistics cation No. 60/977,052, filed on Oct. 2, 2007 and U.S. Provi of expression values for the same genes in mp53/Ras cells, as sional Application No. 61/044,372, filed on Apr. 11, 2008, compared to YAMC. Data points in lower left and upper right which are incorporated by reference herein in their entirety. hand quadrants show co-regulation of the indicated genes in the murine model and human colon cancer. FIG. 2A shows I. BACKGROUND plot based on cDNA microarray data as described in Supple 0003. Understanding the molecular underpinnings of can mental Methods. Of the 95 CRG identified in mp53/Ras cells, cer is of critical importance to developing targeted interven 69 genes are represented on these cDNA arrays. Names are tion strategies. Identification of Such targets, however, is indicated for the 33 genes that appear co-regulated. Of these, notoriously difficult and unpredictable. Malignant cell trans 17 are significantly differentially expressed (t-test, unad formation requires the cooperation of a few oncogenic muta justed, p<0.05) in this human dataset, indicated. FIG. 2B tions that cause Substantial reorganization of many cell fea shows plot based on oligonucleotide microarray data, as tures (Hanahan, D. & Weinberg, R.A. (2000) Cell 100, 57-70) described in Supplemental Methods. Of the 95 CRG identi and induce complex changes in gene expression patterns (Yu, fied in mp53/Ras cells, 38 genes are represented on these J. et al. (1999) Proc Natl AcadSci USA96, 14517-22 (1999); microarrays. Names are indicated for the 20 genes that appear Zhao, R. et al. (2000) Genes Dev 14, 981-93; Schulze, A., et co-regulated. Of these, 6 are significantly differentially al. (2000) Genes Dev 15,981-94: Huang, E. et al. (2003) Nat expressed (t-test, unadjusted, p<0.05) in this human dataset, Genet. 34,226-30; Boiko, A. D. et al. A (2006) Genes Dev 20, indicated. All CRGs are significantly differentially expressed 236-52). Genes critical to this multi-faceted cellular pheno in our murine data set. type thus only have been identified following signaling path 0008 FIG. 3 shows the differential expression and syn way analysis (Vogelstein, B., et al. (2000) Nature 408, 307 ergy score ranking of genetically perturbed non-CRGs in 10; Vousden, K. H. & Lu, X. (2002) Nat Rev Cancer 2, mp53/Ras cells. Bar graphs indicate fold-change expression 594-604: Downward, J. (2003) Nat Rev Cancer 3, 11-22: (log) in mp53/Ras vs. YAMC cells (A) and synergy scores Rodriguez-Viciana, P. et al. (2005) Cold Spring Harb Symp (B) derived from Affymetrix microarray data for non-CRGs Quant Biol 70,461-7) or on an adhoc basis (Schulze, A., et al. selected for gene perturbation experiments. Color code illus (2000) Genes Dev 15, 981-94: Okada, F. et al. (1998) Proc trates gene-associated biological process according to GO. Natl Acad Sci USA 95, 3609-14; Clark, E. A., et al. (2000) 0009 FIG. 4 shows the synergistic response of down Nature 406, 532-5; Yang, J. et al. (2004) Cell 117,927-39; stream genes to oncogenic mutations is a strong predictor for Minn, A.J. et al. (2005) Nature 436,518-24). Thus, there is a critical role in malignant transformation. FIG. 4A shows bar need for new methods of identifying genes critical to the graphs indicating percent change in endpoint tumor Volume formation, proliferation and maintenance of cancer. following CRG and non-CRG perturbations in mp53/Ras cells (left and right panel, respectively). Perturbations signifi II. SUMMARY cantly decreasing tumor size, as compared to matched con trols are shown (***, p<0.001; **, p<0.01: *, p<0.05; Wil 0004 Disclosed are methods and compositions related to coxn signed-rank and t-test). FIG. 4B shows the distribution in one aspect methods for identifying targets for the treatment of gene perturbations over the set of genes differentially of a cancer. In other aspect, disclosed herein are methods for expressed in mp53/Ras cells, rank-ordered by Synergy score. screening for an agent that treats a cancer. Also disclosed Bars, color-coded as above, indicate perturbed genes. CRG herein are methods of treating cancer. Further disclosed are cut-off synergy score (0.9) is indicated by horizontal line. methods related to determining whether a cancer is suscep 0010 FIG. 5 shows the Synergy score ranking of CRGs in tible to treatment. mp53/Ras cells. Graph showing synergy scores for the entire list of 95 CRGs identified in this study derived from Affyme III. BRIEF DESCRIPTION OF THE DRAWINGS trix microarray data, as described in Methods. Individual 0005. The accompanying drawings, which are incorpo synergy scores and associated estimated p values are indi rated in and constitute a part of this specification, illustrate cated in Table 1. Bars indicate CRGs chosen for gene pertur several embodiments and together with the description illus bation experiments. Perturbations causing significant tumor trate the disclosed compositions and methods. reduction are indicated in by a darker line; those not causing 0006 FIG. 1 shows the differential expression and syn reduction are lightly marked. ergy scores of CRGs in mp53/Ras cells and CRG co-regula 0011 FIG. 6 shows the resetting mRNA expression levels tion in human colon cancer. Bar graphs ranking CRG expres in mp53/Ras cells to approximate mRNA levels in normal sion measured by microarray in mp53/Ras vs. YAMC cells YAMC cells via gene perturbations. Each panel shows the US 2012/01 14670 A1 May 10, 2012 relative expression levels of an individual gene following its tumors formed four weeks after injection of cell populations perturbation in mp53/Ras cells together with its expression with indicated CRG perturbations, as compared with levels in the matching vector control mp53/Ras cells and the matched vector controls, colored as above. The box indicates parental YAMC cells, as measured by SYBR Green QPCR. the range from the first quartile to the third quartile of the data. Error bars indicate standard deviation of triplicate samples. The line in the box indicates the median value. The whiskers Independent derivations of the perturbed cells and controls or error bars indicate the highest and lowest values in the data. are shown individually. Injection numbers relating to Plots are ranked by % change in tumor volume. Xenograft assays are shown for each cell derivation, vector 0014 FIG.9 shows that resetting mRNA expression levels followed by perturbed cells. FIG. 6A shows the Re-expres in mp53/Ras cells to approximate mRNA levels in normal sion of down-regulated CRGs in mp53/Ras cells. For CRGs YAMC cells via gene perturbations. Each panel shows the identified as critical for tumor formation, levels of cDNA relative expression levels of an individual gene following its re-expression in the respective cell populations were below, at perturbation in mp53/Ras cells together with its expression or marginally above mRNA expression levels of the corre levels in the matching vector control mp53/Ras cells and the sponding endogenous gene in YAMC cells, although the pos parental YAMC cells, as measured by SYBR Green QPCR. sibility of over-expression at the protein level cannot be Error bars indicate standard deviation of triplicate samples. excluded. For CRGs determined to be non-critical, tumor Independent derivations of the perturbed cells and controls inhibitory effects were not observed over a wide range of are shown individually. For CRGs identified as critical for re-expression levels, including strong over-expression. FIG. tumor formation, levels of cDNA re-expression in the respec 6B shows the shRNA-mediated knock-down of up-regulated tive cell populations were below, at or marginally above CRGs in mp53/Ras cells. FIG. 6C shows the re-expression of mRNA expression levels of the corresponding endogenous down-regulated non-CRGs in mp53/Ras cells. For non-CRGs gene in YAMC cells, although the possibility of over-expres determined to be non-critical, tumor-inhibitory effects were sion at the protein level cannot be excluded. For CRGs deter not observed over a wide range of re-expression levels, mined to be non-critical, tumor-inhibitory effects were not including strong over-expression. The tumor-inhibitory observed overa wide range of re-expression levels, including effect of Tbx 18 may be due to over-expression, as only cell strong over-expression. populations expressing levels of Tbx18 RNA 10-30x above 0015 FIG. 10 shows that cooperation response genes are YAMC levels were obtained. Similarly, the tumor-promoting highly co-regulated in human colon cancer, pancreatic can effect of the Cox6b2 perturbation may be due to over-expres cer, prostate cancer, lung cancer, and melanoma. Table sum sion. FIG. 6D shows shRNA-mediated knock-down of up marizing co-regulation of CRGs in mp53/Ras cells and regulated non-CRGs in mp53/Ras cells. FIG. 6E shows the human cancer based on independent expression analyses of combined re-expression of Fas and Rprm in mp53/Ras cells. primary human colon cancer, pancreatic cancer, prostate can 0012 FIG. 7 shows the altered CRG expression in human cer, lung cancer, melanoma. Up- or down-regulation of CRG colon cancer cells following gene perturbations. Each panel expression VS. controls is indicated, by dark or light shading, shows the relative mRNA expression levels of the indicated respectively. Lack of CRG representation on arrays is indi gene following its perturbation in DLD-1 or HT-29 cells cated by (/). Effects of gene perturbations in mp53/Ras cells together with its mRNA expression level in the matching are indicated by presence of shading around text (shaded text vector control cells, as measured by SYBR Green QPCR. box, tumor inhibitory; no shade, not inhibitory/not tested). Error bars indicate standard deviation of triplicate samples. 0016 FIG. 11 shows the assessment of co-regulation for Independent derivations of the perturbed cells and controls CRG expression in human pancreatic and prostate cancer and are shown individually. Injection numbers relating to murine colon cancer cell model. Data points in lower left and Xenograft assays are shown for each cell derivation, vector upper right hand quadrants show co-regulation of the indi followed by perturbed cells. FIG. 7A shows the expression of cated genes in the murine model and human colon cancer. human cDNA for HoxC13 and murine cDNAs for Jag2, Dffb. FIG. 11A shows T-statistics of CRG expression for a total of Perp and Zfp385 in DLD-1 and HT-29 cells. As qPCR primers 69 out of 95 genes are shown for human pancreatic cancer, as for murine genes do not cross-react with endogenous human compared to normal tissue samples, plotted against t-statis RNA, differential gene expression values become artificially tics of expression values for the same genes in mp53/Ras large. FIG. 7B shows the shRNA-mediated knock-down of cells, as compared to YAMC. Names are indicated for the 33 Plac8 in HT-29 cells. FIG.7C shows the expression of murine genes that appear co-regulated. Of these, 25 are significantly Fas and murine Rprm in human DLD-1 cells. Primers for differentially expressed (t-test, unadjusted, p<0.05) in this mFas do not cross-react with endogenous human RNA result human dataset, indicated in blue. FIG. 11B shows the T-sta ing in artificially large values for differential expression. For tistics of CRG expression for a total of 47 out of 95 genes are Rprm, cross-reactive primers were used, giving lower expres shown for human prostate cancer, as compared to normal sion values due to detection of endogenous RNA. tissue samples, plotted against t-statistics of expression val 0013 FIG. 8 shows that synergistically regulated genes ues for the same genes in mp53/Ras cells, as compared to downstream genes of oncogenic mutations play a critical role YAMC. Names are indicated for the 31 genes that appear in malignant transformation. FIG. 8A shows Bar graphs indi co-regulated. Of these, 23 are significantly differentially cating percent change in endpoint tumor Volume following expressed (t-test, unadjusted, p<0.05) in this human dataset, CRG and non-CRG perturbations in mp53/Ras cells (left and indicated in blue. All CRGs are significantly differentially right panel, respectively). Perturbations significantly expressed in the murine data set. decreasing tumor size, as compared to matched controls are 0017 FIG. 12 shows that HDAC inhibitors reverse the shown (***, p<0.001: **, p<0.01: *, p<0.05; Wilcoxnsigned CRG signature in human cancer cells. Histograms depicting rank and t-test). FIG. 8B shows the impact of CRG perturba expression pattern of CRGs (log). FIG. 12A shows the tions on tumor formation of mp53/Ras cells. Individual CRG TLDA derived values for CRG expression in mp53/Ras cells perturbations are shown. Box plots indicate volume (cm3) of as compared to YAMC cells. FIG. 12B shows Affymetrix US 2012/01 14670 A1 May 10, 2012 microarray data obtained from the CMap database, compar untreated cells. Histograms show mean expression in per ing VA-treated human breast cancer cells (MCF7) with turbed cells by shRNA construct, as compared to matched untreated control cells. vector control cells, itSEM. 0018 FIG. 13 shows the effects of HDACi on mp53/Ras (0022 FIG. 17 shows that Anoikis induction by HDACi and YAMC cell cycle progression and apoptosis. mp53/Ras depends on multiple CRGs. Mp53/Ras cells stably express and YAMC were plated at microarray density onto 15 cm ing the indicated shRNA molecules were pre-treated with 2.5 collagen IV-coated dishes in 10% FBS medium at 39° C. for mMNB or VA for 3 days and then suspended in methylcel two days. The cells were re-plated at 458,000 cells per 15 cm lulose for an additional 3 days in the presence of NB or VA. dish in 10% FBS medium and treated for three days with 2.5 mMNB or VA at 39° C. Cells were then trypsinized and (A), Anoikis was measured by TUNEL staining and flow cytom (B) suspended in methylcellulose supplemented with fresh etry, expressed as % TUNEL positive cells. Data show mean NBorVA, 10% FBS, and ITS-A at 37,000 cells permL, or (C) of duplicate or triplicate samples-SEM. *, p<0.001 versus suspended in methylcellulose w/o FBS, or ITS-A at 150,000 untreated empty vector cells; it, p<0.05 versus NB-treated cells per mL and incubated at 39°C. for three days. Cells were empty vector cells; it, p<0.05 versus VA-treated empty vector extracted from the methylcellulose by repeated re-suspension cells; Wilcoxon signed-rank and t-test. FIG. 17A shows Apo in PBS w/1% BSA and centrifugation, and briefly trypsinized ptosis in mp53/Ras cells expressing shRNA molecules tar to break up cell aggregates. The extracted cells were labeled geting Dapk, Fas, Noxa, Perp or Sfrp2, compared to cells with 10 uMBrdU for ninety minutes prior to harvesting, fixed expressing the empty vector. FIG. 17B shows Apoptosis in in cold 80% ethanol, and stained with an anti-BrdU antibody mp53/Ras cells expressing the empty vector, Noxa shRNA, or and propidium iodide to measure cell cycle progression (A), Noxa shRNA plus a shRNA-resistant Noxa cDNA. FIG. 17C or fixed in 4% paraformaldehyde, and TUNEL-stained to shows Apoptosis of mp53/Ras cells expressing shRNA mol measure cell death (B), (C). Error bars represent standard ecules targeting Etv 1 or Elk3 or empty vector. deviation values derived from multiple independent measure (0023 FIG. 18 shows Anoikis induction by HDACi ments for each sample. The asterisk denotes a statistically depends on multiple CRGs. mp53/Ras cells stably expressing significant difference (p-value <0.05) versus untreated cells. the indicated shRNA molecules were pre-treated with 2.5 0019 FIG. 14 shows that HDAC inhibitors antagonize the mMNB or VA for 3 days and then suspended in methylcel CRG signature and behavior of mp53/Ras cells. FIG. 14A lulose for an additional 3 days in the presence of NB or VA. shows RNA from mp53/Ras cells treated with 2.5 mMVA or NB for 3 days was analyzed for changes in CRG expression Anoikis was measured by TUNEL staining and flow cytom via TaqMan Low Density arrays. Four replicates were per etry, expressed as % TUNEL positive cells. Data show mean formed for each condition. Histograms indicate differential of duplicate or triplicate samples by shRNA constructiSEM. CRG expression, assessed by the t statistic, in mp53/Ras cells * , p<0.001 versus untreated empty vector cells; ii, p<0.05 as compared to normal YAMC cells (upper panel), VA-treated versus NB-treated empty vector cells; it, p<0.05 versus VA mp53/Ras cells as compared to untreated controls (middle treated empty vector cells; Wilcoxon signed-rank and t-test. panel) and NB-treated mp53/Ras cells as compared to 0024 FIG. 19 shows that pharmacologic agents target dif untreated controls (lower panel). FIG. 14B shows Histogram ferent Subsets of CRGs. Histograms depicting expression showing cell death, measured by TUNEL staining, in cell pattern of CRGs (log). Affymetrix microarray data obtained populations treated with 2.5 mMVA or NB for 3 days in from the CMap database, comparing HDAC1 valproic acid adherent culture, or untreated controls. Bars represent the treated MCF7 with untreated control cells (top panel) or mean of triplicate experiments, SEM. (C) Histogram show PI3-kinase inhibitor LY294.002-treated MCF7 with untreated ing cell death in cell populations pre-treated with 2.5 mMVA controls (bottom panel). or NB, or untreated controls, suspended in methylcellulose 0025 FIG. 20 shows that synergistically regulated genes for an additional 3 days. Bars represent the mean of triplicate downstream genes of oncogenic mutations play a critical role experiments, SEM. (D) Histogram showing volume of in malignant transformation. FIG. 20A shows bar graphs tumors formed by untreated mp53/Ras cells (n=6), or by indicating percent change in endpoint tumor Volume follow mp53/Ras cells pre-treated with either 2.5 mMNB (n=8), or ing CRG perturbations in mp53/Ras cells. Perturbations sig 2.5 mMVA (n=4) at four weeks post-injection, represented as nificantly decreasing tumor size, as compared to matched meant-SEM. **, p<0.01, Wilcoxon signed-rank test. controls are shown indicated by darker bars (p<0.05, Wilcoxn 0020 FIG. 15 shows increased histone acetylation at CRG signed-rank and t-test). FIG. 20B shows the impact of com promoters in HDACi-treated cells. YAMC and Mp53/Ras bination CRG perturbations on tumor formation of mp53/Ras cells were treated with 2.5 mM NB for three days, cross cells. Box plots indicate volume (cm) of tumors formed four linked, and harvested for immunoprecipitation using an weeks after injection of cell populations with indicated CRG acetyl-histone H3 immunoprecipitation (ChIP) assay kit perturbations, as compared with matched vector controls, (Millipore). QPCR was run to detect presence and abundance shaded as above. FIG. 20O shows the biological process of of the promoters of five HDACi-sensitive (A) and four CRGs, tumor inhibitory CRGs and known oncogenes and HDACi-insensitive (B) CRGs. tumor Suppressors. Pie charts indicate the percentage of each 0021 FIG.16 shows that RNA interference reduces CRG gene class with indicated ascribed biological functions induction by HDACi in mp53/Ras cells. mp53/Ras cells sta according to the Gene Ontology database. bly expressing shRNA molecules targeting Dapk, Fas, Noxa, (0026 FIG. 21 shows the impact of tumor inhibitory CRG Perp or Sfrp2 (A), shRNA molecules and shRNA-resistant perturbations on tumor formation of mp53/Ras cells. Box cDNAs for Noxa or Perp (B), or shRNA molecules targeting plots indicate volume (cm) of tumors formed four weeks Elk3 or Etv1 (C) were treated with 2.5 mM VA or NB as after injection of cell populations with indicated CRG pertur indicated for 3 days. RNA was isolated and RT-QPCR was bations (dark boxes), as compared with matched vector con performed to assess expression of indicated CRGs, relative to trols (white boxes). The box indicates the range from the first US 2012/01 14670 A1 May 10, 2012
quartile to the third quartile of the data. The line in the box represents endpoints and starting points, and ranges for any indicates the median value. Plots are ranked by % change in combination of the data points. For example, if a particular tumor Volume. data point “10 and a particular data point 15 are disclosed, it 0027 FIG.22 shows oncogene cooperation regulates gene is understood that greater than, greater than or equal to, less expression at transcriptional and translation levels. Histo than, less than or equal to, and equal to 10 and 15 are consid grams show synergy scores for each CRG in total RNA, ered disclosed as well as between 10 and 15. measured by TLDA, and in polysomal RNA (bottom panel), 0033. In this specification and in the claims which follow, measured by Affymetrix microarray. Synergistically regu reference will be made to a number of terms which shall be lated genes are considered to have a synergy score below 0.9, defined to have the following meanings: indicated by the horizontal line. Bars are shaded to indicate 0034) "Optional or “optionally’ means that the subse the effect of perturbation of each CRG on tumor formation quently described event or circumstance may or may not capacity of mp53/Ras cells (dark, significant reduction in occur, and that the description includes instances where said tumor Volume; gray, no significant change in tumor Volume; event or circumstance occurs and instances where it does not. white, notable to be perturbed). 0035. A “decrease” can refer to any change that results in 0028 FIG. 23 shows the insensitivity of gene expression a smaller amount of a symptom, composition, or activity. A patterns to extracellular signals specifically in mp53/Ras Substance is also understood to decrease the genetic output of cells. Histograms show relative gene expression in indicated a gene when the genetic output of the gene product with the cell populations, as compared to normal YAMC cells, mea Substance is less relative to the output of the gene product sured by TLDA using total RNA from cells grown in the without the Substance. Also for example, a decrease can be a presence or absence of FBS for 24 hours prior to cell harvest change in the symptoms of a disorder Such that the symptoms 1ng. are less than previously observed. 0029 FIG. 24 shows that CRGs regulate tumor formation 0036 An “increase' can refer to any change that results in capacity of human pancreatic and prostate cancer cells. a larger amount of a symptom, composition, or activity. Thus, for example, an increase in the amount of Jag2 can includebut IV. DETAILED DESCRIPTION is not limited to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% increase. 0030. Before the present compounds, compositions, 0037) “Inhibit,” “inhibiting” and “inhibition” mean to articles, devices, and/or methods are disclosed and described, decrease an activity, response, condition, disease, or other it is to be understood that they are not limited to specific biological parameter. This can include but is not limited to the synthetic methods or specific recombinant biotechnology complete ablation of the activity, response, condition, or dis methods unless otherwise specified, or to particular reagents ease. This may also include, for example, a 10% reduction in unless otherwise specified, as Such may, of course, vary. It is the activity, response, condition, or disease as compared to the also to be understood that the terminology used herein is for native or control level. Thus, the reduction can be a 10, 20,30, the purpose of describing particular embodiments only and is 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction in not intended to be limiting. between as compared to native or control levels. 0038 “Enhance.” “enhancing, and "enhancement’ mean A. DEFINITIONS to increase an activity, response, condition, disease, or other biological parameter. This can include but is not limited to the 0031. As used in the specification and the appended doubling, tripling, quadrupling, or any other factor of claims, the singular forms “a,” “an and “the include plural increase in activity, response, condition, or disease. This may referents unless the context clearly dictates otherwise. Thus, also include, for example, a 10% increase in the activity, for example, reference to “a pharmaceutical carrier includes response, condition, or disease as compared to the native or mixtures of two or more Such carriers, and the like. control level. Thus, the increase can be a 10, 20,30, 40, 50, 60, 0032 Ranges can be expressed hereinas from “about one 70, 80, 90, 100, 150, 200, 300, 400, 500% or any amount of particular value, and/or to “about another particular value. increase in between as compared to native or control levels. When such a range is expressed, another embodiment 0039 Throughout this application, various publications includes from the one particular value and/or to the other are referenced. The disclosures of these publications in their particular value. Similarly, when values are expressed as entireties are hereby incorporated by reference into this appli approximations, by use of the antecedent “about, it will be cation in order to more fully describe the state of the art to understood that the particular value forms another embodi which this pertains. The references disclosed are also indi ment. It will be further understood that the endpoints of each vidually and specifically incorporated by reference hereinfor of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also the material contained in them that is discussed in the sen understood that there area number of values disclosed herein, tence in which the reference is relied upon. and that each value is also herein disclosed as “about that B. METHODS OF USING THE COMPOSITIONS particular value in addition to the value itself. For example, if the value "10' is disclosed, then “about 10” is also disclosed. 0040 1. Methods of Identifying Targets for the Treatment It is also understood that when a value is disclosed that “less of Cancer than or equal to the value, “greater than or equal to the value' 0041. Despite recognition of the multifaceted cellular phe and possible ranges between values are also disclosed, as notype of cancers and the need for targeted intervention strat appropriately understood by the skilled artisan. For example, egies, identification of Such targets, however, is notoriously if the value “10' is disclosed the “less than or equal to 10 as difficult and unpredictable using techniques known in the art. well as “greater than or equal to 10” is also disclosed. It is also Therefore, disclosed herein are methods for identifying tar understood that the throughout the application, data is pro gets for the treatment of a cancer comprising performing an vided in a number of different formats, and that this data, assay that measures differential expression of a gene or pro US 2012/01 14670 A1 May 10, 2012
tein and identifying those genes, proteins, or microRNAS that TSC2, TSHR, VHL, WAS, WHSC1L18, WRN, WT1, XPA, respond synergistically to the combination of two or more XPC, ZNF145, ZNF198, ZNF278, ZNF384, and ZNFN1A1. cancer genes. It is further understood that the disclosed combinations of two 0042. As used herein, "cancer gene' can refer to any gene or more cancer genes can comprise 2, 3, 4, 5, 6, 7, 8, 9, or 10 that has an effect on the formation, maintenance, prolifera cancer genes. tion, death, or Survival of a cancer. It is understood and herein 0043. As discussed above, disclosed herein are combina contemplated that "cancer gene' can comprise oncogenes, tions of cancer genes, wherein the cancer genes comprise an tumor Suppressor genes, as well as gain or loss of function oncogene and loss of function of a tumor Suppressor gene. It mutants there of It is further understood and herein contem is understood and herein contemplated that there are many plated that where a particular combination of two or more oncogenes known in the art. Thus, for example, disclosed cancer genes is discussed, disclosed herein are each and every hereinare cancer gene combinations comprising an oncogene permutation of the combination including the use of the gain and a tumor Suppressor gene wherein the oncogene is selected or loss of functions mutants of the particular genes in the from the list of oncogenes consisting of ras, raf, Bcl-2, Akt, combination. It is further understood and herein contem Sis, Src, Notch, Stathmin, mdm2, abl, hTERT, c-fos, c-jun, plated that the disclosed combinations can include an onco c-myc, erbB, HER2/Neu, HER3, c-kit, c-met, c-ret, flt3, AP1, gene and a tumor Suppressor gene, two oncogenes, two tumor AML1, axl, alk, fms, fps, gip, lck, MLM, PRAD-1, and trk. Suppressor genes, or any variation thereof where gain or loss Therefore, disclosed herein are methods for identifying tar of function mutants are used. Thus, for example, disclosed gets for the treatment of a cancer comprising performing an hereinare any combination of two or more of the cancer genes assay that measures differential expression of a gene, protein selected from the group consisting of ABL1, ABL2. or microRNAS and identifying those genes, proteins or micro AF15Q14, AF1O, AF3p21, AF5q31, AKT, AKT2, ALK, RNAs that respond synergistically to the combination of two ALO17, AML.1, AP1, APC, ARHGEF, ARHH, ARNT, ASP or more cancer genes, wherein the combination of two or SCR1, ATIC, ATM, AXL, BCL10, BCL11A, BCL11B, more cancer genes comprises an oncogene and a tumor Sup BCL2, BCL3, BCL5, BCL6, BCL7A, BCL9, BCR, BHD, pressor gene wherein the oncogene is selected from the list of BIRC3, BLM, BMPR1A, BRCA1, BRCA2, BRD4, BTG1, oncogenes consisting of ras, raf, Bcl-2, Akt, Sis, Src, Notch, CBFA2T1, CBFA2T3, CBFB, CBL, CCND1, c-fos, CDH1, Stathmin, mdm2, abl, hTERT, c-fos, c-jun, c-myc, erbB, c-jun, CDK4, c-kit, CDKN2A-p14ARF, CDKN2A HER2/Neu, HER3, c-kit, c-met, c-ret, flt3, AP1, AML.1, axl, p16INK4A, CDX2, CEBPA, CEP1, CHEK2, CHIC2, CHN1, alk, fms, fps, gip, lck, MLM, PRAD-1, and trk. It is under CLTC, c-met, c-myc, COL1A1, COPEB, COX6C, CREBBP. stood that there are other means known in the art to accom c-ret, CTNNB1, CYLD, D10S170, DDB2, DDIT3, DDX10, plish this task orther than evaluating synergistic response of DEK, EGFR, EIF4A2, ELKS, ELL, EP300, EPS15, erbB, gene expression to a combination of cancer genes. One Such ERBB2, ERCC2, ERCC3, ERCC4, ERCC5, ERG, ETV1, method, for example, involves developing rank-order by Syn ETV4, ETV6, EVI1, EWSR1, EXT1, EXT2, FACL6, ergy score, multiplicativity score, or maximum p-value by FANCA, FANCC, FANCD2, FANCE, FANCF, FANCG, N-test. While the multiplicativity score and differential FEV, FGFR1, FGFR1OP, FGFR2, FGFR3, FH, FIP1L1, expression via the N-test identify somewhat different sets of FLI1, FLT3, FLT4, FMS, FNBP1, FOXO1A, FOXO3A, FPS, genes than the additive synergy score, all three methods per FSTL3, FUS, GAS7, GATA1, GIP, GMPS, GNAS, form similarly at isolating genes critical to tumor formation GOLGA5, GPC3, GPHN, GRAF, HEI10, HER3, HIP1, from non-essential genes. Thus, disclosed herein are methods HIST1H4I, HLF, HMGA2, HOXA11, HOXA13, HOXA9, for identifying targets for the treatment of a cancer compris HOXC13, HOXD11, HOXD13, HRAS, HRPT2, HSPCA, ing performing an assay that measures differential expression HSPCB, hTERT, IGH, IGK, IGL, IL21R, IRF4, IRTA1, of a gene, protein or microRNAs, evaluating the expression JAK2, KIT, KRAS2, LAF4, LASP1, LCK, LCP1, LCX, via additive synergy score, multiplicative synergy score, or LHFP, LMO1, LMO2, LPP, LYL1, MADH4, MALT1, N-test, and identifying those genes, proteins or microRNAS MAML2, MAP2K4, MDM2, MECT1, MEN1, MET, that have differential expression in response to the combina MHC2TA, MLF1, MLH1, MLL, MLLT1, MLLT10, MLLT2, tion of two or more cancer genes relative to the absence of MLLT3, MLLT4, MLLT6, MLLT7, MLM, MN1, MSF, said cancer genes or the presence of one cancer gene, wherein MSH2, MSH6, MSN, MTS1, MUTYH, MYC, MYCL1, the combination of two or more cancer genes comprises an MYCN, MYH11, MYH9, MYST4, NACA, NBS1, NCOA2, oncogene and a tumor Suppressor gene wherein the oncogene NCOA4, NF1, NF2, NOTCH1, NPM1, NR4A3, NRAS, is selected from the list of oncogenes consisting of ras, raf, NSD1, NTRK1, NTRK3, NUMA1, NUP214, NUP98, NUT, Bcl-2, Akt, Sis, Src, Notch, Stathmin, mdm2, abl, hTERT, OLIG2, p53, p27, p57, p16, p21, p73, PAX3, PAX5, PAX7, c-fos, c-jun, c-myc, erbB, HER2/Neu, HER3, c-kit, c-met, PAX8, PBX1, PCM1, PDGFB, PDGFRA, PDGFRB, c-ret, flt3, AP1, AML.1, axl, alk, fms, fps, gip, lck, MLM, PICALM, PIM1, PML, PMS1, PMS2, PMX1, PNUTL1, PRAD-1, and trk. POU2AF1, PPARG, PRAD-1, PRCC, PRKAR1A, 0044) Further disclosed are cancer gene combinations PRO1073, PSIP2, PTCH, PTEN, PTPN11, RAB5EP, comprising an oncogene and a tumor Suppressor gene and/or RAD51L1, RAF, RAP1GDS1, RARA, RAS, Rb, RB1, their gain or loss of function mutants wherein the tumor RECQL4, REL RET, RPL22, RUNX1, RUNXBP2, SBDS, Suppressor gene is selected from the list of tumor Suppressor SDHB, SDHC, SDHD, SEPT6, SET, SFPQ, SH3GL1, SIS, genes consisting of p53, Rb, PTEN, BRCA-1, BRCA-2, SMAD2, SMAD3, SMAD4, SMARCB1, SMO, SRC, SS18, APC, p57, p27, p 16, p21, p73, p 14ARF, Chek2, NF1, NF2, SS18L1, SSH3BP1, SSX1, SSX2, SSX4, Stathmin, STK11, VHL, WRN, WT1, MEN1, MTS1, SMAD2, SMAD3, and STL, SUFU, TAF15, TAL1, TAL2, TCF1, TCF12, TCF3, SMAD4. Therefore, disclosed herein are methods for identi TCL1A, TEC, TCF12, TFE3, TFEB, TFG, TFPT, TFRC, fying targets for the treatment of a cancer comprising per TIF1, TLX1, TLX3, TNFRSF6, TOP1, TP53, TPM3, TPM4, forming an assay that measures differential expression of a TPR, TRA, TRB, TRD, TRIM33, TRIP11, TRK, TSC1, gene or protein and identifying those genes, proteins, or US 2012/01 14670 A1 May 10, 2012 microRNAs that respond synergistically to the combination consisting of Northern analysis, RNAse protection assay, of two or more cancer genes, wherein the combination of two PCR, QPCR, genome microarray, low density PCR array, or more cancer genes comprises an oncogene and a tumor oligo array, SAGE and high throughput sequencing. Also Suppressor gene and/or their gain or loss of function mutants disclosed herein are methods of identifying targets for the wherein the tumor Suppressor gene is selected from the list of treatment of a cancer comprising performing an assay that tumor suppressor genes consisting of p53, Rb, PTEN, BRCA measures differential expression of a protein. Specifically 1, BRCA-2, APC, p57, p27, p16, p21, p73, p14ARF, Chek2. contemplated are methods of identifying targets for the treat NF1, NF2, VHL, WRN, WT1, MEN1, MTS1, SMAD2, ment of a cancer comprising performing an assay that mea SMAD3, and SMAD4. Therefore disclosed herein are meth Sures differential protein expression wherein the assay is ods for identifying targets for the treatment of a cancer com selected from the group of assays consisting of protein prising performing an assay that measures differential microarray, antibody-based or protein activity-based detec expression of a gene or protein and identifying those genes, tion assays and mass spectrometry. proteins, or micro RNAS that respond synergistically to the 0047. It is understood and herein contemplated that the combination of two or more cancer genes, wherein the com methods disclosed herein can be combined with additional bination of two or more cancer genes comprises an oncogene methods known in the art to further identify the targets, assess and a tumor Suppressor gene wherein the oncogene is selected the effect of the targets on a cancer or screen for agents that from the list of oncogenes consisting of ras, raf, Bcl-2. Akt, interact with the targets and through the interaction modulate Sis, Src, Notch, Stathmin, mdm2, abl, hTERT, c-fos, c-jun, cancer. Therefore, disclosed herein are methods of identify c-myc, erbB, HER2/Neu, HER3, c-kit, c-met, c-ret, flt3, AP1, ing targets for the treatment of a cancer comprising perform AML1, axl, alk, fms, fps, gip, lck, MLM, PRAD-1, and trk inganassay that measures differential expression of a gene or and wherein the tumor Suppressor gene is selected from the protein and identifying those genes, proteins, or microRNAS list of tumor suppressor genes consisting of p53, Rb, PTEN, that respond synergistically to the combination of two or BRCA-1, BRCA-2, APC, p57, p27, p 16, p21, p73, p.14ARF, more cancer genes and further comprising measuring the Chek2, NF1, NF2, VHL, WRN, WT1, MEN, MTS1, effect of the targets on neoplastic cell transformation in vitro, SMAD2, SMAD3, and SMAD4. Thus, for example, specifi in vitro cell death, in vitro survival, in vivo cell death, in vivo cally disclosed are cancer gene combinations comprising p53 Survival, in vitro angiogenesis, in Vivo tumor angiogenesis, and Ras. tumor formation, tumor maintenance, or tumor proliferation. 0045. It is understood that the cancer gene combinations It is also understood that there are many means known in the can include combinations of only oncogenes and/or their gain art for measuring the effect of the targets. One such method is or loss of function mutants. Therefore, disclosed herein are through the perturbation of one or more targets and assaying methods for identifying targets for the treatment of a cancer for a change in the tumor or cancer cells relative to a control. comprising performing an assay that measures differential Thus, for example, disclosed herein are methods, wherein the expression of a gene or protein and identifying those genes, effect of the targets is measured through the perturbation of proteins, or micro RNAS that respond synergistically to the one or more targets and assaying for a change in the tumor or combination of two or more cancer genes, wherein the com cancer cells relative to a control wherein a difference in the bination of two or more cancer genes comprises two or more tumor or cancer cells relative to a control indicates a target oncogenes lwherein the oncogenes are selected from the list that affects the tumor. of oncogenes consisting of ras, raf, Bcl-2. Akt, Sis, Src, Notch, 0048. It is understood that the disclosed compositions and Stathmin, mdm2, abl, hTERT, c-fos, c-jun, c-myc, erbB, methods can be used to treat, identify targets for treatment of HER2/Neu, HER3, c-kit, c-met, c-ret, flt3, AP1, AML.1, axl, or screen for agents that treat any disease where uncontrolled alk, fms, fps, gip, lck, MLM, PRAD-1, and trk. Likewise, it is cellular proliferation occurs such as cancers. A non-limiting understood that the cancer gene combinations can include list of different types of cancers is as follows: lymphomas combinations of only tumor Suppressor genes and/or their (Hodgkins and non-Hodgkins), leukemias, carcinomas, car gain or loss of function mutants. Therefore, disclosed herein cinomas of Solid tissues, squamous cell carcinomas, adeno are methods for identifying targets for the treatment of a carcinomas, sarcomas, gliomas, high grade gliomas, blasto cancer comprising performing an assay that measures differ mas, neuroblastomas, plasmacytomas, histiocytomas, ential expression of a gene or protein and identifying those melanomas, adenomas, hypoxic tumours, myelomas, AIDS genes, proteins, or micro RNAS that respond synergistically related lymphomas or sarcomas, metastatic cancers, or can to the combination of two or more cancer genes, wherein the cers in general. combination of two or more cancer genes comprises two or 0049. A representative but non-limiting list of cancers that more tumor Suppressor genes wherein the tumor suppressor the disclosed compositions can be used to treat is the follow gene is selected from the list of tumor Suppressor genes con ing: lymphoma, B cell lymphoma, T cell lymphoma, mycosis sisting of p53, Rb, PTEN, BRCA-1, BRCA-2, APC, p57, p27, fungoides, Hodgkin's Disease, leukemias, myeloid leukemia, p16, p21, p73, p14ARF, Chek2, NF1, NF2, VHL, WRN, bladder cancer, brain cancer, nervous system cancer, head and WT1, MEN1, MTS1, SMAD2, SMAD3, and SMAD4. neck cancer, squamous cell carcinoma of head and neck, lung 0046. The methods disclosed hereincan be assayed by any cancers such as Small cell lung cancer and non-small cell lung means to measure differential expression of a gene or protein cancer, neuroblastoma/glioblastoma, ovarian cancer, pancre known in the art. Specifically contemplated herein are meth atic cancer, prostate cancer, skin cancer, liver cancer, mela ods of identifying targets for the treatment of a cancer com noma, squamous cell carcinomas of the mouth, throat, larynx, prising performing an assay that measures differential and lung, gastric cancer, colon cancer, cervical cancer, cervi expression of a gene. Specifically contemplated are methods cal carcinoma, breast cancer, and epithelial cancer, bone can of identifying targets for the treatment of a cancer comprising cers, renal cancer, bladder cancer, genitourinary cancer, performing an assay that measures differential gene expres esophageal carcinoma, large bowel cancer, metastatic can Sion, wherein the assay is selected from the group of assays cers hematopoietic cancers, sarcomas, Ewing's sarcoma, Syn US 2012/01 14670 A1 May 10, 2012
ovial cancer, Soft tissue cancers; and testicular cancer. Thus Atp8al, Bbs7, Bnip3, Cox6b2, Cxcl1, Daf1, Dap, Dapk1. disclosed herein are methods of treating wherein the cancer is Dffb, Dgka, Dixdc, Eno3, Ephb2, Eval, Fas, Fgf7, Gpr149, selected form the group of cancers consisting of lymphoma, B Hbegf, Hey2, Hmgal, Hoxc13, Id2, Ida, Igsf4a, Jag2, Mcam, cell lymphoma, T cell lymphoma, mycosis fungoides, Notch3, Noxa, Nrp2, Oaf, Pardog, Perp, Pitx2, Plac8, Pla2g7, Hodgkin's Disease, leukemias, myeloid leukemia, bladder Pltp, Plxdc2, Prkg, Pyr14, Rab40b, Rb1, Rgs2, Rprm, Satb1, cancer, brain cancer, nervous system cancer, head and neck Sbk1, Sema3d, Sfrp2, Slc14a1, Sod3, Stimna, Unc45b, cancer, squamous cell carcinoma of head and neck, lung Wnt 9a, Zac1, and Zfp385. For example, disclosed herein are cancers such as Small cell lung cancer and non-small cell lung methods of identifying targets wherein the one or more tar cancer, neuroblastoma/glioblastoma, ovarian cancer, pancre gets are combinations of CRGs such as Dapkand Noxa; Dapk atic cancer, prostate cancer, skin cancer, liver cancer, mela and Perp; Dapk and Sfrp2: Dfb and Sfrp2; Fas and Rprm: noma, squamous cell carcinomas of the mouth, throat, larynx, Noxa and Rprm; Noxa and Sfrp2; and Rprim and Sfrp2. and lung, gastric cancer, colon cancer, cervical cancer, cervi 0053 2. Methods for Screening for Agents that Treat Can cal carcinoma, breast cancer, and epithelial cancer, bone can C cers, renal cancer, bladder cancer, genitourinary cancer, 0054. It is understood and herein contemplated that the esophageal carcinoma, large bowel cancer, metastatic can targets identified through the methods disclosed herein have cers hematopoietic cancers, sarcomas, Ewing's sarcoma, Syn many uses, for example, as targets for drug treatment or ovial cancer, Soft tissue cancers; and testicular cancer. screening foragents that modulate the targets identified by the 0050 Compounds and methods disclosed herein may also methods disclosed herein. Agents identified though screening be used for the treatment of precancer conditions such as for affects on the targets can inhibit cancer. Thus disclosed cervical and anal dysplasias, other dysplasias, severe dyspla herein are methods for screening for an agent that treats a sias, hyperplasias, atypical hyperplasias, and neoplasias. cancer comprising contacting the agent with a target identi 0051. It is further understood that the targets in the dis fied by the methods disclosed herein, wherein an agent that closed methods can be cooperation response genes selected modulates the target such that tumor activity is inhibited is an from the list of cooperation response genes consisting of agent that treats cancer. Specifically, disclosed herein are Abat, Abcal, Ank, Ankrd1, Arhgap24. Atp8al, Bbs7, Bex 1, methods for Screening for an agent that treats a cancer com Ccl9, Centd3, Chst1, Ckmt1, Col9a3, Cpz, Cxcl1, Cxcl15, prising contacting the agent with a target identified by per Daf1, Dapk1, Dffb, Dgka, Dixdc, Dusp15, Elay 12, Eno3, forming an assay that measures differential expression of a Ephb2, Espin, Eval, Fas, F2r11, Fgf18, Fgf7, Fhod3, FHOS2, gene or protein and identifying those genes, proteins, or Garn13, Gca, Gpr149, Hbegf, Hey2, Hmgal, Hmga2. microRNAs that respond synergistically to the combination Hoxc13, Id2, Ida, Igfbp2, Igsf4a, Jag2. Kctd 15, Lass4, Ldhb. of two or more cancer genes, wherein an agent that modulates Man2b1, Mcam, Mmp15, Mpp7, Mrpl15, Mrpplif4, Ms4al.0, the target such that tumor activity is inhibited is an agent that Mtus 1,Nbea, Notch3, Noxa, Oaf, Parvb, Pardóg, Perp, Plac8, treats cancer. Also disclosed are methods wherein the differ Pla2g7, Pitx2, Pltp, Plxdc2, Prkcm, Prkg, Prss22, Pyr14, ential expression of a gene or protein is identified by N-test, Rab40b, Rai2. Rasl 11a, Rb1, Rgs2, Rprm, Rspo3, Satb1, T-test, or multiplicative synergy score, or additive synergy Sbk1, SbSn, Scn3b, Sema3d, Sema7a, Serpinb2, Sfrp2. SCO. Slc14a1, Slc27a3, Sms, Sod3, Stimna, Tex 15, Tnfrsfl8, 0055 Numerous studies indicate the utility of gene Tnnt2, Unc45b, Wnt 9a, Zac1, Zfp385, and the cooperation expression-based strategies for identifying drugs that mimic response genes identified by the Genbank accession numbers or reverse biological states across different cell types and AV133559, BM118398, BB353853, BB381558, AV231983, species (Hassane et al., 2008: Hieronymus et al., 2006; AI848263, AV244.175, BF159528, AV231424, AV234963, Hughes et al., 2000; Lamb et al., 2006; Stegmaier et al., 2004: BC013499, AV254040, BG071013, AK003981, BG066186, Stegmaier et al., 2007; Wei et al., 2006). To facilitate such AK005731, BC027185, AKO09671, AV323203, AI509011, comparisons, the Connectivity Map (CMap) was created BM220576, BQ173895, AV024662, BB207363, BC026627, (Lamb et al., 2006). AK017369, BQ031255, BC007 193, BE949277, AKO18275, 0056 a) Connectivity Map BB704967, BB312717, AKO18112, BI905111, BE957307, 0057 The Connectivity Map is a gene expression reposi BG066982, BB358264, BB478071, AV298.358, BB767109, tory comprising a compendium of microarray gene expres AA266723, AV241486, BB 133117, AI450842, and sion data obtained from cells in a particular biological state. AW543723. It is a further embodiment that the target is a Generally, such states can arise from exposure to Small mol cooperation response gene selected from the group of coop ecules/drugs, RNAi, gene transduction, gene knockout, eration response genes consisting of Abcal, Ank, Arhgap24. mutation, or disease. Connectivity Map is able to indepen Atp8a1. Bbs7, Bnip3, Cox6b2, Cxcl1, Daf1, Dap, Dapk1. dently obtain a gene expression signature arising from a treat Dffb, Dgka, Dixdc, Eno3, Ephb2, Eval, Fas, Fgf7, Gpr149, ment of interest (query signature) and identify instances of Hbegf, Hey2, Hmgal, Hoxc13, Id2, Ida, Igsf4a, Jag2, Mcam, biological states within the Connectivity Map most similar to Notch3, Noxa, Nrp2, Oaf, Pardóg, Perp, Pitx2, Plac8, Pla2g7, this query signature. Thus, any known or unknown biological Pltp, Plxdc2, Prkg, Pyr14, Rab40b, Rb1, Rgs2, Rprm, Satb1, state can be connected to a known biological state based on Sbk1, Sema3d, Sfrp2, Slc14al, Sod3, Stimna, Unc45b, microarray gene expression data. Therefore, disclosed herein Wnt 9a, Zac1, and Zfp385. are methods of identifying compositions having anti-cancer 0052. It is also understood and herein contemplated that activity, wherein the process of identifying of molecules there can be instances where despite up or down-regulation of which modulate the related gene set is performed by using the a CRG, pertubrbation of a single CRG does not result in an connectivity map. Positive connectivity can identify common inhibition of the disease or condition, but perturbation of biological effects of compounds (Lamb et al., 2006). The more than one CRG does result in inhibition. Thus, disclosed CMap can also identify antagonists of disease states, via herein are combinations one or more targets are selected from negative connectivity, including novel putative inhibitors of the group of targets consisting of Abca1, Ank, Arhgap24. Alzheimer's disease, dexamethasone-resistant acute lympho US 2012/01 14670 A1 May 10, 2012
blastic leukemia and acute myeloid leukemia stem cells (Has one or more targets, wherein the agent modulates the activity sane et al., 2008: Lamb et al., 2006: Wei et al., 2006). Herein, of the target in a manner Such that tumor Survival or growth the CMap was utilized to identify instances of negative con (including but not limited to neoplastic cell transformation in nectivity to the CRG signature, in order to find pharmacologic vitro, in vitro cell death, in vivo cell death, in vitro angiogen agents that reverse the CRG signature and function to inhibit esis, in Vivo tumor angiogenesis, tumor formation, tumor malignant transformation. maintenance, or tumor proliferation or further decrease in in 0058 b) Random Forest vitro or in vivo survival) is inhibited, and wherein the targets 0059 RANDOM FORESTR) is an algorithm based clas are selected from the group of targets consisting of Abat, sifier decision tree which provides data on the correlation and Abca1, Ank, Ankrd1, Arhgap24. Atp8al, Bbs7, Bex 1, Ccl9. strength of individual datapoints called trees. Centd3, Chst1, Ckmt1, Col9a3, Cpz, Cxcl1, Cxcl15, Dafl, 0060 c) Gene Expression Omnibus Dapk1, Dfb, Dgka, Dixdc, Dusp15, Elav 12, Eno3, Ephb2, 0061 The Gene Expression Omnibus (GEO) is a public Espin, Eval, Fas, F2r11, Fgf18, Fgf7, Fhod3, FHOS2, gene expression repository which is updated through Submis Garn13, Gca, Gpr149, Hbegf, Hey2, Hmgal, Hmga2. Hoxc13, Id2, Ida, Igfbp2, Igsf4a, Jag2. Kctd 15, Lass4, Ldhb. sion of experimental date of microarray analysis measiuring Man2b1, Mcam, Mmp15, Mpp7, Mrpl15, Mrpplif4, Ms4al.0, mRNA, miRNA, genomic DNA (arrayCGH, ChIP-chip, and Mtus 1,Nbea, Notch3, Noxa, Oaf, Parvb, Pardóg, Perp, Plac8, SNP), and protein abundance as well as serial analysis of gene P1a2g7, Pitx2, Pltp, Plxdc2, Prkcm, Prkg, Prss22, Pyr14, expression (SAGE). The database holds over 500 million Rab40b, Rai2. Rasl 11a, Rb1, Rgs2, Rprm, Rspo3, Satb1, gene expression measurements. Sbk1, SbSn, Scn3b, Sema3d, Sema7a, Serpinb2, Sfrp2. 0062. It is understood and herein contemplated that a Slc14a1, Slc27a3, Sms, Sod3, Stimna, Tex 15, Tnfrsfl8, single agent may not be effective in the treatment of a cancer Tnnt2, Unc45b, Wnt 9a, Zac1, Zfp385, and the cooperation or the modulation of one or more of the targets identified by response genes identified by the Genbank accession numbers the methods disclosed herein. Thus, disclosed herein are AV133559, BM118398, BB353853, BB381558, AV231983, methods for screening for a combination of two or more AI848263, AV244.175, BF159528, AV231424, AV234963, agents that treats a cancer comprising contacting the agent BC013499, AV254040, BG071013, AK003981, BG066186, with a target identified by the methods disclosed herein, AK005731, BC027185, AKO09671, AV323203, AI509011, wherein an agent that modulates the target such that tumor BM220576, BQ173895, AV024662, BB207363, BC026627, activity is inhibited is an agent that treats cancer. AK017369, BQ031255, BC007193, BE949277, AK018275, 0063. It is further understood that, as noted above, the BB704967, BB312717, AKO18112, BI905111, BE957307, targets in the disclosed methods can be cooperation response BG066982, BB358264, BB478071, AV298.358, BB767109, genes selected from the list of cooperation response genes AA266723, AV241486, BB 133117, AI450842, and consisting of Abat, Abcal, Ank, Ankrdl, Arhgap24. Atp8al, AW543723. It is understood that the one or more agents can Bbs7, Bex1, Ccl9, Centd3, Chst1, Ckmt1, Col9a3, Cpz, comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 agents. Thus, disclosed Cxcl1, Cxcl15, Daf1, Dapk1, Dffb, Dgka, Dixdc, Dusp15, herein are methods for screening comprising one agent. Also Elav 12, Eno3, Ephb2, Espin, Eval, Fas, F2r11, Fgf18, Fgf7, disclosed are methods for screening for a combination of two Fhod3, FHOS2, Garn13, Gca, Gpr149, Hbegf, Hey2, Hmgal, or more agents that treats cancer comprising contacting the Hmga2, Hoxc13, Id2, Ida, Igfbp2, Igsf4a, Jag2. Kctd 15. agent with the one or more targets, wherein the agent modu Lass4, Ldhb, Man2b1, Mcam, Mmp15, Mpp7, Mrpl15, Mrp lates the activity of the target in a manner Such that tumor plf4, Ms4all0, Mtus 1, Nbea, Notch3, Noxa, Oaf, Parvb, proliferation is inhibited, and wherein the targets are selected Pardog, Perp, Plac8, P1a2g7, Pitx2, Pltp, Plxdc2, Prkcm, from the group of targets consisting of Abat, Abcal, Ank, Prkg, Prss22, Pyr14, Rab40b, Rai2. Rasl 11a, Rb1, Rgs2. Ankrd1, Arhgap24. Atp8a1. Bbs7, Bex 1, Ccl9, Centa3. Rprm, Rspo3, Satb1, Sbk1, SbSn, Scn3b, Sema3d, Sema7a, Chst1, Ckmt1, Col9a3, Cpz, Cxcl1, Cxcl15, Dafl, Dapk1. Serpinb2, Sfrp2, Slc14a1, Slc27a3, Sms, Sod3, Stimna, Dffb, Dgka, Dixdc, Dusp15, Elav 12, Eno3, Ephb2, Espin, Tex15, Tnfrsfl8, Tnnt2, Unc45b, Wnt 9a, Zac1, Zfp385, and Eval, Fas, F2r11, Fgf18, Fgf7, Fhod3, FHOS2, Garn13, Gca, the cooperation response genes identified by the Genbank Gpr149, Hbegf, Hey2, Hmgal, Hmga2, Hoxc13, Id2, Ida, accession numbers AV 133559, BM118398, BB353853, Igfbp2, Igsf4a, Jag2. Kctd 15, Lass4, Ldhb, Man2b1, Mcam, BB381558, AV231983, AI848263, AV244.175, BF159528, Mmp15, Mpp7, Mrpl15, Mrpplf4, Ms4all0, Mtus1, Nbea, AV231424, AV234963, BCO13499, AV254040, BG071013, Notch3, Noxa, Oaf, Parvb, Pardóg, Perp, Plac8, P1a2g7, AK003981, BG066186, AK005731, BC027185, AK009671, Pitx2, Pltp, Plxdc2, Prkcm, Prkg, Prss22, Pyr14, Rab40b, AV323203, AI509011, BM220576, BQ173895, AV024662, Rai2. Rasl 11a, Rb1, Rgs2, Rprm, Rspo3, Satb1, Sbk1, SbSn, BB207363, BC026627, AKO17369, BQ031255, BC007 193, Scn3b, Sema3d, Sema7a, Serpinb2, Sfrp2, Slc14al, Slc27a3, BE949277, AKO18275, BB704967, BB312717, AKO18112, Sms, Sod3, Stimna, Tex15, Tnfrsfl8, Tnnt2, Unc45b, Wnt9a, BI905111, BE957307, BG066982, BB358264, BB478071, Zac1, Zfp385, and the cooperation response genes identified AV298358, BB767109, AA266723, AV241486, BB133117, by the Genbank accession numbers AV133559, BM1 18398, AI450842, and AW543723. It is a further embodiment that BB353853, BB381558, AV231983, AI848263, AV244.175, the target is a cooperation response gene selected from the BF159528, AV231424, AV234963, BC013499, AV254040, group of cooperation response genes consisting of Abcal, BG071013, AK003981, BG066186, AK005731, BC027185, Ank, Arhgap24. Atp8a1. Bbs7, Bnip3, Cox6b2, Cxcl1, Dafl. AKO09671, AV323203, AI509011, BM220576, BQ173895, Dap, Dapk1, Dffb, Dgka, Dixdc, Eno3, Ephb2, Eval, Fas, AV024662, BB207363, BC026627, AKO17369, BQ031255, Fgf7, Gpr149, Hbegf, Hey2, Hmgal, Hoxc13, Id2, Ida, BC007 193, BE949277, AKO18275, BB704967, BB312717, Igsf4a, Jag2, Mcam, Notch3, Noxa, Nrp2, Oaf, Pardóg, Perp, AKO18112, BI905111, BE957307, BG066982, BB358264, Pitx2, Plac8, P1a2g7, Pltp, Plxdc2, Prkg, Pyr14, Rab40b, BB478071, AV298358, BB767109, AA266723, AV241486, Rb1, Rgs2, Rprm, Satb1, Sbk1, Sema3d, Sfrp2, Slc14a1, BB133117, AI450842, and AW543723. Sod3, Stimna, Unc45b, Wnt 9a, Zac1, and Zfp385. Thus, spe 0064. It is also understood and herein contemplated that cifically disclosed herein are methods for screening for one or there can be instances where despite up or down-regulation of more agents (such as a combination of two or more agents) a CRG, pertubrbation of a single CRG does not result in an that treats cancer comprising contacting the agent with the inhibition of the disease or condition, but perturbation of US 2012/01 14670 A1 May 10, 2012
more than one CRG does result in inhibition. Thus, disclosed 0069. “Treatment,” “treat,” or “treating mean a method of herein are methods of Screening where the screen is con reducing the effects of a disease or condition. Treatment can ducted on more than one target and wherein the one or more also refer to a method of reducing the disease or condition targets are selected from the group of targets consisting of itself rather than just the symptoms. The treatment can be any Abca1, Ank, Arhgap24. Atp8a1. Bbs7, Bnip3, Cox6b2, reduction from native levels and can be but is not limited to Cxcl1, Dafl, Dap, Dapk1, Dfb, Dgka, Dixdc, Eno3, Ephb2, the complete ablation of the disease, condition, or the Symp Eval, Fas, Fgf7, Gpr149, Hbegf, Hey2, Hmgal, Hoxc13, Id2. toms of the disease or condition. Therefore, in the disclosed Id4, Igsf4a, Jag2, Mcam, Notch3, Noxa, Nrp2, Oaf, Pardog, Perp, Pitx2, Plac8, P1a2g7, Pltp, Plxdc2, Prkg, Pyr14, methods, “treatment can refer to a 10%, 20%, 30%, 40%, Rab40b, Rb1, Rgs2, Rprim, Satb1, Sbk1, Sema3d, Sfrp2, 50%. 60%, 70%,80%,90%, or 100% reduction in the severity Slc14al, Sod3, Stimna, Unc45b, Wnt9a, Zac1, and Zfp385. of an established disease or the disease progression. For For example, disclosed herein are methods of Screening example, a disclosed method for reducing the effects of pros wherein the one or more targets are combinations of CRGs tate cancer is considered to be a treatment if there is a 10% such as Dapk and Noxa; Dapk and Perp; Dapk and Sfrp2: reduction in one or more symptoms of the disease in a subject Dfb and Sfrp2; Fas and Rprm; Noxa and Rprim; Noxa and with the disease when compared to native levels in the same Sfrp2; and Rprm and Sfrp2. subject or control subjects. Thus, the reduction can be a 10, 0065. It is understood and herein contemplated that the 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of desired effect of the agent on the cooperation response gene reduction in between as compared to native or control levels. depends on the activity of the cooperation response gene and It is understood and herein contemplated that “treatment' its effect on the cancer. In some cases for inhibition of the does not necessarily refer to a cure of the disease or condition, cancerto occur, the cooperation response gene must be inhib but an improvement in the outlook of a disease or condition. ited and in other cases enhanced. Thus, it is understood and 0070. It is understood and herein contemplated that the herein contemplated that disclosed agents can modulate the one or more agents can modulate that activity of any of the activity of the target through inhibition or enhancement. targets disclosed herein. Thus, disclosed herein in one Therefore, disclosed herein are methods for screening for an embodiment are methods wherein the one of more agents agent that treats cancer comprising contacting the agent with modulate the activity of one or more targets. Further disclosed the one or more targets, wherein the agent modulates the are methods wherein the one or more targets are one or more activity of the target in a manner Such that tumor proliferation cooperation response genes. Thus disclosed herein in one is inhibited, wherein the agent modulation of the activity of embodiment are methods wherein the one of more agents the target is inhibition. In particular, disclosed herein are modulate the activity of one or more cooperation response methods for Screening for an agent that treats cancer com genes selected for the group consisting of Abat, Abca1, Ank, prising contacting the agent with the one or more targets, Ankrd1, Arhgap24. Atp8a1. Bbs7, Bex 1, Ccl9, Centa3. wherein the agent inhibits the activity of the targetina manner Chst1, Ckmt1, Col9a3, Cpz, Cxcl1, Cxcl15, Dafl, Dapk1. such that tumor proliferation is inhibited, wherein the target is Dffb, Dgka, Dixdc, Dusp15, Elav 12, Eno3, Ephb2, Espin, a cooperation response gene. Further disclosed are methods Eval, Fas, F2r11, Fgf18, Fgf7, Fhod3, FHOS2, Garn13, Gca, wherein the cooperation response gene selected from the Gpr149, Hbegf, Hey2, Hmgal, Hmga2, Hoxc13, Id2, Ida, group consisting of Ank, Cxcl1, Eno3, Fgf7, Gpr149, Hmgal, Igfbp2, Igsf4a, Jag2. Kctd 15, Lass4, Ldhb, Man2b1, Mcam, Id4, Igsf4a, Oaf, Pla2g7, Plac8, Pltp, Plxdc2, Rgs2, and Mmp15, Mpp7, Mrpl15, Mrpplf4, Ms4all0, Mtus1, Nbea, Sod3. Notch3, Noxa, Oaf, Parvb, Pardóg, Perp, Plac8, P1a2g7, 0066. Also disclosed herein are methods for screening for Pitx2, Pltp, Plxdc2, Prkcm, Prkg, Prss22, Pyr14, Rab40b, an agent that treats cancer comprising contacting the agent Rai2. Rasl 11a, Rb1, Rgs2, Rprm, Rspo3, Satb1, Sbk1, SbSn, with the one or more targets, wherein the agent modulates the Scn3b, Sema3d, Sema7a, Serpinb2, Sfrp2, Slc14al, Slc27a3, activity of the target in a manner Such that tumor proliferation Sms, Sod3, Stimna, Tex15, Tnfrsfl8, Tnnt2, Unc45b, Wnt9a, is inhibited, wherein the agent modulation of the activity of Zac1, Zfp385, as well as the cooperation response genes the target is enhanced. In particular, disclosed herein are identified by the Genbank accession number AV 133559, methods for Screening for an agent that treats cancer com BM118398, BB353853, BB381558, AV231983, AI848263, prising contacting the agent with the one or more targets, AV244.175, BF159528, AV231424, AV234963, BC013499, wherein the agent enhances the activity of the target in a AV 254040, BG071013, AKO03981, BG 066186, AKO05731, manner such that tumor proliferation is inhibited, wherein the BC027185, AKO09671, AV323203, AI509011, BM220576, target is a cooperation response gene. Further disclosed are BQ173895, AV024662, BB207363, BC026627, AKO17369, methods wherein the cooperation response gene selected BQ031255, BC007 193, BE949277, AK018275, BB704967, from the group consisting of Abcal, Arhgap24. Atp8al, BB312717, AKO18112, BI905111, BE957307, BG066982, Bbs7, Daf1, Dapk1, Dffb, Dgka, Dixdc, Ephb2, Eval, Fas, BB358264, BB478071, AV298358, BB767109, AA266723, Hey2, Hmgal, Hoxc13, Id2, Jag2, Mcam, Notch3, Noxa, AV241486, BB 133117, AI450842, and AW543723. In a fur Pardog, Perp, Pitx2, Prkg, Pvr14, Rab40b, Rb1, Rprm, Satb1, ther aspect, disclosed herein are methods of treating cancer Sbk1, Sema3d, Sfrp2, Slc14a1, Stimna, Unc45b, Wnt 9a, wherein the one or more cooperation response genes are Zac1, and Zfp385. selected from the group consisting of Abca1, Ank, Arhgap24. 0067 3. Method of Treating Cancer Atp8al, Bbs7, Bnip3, Cox6b2, Cxcl1, Daf1, Dap, Dapk1. 0068. The agents identified by the screening methods dis Dffb, Dgka, Dixdc, Eno3, Ephb2, Eval, Fas, Fgf7, Gpr149, closed herein have many uses, for example, the treatment of a Hbegf, Hey2, Hmgal, Hoxc13, Id2, Ida, Igsf4a, Jag2, Mcam, cancer. Disclosed herein are methods of treating a cancer in a Notch3, Noxa, Nrp2, Oaf, Pardog, Perp, Pitx2, Plac8, Subject comprising administering to the Subject one or more P1a2g7, Pltp, Plxdc2, Prkg, Pyr14, Rab40b, Rb1, Rgs2. agents that modulate the activity of one or more cooperation Rprm, Satb1, Sbk1, Sema3d, Sfrp2, Slc14a1, Sod3, Stimna, response genes. Unc45b, Wnt9a, Zac1, and Zfp385 US 2012/01 14670 A1 May 10, 2012
0071. It is understood and herein contemplated that the dextromethorphan, dicycloverine, diethylstilbestrol, diflo activity of the cooperation response gene can be modulated rasone, diflunisal, dihydroergotamine, diloxanide, dinopros by modulating the expression of one or more, two or more, tone, diphemanil metilsulfate, diphenylpyraline, doxy three or more, four or more, or five or more of the CRG. It is lamine, droperidol, epirizole, epitioStanol, esculetin, further understood and herein contemplated that the expres estradiol, estropipate, ethionamide, etofenamate, etomidate, sion can be inhibited or enhanced. It is understood and herein eucatropine, famotidine, famprofaZone, fendiline, fisetin, contemplated that those of skill in the art will understand fludrocortisone, flufenamic acid, flupentiXol, fluphenazine, whether to inhibit or enhance the activity of one or more fluticasone, fluvastatin, fosfosal, fulvestrant, gabexate, galan cooperation response genes. For example, one of skill in the tamine, gemfibrozil, genistein, glibenclamide, gliquidone, art will understand that where the expression of a particular glycocholic acid, gossypol, gramine, guanadrel, halcinonide, CRG is up-regulated in a cancer, one of skill in the art will haloperidol, harpagoside, hexamethonium bromide, homo want to administer an agent that decreases or inhibits the chlorcyclizine, hydroxyzine, idoxuridine, ifosfamide, inda up-regulation of the CRG. Similarly, where the expression of pamide, iobenguane, iopanoic acid, iopromide, isoetarine, a particular CRG is down-regulated in a cancer, one of skill in isoXSuprine, isradipine, ketorolac, ketotifen, lanatoside C. the art will want to administer an agent that increases or lansoprazole, laudanosine, letrozole, levodopa, levomepro enhances the expression of the down-regulated CRG. How mazine, lidocaine, liothyronine, lisinopril, lisuride, ever, it is also understood that in Some cases Such as, for LY-294.002, lynestrenol, meclofenamic acid, meclofenoxate, example, Pltp, when a down-regulated CRG is enhanced medrysone, mefloquine, mepacrine, methapyrilene, meth tumor size increases. It is understood that those of skill in the aZolamide, methyldopa, methylergometrine, metoclopra art will recognize that for those down-regulated CRG’s that mide, mevalolactone, mometaSone, monensin, monorden, result in increased tumor size when the CRG expression or naftopidil, nalbuphine, naltrexone, napelline, naphazoline, activity is increased, are treated with an agent that decreases naringin, niclosamide, niflumic acid, nimeSulide, expression or the activity of the CRG. Similarly, where an nomifensine, noretynodrel, norfloxacin, orphenadrine, oxo up-regulated CRG when inhibited leads to increased tumor linic acid, oXprenolol, papaverine, pentolonium, pepstatin, volume (as happens with Slc14a1), treatment involves perphenazine, PF-00562151-00, phenelzine, phenindione, enhancing or increasing expression or activity of the CRG. pheniramine, phthalylsulfathiazole, pinacidil, pioglitaZone, Moreover, it is contemplated herein that one method of treat piperine, piretanide, piribedil, pirlindole, PNU-0230031, ing cancer is to administer an agent that targets down-regu pralidoxime, pramocaine, praziquantel, prednisone, lated CRG’s in combination with an agent that targets up Prestwick-1 100, Prestwick-981, probenecid, prochlorpera regulated CRG’s. Therefore, for example, disclosed herein Zine, proglumide, propofol, protriptyline, racecadotril, ribo are methods of treating cancer comprising administering to flavin, rifabutin, rimexolone, roXithromycin, Santonin, the subject one or more agents that inhibits the activity of one SB-203580, SC-560, scopoletin, scriptaid, seneciphylline, or more cooperation response genes. Also disclosed are meth Sirolimus, Sitosterol, Sodium phenylbutyrate, Solanine, spec ods wherein the cooperation response gene is selected from tinomycin, spiradoline, SR-95531, SR-95639A, sulfadimi the group consisting of Ank, Cxcl1, Eno3, Fgf7, Gpr149, dine, Sulfaguanidine, Sulfanilamide, Sulfathiazole, tanespi Hmgal, Ida, Igsf4a, Oaf, Pla2g7, Plac8, Pltp, Plxdc2, Rgs2. mycin, terbutaline, terguride, thalidomide, thiamazole, and Sod3. Also disclosed are methods of treating cancer thiamphenicol, thioridazine, ticarcillin, ticlopidine, timida comprising administering to the Subject one or more agents Zole, tiratricol, tolfenamic acid, tremorine, trichostatin A, that enhances the activity of one or more cooperation trifluoperazine, troglitaZone, tyloxapol, urSodeoxycholic response genes. Also disclosed are methods wherein the acid, valproic acid, VanoXerine, Vidarabine, Vincamine, Vori cooperation response gene is selected from the group consist nostat, wortmannin, yohimbic acid, yohimbine, or Zidovu ing of Abca1, Arhgap24. Atp8a1. Bbs7, Dafl, Dapk1, Dffb. dine. Dgka, Dixdc, Ephb2, Eval, Fas, Hey2, Hmgal, Hoxc13, Id2. 0072 Also disclosed are methods of treating a cancer Jag2, Mcam, Notch3, Noxa, Pardog, Perp, Pitx2. Prkg, Pyr14. comprising administering to the Subject one or more, two or Rab40b, Rb1, Rprm, Satb1, Sbk1, Sema3d, Sfrp2, Slc14al, more, three or more, four or more, or five or more agents that Stmn4, Unc45b, Wnt 9a, Zac1, and Zfp385. Thus, for enhance the activity of one or more CRG’s in combination example, disclosed herein are method of treating a cancer with one or more, two or more, three or more, four or more, or comprising administering to a subject one or more agents five or more agents that enhance the activity of one or more such as (+)-chelidonine, 0179445-0000, 0198306-0000, 1,4- CRG’s. Also disclosed are methods wherein the CRG’s that chryseneduinone, 15-delta prostaglandin J2, 2,6-dimethylpi are enhanced are selected from the group consisting of Abcal, peridine, 4-hydroxyphenazone, 5186223, 6-azathymine, Arhgap24. Atp8al, Bbs7, Daf1, Dapk 1, Dfb, Dgka, Dixdc, acenocoumarol, alpha-estradiol, altizide, alverine, alvespi Ephb2, Eval, Fas, Hey2, Hmgal, Hoxc13, Id2, Jag2, Mcam, mycin, amikacin, aminohippuric acid, amoxicillin, ampro Notch3, Noxa, Pardog, Perp, Pitx2, Prkg, Pyr14, Rab40b, lium, ampyrone, antimycin A, arachidonyltrifluoromethane, Rb1, Rprm, Satb1, Sbk1, Sema3d, Sfrp2, Slc14a1, Stimna, atractyloside, azathioprine, azlocillin, bacampicillin, Unc45b, Wnt 9a, Zac1, and Zfp385. Examples of agent that baclofen, bambuterol, beclometasone, benzylpenicillin, enhance CRG expression or activity include, but are not lim betaxolol, betulinic acid, biperiden, boldine, bromocriptine, ited to 6-benzylaminopurine, 8-azaguanine, acetylsalicylic bufexamac, buspirone, butacaine, butirosin, calycanthine, acid, allantoin, alpha-yohimbine, azlocillin, bemegride, ben canadine, canavanine, carbarSone, carbenoXolone, carbima fluorex, benfotiamine, berberine, bromopride, cantharidin, Zole, carcinine, carmustine, cefalotin, cefepime, ceftazidime, carbachol, chloramphenicol, cinoxacin, citiolone, daunoru cephaeline, chenodeoxycholic acid, chlorhexidine, chloro bicin, desoxycortone, dicloxacillin, doSulepin, epitioStanol, genic acid, chlorpromazine, chlortalidone, cinchonidine, cin ethaverine, ethotoin, etofylline, etynodiol, fenoprofen, fluo chonine, clemizole, co-dergocrine mesilate, CP-320650-01, rometholone, geldanamycin, ginkgolide A, hesperetin, CP-690334-01, dacarbazine, demeclocycline, dexibuprofen, iohexyl, ioVersol, ioxaglic acid, ipratropium bromide, isox US 2012/01 14670 A1 May 10, 2012
Suprine, lisinopril, mebendazole, meclofenoxate, mephen methoxamine, methoXSalen, methylbenzethonium chloride, esin, mestranol, meticrane, metoclopramide, metolaZone, methyldopate, methylergometrine, methylprednisolone, metoprolol, morantel, MS-275, napelline, neostigmine bro metitepine, metixene, metoclopramide, metolaZone, metriza mide, phenelZine, picrotoxinin, pimethixene, pipenZolate mide, metronidazole, mexiletine, mifepristone, mimosine, bromide, procainamide, pronetalol, propafenone, propanthe minaprine, minocycline, minoxidil, molindone, monastrol, line bromide, pyrimethamine, pyrvinium, quinidine, rifabu monensin, moxonidine, myricetin, nabumetone, nadolol. tin, rollitetracycline, sanguinarine, skimmianine, S-propra nafcillin, naftidrofuryl, naftifine, naphazoline, naproxen, nolol, Sulconazole, Sulfametoxydiazine, Sulfaphenazole, neomycin, neostigmine bromide, nimodipine, nitrofural, Suloctidil, Syrosingopine, tacrine, tanespimycin, thiogua nizatidine, nomegestrol, norcyclobenzaprine, nordihy nosine, tolaZamide, tracazolate, trichostatin A, trifluridine, droguaiaretic acid, orlistat, orphenadrine, oxamniquine, triflusal, trimetazidine, trioxysalen, valproic acid, Vidarabine, oxaprozin, oxetacaine, oxolamine, oXprenolol, oxybutynin, or vorinostat. Further disclosed are methods wherein the oxymetazoline, palmatine, parbendazole, parthenolide, pen CRG’s that are inhibited are selected from the group consist butolol, pentetrazol, pergolide, PF-00539745-00, PHA ing of Ank, Cxcl1, Eno3, Fgf7, Gpr149, Hmgal, Ida, Igsf4a, 007453.60, PHA-00767505E, PHA-00851261E, phenazone, Oaf, P1a2g7, Plac8, Pltp, Plxdc2, Rgs2, and Sod3. Examples phenelZine, pheneticillin, phenoxybenzamine, phentolamine, of agent that inhibit CRG expression or activity include, but pinacidil, pioglitaZone, piremperone, pivmecillinam, pizo are not limited to (-)-MK-801 (+/-)-catechin, 0317956 tifen, PNU-0230031, PNU-0251 126, PNU-0293363, podo 0000, 15-delta prostaglandin J2, 2-aminobenzenesulfona phyllotoxin, practolol, prednicarbate, prenylamine, mide, 3-acetamidocoumarin, 5155877, 5186324, 5194442, Prestwick-642, Prestwick-674, Prestwick-675, Prestwick 7-aminocephalosporanic acid, abamectin, acebutolol, ace 682, Prestwick-685, Prestwick-857, Prestwick-967, clofenac, acepromazine, adiphenine, AH-6809, alclometa Prestwick-983, primidone, probenecid, probucol, prochlor Sone, alfuZosin, allantoin, alpha-ergocryptine, alprenolol. perazine, propafenone, propranolol, pyrithyldione, qui alprostadil, amantadine, ambroXol, amiloride, aminophyl pazine, raloxifene, ramipril, R-atenolol, ribavirin, ribostamy line, amplicillin, anabasine, arcaine, ascorbic acid, atova cin, rifampicin, riluzole, risperidone, rofecoxib, quone, atracurium besilate, atropine, aztreonam, bambuterol, rolitetracycline, rosiglitaZone, rotenone, rottlerin, Santonin, BCB000040, bemegride, benserazide, benzamil, benzbroma SB-203580, scopolamine N-oxide, securinine, sertacona rone, benzethonium chloride, benzocaine, benzonatate, ben Zole, simvastatin, sirolimus, Sodium phenylbutyrate, Sotalol, Zydamine, bergenin, betamethasone, bethanechol, betoni spiradoline, splitomicin, S-propranolol, SR-95639A, stachy cine, brinzolamide, bucladesine, bumetanide, buspirone, drine, Sulfachlorpyridazine, sulfadoxine, Sulfamerazine, Sul butirosin, capsaicin, carbachol, carbarSone, carteolol, cefa famethoxypyridazine, Sulfamonomethoxine, Sulfathiazole, clor, cefalonium, cefamandole, cefixime, ceforanide, cefo Sulindac, Syrosingopine, tacrine, tamoxifen, tanespimycin, taxime, cefoxitin, cefuroxime, chlorcyclizine, chlorphenesin, teraZosin, terguride, tetracycline, tetrandrine, tetry Zoline, chlortalidone, chlorZoxazone, ciclacillin, cimetidine, cin thapsigargin, thiamazole, thiamphenicol, thiostrepton, chonidine, cinchonine, clebopride, clemastine, clobetasol, tiaprofenic acid, tiletamine, timidazole, tocamide, tolnaftate, clorSulon, clotrimazole, clozapine, clozapine, colchicines, topiramate, tracazolate, tranexamic acid, trapidil, tretinoin, colforsin, colistin, convolamine, coralyne, CP-690334-01, tribenoside, trichostatin A, tridihexethyl, trifluoperazine, tri CP-863 187, cyclopentolate, cytochalasin B, daunorubicin, flupromazine, trimethadione, trimethobenzamide, troglita decamethonium bromide, decitabine, demecarium bromide, Zone, tubocurarine chloride, tyrphostin AG-1478, ursolic dexamethasone, diaZOxide, diclofenac, dicloxacillin, dicou acid, valproic acid, vinblastine, Vincamine, Vinpocetine, marol, dicycloverine, diethylcarbamazine, diflunisal, dihy Vitexin, withaferin A, wortmannin, yohimbic acid, yohim droergocristine, dilaZep, diloxanide, dinoprost, dinoprostone, bine, Zalcitabine, Zaprinast, Zardaverine, Zoxazolamine, and diperodon, diphenhydramine, diphenylpyraline, disulfuram, Zuclopenthixol. It is understood and herein contemplated that dl-alpha tocopherol, dobutamine, doSulepin, doxepin, doxy any of the disclosed agents can be administered in combina cycline, dropropizine, dyclonine, edrophonium chloride, tion. For example, disclosed herein are methods of treating a enalapril, epivincamine, erythromycin, esculin, estradiol. cancer comprising administering a first agent that enhances estriol, estrone, ethotoin, etilefrine, F0447-0125, famprofa the expression oracitivity of one or more CRG’s and a second Zone, fasudil, felbinac, fenbendazole, fenofibrate, finasteride, agent the inhibits the expression or activity of one or more florfenicol, flufenamic acid, fluocinonide, fluorocurarine, flu CRG’s oxetine, fluphenazine, flurbiprofen, fluspirilene, flutamide, 0073. It is understood and contemplated herein that one fluticasone, fluvastatin, fluvoxamine, foliosidine, fosfosal, means of treating cancer is through the administration of a fulvestrant, furosemide, fursultiamine, gabexate, geldanamy single agent that modulates the expression or activity of one cin, genistein, gentamicin, gibberellic acid, Gly-His-Lys, or more, two or more, three or more, four or more, or five or guanabenz, H-89, halcinonide, halofantrine, haloperidol, har more cooperative response genes. It is understood and herein maline, harmalol, harmine, harpagoside, hecogenin, heliot contemplated that modulation of expression is not the only rine, helveticoside, heptaminol, hydrocotamine, hydroqui means for modulating the activity of one or more cooperation nine, ikarugamycin, iodixanol, iohexyl, iopamidol, ioVersol, response genes and Such means can be accomplished by any isoniazid, isopropamide iodide, isotretinoin, josamycin, manner known to those of skill in the art. Therefore, for kaempferol, kawain, ketanserin, ketoprofen, khellin, lacto example, disclosed herein are methods of treating cancer bionic acid, levobunolol, levodopa, lincomycin, lisuride, wherein the activity of the cooperation response gene is inhib lisuride, lobelanidine, lomefloxacin, loperamide, loxapine, ited by the administration of an antibody, siRNA, small mol lumicolchicine, LY-294.002, meclocycline, meclofenamic ecule inhibitory drug, shRNA, or peptide mimetic that is acid, mefloquine, mepyramine, merbromin, mesalazine, specific for the protein encoded by the cooperation response metamizole Sodium, metampicillin, metanephrine, gene. Also disclosed are methods wherein the antibody, meteneprost, metergoline, methazolamide, methocarbamol. siRNA, small molecule inhibitory drug, or peptide mimetic is US 2012/01 14670 A1 May 10, 2012 specific for the protein encoded by Ank, Cxcl1, Eno3, Fgf7. monoacetylation in cancer cell lines and primary tumor Gpr149, Hmgal, Ida, Igsf4a, Oaf, P1a2g7, Plac8, Pltp, samples (Fraga et al., 2005), and the functional interaction of Plxdc2, Rgs2, and Sod3. HDAC2 over-expression with loss of the APC tumor suppres 0074. In another aspect, the disclosed methods of treating sor gene in colon cancer cells (Zhu et al., 2004). cancer can be combined with anti-cancer agents such as, for 0078. A variety of natural and synthetic compounds func example, chemotherapeutics or anti-oxidants known in the tion as HDAC inhibitors (HDACi) by binding to the active site art. Therefore, disclosed herein are methods of treating a and chelating the Zinc atom required for HDAC enzymatic cancer in a Subject comprising administering to the Subject activity (Minucci and Pelicci, 2006). These compounds vary one or more anti-cancer agents and one or more agents that modulate the activity of one or more cooperation response greatly interms of stability, potency, efficacy and toxicity and genes. Further disclosed are methods wherein the anti-cancer inhibit both class 1 and class 2 HDACs (Minucci and Pelicci, agent is a chemotherapeutic or antioxidant compound. Also 2006). HDACi induce cell cycle arrest, differentiation, and disclosed are methods wherein the anti-cancer agent is a apoptosis in human cancer cell lines in vitro (Butler et al., histone deacetylase inhibitor. 2000: Gottlicher et al., 2001; Hague et al., 1993; Heerdt et al., 0075 Gene expression is highly dependent upon chroma 1994). In contrast, normal cells are relatively resistant to these tin structure that is in turn regulated by the opposing activities compounds (Marks et al., 2000), although HDACihave wide of histone acetyltransferases (Baeg et al., 1995) and histone spread effects on transcription, as about 20 percent of genes deacetylases (HDACs) (Marks et al., 2000). HDACs remove are influenced by HDACi with an equal number of up- or acetyl groups from lysine residues on histone tails, condens down-regulated genes (Glaser et al., 2003; Mitsiades et al., ing chromatin structure and preventing transcription factor 2004: Peart et al., 2005; Van Lint et al., 1996). binding (Marks et al., 2000). Histone deacetylation is thus (0079. The tumor-selective biological effects of HDACi associated with heterochromatin and transcriptional silenc are attributed to the induction of anti-growth and apoptotic ing (Iizuka and Smith, 2003; Jenuwein and Allis, 2001), and genes in cancer cells (Insing a et al., 2005; Nebbioso et al., this level of gene expression regulation is necessary for nor 2005; Villar-Garea and Esteller, 2004), notably the p53-inde mal development as HDAC1 loss-of-function results in pendent up-regulation of p21 and associated cell cycle arrest embryonic lethality (Lagger et al., 2002), knock out of (Archer et al., 1998; Gui et al., 2004: Richon et al., 2000). HDAC4 results in defective skeletonogenesis (Vega et al., HDACi selectively induce apoptosis in APL cells versus nor 2004), and knockout of HDACS or HDAC9 results in cardiac mal lymphocytes and these effects are dependent on the hypertrophy (Zhang et al., 2002). increased expression of tumor-necrosis factor-related apop 0076. There are four distinct classes of HDACs, the first tosis-inducing ligand (TRAIL), death receptor 5 (DR5), Fas, two of which have been extensively characterized and are evolutionarily conserved among eukaryotic organisms (Mi and Fas ligand (Fasl) (Insing a et al., 2005). HDACi are nucci and Pelicci, 2006). HDAC1-3 and HDAC8 comprise currently under clinical evaluation as single agents (Carducci class 1 and are related to the yeast RPD3 HDAC, and et al., 2001; Gilbert et al., 2001; Gore et al., 2002; Kelly et al., HDAC4-7, HDAC9, and HDAC10 comprise class 2 and are 2005; Kelly et al., 2003; Patnaiket al., 2002) or in combina related to the yeast HDA1 HDAC (Minucci and Pelicci, tion with existing chemotherapeutics (Kuendgenet al., 2006). 2006). While the members of both classes have a zinc-depen These trials have determined that HDACiare generally asso dent catalytic domain, class 1 HDACs are constitutively ciated with low toxicity and in Some cases a maximal toler nuclear proteins and class 2 HDACs shuttle between the ated dose was not reached (Minucci and Pelicci, 2006). cytoplasm and the nucleus (Minucci and Pelicci, 2006; Verdin Although all HDACi tested had some clinical effects, many et al., 2003). Class 1 HDACs are ubiquitously expressed, have low potency and patients succumbed to disease after while class 2 HDACs exhibit varying degrees of tissue speci treatment ceased (Minucci and Pelicci, 2006). There are cur ficity (Minucci and Pelicci, 2006), which likely accounts for rently no criteria to determine which patients are most likely the embryonic lethality of knocking out HDAC1 versus the to benefit from HDACi treatment, although elucidating the tissue-specific phenotypes of HDAC4, 5, and 9 knock-out molecular basis for the tumor-selective effects of these com mice (Lagger et al., 2002; Vega et al., 2004, Zhang et al., pounds can promote the development of improved HDACi. 2002). 0080. The selective induction of Fas in HDACi-treated 0077. The role of HDACs in cancer was first demonstrated APL cells versus normal lymphocytes (Insing a et al., 2005) in acute promyelocytic leukemia (Aplin et al.) where onco raised the possibility that HDACicould restore the expression proteins generated by the fusion of the retinoic acid recep of Fas and other down-regulated pro-apoptotic or growth tor-O gene and either the promyelocytoic leukemia or promy inhibitory genes in malignant cells transformed by multiple eloctyic leukemia Zinc finger genes arrest the differentiation oncogenic mutations. Indeed, young adult mouse colon cells of leukemic cells (Minucci et al., 2001). These fusion proteins transformed by cooperating oncogenic mutations such as Ras repress the transcription of genes involved in myeloid differ activation and p53 loss-of-function (Xia and Land, 2007) entiation by recruiting HDAC-containing complexes (Mi responded with altered morphology and proliferation to nucci and Pelicci, 2006). In addition, the BCL6 transcrip HDACi treatment and completely inhibited the ability of tional repressor and AML1-ETO fusion protein induce non these cells to form colonies in Soft agar in vitro and tumors in Hodgkin's lymphoma and acute myelogenous leukemia nude mice in vivo, presumably via sensitization to anoikis. (AML), respectively, by recruiting transcriptional repression Additionally, these biological effects are causally linked to complexes that contain HDACs (Marks et al., 2000). The the restored expression of a series of cooperation response importance of HDACs in Solid tumorigenesis is Supported by genes that are synergistically down-regulated following the correlation of the risk for tumor recurrence in low-grade expression of mutant p53 and activated Ras. Notably, inter prostate cancer with distinct patterns of histone modifications fering with the re-expression of six of these genes abrogated (Seligson et al., 2005), the global loss of histone 4 the effects of the HDACiand rescued tumor formation in vivo US 2012/01 14670 A1 May 10, 2012 indicating that the restored expression of all six genes is Zole, levodopa, levomepromazine, lidocaine, liothyronine, required for HDACi to antagonize the transformed pheno lisinopril, lisuride, LY-294.002, lynestrenol, meclofenamic type. acid, meclofenoxate, medrysone, mefloquine, mepacrine, 0081. Thus, for example, disclosed herein are methods of methapyrilene, methazolamide, methyldopa, methylergo treating a cancer in a Subject comprising administering to the metrine, metoclopramide, mevalolactone, mometaSone, Subject one or more anti-cancer agents and an agent that monensin, monorden, naftopidil, nalbuphine, naltrexone, modulates the activity of one or more cooperation response napelline, naphazoline, naringin, niclosamide, niflumic acid, genes, wherein the anti-cancer agent is a histone deacetylase nimeSulide, nomifensine, noretynodrel, norfloxacin, inhibitor, and wherein the cooperation response genes are orphenadrine, oxolinic acid, oXprenolol, papaverine, pentolo selected from the group consisting of Abat, Abcal, Ank, nium, pepstatin, perphenazine, PF-00562151-00, phenelzine, Ankrd1, Arhgap24. Atp8a1. Bbs7, Bex 1, Ccl9, Centa3. phenindione, pheniramine, phthalylsulfathiazole, pinacidil, Chst1, Ckmt1, Col9a3, Cpz, Cxcl1, Cxcl15, Daf1, Dapk1. pioglitazone, piperine, piretanide, piribedil, pirlindole, PNU Dffb, Dgka, Dixdc, Dusp15, Elav 12, Eno3, Ephb2, Espin, 0230031, pralidoxime, pramocaine, praziquantel, pred Eval, Fas, F2r11, Fgf18, Fgf7, Fhod3, FHOS2, Garn13, Gca, nisone, Prestwick-1 100, Prestwick-981, probenecid, Gpr149, Hbegf, Hey2, Hmgal, Hmga2, Hoxc13, Id2, Ida, prochlorperazine, proglumide, propofol, protriptyline, Igfbp2, Igsf4a, Jag2. Kctd 15, Lass4, Ldhb, Man2b1, Mcam, racecadotril, riboflavin, rifabutin, rimexolone, roxithromy Mmp15, Mpp7, Mrpl15, Mrpplf4, Ms4all0, Mtus1, Nbea, cin, santonin, SB-203580, SC-560, scopoletin, scriptaid, Notch3, Noxa, Oaf, Parvb, Pardóg, Perp, Plac8, P1a2g7, Seneciphylline, sirolimus, sitosterol, Sodium phenylbutyrate, Pitx2, Pltp, Plxdc2, Prkcm, Prkg, Prss22, Pvr14, Rab40b, Solanine, spectinomycin, spiradoline, SR-95531, Rai2. Rasl 11a, Rb1, Rgs2, Rprm, Rspo3, Satb1, Sbk1, SbSn, SR-95639A, sulfadimidine, sulfaguanidine, sulfanilamide, Scn3b, Sema3d, Sema7a, Serpinb2, Sfrp2, Slc14al, Slc27a3, Sulfathiazole, tanespimycin, terbutaline, terguride, thalido Sms, Sod3, Stimna, Tex15, Tnfrsfl8, Tnnt2, Unc45b, Wnt 9a, mide, thiamazole, thiamphenicol, thioridazine, ticarcillin, Zac1, and Zfp385. Also disclosed are methods wherein the ticlopidine, timidazole, tiratricol, tolfenamic acid, tremorine, cooperation response genes are selected from the group con trichoStatin A, trifluoperazine, troglitaZone, tyloxapol, sisting of Dapk1, Dffb, Fas, Noxa, Perp, Rprm, Sfrp2, and urSodeoxycholic acid, valproic acid, VanoXerine, Vidarabine, Zac1. It is understood that any agent known in the art that Vincamine, Vorinostat, wortmannin, yohimbic acid, yohim enhances or inhibits one or more CRG’s may by used in the bine, and Zidovudine. treatment methods disclosed herein. Thus, for example, also I0082. As disclosed above the compositions and methods disclosed are methods of treating a cancer comprising admin disclosed hereincan be used to treat any disease where uncon istering an agent wherein the agent is selected from the any trolled cellular proliferation occurs such as cancers. A non one or more of the agents listed on Tables, 12, 15, 16, or 17). limiting list of different types of cancers is as follows: lym Thus, for example, an agent for treating cancer by modulating phomas (Hodgkins and non-Hodgkins), leukemias, the expression or activity of one or more CRGs includes but is carcinomas, carcinomas of Solid tissues, squamous cell car not limited to (+)-chelidonine, 0179445-0000, 0198306 cinomas, adenocarcinomas, Sarcomas, gliomas, high grade 0000, 1,4-chrysenequinone, 15-delta prostaglandin J2, 2.6- gliomas, blastomas, neuroblastomas, plasmacytomas, histio dimethylpiperidine, 4-hydroxyphenazone, 5186223, 6-aza cytomas, melanomas, adenomas, hypoxic tumours, myelo thymine, acenocoumarol, alpha-estradiol, altizide, alverine, mas, AIDS-related lymphomas or sarcomas, metastatic can alvespimycin, amikacin, aminohippuric acid, amoxicillin, cers, or cancers in general. amprolium, ampyrone, antimycin A, arachidonyltrifluo I0083. A representative but non-limiting list of cancers that romethane, atractyloside, azathioprine, azlocillin, bacampi the disclosed compositions can be used to treat is the follow cillin, baclofen, bambuterol, beclometasone, benzylpenicil ing: lymphoma, B cell lymphoma, T cell lymphoma, mycosis lin, betaxolol, betulinic acid, biperiden, boldine, fungoides, Hodgkin's Disease, leukemias, myeloid leukemia, bromocriptine, bufeXamac, buspirone, butacaine, butirosin, bladder cancer, brain cancer, nervous system cancer, head and calycanthine, canadine, canavanine, carbarSone, carbenox neck cancer, squamous cell carcinoma of head and neck, lung olone, carbimazole, carcinine, carmustine, cefalotin, cancers such as Small cell lung cancer and non-small cell lung cefepime, ceftazidime, cephaeline, chenodeoxycholic acid, cancer, neuroblastoma/glioblastoma, ovarian cancer, pancre chlorhexidine, chlorogenic acid, chlorpromazine, chlortali atic cancer, prostate cancer, skin cancer, liver cancer, mela done, cinchonidine, cinchonine, clemizole, co-dergocrine noma, squamous cell carcinomas of the mouth, throat, larynx, mesilate, CP-320650-01, CP-690334-01, dacarbazine, deme and lung, gastric cancer, colon cancer, cervical cancer, cervi clocycline, dexibuprofen, dextromethorphan, dicycloverine, cal carcinoma, breast cancer, and epithelial cancer, bone can diethylstilbestrol, diflorasone, diflunisal, dihydroergotamine, cers, renal cancer, bladder cancer, genitourinary cancer, diloxanide, dinoprostone, diphemanil metilsulfate, diphe esophageal carcinoma, large bowel cancer, metastatic can nylpyraline, doxylamine, droperidol, epirizole, epitiostanol, cers hematopoietic cancers, sarcomas, Ewing's sarcoma, Syn esculetin, estradiol, estropipate, ethionamide, etofenamate, ovial cancer, Soft tissue cancers; and testicular cancer. Thus etomidate, eucatropine, famotidine, famprofaZone, fendiline, disclosed herein are methods of treating wherein the cancer is fisetin, fludrocortisone, flufenamic acid, flupentiXol. selected form the group of cancers consisting of lymphoma, B fluiphenazine, fluticasone, fluvastatin, fosfosal, fulvestrant, cell lymphoma, T cell lymphoma, mycosis fungoides, gabexate, galantamine, gemfibrozil, genistein, glibencla Hodgkin's Disease, leukemias, myeloid leukemia, bladder mide, gliquidone, glycocholic acid, gossypol, gramine, gua cancer, brain cancer, nervous system cancer, head and neck nadrel, halcinonide, haloperidol, harpagoside, hexametho cancer, squamous cell carcinoma of head and neck, lung nium bromide, homochlorcyclizine, hydroxy Zine, cancers such as Small cell lung cancer and non-small cell lung idoxuridine, ifosfamide, indapamide, iobenguane, iopanoic cancer, neuroblastoma/glioblastoma, ovarian cancer, pancre acid, iopromide, isoetarine, isoxSuprine, isradipine, ketoro atic cancer, prostate cancer, skin cancer, liver cancer, mela lac, ketotifen, lanatoside C, lanSoprazole, laudanosine, letro noma, squamous cell carcinomas of the mouth, throat, larynx, US 2012/01 14670 A1 May 10, 2012
and lung, gastric cancer, colon cancer, cervical cancer, cervi and Zac 1 indicates Susceptibility to histone deacetylase cal carcinoma, breast cancer, and epithelial cancer, bone can inhibitors. Also disclosed are methods wherein more than one cers, renal cancer, bladder cancer, genitourinary cancer, anti-cancer agent. Thus, disclosed herein are methods for esophageal carcinoma, large bowel cancer, metastatic can determining whether a cancer is Susceptible to treatment with cers hematopoietic cancers, sarcomas, Ewing's sarcoma, Syn one or more anti-cancer agents comprising measuring the ovial cancer, Soft tissue cancers; and testicular cancer. expression of the cooperation response gene panel in the 0084. However, it is recognized herein that perturbation of cancer relative to a control, wherein the responsiveness of one some CRGs may have an effect for one type of cancer and not or more cooperation response genes indicates sensitivity to have an effect in another type of cancer. For example, dis treatment. closed herein are methods of treating colon cancer compris ing administering to a Subject with colon cancer an agent that I0087. It is understood that the cooperation response gene modulates the expression or activity of one or more CRGs panel will vary depending on the particular cell type or cancer. such as Dfb, Dgka, Dixdc1, Eno3, Fas, Fgf7, Gpr149. Thus, disclosed herein are methods, wherein the cooperation Hmgal, Hmga2, HoxC13, Id2, Ida, Igsf4a, Jag2, Noxa, Oaf, response gene is selected from the group consisting of Abat, Perp., P1a2g7, Plac8, Plxdc2, RgS2, Rprm, Satb1, Sema3d, Abca1, Ank, Ankrd1, Arhgap24. Atp8al, Bbs7, Bex 1, Ccl9. Sfrp2, Slc14a1, Sod3, Stimna, Unc45b, and Spf385. Simi Centd3, Chst1, Ckmt1, Col9a3, Cpz, Cxcl1, Cxcl15, Dafl, larly, disclosed herein are methods of treating pancreatic can Dapk1, Dfb, Dgka, Dixdc, Dusp15, Elav 12, Eno3, Ephb2, cer comprising administering to a Subject with pancreatic Espin, Eval, Fas, F2r11, Fgf18, Fgf7, Fhod3, FHOS2, cancer an agent that modulates the expression or activity of Garn13, Gca, Gpr149, Hbegf, Hey2, Hmgal, Hmga2. one or more CRGs such as Arhgap24, Dapk1, Dixdc1, Eno3, Hoxc13, Id2, Ida, Igfbp2, Igsf4a, Jag2. Kctd 15, Lass4, Ldhb. Fgf7, Hey2, HoxC13, Jag2, P1a2g7, Plac8, Rab40b, Rprm, Man2b1, Mcam, Mmp15, Mpp7, Mrpl15, Mrpplif4, Ms4al.0, Satb1, and Unc45b. Also disclosed are methods of treating Mtus 1,Nbea, Notch3, Noxa, Oaf, Parvb, Pardóg, Perp, Plac8, prostate cancer comprising administering to a subject with P1a2g7, Pitx2, Pltp, Plxdc2, Prkcm, Prkg, Prss22, Pyr14, prostate cancer an agent that modulates the expression or Rab40b, Rai2. Rasl 11a, Rb1, Rgs2, Rprm, Rspo3, Satb1, activity of one or more CRGs such as Arhgap24, Dafl, Eval, Sbk1, SbSn, Scn3b, Sema3d, Sema7a, Serpinb2, Sfrp2. HoxC13, Mcam, Notch3, Noxa, Oaf, Pardóg, Perp., P1a2g7, Slc14a1, Slc27a3, Sms, Sod3, Stimna, Tex 15, Tnfrsfl8, Sfrp2, and Zfp385. Also disclosed are methods of treating a Tnnt2, Unc45b, Wnt 9a, Zac1, Zfp385, as well as the coop melanoma comprising administering to a Subject with a mela eration response genes identified by the Genbank accession noma an agent that modulates the expression or activity of number AV 133559, BM118398, BB353853, BB381558, one or more CRGs such as Arhgap24. Atp8al, Bbs7, Cxcl1. AV231983, AI848263, AV244.175, BF159528, AV231424, Dixdc1, Fas, Hey2, Jag2, Notch3, Noxa, Pitx2. Pla2g7. AV234963, BC013499, AV254040, BG071013, AK003981, Plac8, Prkg1, Rab40b, Satb1, and Stmn4. Also disclosed are BG066186, AK005731, BC027185, AK009671, AV323203, methods of treating lung cancer comprising administering to AI509011, BM220576, BQ173895, AV024662, BB207363, a subject with lung cancer an agent that modulates the expres BC026627, AK017369, BQ031255, BC007193, BE949277, sion or activity of one or more CRGs such as Abca1, AKO18275, BB704967, BB312717, AKO18112, BI905111, Arhgap24. Bbs7, Daf1, Dixdc1, Eno3, Fas, Hey2, Mcam, BE957307, BG066982, BB358264, BB478071, AV298358, P1a2g7, Prkg1, Satb1, Sfrp2, and Unc45b. BB767109, AA266723, AV241486, BB 133117, AI450842, 0085 4. Methods of Diagnosing or Assessing the Efficacy and AW543723. It is understood and herein contemplated that of a Treatment. the disclosed cooperation response genes can have pro-apo I0086. The activity of the cooperation response genes iden ptotic or anti-proliferative activity. Therefore, disclosed tified herein can have tremendous affect on the effectiveness herein are methods, wherein the activated cooperation of a treatment. By determining whether one or more coopera response gene has pro-apoptotic or anti-proliferation activity. tion response genes are suppressed, expressed, or over-ex Thus, for example, in one embodiment, disclosed herein are pressed in a cancer relative to a control, a determination can methods wherein the cooperation response gene is selected be made as to the susceptibility or resistance of an individual from the group consisting of Dapk1, Dffb, Fas, Noxa, Perp, to a treatment can be made as well as the determination of the Rprm, Sfrp2, and Zac1. efficacy of a treatment for a cancer given the cancers expres 0088. The disclosed methods can be used to determine the sion profile of cooperation response genes. In this way, susceptibility or resistance of any subject or cell as well as the known compounds can be tested for effectiveness in modu efficacy in any type of cancer. Thus, disclosed herein are lating the activity of one or more cooperation response genes methods for determining whether a cancer is susceptible or in a manner that inhibits a cancer. Thus, disclosed herein are resistant to treatment with an anti-cancer agent wherein the methods for determining whether a cancer is susceptible to cancer comprises but is not limited to lymphoma, B cell treatment with an agent comprising measuring the expression lymphoma, T cell lymphoma, mycosis fungoides, Hodgkin’s of the cooperation response gene panel in the cancer relative Disease, leukemias, myeloid leukemia, bladder cancer, brain to a control, wherein the responsiveness of one or more coop cancer, nervous system cancer, head and neck cancer, squa eration response genes indicates sensitivity to treatment. It is mous cell carcinoma of head and neck, lung cancers such as understood the anti-cancer agent can be any new or old com Small cell lung cancer and non-Small cell lung cancer, neuro position known in the art regardless of the known effective blastoma/glioblastoma, ovarian cancer, pancreatic cancer, ness in treating cancer. Thus, disclosed in one aspect are prostate cancer, skin cancer, liver cancer, melanoma, squa methods wherein the anti-cancer agent is a chemotherapeutic mous cell carcinomas of the mouth, throat, larynx, and lung, or anti-oxidant. Also disclosed are methods wherein the anti gastric cancer, colon cancer, cervical cancer, cervical carci cancer agent is a histone deacetylase inhibitor (HDACi). noma, breast cancer, and epithelial cancer, bone cancers, Thus, for example, disclosed herein are methods wherein renal cancer, bladder cancer, genitourinary cancer, esoph expression of Dapk1, Dffb, Fas, Noxa, Perp, Rprm, Sfrp2. ageal carcinoma, large bowel cancer, metastatic cancers US 2012/01 14670 A1 May 10, 2012 hematopoietic cancers, sarcomas, Ewing's sarcoma, synovial Mpp7, Mrpl15, Mrpplif4, Ms4all0, Mtus 1, Nbea, Notch3, cancer, Soft tissue cancers; and testicular cancer. Noxa, Oaf, Parvb, Pardóg, Perp, Plac8, Pla2g7, Pitx2, Pltp, 0089 5. Methods of Using the Compositions as Research Plxdc2, Prkcm, Prkg, Prss22, Pyr14, Rab40b, Rai2. Rasl 11a, Tools Rb1, RgS2, Rprm, Rspo3, Satb1, Sbk1, SbSn, Scn3b, 0090 The compositions can be used for example as targets Sema3d, Sema7a, Serpinb2, Sfrp2, Slc14a1, Slc27a3, Sms, in combinatorial chemistry protocols or other screening pro Sod3, Stimna, Tex15, Tnfrsfl8, Tnnt2, Unc45b, Wnt9a, Zac1, tocols to isolate molecules that possess desired functional and Zfp385 as well as any other proteins disclosed herein, as properties related to inhibiting a cancer. well as various functional nucleic acids. The disclosed 0091. The disclosed compositions can also be used diag nucleic acids are made up of for example, nucleotides, nucle nostic tools related to diseases, such as cancer. otide analogs, or nucleotide Substitutes. Non-limiting 0092. The disclosed compositions can be used as dis examples of these and other molecules are discussed herein. cussed hereinas either reagents in microarrays or as reagents It is understood that for example, when a vector is expressed to probe or analyze existing microarrays. The disclosed com in a cell, that the expressed mRNA will typically be made up positions can be used in any known method for isolating or of A, C, G, and U. Likewise, it is understood that if, for identifying single nucleotide polymorphisms. The composi example, an antisense molecule is introduced into a cell or tions can also be used in any known method of Screening cell environment through for example exogenous delivery, it assays, related to chip/micro arrays. The compositions can is advantagous that the antisense molecule be made up of also be used in any known way of using the computer readable nucleotide analogs that reduce the degradation of the anti embodiments of the disclosed compositions, for example, to sense molecule in the cellular environment. study relatedness or to perform molecular modeling analysis (0096) a) Nucleotides and Related Molecules related to the disclosed compositions. 0097. A nucleotide is a molecule that contains a base moi ety, a Sugar moiety and a phosphate moiety. Nucleotides can C COMPOSITIONS be linked together through their phosphate moieties and Sugar 0093. Disclosed are the components to be used to prepare moieties creating an internucleoside linkage. The base moiety the disclosed compositions as well as the compositions them of a nucleotide can be adenine-9-yl (A), cytosine-1-yl (C), selves to be used within the methods disclosed herein. These guanine-9-yl (G), uracil-1-yl (U), and thymin-1-yl (T). The and other materials are disclosed herein, and it is understood Sugar moiety of a nucleotide is a ribose or a deoxyribose. The that when combinations, Subsets, interactions, groups, etc. of phosphate moiety of a nucleotide is pentavalent phosphate. these materials are disclosed that while specific reference of An non-limiting example of a nucleotide would be 3'-AMP each various individual and collective combinations and per (3'-adenosine monophosphate) or 5'-GMP (5'-guanosine mutation of these compounds may not be explicitly disclosed, monophosphate). each is specifically contemplated and described herein. For 0098. A nucleotide analog is a nucleotide which contains example, if a particular cancer gene or cooperation response Some type of modification to either the base, Sugar, or phos gene is disclosed and discussed and a number of modifica phate moieties. Modifications to nucleotides are well known tions that can be made to a number of molecules including the in the art and would include for example, 5-methylcytosine cancer gene or cooperation response gene are discussed, spe (5-me-C), 5-hydroxymethyl cytosine, Xanthine, hypoxan cifically contemplated is each and every combination and thine, and 2-aminoadenine as well as modifications at the permutation of cancer gene or cooperation response gene and Sugar or phosphate moieties. the modifications that are possible unless specifically indi 0099 Nucleotide substitutes are molecules having similar cated to the contrary. Thus, if a class of molecules A, B, and functional properties to nucleotides, but which do not contain Care disclosed as well as a class of molecules D, E, and F and a phosphate moiety, such as peptide nucleic acid (PNA). an example of a combination molecule, A-Dis disclosed, then Nucleotide substitutes are molecules that will recognize even if each is not individually recited each is individually nucleic acids in a Watson-Crick or Hoogsteen manner, but and collectively contemplated meaning combinations, A-E, which are linked together through a moiety other than a A-F B-D, B-E, B-F, C-D, C-E, and C-F are considered dis phosphate moiety. Nucleotide substitutes are able to conform closed. Likewise, any Subset or combination of these is also to a double helix type structure when interacting with the disclosed. Thus, for example, the sub-group of A-E, B-F, and appropriate target nucleic acid. C-E would be considered disclosed. This concept applies to 0100. It is also possible to link other types of molecules all aspects of this application including, but not limited to, (conjugates) to nucleotides or nucleotide analogs to enhance steps in methods of making and using the disclosed compo for example, cellular uptake. Conjugates can be chemically sitions. Thus, if there are a variety of additional steps that can linked to the nucleotide or nucleotide analogs. Such conju be performed it is understood that each of these additional gates include but are not limited to lipid moieties such as a steps can be performed with any specific embodiment or cholesterol moiety. (Letsinger et al., Proc. Natl. Acad. Sci. combination of embodiments of the disclosed methods. USA, 1989, 86,6553-6556), 0094) 1. Nucleic Acids 0101. A Watson-Crick interaction is at least one interac 0095. There are a variety of molecules disclosed herein tion with the Watson-Crick face of a nucleotide, nucleotide that are nucleic acid based, including for example the nucleic analog, or nucleotide substitute. The Watson-Crick face of a acids that encode, for example, Abat, Abca1, Ank, Ankrdl, nucleotide, nucleotide analog, or nucleotide Substitute Arhgap24. Atp8al, Bbs7, Bex 1, Ccl9, Centa3, Chst1, Ckmt1, includes the C2, N1, and C6 positions of a purine based Col9a3, Cpz, Cxcl1, Cxcl15, Daf1, Dapk1, Dfb, Dgka, nucleotide, nucleotide analog, or nucleotide Substitute and Dixdc, Dusp15, Elav 12, Eno3, Ephb2, Espin, Eval, Fas, the C2, N3, C4 positions of a pyrimidine based nucleotide, F2r11, Fgf18, Fgf7, Fhod3, FHOS2, Garn13, Gca, Gpr149, nucleotide analog, or nucleotide Substitute. Hbegf, Hey2, Hmgal, Hmga2, Hoxc13, Id2, Ida, Igfbp2. 0102) A Hoogsteen interaction is the interaction that takes Igsf4a, Jag2. Kctd 15, Lass4, Ldhb, Man2b1, Mcam, Mmp15, place on the Hoogsteen face of a nucleotide or nucleotide US 2012/01 14670 A1 May 10, 2012
analog, which is exposed in the major groove of duplex DNA. external guide sequences. The functional nucleic acid mol The Hoogsteen face includes the N7 position and reactive ecules can act as affectors, inhibitors, modulators, and stimu groups (NH2 or O) at the C6 position of purine nucleotides. lators of a specific activity possessed by a target molecule, or (0103 b) Sequences the functional nucleic acid molecules can possess a de novo 0104. There are a variety of sequences related to, for activity independent of any other molecules. example, Abat, Abcal, Ank, Ankrdl, Arhgap24. Atp8al, 0110 Functional nucleic acid molecules can interact with Bbs7, Bex1, Ccl9, Centd3, Chst1, Ckmt1, Col9a3, Cpz, any macromolecule, such as DNA, RNA, polypeptides, or Cxcl1, Cxcl15, Daf1, Dapk1, Dffb, Dgka, Dixdc, Dusp15, carbohydrate chains. Thus, functional nucleic acids can inter Elav 12, Eno3, Ephb2, Espin, Eval, Fas, F2r11, Fgf18, Fgf7, act with the mRNA of Abat, Abca1, Ank, Ankrd1, Arhgap24. Fhod3, FHOS2, Garn13, Gca, Gpr149, Hbegf, Hey2, Hmgal, Atp8al, Bbs7, Bex1, Ccl9, Centd3, Chst1, Ckmt1, Col9a3, Hmga2, Hoxc13, Id2, Ida, Igfbp2, Igsf4a, Jag2. Kctd 15. Cpz, Cxcl1, Cxcl15, Daf1, Dapk1, Dfb, Dgka, Dixdc, Lass4, Ldhb, Man2b1, Mcam, Mmp15, Mpp7, Mrpl15, Mrp Dusp15, Elav 12, Eno3, Ephb2, Espin, Eval, Fas, F2r 11, plf4, Ms4all0, Mtus 1, Nbea, Notch3, Noxa, Oaf, Parvb, Fgf18, Fgf7, Fhod3, FHOS2, Garn13, Gca, Gpr149, Hbegf. Pardog, Perp, Plac8, P1a2g7, Pitx2, Pltp, Plxdc2, Prkcm, Hey2, Hmgal, Hmga2, Hoxc13, Id2, Ida, Igfbp2, Igsf4a, Prkg, Prss22, Pyr14, Rab40b, Rai2. Rasl 11a, Rb1, Rgs2. Jag2. Kctd 15, Lass4, Ldhb, Man2b1, Mcam, Mmp15, Mpp7. Rprm, Rspo3, Satb1, Sbk1, SbSn, Scn3b, Sema3d, Sema7a, Mrpl15, Mrpplif4, Ms4all0, Mtus1, Nbea, Notch3, Noxa, Oaf, Serpinb2, Sfrp2, Slc14a1, Slc27a3, Sms, Sod3, Stimna, Parvb, Pardog, Perp, Plac8, P1a2g7, Pitx2, Pltp, Plxdc2, Tex15, Tnfrsfl8, Tnnt2, Unc45b, Wnt9a, Zac1, and Zfp385 Prkcm, Prkg, Prss22, Pvr14, Rab40b, Rai2, Rasl 11a, Rb1, as well as any other protein disclosed herein that are disclosed RgS2, Rprm, Rspo3, Satb1, Sbk1, SbSn, Scn3b, Sema3d, on Genbank, and these sequences and others are herein incor Sema7a, Serpinb2, Sfrp2, Slc14al, Slc27a3, Sms, Sod3, porated by reference in their entireties as well as for indi Stmn4, Tex 15, Tnfrsfl8, Tnnt2, Unc45b, Wnt 9a, Zac1, and vidual Subsequences contained therein. Zfp385 or the genomic DNA of Abat, Abca1, Ank, Ankrd1, 0105. A variety of sequences are provided herein and these Arhgap24. Atp8al, Bbs7, Bex1, Ccl9, Centa3, Chst1, Ckmt1, and others can be found in Genbank. Those of skill in the art Col9a3, Cpz, Cxcl1, Cxcl15, Daf1, Dapk1, Dfb, Dgka, understand how to resolve sequence discrepancies and differ Dixdc, Dusp15, Elav 12, Eno3, Ephb2, Espin, Eval, Fas, ences and to adjust the compositions and methods relating to F2r11, Fgf18, Fgf7, Fhod3, FHOS2, Garn13, Gca, Gpr149, a particular sequence to other related sequences. Primers Hbegf, Hey2, Hmgal, Hmga2, Hoxc13, Id2, Ida, Igfbp2. and/or probes can be designed for any sequence given the Igsf4a, Jag2. Kctd 15, Lass4, Ldhb, Man2b1, Mcam, Mmp15, information disclosed herein and known in the art. Mpp7, Mrpl15, Mrpplifa, Ms4all0, Mtus 1, Nbea, Notch3, 0106 c) Primers and Probes Noxa, Oaf, Parvb, Pardog, Perp, Plac8, P1a2g7, Pitx2, Pltp, 0107 Disclosed are compositions including primers and Plxdc2, Prkcm, Prkg, Prss22, Pvr14, Rab40b, Rai2. Rasl 11a, probes, which are capable of interacting with the genes dis Rb1, RgS2, Rprm, Rspo3, Satb1, Sbk1, SbSn, Scn3b, closed herein. In certain embodiments the primers are used to Sema3d, Sema7a, Serpinb2, Sfrp2, Slc14a1, Slc27a3, Sms, support DNA amplification reactions. Typically the primers Sod3, Stimna, Tex15, Tnfrsfl8, Tnnt2, Unc45b, Wnt9a, Zac1, will be capable of being extended in a sequence specific and Zfp385 or they can interact with the polypeptide. Often manner. Extension of a primer in a sequence specific manner functional nucleic acids are designed to interact with other includes any methods wherein the sequence and/or composi nucleic acids based on sequence homology between the target tion of the nucleic acid molecule to which the primer is molecule and the functional nucleic acid molecule. In other hybridized or otherwise associated directs or influences the situations, the specific recognition between the functional composition or sequence of the product produced by the nucleic acid molecule and the target molecule is not based on extension of the primer. Extension of the primer in a sequence sequence homology between the functional nucleic acid mol specific manner therefore includes, but is not limited to, PCR, ecule and the target molecule, but rather is based on the DNA sequencing, DNA extension, DNA polymerization, formation of tertiary structure that allows specific recognition RNA transcription, or reverse transcription. Techniques and to take place. conditions that amplify the primer in a sequence specific 0111 Antisense molecules are designed to interact with a manner are preferred. In certain embodiments the primers are target nucleic acid molecule through either canonical or non used for the DNA amplification reactions, such as PCR or canonical base pairing. The interaction of the antisense mol direct sequencing. It is understood that in certain embodi ecule and the target molecule is designed to promote the ments the primers can also be extended using non-enzymatic destruction of the target molecule through, for example, techniques, where for example, the nucleotides or oligonucle RNAseH mediated RNA-DNA hybrid degradation. Alterna otides used to extend the primer are modified such that they tively the antisense molecule is designed to interrupt a pro will chemically react to extend the primer in a sequence cessing function that normally would take place on the target specific manner. Typically the disclosed primers hybridize molecule. Such as transcription or replication. Antisense mol with the nucleic acid or region of the nucleic acid or they ecules can be designed based on the sequence of the target hybridize with the complement of the nucleic acid or comple molecule. Numerous methods for optimization of antisense ment of a region of the nucleic acid. efficiency by finding the most accessible regions of the target 0108 d) Functional Nucleic Acids molecule exist. Exemplary methods would be in vitro selec 0109 Functional nucleic acids are nucleic acid molecules tion experiments and DNA modification studies using DMS that have a specific function, such as binding a target mol and DEPC. It is preferred that antisense molecules bind the ecule or catalyzing a specific reaction. Functional nucleic target molecule with a dissociation constant (kd) less than or acid molecules can be divided into the following categories, equal to 10-6, 10-8, 10-10, or 10-12. A representative sample which are not meant to be limiting. For example, functional of methods and techniques which aid in the design and use of nucleic acids include antisense molecules, aptamers, antisense molecules can be found in the following non-lim ribozymes, triplex forming molecules, shRNAs, siRNAs, and iting list of U.S. Pat. Nos. 5,135,917, 5,294,533, 5,627,158, US 2012/01 14670 A1 May 10, 2012
5,641,754, 5,691.317, 5,780,607, 5,786,138, 5,849,903, nucleic acid. It is preferred that the ribozymes catalyze inter 5,856,103, 5,919,772, 5,955,590, 5,990,088, 5,994,320, molecular reactions. There are a number of different types of 5,998,602, 6,005,095, 6,007,995, 6,013,522, 6,017,898, ribozymes that catalyze nuclease or nucleic acid polymerase 6,018,042, 6,025, 198, 6,033,910, 6,040,296, 6,046,004, type reactions which are based on ribozymes found in natural 6,046,319, and 6,057,437. systems, such as hammerhead ribozymes, (for example, but 0112 Aptamers are molecules that interact with a target not limited to the following U.S. Pat. Nos. 5,334,711, 5,436, molecule, preferably in a specific way. Typically aptamers are 330, 5,616,466, 5,633,133, 5,646,020, 5,652,094, 5,712,384, Small nucleic acids ranging from 15-50 bases in length that 5,770,715, 5,856.463, 5,861,288, 5,891,683, 5,891,.684, fold into defined secondary and tertiary structures, such as 5,985,621, 5,989,908, 5,998,193, 5,998,203, WO 98.58058 stem-loops or G-quartets. Aptamers can bind Small mol by Ludwig and Sproat, WO 98.58057 by Ludwig and Sproat, ecules, such as ATP (U.S. Pat. No. 5,631,146) and theophiline and WO 97.18312 by Ludwig and Sproat) hairpin ribozymes (U.S. Pat. No. 5,580,737), as well as large molecules, such as (for example, but not limited to the following U.S. Pat. Nos. reverse transcriptase (U.S. Pat. No. 5,786,462) and thrombin 5,631,115, 5,646,031, 5,683,902, 5,712,384, 5,856,188, (U.S. Pat. No. 5,543,293). Aptamers can bind very tightly 5,866,701, 5,869,339, and 6,022,962), and tetrahymena with kds from the target molecule of less than 10-12 M. It is ribozymes (for example, but not limited to the following U.S. preferred that the aptamers bind the target molecule with a kd Pat. Nos. 5,595,873 and 5,652,107). There are also a number less than 10-6, 10-8, 10-10, or 10-12. Aptamers can bind the of ribozymes that are not found in natural systems, but which target molecule with a very high degree of specificity. For have been engineered to catalyze specific reactions de novo example, aptamers have been isolated that have greater than a (for example, but not limited to the following U.S. Pat. Nos. 10000 fold difference in binding affinities between the target 5,580,967, 5,688,670, 5,807,718, and 5,910.408). Preferred molecule and another molecule that differ at only a single ribozymes cleave RNA or DNA substrates, and more prefer position on the molecule (U.S. Pat. No. 5,543,293). It is ably cleave RNA substrates. Ribozymes typically cleave preferred that the aptamer have a kd with the target molecule nucleic acid Substrates through recognition and binding of the at least 10, 100, 1000, 10,000, or 100,000 fold lower than the target Substrate with Subsequent cleavage. This recognition is kd with a background binding molecule. It is preferred when often based mostly on canonical or non-canonical base pair doing the comparison for a polypeptide for example, that the interactions. This property makes ribozymes particularly background molecule be a different polypeptide. For good candidates for target specific cleavage of nucleic acids example, when determining the specificity of Abat, Abcal, because recognition of the target Substrate is based on the Ank, Ankrd1, Arhgap24, Atp8al, Bbs7, Bexl, Ccl9, Centd3, target Substrates sequence. Representative examples of how Chst1, Ckmt1, Col9a3, Cpz, Cxcl1, Cxcl15, Daf1, Dapk1. to make and use ribozymes to catalyze a variety of different Dffb, Dgka, Dixdc, Dusp15, Elav 12, Eno3, Ephb2, Espin, reactions can be found in the following non-limiting list of Eval, Fas, F2r11, Fgf18, Fgf7, Fhod3, FHOS2, Garn13, Gca, U.S. Pat. Nos. 5,646,042, 5,693,535, 5,731,295, 5,811,300, Gpr149, Hbegf, Hey2, Hmgal, Hmga2, Hoxc13, Id2, Ida, 5,837,855, 5,869,253, 5,877,021, 5,877,022, 5,972,699, Igfbp2, Igsf4a, Jag2. Kctd 15, Lass4, Ldhb, Man2b1, Mcam, 5,972,704, 5,989,906, and 6,017,756. Mmp15, Mpp7, Mrpl15, Mrpplf4, Ms4all0, Mtus1, Nbea, 0114 Triplex forming functional nucleic acid molecules Notch3, Noxa, Oaf, Parvb, Pardóg, Perp, Plac8, P1a2g7, are molecules that can interact with either double-stranded or Pitx2, Pltp, Plxdc2, Prkcm, Prkg, Prss22, Pvr14, Rab40b, single-stranded nucleic acid. When triplex molecules interact Rai2. Rasl 11a, Rb1, Rgs2, Rprm, Rspo3, Satb1, Sbk1, SbSn, with a target region, a structure called a triplex is formed, in Scn3b, Sema3d, Sema7a, Serpinb2, Sfrp2, Slc14al, Slc27a3, which there are three strands of DNA forming a complex Sms, Sod3, Stimna, Tex15, Tnfrsfl8, Tnnt2, Unc45b, Wnt 9a, dependant on both Watson-Crick and Hoogsteen base-pair Zac1, and Zfp385 aptamers, the background protein could be ing. Triplex molecules are preferred because they can bind Abat, Abca1, Ank, Ankrd1, Arhgap24. Atp8al, Bbs7, Bex 1, target regions with high affinity and specificity. It is preferred Ccl9, Centd3, Chst1, Ckmt1, Col9a3, Cpz, Cxcl1, Cxcl15, that the triplex forming molecules bind the target molecule Daf1, Dapk1, Dffb, Dgka, Dixdc, Dusp15, Elav 12, Eno3, with a kdless than 10-6, 10-8, 10-10, or 10-12. Representa Ephb2, Espin, Eval, Fas, F2r11, Fgf18, Fgf7, Fhod3, FHOS2, tive examples of how to make and use triplex forming mol Garn13, Gca, Gpr149, Hbegf, Hey2, Hmgal, Hmga2. ecules to bind a variety of different target molecules can be Hoxc13, Id2, Ida, Igfbp2, Igsf4a, Jag2. Kctd 15, Lass4, Ldhb. found in the following non-limiting list of U.S. Pat. Nos. Man2b1, Mcam, Mmp15, Mpp7, Mrpl15, Mrpplif4, Ms4al.0, 5,176,996, 5,645,985, 5,650,316, 5,683,874, 5,693,773, Mtus 1,Nbea, Notch3, Noxa, Oaf, Parvb, Pardóg, Perp, Plac8, 5,834,185, 5,869,246, 5,874,566, and 5,962,426. Pla2g7, Pitx2, Pltp, Plxdc2, Prkcm, Prkg, Prss22, Pvr14, 0115 External guide sequences (EGSs) are molecules that Rab40b, Rai2. Rasl 11a, Rb1, Rgs2, Rprm, Rspo3, Satb1, bind a target nucleic acid molecule forming a complex, and Sbk1, SbSn, Scn3b, Sema3d, Sema7a, Serpinb2, Sfrp2. this complex is recognized by RNase P, which cleaves the Slc14a1, Slc27a3, Sms, Sod3, Stimna, Tex 15, Tnfrsfl8, target molecule. EGSS can be designed to specifically target a Tnnt2, Unc45b, Wnt 9a, Zac1, and Zfp385. Representative RNA molecule of choice. RNAse Paids in processing transfer examples of how to make and use aptamers to bind a variety RNA (tRNA) within a cell. Bacterial RNAse P can be of different target molecules can be found in the following recruited to cleave virtually any RNA sequence by using an non-limiting list of U.S. Pat. Nos. 5,476,766, 5,503,978, EGS that causes the target RNA: EGS complex to mimic the 5,631,146, 5,731,424, 5,780,228, 5,792,613, 5,795,721, natural tRNA substrate. (WO92/03566 by Yale, and Forster 5,846,713, 5,858,660, 5,861,254, 5,864,026, 5,869,641, and Altman, Science 238:407-409 (1990)). 5,958,691, 6,001,988, 6,011,020, 6,013,443, 6,020, 130, 0116. Similarly, eukaryotic EGS/RNAse P-directed cleav 6,028, 186, 6,030,776, and 6,051,698. age of RNA can be utilized to cleave desired targets within 0113 Ribozymes are nucleic acid molecules that are eukarotic cells. (Yuan et al., Proc. Natl. Acad. Sci. USA capable of catalyzing a chemical reaction, either intramolecu 89:8006-8010 (1992); WO 93/22434 by Yale; WO95/24489 larly or intermolecularly. Ribozymes are thus catalytic by Yale:Yuan and Altman, EMBO.J. 14:159-168 (1995), and US 2012/01 14670 A1 May 10, 2012
Carrara et al., Proc. Natl. Acad. Sci. (USA) 92:2627-2631 titioner) for an indefinite period and/or until the efficacy of the (1995)). Representative examples of how to make and use treatment has been established. EGS molecules to facilitate cleavage of a variety of different 0121 Parenteral administration of the nucleic acid or vec target molecules be found in the following non-limiting list of tor, if used, is generally characterized by injection. U.S. Pat. Nos. 5,168,053, 5,624,824, 5,683,873, 5,728,521, Injectables can be prepared in conventional forms, either as 5,869,248, and 5,877,162. liquid solutions or Suspensions, solid forms suitable for solu tion of suspension in liquid prior to injection, or as emulsions. 0117 2. Nucleic Acid Delivery A more recently revised approach for parenteral administra 0118. In the methods described above which include the tion involves use of a slow release or Sustained release system administration and uptake of exogenous DNA into the cells of Such that a constant dosage is maintained. For additional a Subject (i.e., gene transduction or transfection), the dis discussion of Suitable formulations and various routes of closed nucleic acids can be in the form of naked DNA or administration of therapeutic compounds, see, e.g., Reming RNA, or the nucleic acids can be in a vector for delivering the ton: The Science and Practice of Pharmacy (19th ed.) ed. A. R. nucleic acids to the cells, whereby the antibody-encoding Gennaro, Mack Publishing Company, Easton, Pa. 1995. DNA fragment is under the transcriptional regulation of a 0.122 3. Delivery of the Compositions to Cells promoter, as would be well understood by one of ordinary I0123. There are a number of compositions and methods skill in the art. The vector can be a commercially available which can be used to deliver nucleic acids to cells, either in preparation, such as an adenovirus vector (Quantum Biotech vitro or in vivo. These methods and compositions can largely nologies, Inc. (Laval, Quebec, Canada). Delivery of the be broken down into two classes: viral based delivery systems nucleic acid or vector to cells can be via a variety of mecha and non-viral based delivery systems. For example, the nisms. As one example, delivery can be via a liposome, using nucleic acids can be delivered through a number of direct commercially available liposome preparations such as LIPO delivery systems such as, electroporation, lipofection, cal FECTIN, LIPOFECTAMINE (GIBCO-BRL, Inc., Gaithers cium phosphate precipitation, plasmids, viral vectors, viral burg, Md.), SUPERFECT (Qiagen, Inc. Hilden, Germany) nucleic acids, phage nucleic acids, phages, cosmids, or via and TRANSFECTAM (Promega Biotec, Inc., Madison, transfer of genetic material in cells or carriers such as cationic Wis.), as well as other liposomes developed according to liposomes. Appropriate means for transfection, including procedures standard in the art. In addition, the disclosed viral vectors, chemical transfectants, or physico-mechanical nucleic acid or vector can be delivered in vivo by electropo methods such as electroporation and direct diffusion of DNA, ration, the technology for which is available from Genetron are described by, for example, Wolff, J. A., et al., Science, ics, Inc. (San Diego, Calif.) as well as by means of a 247, 1465-1468, (1990); and Wolff, J. A. Nature, 352, 815 SONOPORATION machine (ImaRPharmaceutical Corp., 818, (1991). Such methods are well known in the art and Tucson, Ariz.). readily adaptable for use with the compositions and methods 0119. As one example, vector delivery can be via a viral described herein. In certain cases, the methods will be modi system, Such as a retroviral vector system which can package fied to specifically function with large DNA molecules. Fur a recombinant retroviral genome (see e.g., Pastan et al., Proc. ther, these methods can be used to target certain diseases and Natl. Acad. Sci. U.S.A. 85:4486, 1988: Miller et al., Mol. cell populations by using the targeting characteristics of the Cell. Biol. 6:2895, 1986). The recombinant retrovirus can carrier. then be used to infect and thereby deliver to the infected cells 0.124 a) Nucleic Acid Based Delivery Systems nucleic acid encoding a broadly neutralizing antibody (or 0.125 Transfer vectors can be any nucleotide construction active fragment thereof). The exact method of introducing the used to deliver genes into cells (e.g., a plasmid), or as part of altered nucleic acid into mammalian cells is, of course, not a general strategy to delivergenes, e.g., as part of recombinant limited to the use of retroviral vectors. Other techniques are retrovirus or adenovirus (Ram et al. Cancer Res. 53:83-88, widely available for this procedure including the use of aden (1993)). oviral vectors (Mitani et al., Hum. Gene Ther. 5:941-948, I0126. As used herein, plasmid or viral vectors are agents 1994), adeno-associated viral (AAV) vectors (Goodman et that transport the disclosed nucleic acids, Such as Abat, al., Blood 84: 1492-1500, 1994), lentiviral vectors (Naidini et Abca1, Ank, Ankrd1, Arhgap24. Atp8al, Bbs7, Bex 1, Ccl9. al., Science 272:263-267, 1996), pseudotyped retroviral vec Centd3, Chst1, Ckmt1, Col9a3, Cpz, Cxcl1, Cxcl15, Dafl, tors (Agrawal et al., Exper. Hematol. 24:738-747, 1996). Dapk1, Dfb, Dgka, Dixdc, Dusp15, Elav 12, Eno3, Ephb2, Physical transduction techniques can also be used. Such as Espin, Eval, Fas, F2r11, Fgf18, Fgf7, Fhod3, FHOS2, liposome delivery and receptor-mediated and other endocy Garn13, Gca, Gpr149, Hbegf, Hey2, Hmgal, Hmga2. tosis mechanisms (see, for example, Schwartzenberger et al., Hoxc13, Id2, Ida, Igfbp2, Igsf4a, Jag2. Kctd 15, Lass4, Ldhb. Blood 87:472-478, 1996). This disclosed compositions and Man2b1, Mcam, Mmp15, Mpp7, Mrpl15, Mrpplif4, Ms4al.0, methods can be used in conjunction with any of these or other Mtus 1,Nbea, Notch3, Noxa, Oaf, Parvb, Pardóg, Perp, Plac8, commonly used gene transfer methods. Pla2g7, Pitx2, Pltp, Plxdc2, Prkcm, Prkg, Prss22, Pvr14, 0120. As one example, if the antibody-encoding nucleic Rab40b, Rai2. Rasl 11a, Rb1, Rgs2, Rprm, Rspo3, Satb1, acid is delivered to the cells of a subject in an adenovirus Sbk1, SbSn, Scn3b, Sema3d, Sema7a, Serpinb2, Sfrp2. vector, the dosage for administration of adenovirus to humans Slc14a1, Slc27a3, Sms, Sod3, Stimna, Tex 15, Tnfrsfl8, can range from about 107 to 109 plaque forming units (pfu) Tnnt2, Unc45b, Wnt 9a, Zac1, and Zfp385 into the cell with per injection but can be as high as 1012 pful per injection out degradation and include a promoter yielding expression (Crystal, Hum. Gene Ther. 8:985-1001, 1997: Alvarez and of the gene in the cells into which it is delivered. In some Curiel, Hum. Gene Ther. 8:597-613, 1997). A subject can embodiments the vectors are derived from either a virus or a receive a single injection, or, if additional injections are nec retrovirus. Viral vectors are, for example, Adenovirus, essary, they can be repeated at six month intervals (or other Adeno-associated virus, Herpes virus, Vaccinia virus, Polio appropriate time intervals, as determined by the skilled prac virus, AIDS virus, neuronal trophic virus, Sindbis and other US 2012/01 14670 A1 May 10, 2012
RNA viruses, including these viruses with the HIV backbone. synthesis, and specific sequences near the ends of the LTRS Also preferred are any viral families which share the proper that enable the insertion of the DNA state of the retrovirus to ties of these viruses which make them suitable for use as insert into the host genome. The removal of the gag, pol, and vectors. Retroviruses include Murine Maloney Leukemia enV genes allows for about 8 kb of foreign sequence to be virus, MMLV, and retroviruses that express the desirable inserted into the viral genome, become reverse transcribed, properties of MMLV as a vector. Retroviral vectors are able to and upon replication be packaged into a new retroviral par carry a larger genetic payload, i.e., a transgene or marker ticle. This amount of nucleic acid is sufficient for the delivery gene, than other viral vectors, and for this reason are a com of a one to many genes depending on the size of each tran monly used vector. However, they are not as useful in non script. It is preferable to include either positive or negative proliferating cells. Adenovirus vectors are relatively stable selectable markers along with other genes in the insert. and easy to work with, have high titers, and can be delivered 0131 Since the replication machinery and packaging pro in aerosol formulation, and can transfect non-dividing cells. teins in most retroviral vectors have been removed (gag, pol, Pox viral vectors are large and have several sites for inserting and env), the vectors are typically generated by placing them genes, they are thermostable and can be stored at room tem into a packaging cell line. A packaging cell line is a cell line perature. A preferred embodiment is a viral vector which has which has been transfected or transformed with a retrovirus been engineered so as to Suppress the immune response of the that contains the replication and packaging machinery, but host organism, elicited by the viral antigens. Preferred vectors lacks any packaging signal. When the vector carrying the of this type will carry coding regions for Interleukin 8 or 10. DNA of choice is transfected into these cell lines, the vector 0127 Viral vectors can have higher transaction (ability to containing the gene of interest is replicated and packaged into introduce genes) abilities than chemical or physical methods new retroviral particles, by the machinery provided in cis by to introduce genes into cells. Typically, viral vectors contain, the helper cell. The genomes for the machinery are not pack nonstructural early genes, structural late genes, an RNA poly aged because they lack the necessary signals. merase III transcript, inverted terminal repeats necessary for (0132 (2) Adenoviral Vectors replication and encapsidation, and promoters to control the I0133. The construction of replication-defective adenovi transcription and replication of the viral genome. When engi ruses has been described (Berkner et al., J. Virology 61: 1213 neered as Vectors, viruses typically have one or more of the 1220 (1987); Massie et al., Mol. Cell. Biol. 6:2872-2883 early genes removed and a gene or gene/promotor cassette is (1986); Haj-Ahmad et al., J. Virology 57:267-274 (1986); inserted into the viral genome in place of the removed viral Davidson et al., J. Virology 61: 1226-1239 (1987); Zhang DNA. Constructs of this type can carry up to about 8 kb of "Generation and identification of recombinant adenovirus by foreign genetic material. The necessary functions of the liposome-mediated transfection and PCR analysis’ BioTech removed early genes are typically supplied by cell lines which niques 15:868-872 (1993)). The benefit of the use of these have been engineered to express the gene products of the early viruses as vectors is that they are limited in the extent to which genes in trans. they can spread to other cell types, since they can replicate 0128 (1) Retroviral Vectors within an initial infected cell, but are unable to form new 0129. A retrovirus is an animal virus belonging to the virus infectious viral particles. Recombinant adenoviruses have family of Retroviridae, including any types, Subfamilies, been shown to achieve high efficiency gene transfer after genus, or tropisms. Retroviral vectors, in general, are direct, in Vivo delivery to airway epithelium, hepatocytes, described by Verma, I. M., Retroviral vectors for gene trans vascular endothelium, CNS parenchyma and a number of fer. In Microbiology-1985, American Society for Microbiol other tissue sites (Morsy, J. Clin. Invest. 92:1580-1586 ogy, pp. 229-232, Washington, (1985), which is incorporated (1993); Kirshenbaum, J. Clin. Invest. 92:381-387 (1993); by reference herein. Examples of methods for using retroviral Roessler, J. Clin. Invest. 92: 1085-1092 (1993); Moullier, vectors for genetherapy are described in U.S. Pat. Nos. 4,868, Nature Genetics 4:154-159 (1993); La Salle, Science 259: 116 and 4,980.286; PCT applications WO 90/02806 and WO 988-990 (1993); Gomez-Foix, J. Biol. Chem. 267:25129 89/07136; and Mulligan, (Science 260:926-932 (1993)); the 25134 (1992); Rich, Human Gene Therapy 4:461-476 teachings of which are incorporated herein by reference. (1993); Zabner, Nature Genetics 6:75-83 (1994); Guzman, 0130. A retrovirus is essentially a package which has Circulation Research 73:1201-1207 (1993); Bout, Human packed into it nucleic acid cargo. The nucleic acid cargo Gene Therapy 5:3-10 (1994); Zabner, Cell 75:207-216 carries with it a packaging signal, which ensures that the (1993); Caillaud, Eur. J. Neuroscience 5:1287-1291 (1993); replicated daughter molecules will be efficiently packaged and Ragot, J. Gen. Virology 74:501-507 (1993)). Recombi within the package coat. In addition to the package signal, nant adenoviruses achieve gene transduction by binding to there are a number of molecules which are needed in cis, for specific cell surface receptors, after which the virus is inter the replication, and packaging of the replicated virus. Typi nalized by receptor-mediated endocytosis, in the same man cally a retroviral genome, contains the gag, pol, and envgenes ner as wild type or replication-defective adenovirus (Char which are involved in the making of the protein coat. It is the donnet and Dales, Virology 40:462-477 (1970); Brown and gag, pol, and enV genes which are typically replaced by the Burlingham, J. Virology 12:386-396 (1973); Svensson and foreign DNA that it is to be transferred to the target cell. Persson, J. Virology 55:442-449 (1985); Seth, et al., J. Virol. Retrovirus vectors typically contain a packaging signal for 51:650-655 (1984); Seth, et al., Mol. Cell. Biol. 4:1528-1533 incorporation into the package coat, a sequence which signals (1984); Varga et al., J. Virology 65:6061-6070 (1991); Wick the start of the gag transcription unit, elements necessary for ham et al., Ce1173:309-319 (1993)). reverse transcription, including a primer binding site to bind 0.134. A viral vector can be one based on an adenovirus the tRNA primer of reverse transcription, terminal repeat which has had the E1 gene removed and these virons are sequences that guide the switch of RNA strands during DNA generated in a cell line such as the human 293 cell line. In synthesis, a purine rich sequence 5' to the 3' LTR that serve as another preferred embodiment both the E1 and E3 genes are the priming site for the synthesis of the second strand of DNA removed from the adenovirus genome. US 2012/01 14670 A1 May 10, 2012 20
0135 (3) Adeno-Asscociated Viral Vectors delivery mechanism chosen will depend in part on the type of 0.136 Another type of viral vector is based on an adeno cell targeted and whether the delivery is occurring for associated virus (AAV). This defective parvovirus is a pre example in vivo or in vitro. ferred vector because it can infect many cell types and is 0146 Thus, the compositions can comprise, in addition to nonpathogenic to humans. AAV type Vectors can transport the disclosed vectors for example, lipids such as liposomes, about 4 to 5 kb and wild type AAV is known to stably insert such as cationic liposomes (e.g., DOTMA, DOPE, DC-cho into chromosome 19. Vectors which contain this site specific lesterol) or anionic liposomes. Liposomes can further com integration property are preferred. An especially preferred prise proteins to facilitate targeting a particular cell, if embodiment of this type of vector is the P4.1 C vector pro desired. Administration of a composition comprising a com duced by Avigen, San Francisco, Calif., which can contain the pound and a cationic liposome can be administered to the herpes simplex virus thymidine kinase gene, HSV-tk, and/or blood afferent to a target organ or inhaled into the respiratory a marker gene. Such as the gene encoding the green fluores tract to target cells of the respiratory tract. Regarding lipo cent protein, GFP. Somes, see, e.g., Brigham et al. Am. J. Resp. Cell. Mol. Biol. 0.137 In another type of AAV virus, the AAV contains a 1:95-100 (1989): Felgner et al. Proc. Natl. Acad. Sci. USA pair of inverted terminal repeats (ITRs) which flank at least 84:7413-7417 (1987); U.S. Pat. No. 4,897,355. Furthermore, one cassette containing a promoter which directs cell-specific the compound can be administered as a component of a expression operably linked to a heterologous gene. Heterolo microcapsule that can be targeted to specific cell types, such gous in this context refers to any nucleotide sequence or gene as macrophages, or where the diffusion of the compound or which is not native to the AAV or B19 parvovirus. delivery of the compound from the microcapsule is designed 0138 Typically the AAV and B19 coding regions have for a specific rate or dosage. been deleted, resulting in a safe, noncytotoxic vector. The 0.147. In the methods described above which include the AAV ITRs, or modifications thereof, confer infectivity and administration and uptake of exogenous DNA into the cells of site-specific integration, but not cytotoxicity, and the pro a subject (i.e., gene transduction or transfection), delivery of moter directs cell-specific expression. U.S. Pat. No. 6,261, the compositions to cells can be via a variety of mechanisms. 834 is herein incorproated by reference for material related to As one example, delivery can be via a liposome, using com the AAV vector. mercially available liposome preparations such as LIPOFEC 0.139. The disclosed vectors thus provide DNA molecules TIN, LIPOFECTAMINE (GIBCO-BRL, Inc., Gaithersburg, which are capable of integration into a mammalian chromo Md.), SUPERFECT (Qiagen, Inc. Hilden, Germany) and some without substantial toxicity. TRANSFECTAM (Promega Biotec, Inc., Madison, Wis.), as 0140. The inserted genes in viral and retroviral usually well as other liposomes developed according to procedures contain promoters, and/or enhancers to help control the standard in the art. In addition, the disclosed nucleic acid or expression of the desired gene product. A promoter is gener vector can be delivered in vivo by electroporation, the tech ally a sequence or sequences of DNA that function when in a nology for which is available from Genetronics, Inc. (San relatively fixed location in regard to the transcription start Diego, Calif.) as well as by means of a SONOPORATION site. A promoter contains core elements required for basic machine (ImaRX Pharmaceutical Corp., Tucson, Ariz.). interaction of RNA polymerase and transcription factors, and 0.148. The materials may be in solution, suspension (for may contain upstream elements and response elements. example, incorporated into microparticles, liposomes, or 0141 (4) Large Payload Viral Vectors cells). These may be targeted to a particular cell type via 0142 Molecular genetic experiments with large human antibodies, receptors, or receptor ligands. The following ref herpesviruses have provided a means whereby large heterolo erences are examples of the use of this technology to target gous DNA fragments can be cloned, propagated and estab specific proteins to tumor tissue (Senter, et al., Bioconjugate lished in cells permissive for infection with herpesviruses Chem. 2:447-451, (1991); Bagshawe, K. D., Br. J. Cancer, (Sun et al., Nature Genetics 8:33-41, 1994; Cotter and Rob 60:275-281, (1989); Bagshawe, et al., Br. J. Cancer, 58:700 ertson, Curr Opin Mol Ther 5: 633-644, 1999). These large 703, (1988); Senter, et al., Bioconjugate Chem., 4:3-9, DNA viruses (herpes simplex virus (HSV) and Epstein-Barr (1993); Battelli, et al., Cancer Immunol. Immunother. virus (EBV), have the potential to deliver fragments of human 35:421-425, (1992); Pietersz and McKenzie, Immunolog. heterologous DNA >150 kb to specific cells. EBV recombi Reviews, 129:57-80, (1992); and Roffler, et al., Biochem. nants can maintainlarge pieces of DNA in the infected B-cells Pharmacol, 42:2062-2065, (1991)). These techniques can be as episomal DNA. Individual clones carried human genomic used for a variety of other specific cell types. Vehicles such as inserts up to 330 kb appeared genetically stable the mainte 'stealth' and other antibody conjugated liposomes (including nance of these episomes requires a specific EBV nuclear lipid mediated drug targeting to colonic carcinoma), receptor protein, EBNA1, constitutively expressed during infection mediated targeting of DNA through cell specific ligands, with EBV. Additionally, these vectors can be used for trans lymphocyte directed tumor targeting, and highly specific fection, where large amounts of protein can be generated therapeutic retroviraltargeting of murine glioma cells in vivo. transiently in vitro. Herpesvirus amplicon systems are also The following references are examples of the use of this being used to package pieces of DNA >220 kb and to infect technology to target specific proteins to tumor tissue (Hughes cells that can stably maintain DNA as episomes. et al., Cancer Research, 49:6214-6220, (1989); and Litzinger 0143. Other useful systems include, for example, replicat and Huang, Biochimica et Biophysica Acta, 1104:179-187, ing and host-restricted non-replicating vaccinia virus vectors. (1992)). In general, receptors are involved in pathways of 014.4 b) Non-Nucleic Acid Based Systems endocytosis, either constitutive or ligand induced. These 0145 The disclosed compositions can be delivered to the receptors cluster in clathrin-coated pits, enter the cell via target cells in a variety of ways. For example, the composi clathrin-coated vesicles, pass through an acidified endoSome tions can be delivered through electroporation, or through in which the receptors are sorted, and then either recycle to the lipofection, or through calcium phosphate precipitation. The cell Surface, become stored intracellularly, or are degraded in US 2012/01 14670 A1 May 10, 2012 lysosomes. The internalization pathways serve a variety of hepatitis-B Virus and most preferably cytomegalovirus, or functions, such as nutrient uptake, removal of activated pro from heterologous mammalian promoters, e.g. beta actin pro teins, clearance of macromolecules, opportunistic entry of moter. The early and late promoters of the SV40 virus are viruses and toxins, dissociation and degradation of ligand, conveniently obtained as an SV40 restriction fragment which and receptor-level regulation. Many receptors follow more also contains the SV40 viral origin of replication (Fiers et al., than one intracellular pathway, depending on the cell type, Nature, 273: 113 (1978)). The immediate early promoter of receptor concentration, type of ligand, ligand Valency, and the human cytomegalovirus is conveniently obtained as a ligand concentration. Molecular and cellular mechanisms of HindIII E restriction fragment (Greenway, P. J. et al., Gene receptor-mediated endocytosis has been reviewed (Brown 18:355-360 (1982)). Of course, promoters from the host cell and Greene, DNA and Cell Biology 10:6, 399-409 (1991)). or related species also are useful herein. 0149 Nucleic acids that are delivered to cells which are to 0158 Enhancer generally refers to a sequence of DNA that be integrated into the host cell genome, typically contain functions at no fixed distance from the transcription start site integration sequences. These sequences are often viral related and can be either 5' (Laimins, L. et al., Proc. Natl. Acad. Sci. sequences, particularly when viral based systems are used. 78: 993 (1981)) or 3 (Lusky, M. L., et al., Mol. Cell. Bio. 3: These viral intergration systems can also be incorporated into 1108 (1983)) to the transcription unit. Furthermore, enhanc nucleic acids which are to be delivered using a non-nucleic ers can be within an intron (Banerji, J. L. et al., Cell 33: 729 acid based system of deliver, Such as a liposome, so that the (1983)) as well as within the coding sequence itself (Osborne, nucleic acid contained in the delivery system can be come T. F., et al., Mol. Cell. Bio. 4: 1293 (1984)). They are usually integrated into the host genome. between 10 and 300 by in length, and they function in cis. 0150. Other general techniques for integration into the Enhancers function to increase transcription from nearby pro host genome include, for example, systems designed to pro moters. Enhancers also often contain response elements that mote homologous recombination with the host genome. mediate the regulation of transcription. Promoters can also These systems typically rely on sequence flanking the nucleic contain response elements that mediate the regulation of tran acid to be expressed that has enough homology with a target Scription. Enhancers often determine the regulation of sequence within the host cell genome that recombination expression of a gene. While many enhancer sequences are between the vector nucleic acid and the target nucleic acid now known from mammalian genes (globin, elastase, albu takes place, causing the delivered nucleic acid to be integrated min, -fetoprotein and insulin), typically one will use an into the host genome. These systems and the methods neces enhancer from a eukaryotic cell virus for general expression. sary to promote homologous recombination are known to Preferred examples are the SV40 enhancer on the late side of those of skill in the art. the replication origin (bp 100-270), the cytomegalovirus 0151 c) In Vivo/Ex Vivo early promoter enhancer, the polyoma enhancer on the late 0152. As described above, the compositions can be admin side of the replication origin, and adenovirus enhancers. istered in a pharmaceutically acceptable carrier and can be 0159. The promotor and/or enhancer may be specifically delivered to the subject's cells in vivo and/or ex vivo by a activated either by light or specific chemical events which variety of mechanisms well known in the art (e.g., uptake of trigger their function. Systems can be regulated by reagents naked DNA, liposome fusion, intramuscular injection of Such as tetracycline and dexamethasone. There are also ways DNA via a gene gun, endocytosis and the like). to enhance viral vector gene expression by exposure to irra 0153. If ex vivo methods are employed, cells or tissues can diation, such as gamma irradiation, or alkylating chemo be removed and maintained outside the body according to therapy drugs. standard protocols well known in the art. The compositions 0160. In certain embodiments the promoter and/or can be introduced into the cells via any gene transfer mecha enhancer region can act as a constitutive promoter and/or nism, such as, for example, calcium phosphate mediated gene enhancer to maximize expression of the region of the tran delivery, electroporation, microinjection or proteoliposomes. Scription unit to be transcribed. In certain constructs the pro The transduced cells can then be infused (e.g., in a pharma moter and/or enhancer region be active in all eukaryotic cell ceutically acceptable carrier) or homotopically transplanted types, even if it is only expressed in a particular type of cell at back into the subject per standard methods for the cell or a particular time. A preferred promoter of this type is the tissue type. Standard methods are known for transplantation CMV promoter (650 bases). Other preferred promoters are or infusion of various cells into a subject. SV40 promoters, cytomegalovirus (full length promoter), 0154 4. Expression Systems and retroviral vector LTF. 0155 The nucleic acids that are delivered to cells typically 0.161 It has been shown that all specific regulatory ele contain expression controlling systems. For example, the ments can be cloned and used to construct expression vectors inserted genes in viral and retroviral systems usually contain that are selectively expressed in specific cell types such as promoters, and/or enhancers to help control the expression of melanoma cells. The glial fibrillary acetic protein (GFAP) the desired gene product. A promoter is generally a sequence promoter has been used to selectively express genes in cells of or sequences of DNA that function when in a relatively fixed glial origin. location in regard to the transcription start site. A promoter 0162 Expression vectors used in eukaryotic host cells contains core elements required for basic interaction of RNA (yeast, fungi, insect, plant, animal, human or nucleated cells) polymerase and transcription factors, and may contain may also contain sequences necessary for the termination of upstream elements and response elements. transcription which may affect mRNA expression. These 0156 a) Viral Promoters and Enhancers regions are transcribed as polyadenylated segments in the 0157 Preferred promoters controlling transcription from untranslated portion of the mRNA encoding tissue factor vectors in mammalian host cells may be obtained from Vari protein. The 3' untranslated regions also include transcription ous sources, for example, the genomes of viruses Such as: termination sites. It is preferred that the transcription unit also polyoma, Simian Virus 40 (SV40), adenovirus, retroviruses, contains a polyadenylation region. One benefit of this region US 2012/01 14670 A1 May 10, 2012 22 is that it increases the likelihood that the transcribed unit will with Abat, Abca1, Ank, Ankrd1, Arhgap24. Atp8al, Bbs7, be processed and transported like mRNA. The identification Bex1, Ccl9, Centd3, Chst1, Ckmt1, Col9a3, Cpz, Cxcl1, and use of polyadenylation signals in expression constructs is Cxcl15, Dafl, Dapk1, Dffb, Dgka, Dixdc, Dusp15, Elav 12, well established. It is preferred that homologous polyadeny Eno3, Ephb2, Espin, Eval, Fas, F2r11, Fgf18, Fgf7, Fhod3, lation signals be used in the transgene constructs. In certain FHOS2, Garn13, Gca, Gpr149, Hbegf, Hey2, Hmgal, transcription units, the polyadenylation region is derived Hmga2, Hoxc13, Id2, Ida, Igfbp2, Igsf4a, Jag2. Kctd 15. from the SV40 early polyadenylation signal and consists of Lass4, Ldhb, Man2b1, Mcam, Mmp15, Mpp7, Mrpl15, Mrp about 400 bases. It is also preferred that the transcribed units plf4, Ms4all0, Mtus 1, Nbea, Notch3, Noxa, Oaf, Parvb, contain other standard sequences alone or in combination Pardog, Perp, Plac8, Pla2g7, Pitx2, Pltp, Plxdc2, Prkcm, with the above sequences improve expression from, or stabil Prkg, Prss22, Pvr14, Rab40b, Rai2, Rasl11a, Rb1, Rgs2. ity of the construct. Rprm, Rspo3, Satb1, Sbk1, SbSn, Scn3b, Sema3d, Sema7a, (0163 b) Markers Serpinb2, Sfrp2, Slc14a1, Slc27a3, Sms, Sod3, Stimna, 0164. The viral vectors can include nucleic acid sequence Tex15, Tnfrsf18, Tnnt2, Unc45b, Wnt 9a, Zac1, and Zfp385. encoding a marker product. This marker product is used to The antibodies can be tested for their desired activity using determine if the gene has been delivered to the cell and once the in vitro assays described herein, or by analogous methods, delivered is being expressed. Preferred marker genes are the after which their in vivo therapeutic and/or prophylactic E. Colilacz gene, which encodes B-galactosidase, and green activities are tested according to known clinical testing meth fluorescent protein. ods. 0.165. In some embodiments the marker may be a select 0170 The term “monoclonal antibody” as used herein able marker. Examples of suitable selectable markers for refers to an antibody obtained from a substantially homoge mammalian cells are dihydrofolate reductase (DHFR), thy neous population of antibodies, i.e., the individual antibodies midine kinase, neomycin, neomycin analog G418, hydromy within the population are identical except for possible natu cin, and puromycin. When Such selectable markers are suc rally occurring mutations that may be present in a small cessfully transferred into a mammalian host cell, the subset of the antibody molecules. The monoclonal antibodies transformed mammalian host cell can Survive if placed under herein specifically include “chimeric' antibodies in which a selective pressure. There are two widely used distinct catego portion of the heavy and/or light chain is identical with or ries of selective regimes. The first category is based on a cell's homologous to corresponding sequences in antibodies metabolism and the use of a mutant cell line which lacks the derived from a particular species or belonging to a particular ability to grow independent of a supplemented media. Two antibody class or subclass, while the remainder of the chain(s) examples are: CHODHFR-cells and mouse LTK-cells. These is identical with or homologous to corresponding sequences cells lack the ability to grow without the addition of such in antibodies derived from another species or belonging to nutrients as thymidine or hypoxanthine. Because these cells another antibody class or Subclass, as well as fragments of lack certain genes necessary for a complete nucleotide Syn Such antibodies, as long as they exhibit the desired antago thesis pathway, they cannot survive unless the missing nucle nistic activity (See, U.S. Pat. No. 4,816,567 and Morrisonet otides are provided in a Supplemented media. An alternative al., Proc. Natl. Acad. Sci. USA, 81:6851-6855 (1984)). to supplementing the media is to introduce an intact DHFR or (0171 The disclosed monoclonal antibodies can be made TK gene into cells lacking the respective genes, thus altering using any procedure which produces mono clonal antibodies. their growth requirements. Individual cells which were not For example, disclosed monoclonal antibodies can be pre transformed with the DHFR or TK gene will not be capable of pared using hybridoma methods, such as those described by Survival in non-Supplemented media. Kohler and Milstein, Nature, 256:495 (1975). In a hybridoma 0166 The second category is dominant selection which method, amouse or other appropriate host animal is typically refers to a selection scheme used in any cell type and does not immunized with an immunizing agent to elicitlymphocytes require the use of a mutant cell line. These schemes typically that produce or are capable of producing antibodies that will use a drug to arrest growth of a host cell. Those cells which specifically bind to the immunizing agent. Alternatively, the have a novel gene would express a protein conveying drug lymphocytes may be immunized in vitro. resistance and would survive the selection. Examples of Such 0172. The monoclonal antibodies may also be made by dominant selection use the drugs neomycin, (Southern P. and recombinant DNA methods, such as those described in U.S. Berg, P. J. Molec. Appl. Genet. 1:327 (1982)), mycophenolic Pat. No. 4,816,567 (Cabilly et al.). DNA encoding the dis acid, (Mulligan, R. C. and Berg, P. Science 209: 1422 (1980)) closed monoclonal antibodies can be readily isolated and or hygromycin, (Sugden, B. et al., Mol. Cell. Biol. 5: 410-413 sequenced using conventional procedures (e.g., by using oli (1985)). The three examples employ bacterial genes under gonucleotide probes that are capable of binding specifically eukaryotic control to convey resistance to the appropriate to genes encoding the heavy and light chains of murine anti drug G418 or neomycin (geneticin), Xgpt (mycophenolic bodies). Libraries of antibodies or active antibody fragments acid) or hygromycin, respectively. Others include the neomy can also be generated and screened using phage display tech cin analog G418 and puramycin. niques, e.g., as described in U.S. Pat. No. 5,804,440 to Burton (0167 5. Antibodies et al. and U.S. Pat. No. 6,096,441 to Barbas et al. (0168 (1) Antibodies Generally 0173. In vitro methods are also suitable for preparing (0169. The term “antibodies' is used herein in a broad monovalent antibodies. Digestion of antibodies to produce sense and includes both polyclonal and monoclonal antibod fragments thereof, particularly, Fab fragments, can be accom ies. In addition to intact immunoglobulin molecules, also plished using routine techniques known in the art. For included in the term “antibodies' are fragments or polymers instance, digestion can be performed using papain. Examples of those immunoglobulin molecules, and human or human of papain digestion are described in WO94/29348 published ized versions of immunoglobulin molecules or fragments Dec. 22, 1994 and U.S. Pat. No. 4.342,566. Papain digestion thereof, as long as they are chosen for their ability to interact of antibodies typically produces two identical antigen bind US 2012/01 14670 A1 May 10, 2012 ing fragments, called Fab fragments, each with a single anti chimeric antibody or antibody chain (or a fragment thereof, genbinding site, and a residual Fc fragment. Pepsin treatment such as an Fv, Fab, Fab', or other antigen-binding portion of yields a fragment that has two antigen combining sites and is an antibody) which contains a portion of an antigen binding still capable of cross-linking antigen. site from a non-human (donor) antibody integrated into the 0.174. The fragments, whether attached to other sequences framework of a human (recipient) antibody. or not, can also include insertions, deletions, Substitutions, or 0181. To generate a humanized antibody, residues from other selected modifications of particular regions or specific one or more complementarity determining regions (CDRs) of amino acids residues, provided the activity of the antibody or a recipient (human) antibody molecule are replaced by resi antibody fragment is not significantly altered or impaired dues from one or more CDRs of a donor (non-human) anti compared to the non-modified antibody or antibody frag body molecule that is known to have desired antigen binding ment. These modifications can provide for Some additional characteristics (e.g., a certain level of specificity and affinity property, Such as to remove/add amino acids capable of dis for the target antigen). In some instances, FV framework (FR) ulfide bonding, to increase its bio-longevity, to alter its secre residues of the human antibody are replaced by correspond tory characteristics, etc. In any case, the antibody orantibody ing non-human residues. Humanized antibodies may also fragment must possess a bioactive property, Such as specific contain residues which are found neither in the recipient binding to its cognate antigen. Functional or active regions of antibody nor in the imported CDR or framework sequences. the antibody or antibody fragment may be identified by Generally, a humanized antibody has one or more amino acid mutagenesis of a specific region of the protein, followed by residues introduced into it from a source which is non-human. expression and testing of the expressed polypeptide. Such In practice, humanized antibodies are typically human anti methods are readily apparent to a skilled practitioner in the art bodies in which some CDR residues and possibly some FR and can include site-specific mutagenesis of the nucleic acid residues are substituted by residues from analogous sites in encoding the antibody or antibody fragment. (Zoller, M. J. rodent antibodies. Humanized antibodies generally contain at Curr. Opin. Biotechnol. 3:348-354, 1992). least a portion of an antibody constant region (Fc), typically (0175. As used herein, the term “antibody” or “antibodies” that of a human antibody (Jones et al., Nature, 321:522-525 can also refer to a human antibody and/or a humanized anti (1986), Reichmann et al., Nature, 332:323-327 (1988), and body. Many non-human antibodies (e.g., those derived from Presta, Curr. Opin. Struct. Biol. 2:593-596 (1992)). mice, rats, or rabbits) are naturally antigenic in humans, and 0182 Methods for humanizing non-human antibodies are thus can give rise to undesirable immune responses when well known in the art. For example, humanized antibodies can administered to humans. Therefore, the use of human or be generated according to the methods of Winter and co humanized antibodies in the methods serves to lessen the workers (Jones et al., Nature, 321:522-525 (1986), Riech chance that an antibody administered to a human will evoke mann et al., Nature, 332:323-327 (1988), Verhoeyen et al., an undesirable immune response. Science, 239:1534-1536 (1988)), by substituting rodent (0176 (2) Human Antibodies CDRs or CDR sequences for the corresponding sequences of 0177. The disclosed human antibodies can be prepared a human antibody. Methods that can be used to produce using any technique. Examples of techniques for human humanized antibodies are also described in U.S. Pat. No. monoclonal antibody production include those described by 4,816,567 (Cabilly et al.), U.S. Pat. No. 5,565,332 (Hoogen Cole et al. (Monoclonal Antibodies and Cancer Therapy, Alan boom et al.), U.S. Pat. No. 5,721,367 (Kay et al.), U.S. Pat. R. Liss, p. 77, 1985) and by Boerner et al. (J. Immunol. No. 5,837.243 (Deo et al.), U.S. Pat. No. 5,939,598 147(1):86-95, 1991). Human antibodies (and fragments (Kucherlapati et al.), U.S. Pat. No. 6,130,364 (Jakobovits et thereof) can also be produced using phage display libraries al.), and U.S. Pat. No. 6,180.377 (Morgan et al.). (Hoogenboom et al., J. Mol. Biol., 227:381, 1991; Marks et 0183 (4) Administration of Antibodies al., J. Mol. Biol., 222:581, 1991). 0.184 Administration of the antibodies can be done as 0178. The disclosed human antibodies can also be disclosed herein. Nucleic acid approaches for antibody deliv obtained from transgenic animals. For example, transgenic, ery also exist. The broadly neutralizing anti Abat, Abca1, mutant mice that are capable of producing a full repertoire of Ank, Ankrd1, Arhgap24. Atp8al, Bbs7, Bex 1, Ccl9, Centa3. human antibodies, in response to immunization, have been Chst1, Ckmt1, Col9a3, Cpz, Cxcl1, Cxcl15, Dafl, Dapk1. described (see, e.g., Jakobovits et al., Proc. Natl. Acad. Sci. Dffb, Dgka, Dixdc, Dusp15, Elav 12, Eno3, Ephb2, Espin, USA, 90:2551-255 (1993); Jakobovits et al., Nature, 362: Eval, Fas, F2r11, Fgf18, Fgf7, Fhod3, FHOS2, Garn13, Gca, 255-258 (1993); Bruggermann et al., Year in Immunol. 7:33 Gpr149, Hbegf, Hey2, Hmgal, Hmga2, Hoxc13, Id2, Ida, (1993)). Specifically, the homozygous deletion of the anti Igfbp2, Igsf4a, Jag2. Kctd 15, Lass4, Ldhb, Man2b1, Mcam, body heavy chain joining region (J(H)) gene in these chimeric Mmp15, Mpp7, Mrpl15, Mrpplf4, Ms4all0, Mtus1, Nbea, and germ-line mutant mice results in complete inhibition of Notch3, Noxa, Oaf, Parvb, Pardóg, Perp, Plac8, P1a2g7, endogenous antibody production, and the Successful transfer Pitx2, Pltp, Plxdc2, Prkcm, Prkg, Prss22, Pvr14, Rab40b, of the human germ-line antibody gene array into Such germ Rai2. Rasl 11a, Rb1, Rgs2, Rprm, Rspo3, Satb1, Sbk1, SbSn, line mutant mice results in the production of human antibod Scn3b, Sema3d, Sema7a, Serpinb2, Sfrp2, Slc14al, Slc27a3, ies upon antigen challenge. Antibodies having the desired Sms, Sod3, Stimna, Tex15, Tnfrsfl8, Tnnt2, Unc45b, Wnt9a, activity are selected using Env-CD4-co-receptor complexes Zac1, and Zfp385 antibodies and antibody fragments can also as described herein. be administered to patients or Subjects as a nucleic acid prepa (0179 (3) Humanized Antibodies ration (e.g., DNA or RNA) that encodes the antibody or 0180 Antibody humanization techniques generally antibody fragment, such that the patient's or Subject's own involve the use of recombinant DNA technology to manipu cells take up the nucleic acid and produce and secrete the late the DNA sequence encoding one or more polypeptide encoded antibody or antibody fragment. The delivery of the chains of an antibody molecule. Accordingly, a humanized nucleic acid can be by any means, as disclosed herein, for form of a non-human antibody (or a fragment thereof) is a example. US 2012/01 14670 A1 May 10, 2012 24
0185. 6. Pharmaceutical Carriers/Delivery of Pharamceu technology to target specific proteins to tumor tissue (Hughes tical Products et al., Cancer Research, 49:6214-6220, (1989); and Litzinger 0186. As described above, the compositions can also be and Huang, Biochimica et Biophysica Acta, 1104:179-187, administered in Vivo in a pharmaceutically acceptable carrier. (1992)). In general, receptors are involved in pathways of By “pharmaceutically acceptable' is meant a material that is endocytosis, either constitutive or ligand induced. These not biologically or otherwise undesirable, i.e., the material receptors cluster in clathrin-coated pits, enter the cell via may be administered to a subject, along with the nucleic acid clathrin-coated vesicles, pass through an acidified endoSome or vector, without causing any undesirable biological effects in which the receptors are sorted, and then either recycle to the or interacting in a deleterious manner with any of the other cell Surface, become stored intracellularly, or are degraded in components of the pharmaceutical composition in which it is lysosomes. The internalization pathways serve a variety of contained. The carrier would naturally be selected to mini functions, such as nutrient uptake, removal of activated pro mize any degradation of the active ingredient and to minimize teins, clearance of macromolecules, opportunistic entry of any adverse side effects in the subject, as would be well viruses and toxins, dissociation and degradation of ligand, known to one of skill in the art. and receptor-level regulation. Many receptors follow more 0187. The compositions may be administered orally, than one intracellular pathway, depending on the cell type, parenterally (e.g., intravenously), by intramuscular injection, receptor concentration, type of ligand, ligand Valency, and by intraperitoneal injection, transdermally, extracorporeally, ligand concentration. Molecular and cellular mechanisms of topically or the like, including topical intranasal administra receptor-mediated endocytosis has been reviewed (Brown tion or administration by inhalant. As used herein, “topical and Greene, DNA and Cell Biology 10:6,399-409 (1991)). intranasal administration” means delivery of the composi 0.190 a) Pharmaceutically Acceptable Carriers tions into the nose and nasal passages through one or both of 0191 The compositions, including antibodies, can be the nares and can comprise delivery by a spraying mechanism used therapeutically in combination with a pharmaceutically or droplet mechanism, or through aerosolization of the acceptable carrier. nucleic acid or vector. Administration of the compositions by 0.192 Suitable carriers and their formulations are inhalant can be through the nose or mouth via delivery by a described in Remington: The Science and Practice of Phar spraying or droplet mechanism. Delivery can also be directly macy (19th ed.) ed. A. R. Gennaro, Mack Publishing Com to any area of the respiratory system (e.g., lungs) via intuba pany, Easton, Pa. 1995. Typically, an appropriate amount of a tion. The exact amount of the compositions required will vary pharmaceutically-acceptable salt is used in the formulation to from Subject to Subject, depending on the species, age, Weight render the formulation isotonic. Examples of the pharmaceu and general condition of the subject, the severity of the aller tically-acceptable carrier include, but are not limited to, gic disorder being treated, the particular nucleic acidor vector saline, Ringer's solution and dextrose solution. The pH of the used, its mode of administration and the like. Thus, it is not solution is preferably from about 5 to about 8, and more possible to specify an exact amount for every composition. preferably from about 7 to about 7.5. Further carriers include However, an appropriate amount can be determined by one of Sustained release preparations such as semipermeable matri ordinary skill in the art using only routine experimentation ces of Solid hydrophobic polymers containing the antibody, given the teachings herein. which matrices are in the form of shaped articles, e.g., films, 0188 Parenteral administration of the composition, if liposomes or microparticles. It will be apparent to those per used, is generally characterized by injection. Injectables can Sons skilled in the art that certain carriers may be more pref be prepared in conventional forms, either as liquid solutions erable depending upon, for instance, the route of administra or Suspensions, Solid forms Suitable for Solution of Suspen tion and concentration of composition being administered. sion in liquid prior to injection, or as emulsions. A more 0193 Pharmaceutical carriers are known to those skilled recently revised approach for parenteral administration in the art. These most typically would be standard carriers for involves use of a slow release or Sustained release system Such administration of drugs to humans, including Solutions such that a constant dosage is maintained. See, e.g., U.S. Pat. No. as sterile water, saline, and buffered solutions at physiological 3,610,795, which is incorporated by reference herein. pH. The compositions can be administered intramuscularly or 0189 The materials may be in solution, suspension (for subcutaneously. Other compounds will be administered example, incorporated into microparticles, liposomes, or according to standard procedures used by those skilled in the cells). These may be targeted to a particular cell type via art antibodies, receptors, or receptor ligands. The following ref 0194 Pharmaceutical compositions may include carriers, erences are examples of the use of this technology to target thickeners, diluents, buffers, preservatives, Surface active specific proteins to tumor tissue (Senter, et al., Bioconjugate agents and the like in addition to the molecule of choice. Chem. 2:447-451, (1991); Bagshawe, K. D., Br. J. Cancer, Pharmaceutical compositions may also include one or more 60:275-281, (1989); Bagshawe, et al., Br. J. Cancer, 58:700 active ingredients such as antimicrobial agents, antiinflam 703, (1988); Senter, et al., Bioconjugate Chem., 4:3-9, matory agents, anesthetics, and the like. (1993); Battelli, et al., Cancer Immunol. Immunother. 0.195 The pharmaceutical composition may be adminis 35:421-425, (1992); Pietersz and McKenzie, Immunolog. tered in a number of ways depending on whether local or Reviews, 129:57-80, (1992); and Roffler, et al., Biochem. systemic treatment is desired, and on the area to be treated. Pharmacol, 42:2062-2065, (1991)). Vehicles such as Administration may be topically (including ophthalmically, 'stealth' and other antibody conjugated liposomes (including vaginally, rectally, intranasally), orally, by inhalation, or lipid mediated drug targeting to colonic carcinoma), receptor parenterally, for example by intravenous drip, Subcutaneous, mediated targeting of DNA through cell specific ligands, intraperitoneal or intramuscular injection. The disclosed anti lymphocyte directed tumor targeting, and highly specific bodies can be administered intravenously, intraperitoneally, therapeutic retroviraltargeting of murine glioma cells in vivo. intramuscularly, Subcutaneously, intracavity, or transder The following references are examples of the use of this mally. US 2012/01 14670 A1 May 10, 2012
0196. Preparations for parenteral administration include used alone might range from about 1 ug/kg to up to 100 mg/kg sterile aqueous or non-aqueous solutions, Suspensions, and of body weight or more per day, depending on the factors emulsions. Examples of non-aqueous solvents are propylene mentioned above. glycol, polyethylene glycol, vegetable oils such as olive oil, 0202 Following administration of a disclosed composi and injectable organic esters such as ethyl oleate. Aqueous tion, Such as an antibody, for treating, inhibiting, or prevent carriers include water, alcoholic/aqueous Solutions, emul ing a cancer, the efficacy of the therapeutic antibody can be sions or Suspensions, including saline and buffered media. assessed in various ways well known to the skilled practitio Parenteral vehicles include sodium chloride solution, Ring ner. For instance, one of ordinary skill in the art will under er's dextrose, dextrose and sodium chloride, lactated Ring stand that a composition, such as an antibody, disclosed er's, or fixed oils. Intravenous vehicles include fluid and nutri herein is efficacious in treating or inhibiting a cancer in a ent replenishers, electrolyte replenishers (such as those based Subject by observing that the composition reduces tumor size or prevents a further increase in other indicators of tumor on Ringer's dextrose), and the like. Preservatives and other Survival or growth including but not limited to neoplastic cell additives may also be present such as, for example, antimi transformation in vitro, in vitro cell death, in vivo cell death, crobials, anti-oxidants, chelating agents, and inert gases and in vitro angiogenesis, in vivo tumorangiogenesis, tumor for the like. mation, tumor maintenance, or tumor proliferation or further 0.197 Formulations for topical administration may decrease in in vitro or in vivo survival. include ointments, lotions, creams, gels, drops, Suppositories, 0203 The compositions that inhibit Abat, Abca1, Ank, sprays, liquids and powders. Conventional pharmaceutical Ankrd1, Arhgap24. Atp8a1. Bbs7, Bex 1, Ccl9, Centa3. carriers, aqueous, powder or oily bases, thickeners and the Chst1, Ckmt1, Col9a3, Cpz, Cxcl1, Cxcl15, Dafl, Dapk1. like may be necessary or desirable. Dffb, Dgka, Dixdc, Dusp15, Elav 12, Eno3, Ephb2, Espin, 0198 Compositions for oral administration include pow Eval, Fas, F2r11, Fgf18, Fgf7, Fhod3, FHOS2, Garn13, Gca, ders or granules, Suspensions or Solutions in water or non Gpr149, Hbegf, Hey2, Hmgal, Hmga2, Hoxc13, Id2, Ida, aqueous media, capsules, Sachets, or tablets. Thickeners, fla Igfbp2, Igsf4a, Jag2. Kctd 15, Lass4, Ldhb, Man2b1, Mcam, Vorings, diluents, emulsifiers, dispersing aids or binders may Mmp15, Mpp7, Mrpl15, Mrpplf4, Ms4all0, Mtus1, Nbea, be desirable. Notch3, Noxa, Oaf, Parvb, Pardóg, Perp, Plac8, P1a2g7, Pitx2, Pltp, Plxdc2, Prkcm, Prkg, Prss22, Pyr14, Rab40b, 0199 Some of the compositions may potentially be Rai2. Rasl 11a, Rb1, Rgs2, Rprm, Rspo3, Satb1, Sbk1, SbSn, administered as a pharmaceutically acceptable acid- or base Scn3b, Sema3d, Sema7a, Serpinb2, Sfrp2, Slc14al, Slc27a3, addition salt, formed by reaction with inorganic acids such as Sms, Sod3, Stimna, Tex15, Tnfrsfl8, Tnnt2, Unc45b, Wnt9a, hydrochloric acid, hydrobromic acid, perchloric acid, nitric Zac1, and Zfp385 interactions disclosed herein may be acid, thiocyanic acid, Sulfuric acid, and phosphoric acid, and administered prophylactically to patients or Subjects who are organic acids such as formic acid, acetic acid, propionic acid, at risk for a cancer. glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic 0204. Other molecules that interact with Abat, Abcal, acid, Succinic acid, maleic acid, and fumaric acid, or by Ank, Ankrd1, Arhgap24. Atp8al, Bbs7, Bex 1, Ccl9, Centa3. reaction with an inorganic base Such as Sodium hydroxide, Chst1, Ckmt1, Col9a3, Cpz, Cxcl1, Cxcl15, Dafl, Dapk1. ammonium hydroxide, potassium hydroxide, and organic Dffb, Dgka, Dixdc, Dusp15, Elav 12, Eno3, Ephb2, Espin, bases such as mono-, di-, trialkyl and arylamines and Substi Eval, Fas, F2r11, Fgf18, Fgf7, Fhod3, FHOS2, Garn13, Gca, tuted ethanolamines Gpr149, Hbegf, Hey2, Hmgal, Hmga2, Hoxc13, Id2, Ida, 0200 b) Therapeutic Uses Igfbp2, Igsf4a, Jag2. Kctd 15, Lass4, Ldhb, Man2b1, Mcam, 0201 Effective dosages and schedules for administering Mmp15, Mpp7, Mrpl15, Mrpplf4, Ms4all0, Mtus1, Nbea, the compositions may be determined empirically, and making Notch3, Noxa, Oaf, Parvb, Pardóg, Perp, Plac8, Pla2g7, such determinations is within the skill in the art. The dosage Pitx2, Pltp, Plxdc2, Prkcm, Prkg, Prss22, Pyr14, Rab40b, ranges for the administration of the compositions are those Rai2. Rasl 11a, Rb1, Rgs2, Rprm, Rspo3, Satb1, Sbk1, SbSn, large enough to produce the desired effect in which the Symp Scn3b, Sema3d, Sema7a, Serpinb2, Sfrp2, Slc14al, Slc27a3, toms/disorder are/is effected. The dosage should not be so Sms, Sod3, Stimna, Tex15, Tnfrsfl8, Tnnt2, Unc45b, Wnt9a, large as to cause adverse side effects. Such as unwanted cross Zac1, and Zfp385 which do not have a specific pharmacueti reactions, anaphylactic reactions, and the like. Generally, the cal function, but which may be used for tracking changes dosage will vary with the age, condition, sex and extent of the within cellular chromosomes or for the delivery of diagnositic disease in the patient, route of administration, or whether tools for example can be delivered in ways similar to those other drugs are included in the regimen, and can be deter described for the pharmaceutical products. mined by one of skill in the art. The dosage can be adjusted by 0205 The disclosed compositions and methods can also the individual physician in the event of any counterindica be used for example as tools to isolate and test new drug tions. Dosage can vary, and can be administered in one or candidates for various cancers including but not limited to more dose administrations daily, for one or several days. lymphoma, B cell lymphoma, T cell lymphoma, mycosis Guidance can be found in the literature for appropriate dos fungoides, Hodgkin's Disease, leukemias, myeloid leukemia, ages for given classes of pharmaceutical products. For bladder cancer, brain cancer, nervous system cancer, head and example, guidance in selecting appropriate doses for antibod neck cancer, squamous cell carcinoma of head and neck, lung ies can be found in the literature on therapeutic uses of anti cancers such as Small cell lung cancer and non-small cell lung bodies, e.g., Handbook of Monoclonal Antibodies, Ferrone et cancer, neuroblastoma/glioblastoma, ovarian cancer, pancre al., eds., Noges Publications, Park Ridge, N.J., (1985) ch. 22 atic cancer, prostate cancer, skin cancer, liver cancer, mela and pp. 303-357; Smith et al., Antibodies in Human Diagno noma, squamous cell carcinomas of the mouth, throat, larynx, sis and Therapy, Haber et al., eds., Raven Press, New York and lung, gastric cancer, colon cancer, cervical cancer, cervi (1977) pp. 365-389. A typical daily dosage of the antibody cal carcinoma, breast cancer, and epithelial cancer, bone can US 2012/01 14670 A1 May 10, 2012 26 cers, renal cancer, bladder cancer, genitourinary cancer, 0213. It is understood that the disclosed methods for iden esophageal carcinoma, large bowel cancer, metastatic can tifying molecules that inhibit the interactions of for example, cers hematopoietic cancers, sarcomas, Ewing's sarcoma, Syn Abat, Abca1, Ank, Ankrd1, Arhgap24. Atp8al, Bbs7, Bex 1, ovial cancer, Soft tissue cancers; and testicular cancer. Ccl9, Centd3, Chst1, Ckmt1, Col9a3, Cpz, Cxcl1, Cxcl15, 0206 7. Chips and Micro Arrays Daf1, Dapk1, Dffb, Dgka, Dixdc, Dusp15, Elav 12, Eno3, 0207 Disclosed are chips where at least one address is the Ephb2, Espin, Eval, Fas, F2r11, Fgf18, Fgf7, Fhod3, FHOS2, sequences or part of the sequences set forth in any of the Garn13, Gca, Gpr149, Hbegf, Hey2, Hmgal, Hmga2. nucleic acid sequences disclosed herein. Also disclosed are Hoxc13, Id2, Ida, Igfbp2, Igsf4a, Jag2. Kctd 15, Lass4, Ldhb. chips where at least one address is the sequences orportion of Man2b1, Mcam, Mmp15, Mpp7, Mrpl15, Mrpplif4, Ms4al.0, sequences set forth in any of the peptide sequences disclosed Mtus 1,Nbea, Notch3, Noxa, Oaf, Parvb, Pardóg, Perp, Plac8, herein. Pla2g7, Pitx2, Pltp, Plxdc2, Prkcm, Prkg, Prss22, Pyr14, 0208 Also disclosed are chips where at least one address Rab40b, Rai2. Rasl 11a, Rb1, Rgs2, Rprm, Rspo3, Satb1, is a variant of the sequences or part of the sequences set forth Sbk1, SbSn, Scn3b, Sema3d, Sema7a, Serpinb2, Sfrp2. in any of the nucleic acid sequences disclosed herein. Also Slc14a1, Slc27a3, Sms, Sod3, Stimna, Tex 15, Tnfrsfl8, disclosed are chips where at least one address is a variant of Tnnt2, Unc45b, Wnt 9a, Zac1, and Zfp385 can be performed the sequences or portion of sequences set forth in any of the using high through put means. For example, putative inhibi peptide sequences disclosed herein. tors can be identified using Fluorescence Resonance Energy Transfer (FRET) to quickly identify interactions. The under 0209 8. Compositions Identified by Screening with Dis lying theory of the techniques is that when two molecules are closed Compositions/Combinatorial Chemistry close in space, ie, interacting at a level beyond background, a 0210 a) Combinatorial Chemistry signal is produced or a signal can bequenched. Then, a variety 0211. The disclosed compositions can be used as targets of experiments can be performed, including, for example, for any combinatorial technique to identify molecules or adding in a putative inhibitor. If the inhibitor competes with macromolecular molecules that interact with the disclosed the interaction between the two signaling molecules, the sig compositions in a desired way. Also disclosed are the com nals will be removed from each other in space, and this will positions that are identified through combinatorial techniques cause a decrease oran increase in the signal, depending on the or screening techniques in which the compositions disclosed type of signal used. This decrease or increasing signal can be in Table 1 or portions thereof, are used as the target in a correlated to the presence or absence of the putative inhibitor. combinatorial or screening protocol. Any signaling means can be used. For example, disclosed are 0212. It is understood that when using the disclosed com methods of identifying an inhibitor of the interaction between positions in combinatorial techniques or screening methods, any two of the disclosed molecules comprising, contacting a molecules, such as macromolecular molecules, will be iden first molecule and a second molecule together in the presence tified that have particular desired properties such as inhibition of a putative inhibitor, wherein the first molecule or second or stimulation or the target molecule's function. The mol molecule comprises a fluorescence donor, wherein the first or ecules identified and isolated when using the disclosed com second molecule, typically the molecule not comprising the positions, such as, Abat, Abcal, Ank, Ankrdl, Arhgap24. donor, comprises a fluorescence acceptor, and measuring Atp8al, Bbs7, Bex1, Ccl9, Centd3, Chst1, Ckmt1, Col9a3, Fluorescence Resonance Energy Transfer (FRET), in the Cpz, Cxcl1, Cxcl15, Daf1, Dapk1, Dfb, Dgka, Dixdc, presence of the putative inhibitor and the in absence of the Dusp15, Elav 12, Eno3, Ephb2, Espin, Eval, Fas, F2r 11, putative inhibitor, wherein a decrease in FRET in the pres Fgf18, Fgf7, Fhod3, FHOS2, Garn13, Gca, Gpr149, Hbegf. ence of the putative inhibitor as compared to FRET measure Hey2, Hmgal, Hmga2, Hoxc13, Id2, Ida, Igfbp2, Igsf4a, ment in its absence indicates the putative inhibitor inhibits Jag2. Kctd 15, Lass4, Ldhb, Man2b1, Mcam, Mmp15, Mpp7. binding between the two molecules. This type of method can Mrpl15, Mrpplif4, Ms4all0, Mtus1, Nbea, Notch3, Noxa, Oaf, be performed with a cell system as well. Parvb, Pardóg, Perp, Plac8, Pla2g7, Pitx2, Pltp, Plxdc2, 0214 Combinatorial chemistry includes but is not limited Prkcm, Prkg, Prss22, Pyr14, Rab40b, Rai2, Rasl 11a, Rb1, to all methods for isolating Small molecules or macromol RgS2, Rprm, Rspo3, Satb1, Sbk1, SbSn, Scn3b, Sema3d, ecules that are capable of binding either a small molecule or Sema7a, Serpinb2, Sfrp2, Slc14al, Slc27a3, Sms, Sod3, another macromolecule, typically in an iterative process. Pro Stmn4, Tex 15, Tnfrsf18, Tnnt2, Unc45b, Wnt 9a, Zac1, and teins, oligonucleotides, and Sugars are examples of macro Zfp385, are also disclosed. Thus, the products produced using molecules. For example, oligonucleotide molecules with a the combinatorial or screening approaches that involve the given function, catalytic or ligand-binding, can be isolated disclosed compositions, such as, Abat, Abcal, Ank, Ankrdl, from a complex mixture of random oligonucleotides in what Arhgap24. Atp8al, Bbs7, Bex 1, Ccl9, Centa3, Chst1, Ckmt1, has been referred to as “in vitrogenetics’ (Szostak, TIBS19: Col9a3, Cpz, Cxcl1, Cxcl15, Daf1, Dapk1, Dfb, Dgka, 89, 1992). One synthesizes a large pool of molecules bearing Dixdc, Dusp15, Elav 12, Eno3, Ephb2, Espin, Eval, Fas, random and defined sequences and Subjects that complex F2r11, Fgf18, Fgf7, Fhod3, FHOS2, Garn13, Gca, Gpr149, mixture, for example, approximately 1015 individual Hbegf, Hey2, Hmgal, Hmga2, Hoxc13, Id2, Ida, Igfbp2. sequences in 100 ug of a 100 nucleotide RNA, to some selec Igsf4a, Jag2. Kctd 15, Lass4, Ldhb, Man2b1, Mcam, Mmp15, tion and enrichment process. Through repeated cycles of Mpp7, Mrpl15, Mrpplif4, Ms4all0, Mtus 1, Nbea, Notch3, affinity chromatography and PCR amplification of the mol Noxa, Oaf, Parvb, Pardóg, Perp, Plac8, P1a2g7, Pitx2, Pltp, ecules bound to the ligand on the column, Ellington and Plxdc2, Prkcm, Prkg, Prss22, Pyr14, Rab40b, Rai2. Rasl 11a, Szostak (1990) estimated that 1 in 1010 RNA molecules Rb1, RgS2, Rprm, Rspo3, Satb1, Sbk1, SbSn, Scn3b, folded in such a way as to bind a small molecule dyes. DNA Sema3d, Sema7a, Serpinb2, Sfrp2, Slc14a1, Slc27a3, Sms, molecules with Such ligand-binding behavior have been iso Sod3, Stimna, Tex15, Tnfrsfl8, Tnnt2, Unc45b, Wnt9a, Zac1, lated as well (Ellington and Szostak, 1992; Bocket al., 1992). and Zfp385, are also considered herein disclosed. Techniques aimed at similar goals exist for Small organic US 2012/01 14670 A1 May 10, 2012 27 molecules, proteins, antibodies and other macromolecules benefit of this type of technology is that the selection is done known to those of skill in the art. Screening sets of molecules in an intracellular environment. The method utilizes a library for a desired activity whether based on small organic libraries, of peptide molecules that attached to an acidic activation oligonucleotides, or antibodies is broadly referred to as com domain. A peptide of choice is attached to a DNA binding binatorial chemistry. Combinatorial techniques are particu domain of a transcriptional activation protein, Such as Gal 4. larly Suited for defining binding interactions between mol By performing the Two-hybrid technique on this type of ecules and for isolating molecules that have a specific binding system, molecules that bind the extracellular portion of the activity, often called aptamers when the macromolecules are protein from which the peptide was derived can be identified. nucleic acids. 0218 Using methodology well known to those of skill in 0215. There are a number of methods for isolating proteins the art, in combination with various combinatorial libraries, which either have de novo activity or a modified activity. For one can isolate and characterize those Small molecules or example, phage display libraries have been used to isolate macromolecules, which bind to or interact with the desired numerous peptides that interact with a specific target. (See for target. The relative binding affinity of these compounds can example, U.S. Pat. Nos. 6,031,071; 5,824,520; 5,596,079; be compared and optimum compounds identified using com and 5.565,332 which are herein incorporated by reference at petitive binding studies, which are well known to those of least for their material related to phage display and methods skill in the art. relate to combinatorial chemistry) 0219 Techniques for making combinatorial libraries and 0216 A preferred method for isolating proteins that have a screening combinatorial libraries to isolate molecules which given function is described by Roberts and Szostak (Roberts binda desired target are well known to those of skill in the art. R. W. and Szostak J. W. Proc. Natl. Acad. Sci. USA, 94(23) Representative techniques and methods can be found in but 12997-302 (1997). This combinatorial chemistry method are not limited to U.S. Pat. Nos. 5,084,824, 5,288,514, 5,449, couples the functional power of proteins and the genetic 754, 5,506,337, 5,539,083, 5,545,568, 5,556,762, 5,565,324, power of nucleic acids. An RNA molecule is generated in 5,565,332, 5,573,905, 5,618,825, 5,619,680, 5,627,210, which a puromycin molecule is covalently attached to the 5,646,285, 5,663,046, 5,670,326, 5,677, 195, 5,683,899, 3'-end of the RNA molecule. An in vitro translation of this 5,688,696, 5,688,997, 5,698,685, 5,712,146, 5,721,099, modified RNA molecule causes the correct protein, encoded 5,723,598, 5,741,713, 5,792,431, 5,807,683, 5,807,754, by the RNA to be translated. In addition, because of the 5,821,130, 5,831,014, 5,834,195, 5,834,318, 5,834,588, attachment of the puromycin, a peptidyl acceptor which can 5,840,500, 5,847,150, 5,856,107, 5,856,496, 5,859,190, not be extended, the growing peptide chain is attached to the 5,864,010, 5,874.443, 5,877,214, 5,880,972, 5,886,126, puromycin which is attached to the RNA. Thus, the protein 5,886,127, 5,891,737, 5,916,899, 5,919,955, 5,925,527, molecule is attached to the genetic material that encodes it. 5,939,268, 5,942,387, 5,945,070, 5,948,696, 5,958,702, Normal in vitro selection procedures can now be done to 5,958,792, 5,962,337, 5,965,719, 5,972,719, 5,976,894, isolate functional peptides. Once the selection procedure for 5,980,704, 5,985,356, 5,999,086, 6,001,579, 6,004,617, peptide function is complete traditional nucleic acid manipu 6,008,321, 6,017,768, 6,025,371, 6,030,917, 6,040,193, lation procedures are performed to amplify the nucleic acid 6,045,671, 6,045,755, 6,060,596, and 6,061,636. that codes for the selected functional peptides. After amplifi 0220 Combinatorial libraries can be made from a wide cation of the genetic material, new RNA is transcribed with array of molecules using a number of different synthetic puromycin at the 3'-end, new peptide is translated and another techniques. For example, libraries containing fused 2.4-pyri functional round of selection is performed. Thus, protein midinediones (U.S. Pat. No. 6,025,371) dihydrobenzopyrans selection can be performed in an iterative manner just like (U.S. Pat. Nos. 6,017,768 and 5,821,130), amide alcohols nucleic acid selection techniques. The peptide which is trans (U.S. Pat. No. 5,976,894), hydroxy-amino acid amides (U.S. lated is controlled by the sequence of the RNA attached to the Pat. No. 5,972,719) carbohydrates (U.S. Pat. No. 5,965,719), puromycin. This sequence can be anything from a random 1,4-benzodiazepin-2,5-diones (U.S. Pat. No. 5,962.337), sequence engineered for optimum translation (i.e. no stop cyclics (U.S. Pat. No. 5,958,792), biarylamino acid amides codons etc.) or it can be a degenerate sequence of a known (U.S. Pat. No. 5.948,696), thiophenes (U.S. Pat. No. 5,942, RNA molecule to look for improved or altered function of a 387), tricyclic Tetrahydroquinolines (U.S. Pat. No. 5,925, known peptide. The conditions for nucleic acid amplification 527), benzofurans (U.S. Pat. No. 5,919,955), isoquinolines and in vitro translation are well known to those of ordinary (U.S. Pat. No. 5,916,899), hydantoin and thiohydantoin (U.S. skill in the art and are preferably performed as in Roberts and Pat. No. 5,859,190), indoles (U.S. Pat. No. 5,856,496), imi Szostak (Roberts R. W. and Szostak J. W. Proc. Natl. Acad. dazol-pyrido-indole and imidazol-pyrido-benzothiophenes Sci. USA, 94(23) 12997-302 (1997)). (U.S. Pat. No. 5,856.107) substituted 2-methylene-2,3-dihy 0217. Another preferred method for combinatorial meth drothiazoles (U.S. Pat. No. 5,847,150), quinolines (U.S. Pat. ods designed to isolate peptides is described in Cohen et al. No. 5,840,500), PNA (U.S. Pat. No. 5,831,014), containing (Cohen B. A., et al., Proc. Natl. Acad. Sci. USA 95(24): tags (U.S. Pat. No. 5,721,099), polyketides (U.S. Pat. No. 14272-7 (1998). This method utilizes and modifies two-hy 5,712,146), morpholino-subunits (U.S. Pat. Nos. 5,698,685 brid technology. Yeast two-hybrid systems are useful for the and 5,506,337), sulfamides (U.S. Pat. No. 5,618,825), and detection and analysis of protein-protein interactions. The benzodiazepines (U.S. Pat. No. 5.288,514). two-hybrid system, initially described in the yeast Saccharo 0221. As used herein combinatorial methods and libraries myces cerevisiae, is a powerful molecular genetic technique included traditional Screening methods and libraries as well for identifying new regulatory molecules, specific to the pro as methods and libraries used in interative processes. tein of interest (Fields and Song, Nature 340:245-6 (1989)). 0222 b) Computer Assisted Drug Design Cohen et al., modified this technology so that novel interac 0223) The disclosed compositions can be used as targets tions between synthetic or engineered peptide sequences for any molecular modeling technique to identify either the could be identified which bind a molecule of choice. The structure of the disclosed compositions or to identify poten US 2012/01 14670 A1 May 10, 2012 28 tial or actual molecules, such as Small molecules, which inter structure. QUANTA allows interactive construction, modifi act in a desired way with the disclosed compositions. The cation, visualization, and analysis of the behavior of mol nucleic acids, peptides, and related molecules disclosed ecules with each other. herein can be used as targets in any molecular modeling 0227. A number of articles review computer modeling of program or approach. drugs interactive with specific proteins, such as Rotivinen, et 0224. It is understood that when using the disclosed com al., 1988 Acta Pharmaceutica Fennica 97, 159-166; Ripka, positions in modeling techniques, molecules, such as macro New Scientist 54-57 (Jun. 16, 1988); McKinally and Ross molecular molecules, will be identified that have particular mann, 1989 Annu. Rev. Pharmacol. Toxiciol. 29, 111-122; desired properties such as inhibition or stimulation or the Perry and Davies, QSAR: Quantitative Structure-Activity target molecule's function. The molecules identified and iso Relationships in Drug Design pp. 189-193 (Alan R. Liss, Inc. lated when using the disclosed compositions, such as, Abat, 1989); Lewis and Dean, 1989 Proc. R. Soc. Lond. 236, 125 Abca1, Ank, Ankrd1, Arhgap24. Atp8al, Bbs7, Bex 1, Ccl9. 140 and 141-162; and, with respect to a model enzyme for Centd3, Chst1, Ckmt1, Col9a3, Cpz, Cxcl1, Cxcl15, Dafl, nucleic acid components, Askew, et al., 1989 J. Am. Chem. Dapk1, Dfb, Dgka, Dixdc, Dusp15, Elav 12, Eno3, Ephb2, Soc. 111, 1082-1090. Other computer programs that screen Espin, Eval, Fas, F2r11, Fgf18, Fgf7, Fhod3, FHOS2, and graphically depict chemicals are available from compa Garn13, Gca, Gpr149, Hbegf, Hey2, Hmgal, Hmga2. nies Such as BioDesign, Inc., Pasadena, Calif., Allelix, Inc. Hoxc13, Id2, Ida, Igfbp2, Igsf4a, Jag2. Kctd 15, Lass4, Ldhb. Mississauga, Ontario, Canada, and Hypercube, Inc., Cam Man2b1, Mcam, Mmp15, Mpp7, Mrpl15, Mrpplif4, Ms4al.0, bridge, Ontario. Although these are primarily designed for Mtus 1,Nbea, Notch3, Noxa, Oaf, Parvb, Pardóg, Perp, Plac8, application to drugs specific to particular proteins, they can be P1a2g7, Pitx2, Pltp, Plxdc2, Prkcm, Prkg, Prss22, Pvr14, adapted to design of molecules specifically interacting with Rab40b, Rai2. Rasl 11a, Rb1, Rgs2, Rprm, Rspo3, Satb1, specific regions of DNA or RNA, once that region is identi Sbk1, SbSn, Scn3b, Sema3d, Sema7a, Serpinb2, Sfrp2. fied. Slc14a1, Slc27a3, Sms, Sod3, Stimna, Tex 15, Tnfrsfl8, 0228. Although described above with reference to design Tnnt2, Unc45b, Wnt 9a, Zac1, and Zfp385, are also disclosed. and generation of compounds which could alter binding, one Thus, the products produced using the molecular modeling could also screen libraries of known compounds, including approaches that involve the disclosed compositions, such as, natural products or synthetic chemicals, and biologically Abat, Abca1, Ank, Ankrd1, Arhgap24. Atp8al, Bbs7, Bex 1, active materials, including proteins, for compounds which Ccl9, Centd3, Chst1, Ckmt1, Col9a3, Cpz, Cxcl1, Cxcl15, alter Substrate binding or enzymatic activity. Daf1, Dapk1. Dfb, Dgka, Dixdc. Dusp15, Elav 12, Eno3, 0229. 9. Kits Ephb2, Espin, Eval, Fas, F2r11, Fgf18, Fgf7, Fhod3, FHOS2, 0230 Disclosed herein are kits that are drawn to reagents Garn13, Gca, Gpr149, Hbegf, Hey2, Hmgal, Hmga2. that can be used in practicing the methods disclosed herein. Hoxc13, Id2, Ida, Igfbp2, Igsf4a, Jag2. Kctd 15, Lass4, Ldhb. The kits can include any reagent or combination of reagent Man2b1, Mcam, Mmp15, Mpp7, Mrpl15, Mrpplif4, Ms4al.0, discussed herein or that would be understood to be required or Mtus 1,Nbea, Notch3, Noxa, Oaf, Parvb, Pardóg, Perp, Plac8, beneficial in the practice of the disclosed methods. For Pla2g7, Pitx2, Pltp, Plxdc2, Prkcm, Prkg, Prss22, Pvr14, example, the kits could include primers to perform the ampli Rab40b, Rai2. Rasl 11a, Rb1, Rgs2, Rprm, Rspo3, Satb1, fication reactions discussed in certain embodiments of the Sbk1, SbSn, Scn3b, Sema3d, Sema7a, Serpinb2, Sfrp2. methods, as well as the buffers and enzymes required to use Slc14a1, Slc27a3, Sms, Sod3, Stimna, Tex 15, Tnfrsfl8, the primers as intended. For example, disclosed is a kit for Tnnt2, Unc45b, Wnt9a, Zac1, and Zfp385, are also consid assessing a subject's risk for acquiring colon cancer, compris ered herein disclosed. ing a panel of cooperation response genes on a microarray or 0225. Thus, one way to isolate molecules that bind a mol protein array. ecule of choice is through rational design. This is achieved 0231. Throughout this application, various publications through structural information and computer modeling. are referenced. The disclosures of these publications in their Computer modeling technology allows visualization of the entireties are hereby incorporated by reference into this appli three-dimensional atomic structure of a selected molecule cation in order to more fully describe the state of the art to and the rational design of new compounds that will interact which this invention pertains. The references disclosed are with the molecule. The three-dimensional construct typically also individually and specifically incorporated by reference depends on data from X-ray crystallographic analyses or herein for the material contained in them that is discussed in NMR imaging of the selected molecule. The molecular the sentence in which the reference is relied upon. dynamics require force field data. The computer graphics 0232. It will be apparent to those skilled in the art that systems enable prediction of how a new compound will link various modifications and variations can be made in the to the target molecule and allow experimental manipulation present invention without departing from the scope or spirit of of the structures of the compound and target molecule to the invention. Other embodiments of the invention will be perfect binding specificity. Prediction of what the molecule apparent to those skilled in the art from consideration of the compound interaction will be when Small changes are made specification and practice of the invention disclosed herein. It in one or both requires molecular mechanics Software and is intended that the specification and examples be considered computationally intensive computers, usually coupled with as exemplary only, with a true scope and spirit of the invention user-friendly, menu-driven interfaces between the molecular being indicated by the following claims. design program and the user. 0226 Examples of molecular modeling systems are the D. EXAMPLES CHARMm and QUANTA programs, Polygen Corporation, 0233. The following examples are put forth so as to pro Waltham, Mass. CHARMm performs the energy minimiza vide those of ordinary skill in the art with a complete disclo tion and molecular dynamics functions. QUANTA performs Sure and description of how the compounds, compositions, the construction, graphic modeling and analysis of molecular articles, devices and/or methods claimed herein are made and US 2012/01 14670 A1 May 10, 2012 29 evaluated, and are intended to be purely exemplary and are identifying intervention targets in gene networks downstream not intended to limit the disclosure. Efforts have been made to of oncogenic gain and loss-of-funtion mutations that underly ensure accuracy with respect to numbers (e.g., amounts, tem malignant cell transformation. perature, etc.), but some errors and deviations should be 0235 Genes regulated synergistically by cooperating accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in C. or is at ambient temperature, oncogenic mutations were identified by comparing mRNA and pressure is at or near atmospheric. expression profiles of young adult murine colon (YAMC) cells (Whitehead, R. H., et al. (1993) Proc Natl AcadSci USA 1. Example 1 90, 587-913) with those of YAMC cells expressing mutant p53175H (mp53), activated H-Ras 12V (Ras) or both mutant Analysis of Synergistic Response to Oncogenic proteins together (mp53/Ras) (Xia, M. & Land, H. (2007) Nat Mutations Pinpoints Genes Essential for Cancer Phe Struct Mol Biol 14, 215-23) using Affymetrix mouse whole notype genome microarrays. Using a step-wise procedure, 538 genes 0234 Recent observations that cell transformation by p53 (represented by 657 probe sets) were identified that were loss-of-function and Ras activation depends on Synergistic differentially expressed in mp53, Ras and mp53/Ras cells, as modulation of downstream signaling circuitry (Xia, M. & compared to YAMC control cells with a statistical cut off at Land, H. (2007) Nat Struct Mol Biol 14, 215-23) suggested p-0.01 (N-test, Westfall-Young adjusted). A further subset of that malignant cell transformation is a highly cooperative 95 annotated genes that respond synergistically (24 up/67 process critically involving synergy at multiple molecular down) to the combination of mutant p53 and Ras proteins, levels. Herein is demonstrated that the malignant state is termed cooperation response genes (CRG) was then deter critically dependent on a cohort of downstream genes con mined using a synergy criterion, as described in methods trolled synergistically by cooperating oncogenic mutations (Table 1). A synergy score of 0.9 or less defines CRGs. such as loss-of-function p53 and Ras activation. Remarkably, Expression values for the CRGs derived from the microarrays 14 among 24 Such cooperation response genes (CRGs) were also showed a strong positive correlation with expression found to contribute strongly to tumor formation in gene per values for the same genes obtained by TaqMan low-density turbation experiments. In contrast, only one in 14 perturba QPCR arrays (TLDA) (Tables 1 and 2). Thus CRG identifi tions of genes responding in a non-synergistic manner had a cation was confirmed by independent methods, with final similar effect. Synergistic control of gene expression by CRG selection based on microarray data, due to higher oncogenic mutations thus provides an attractive strategy for sample replication in this data set.
TABLE 1 Cooperation Response Genes Expression Synergy Expression Synergy mp53/Ras Score, mp53, Ras Score, vs. YAMC, Raw vs. YAMC, Norm GO Biological Raw Data Data, Norm Data Data, Process Gene Symbol GenBank ID Affymetrix ID (fold) p < 0.01 (fold) p < 0.01 Signal Arhgap24 BCO2SSO2 424842 a. at O.O8 O.29 O.O7 O.31 Transduction Cento3 AI851,258 419833 s at 3.64 O.87 3.39 O.83 Dgka BCOO6713 418578 a O.30 0.79 O.28 O.88 Dixoc1 BB7584.32 435.207 a O.38 O.85 O.36 O.93 Dusp15 AF357887 426189 a 0.57 O.84 O.S1 O.89 Ephb2 AV2214O1 425016 a O.15 O.S8 O.14 O.62 F2r NM 007974 1448931 a 2.15 O.93** 2.07 O.82 Fgf18 NM 00800S 1449545 a. O.38 O.89 0.37 O.99i Fgf7 NM 008008. 1422243 a 7.43 O.93** 7.08 O.85 Garnl3 BB131106 433553 a O.28 O.88 0.27 O.93 Gpr149 BB126999 438210 a 4.09 0.55 3.87 O.S3 Hbegf LO7264 418350 a 4.57 O.99i 4.44 O.90** gfbp2 AKO11784 454159 a. at O.15 O.37% O.15 0.43: ag2 AV264681 426431 a O.24 O.86 O.23 O.91 Ms4a10 AKOO8019 432453 a at O.24 0.73 O.24 O.82 Pardog NM 0531.17 1420851 a O.35 0.79 O.33 O.90 Plxdc2 BB559706 418912 a O.O3 O.36 O.O3 O41 Prkcm AV297026 447623 s at O.24 0.90% O.23 1.03i Prkg1 BBS16668 444232 a O.23 0.86% O.23 O.95% Rab40b AV364488 436,566 a O.32 O.85: O.31 0.93% Rasl11a AKOO4371 4294.44 a O42 O.87 O41 O.95 Rb1 NM OO9029 1417850 a O.28 O.74 0.27 O.83 RgS2 AF2156.68 419248 a 3.91 O.66 3.70 O.62 Rprm NM 023396 1422552 a O.29 O.69 O.30 O.81 Sbk1 BCO25837 451190 a. at O40 O.81 O41 O.91 Sema3d BB499147 429459 a O.17 0.72% O16 0.80% Semafia AA144045 459903 a 4.77 O.68 4.41 O.61 Sfrp2 NM O09144 1448201 a O.13 0.27 O.13 O.31 Stmin4 NM 019675 1418105 a. O.36 0.73 O.34 O.78 Wntal AV2734.09 436978 a 0.37 O.89 O.35 1.OOhi
US 2012/01 14670 A1 May 10, 2012 31
TABLE 1-continued
2610528A11Rik BFS80962 435639 a A13004OM12Rik C85657 428909 a A467606 BB234337 433465 a. at A467606 BB234337 4334.66 a B630019KO6Rik BB179847 4334.52 a Pr2c2 ... Pr2C3 X75557 427760 S at Pr2.c4 AA266723 448O21 a. Down AV133559 45.9971 a Down B767109 439734 a Down B133117 44.1636 a Down W543723 44.1971 a Down B353853 438310 a Down M118398 435981 a Down GO76276 445758 a Down B306828 4.55298 a Down Q266693 442073 a Down V 2 54 7 64 456951 a Down 17OOOO7K13Rik KOOS731 428705 a Down 221 OO23GOSRik CO271.85 424968 a Down 2310O38E17Rik KOO9671 432976 a Down 2410066E13Rik B167663 434581 a Down 6230424C14Rik E949.277 44.1972 a Down 8030476L19Rik BO68813 454354 a Down 993OO13L23Rik KO18112 429987 a Down A930008G19Rik M248711 455428 a Down A930O37G23Rik E 95.7307 454628 a Down BCO13672 CO13672 451777 a Down BCO37703 V231983 455.241 a Down CO3OO27H14Rik B358264 442175 a Down C130O2621Rik COO7193 425078 xat Down LOC10OO41885 C13OO92O11Rik BGO71013 437306 a Down D330O28D13Rik BB478071 434428 a Down Dzip1 ft/ AISO9011 452792 a Down LOC100045776 Dzip1 ft/ AISO9011 428469 a. at Down LOC100045776 LOC10OO44927 NM O09398 4.18424 a Down Tnfaip6 LOC100045546 BB121406 450928 a Down LOC100047292 BI90S111 434889 a Down Acad11 B 4.33545 S. at Down Acad11 454647 a Down Adamts20 456901 a Down AI956758 46.0003 a Down Abi3bp 427054 s at Down Adcy AI848.263 456487 a Down Apol2 B312717 441054 a Down Dmx2 AKO18275 428,749 a Down Depdc7 424303 a Down Ceecam1 435345 a. Down Brunol5 B381558 434969 a Down Glis3 B2O7363 430353 a Down Grh3 AV231424 436932 a Down Gria BM22O576 434728 a Down Limch1 AVO24662 435106 a Down Limch1 BM117827 435321 a Down Mreg AV298.358 437250 a Down Ms4a2 AV241486 443264 a Down Npr3 BGO66982 4351.84 a Down Plekhaf BF159528 455,343 a Down Ptpdc1 AV2S4O40 433823 a Down Slain1 BB704967 424824 a Down Sc7a2 AV2441.75 436555 a. Down Swop AKOO3981 452663 a Down
A synergy score smaller than 1 indicates a synergistic or non-additive change in gene expression in response to multiple as compared to single oncogenic mutations. The p-values estimate the level of confidence that the synergy score is less than one, Synergy scores and associated p-values were calculated as described in Methods. For all synergy scores, p-values are p <0.01, exceptas indicated (p<0.05; p < 0.1; #not significantly less than 1), US 2012/01 14670 A1 May 10, 2012 32
TABLE 2 TABLE 2-continued TLDA assay ID numbers and corresponding synergy scores TLDA assay ID numbers and corresponding synergy scores for indicated CRGs. for indicated CRGs. Synergy Synergy Synergy Synergy Gene Public Score Score Gene Public Score Score Symbol Assay ID RefSeq, (TLDA) (Arrays) Symbol Assay ID RefSeq, (TLDA) (Arrays)
Abat Mm00556951 m1 NM 172961 0.73 Stmin4 Mm.00490524 m1 NM 019675 O.33 0.73 Abca1 Mm00442646 m1 NM 013454 0.75 Tex15 Mm00473190 m1 NM 031374 O.33 O.S9 Ank Mm004.45047 m1 NM 020332 0.57 Tnfrsfl8 Mm00437136 m1 NM 021985 O.61 O.S6 Ankrdl O.31 Mm.004965.12 m1 NM 013468 Tnint2 Mm00441922 m1 NM 011619 O.76 O.8 Arhgap24 O.30 Mm00525303 m1 NM 146161 UncASb Mm00618472 m1 NM 178680 O.32 O.82 Atp8.a1 Mm.00437712 m1 NM OO9727 O.91 Mm00784371 s1 NM OO9052 0.44 O.38 Wnta Mm00460518 m1 NM 139298 O.90 O.89 Mm00441260 m1 NM O11338 O.S8 O.82 Zip385 Mm00600201 m1 NM 013866 1.15 O.85 MnOO517855 m1 NM O23850 O.47 0.7 The indicated assays were performed using TaqMan Low Density Arrays. Shown are 76 Mm.00438216 m1 NM 009897 O.71 O.89 CRGs according to TLDA probe set availability, Synergy scores were calculated as Mm00658509 m1 NM 009936 1.00 O.39 described in Methods. MmOO462216 m1 NM 153107 0.72 O.76 Mm.004338.59 m1 NM 008176 1...SO O.84 Mm00441263 m1 NM O11339 O.90 0.7 0236 CRGs encode proteins involved in the regulation of Mm.00438377 m1 NM 010016 O.39 O41 cell signaling, transcription, apoptosis, metabolism, transport MmOO459400 m1 NM O29653 O.39 O.S8 or adhesion (FIG. 1A, 1B, Table 1), and in large proportion Mm.00432822 m1 NM 007859 O.96 O.86 Mm00444048 m1 NM 016811 0.79 0.79 appear misexpressed in human cancer. For 47 out of the 75 Mim()0468264 g1 NM 007933 O.S6 0.75 CRGS tested co-regulation was found in primary human Mm00468.397 m1 NM 007962 1.34 O.86 Mm.00433237 m1 NM 007987 O.84 O.83 colon cancer and our murine colon cancer cell model (FIG. Mm.00433286 m1 NM 008005 1.00 O.89 1C, FIG. 2). Moreover three of theses genes (EphB2, HB Mm.00433291 m1 NM 008008 O.66 O.85 EGF and Rb) also have been shown to play a causative role in MmOO614166 m1 NM 175276 O.84 O.61 Mm00724.806 m1 NM 178888 0.72 O.88 tumor formation. In addition, altered expression of 29 CRGs MmOO521120 m1 NM 145523 1.03 O.85 has been found in a variety of human cancers (Table 1). Mm00805216 m1 NM 177346 O.39 O.S3 Mm.004393.07 m1 NM 0104.15 O.90 O.9 0237. The relevance of differentially expressed genes for Mm00469280 m1 NM O13904 O.63 0.73 malignant cell transformation was assessed by genetic per Mm0051666.2 m1 NM 016660 O.67 O.82 turbation of a series of 24 CRGs (excluding those with an Mm0078O3O4 SH X58380 O.90 O.87 MmO0802798 m1 NM 010464 O.96 O.83 established role in tumor formation, EphB2, HB-EGF and Mm00711781 m1 NM 010496 O.S8 O.61 Rb) and 14 genes responding to p53175H and/or activated Mm.00499701 m1 NM 031166 O.23 O.39 H-Ras 12V in a non-cooperative manner (non-CRGs). Per Mm.00492632 m1 NM 008342 O.66 0.37 Mm00457551 m1 NM 018770 O.S1 0.7 turbed genes were chosen across a broad range of biological Mm.0043993.5 m1 NM 01.0588 O.69 O.86 functions, levels of differential expression and synergy scores Mm00525397 m1 NM 146.188 O.64 0.7 Mm00482658 m1 NM O26058 O.87 O.69 (FIG. 1 and FIG. 3). These perturbations were carried out in Mm.00493146 m1 NM 008492 O.80 O.S6 mp53/Ras cells with the goal to reestablish expression of the Mm00487585 m1 NM 010764 O.9S O.83 manipulated genes at levels relatively close to those found in Mm005.22397 m1 NM 023061 0.57 O.63 Mm00485062 m1 NM OO8609 O60 O.83 YAMC control cells, and to monitor subsequent tumor for Mm00804108 m1 NM 025.300 1.81 O.88 mation following Sub-cutaneous injection of these cells into Mm00452322 m1 NM 023529 0.37 0.73 immuno-compromised mice. Of the perturbed genes 18 were Mm.00628662 m1 NM 001005864 1.08 O.85 Mm.00435270 m1 NM 008716 O.63 O.62 up- and 20 down-regulated in mp53/Ras cells, relative to Mm00451763 m1 NM 021451 O.36 O.26 YAMC (Tables 3 and 4). Mm00474139 m1 NM 053117 O.84 0.79 Mm00480750 m1 NM 022032 1.19 0.7 0238 Tumor volume was measured weekly for 4 weeks Pla2g7 MnOO479105 m1 NM 013737 O.39 following injection into nude mice of murine and human Plac8 Mm00507371 m1 NM 139198 O.84 O.88 Plp Mm00448202 m1 NM 011125 1.03 O.88 cancer cells. Reversal of the changes in CRG expression Plxdc2 Mm00470649 m1 NM 026162 O.82 O.36 significantly reduced tumor formation by mp53/Ras cells in Prkcm Mm.00435790 m1 NM O08858 1.38 O.9 14 out of 24 cases (Table 3, FIG. 4A), indicating a critical role Prkg1 Mm004.40954 m1 NM 00101.3833 O.76 O.86 Rab40b Mm00454800 m1 NM 139147 1.04 O.85 in malignant transformation for a surprisingly large fraction Rb1 Mm004.85586 m1 NM OO9029 O.83 O.74 of these genes. Perturbation of Plac8, Jag2 and HoxC13 gene RgS2 Mm005O1385 m1 NM 009061 0.79 O.62 expression had the strongest effects. In addition, perturbation Rprm Mm00469773 S1 NM 023396 O.77 O.69 Sbk1 MnOO455133 m1 NM 145587 O.87 O.81 of two CRGs, Fas and Rprm, that alone produced significant Scn3b Mm00463369 m1 NM 153522 O.67 0.57 yet milder changes in tumor formation were combined. This Sema3d Mm00712652 m1 NM 028882 O.99 0.72 Semafia Mm00441361 m1 NM O11352 O40 O.61 yielded significantly increased efficacy in tumor inhibition as Serpinb2 Mm004.40905 m1 NM 011111 O.87 O.9 compared with the respective single perturbations (Wilcoxn Sfrp2 Mm004.85986 m1 NM OO9144 O.38 0.27 test, Table 4). Thus, even genetic perturbations of CRGs that Slc14a1 Mm00472198 m1 NM 028122 O.17 O.39 Sms Mm00786246 S1 NM 009214 122 O.89 seem to have relatively smaller effects when examined on Sod3 Mm00448831, S1, NM 011435 O.99 their own show evidence of being essential when analyzed in combination. US 2012/01 14670 A1 May 10, 2012 33
TABLE 3
Tumor formation by mp53/Ras cells following perturbation of individual cooperation response genes (CRGs) % Change in Expression Tumor Volume Gene Gene Synergy mp53, Ras vs. Number of (Perturbed vs. p Value p Value Name Function Score YAMC (fold) Injections (n) Control) (Wilcoxn) (t-test)
Smaller
Plac8 Unknown O.88 3.21 9 -100 O.OOO6 O.OOO1 ag2 Signaling O.86 O.24 8 -94 O.OOO3 O.OOO7 HoxC13 Transcription 0.83 O42 8 -76 O.OOS O.OO2 Sod3 Metabolism O.90** 4.O3 6 -72 O.OO)4 O.OO1 Gpr149 Signaling O.S3 3.87 2 -70 O.OO6 O.OS Dfb Apoptosis O.86 O3S 8 -69 O.OOS O.O1 Fgf7 Signaling O.85 7.08 6 -68 O.OO)4 O.O1 RgS2 Signaling O.62 3.70 8 -60 O.OOO2 O.OO6 Perp Apoptosis O.70 O.17 6 -59 O.OOO8 O.OO2 Zfp385 Unknown O.85 O.36 8 -59 O.OO7 O.OOS Wnt 9a Signaling O.89 0.37 8 -50 O.OO2 O.OO2 Fas Apoptosis O.83 O3S O -43 O.O2 O.O2 Pla2g7 Metabolism OSO 10.67 4 -42 O.O2 O.04 Rprm Signaling O.69 O.29 2 -36 O.O1 O.04 No Significant Change
Hmga2 Transcription 0.87 14.88 O -34 O.96 O43 gSf24a Migration O.70 16.89 O -33 0.37 O.31 Sfrp2 Signaling 0.27 O.13 O -25 O.23 O.24 d2 Transcription 0.61 O.24 6 -18 O.70 O41 Noxa Apoptosis O.26 O.OS 8 -18 O.30 O.33 Sema3d Signaling 0.72% O.17 6 -16 O.67 O4O Hmgal Transcription 0.82 11.38 4 -5 O48 O.91 Plxdc2 Signaling O.36 O.O3 6 24 O.13 O.08 d4 Transcription 0.39 O.10 6 79 O.2O O.14 Larger
Slc14a1 Metabolism O.39 9.20 6 18O O.OO8 O.OO2
For each gene perturbation, tumor volumes were compared to matched vector controls in the same experiment, Corresponding to the number of injections performed with perturbed cells, matched vector tumors numbered between 6 and 18, with perturbation experiments performed for small groups of genes and matched vector control. A synergy score smaller than 1 indicates a synergistic or non-additive change in gene expression in response to multiple as compared to single oncogenic mutations. The lower synergy score derived from either raw or normalized microarray expression values are indicated. The p-values estimate the level of confidence that the synergy score is less than one, Synergy scores and associated p-values were calculated as described in Methods. For all synergy scores, p-values are p < 0.01, except as indicated (**p < 0.05; p < 0.1).
TABLE 4 Tumor formation of mp53, Ras cells following dual CRG perturbations % Change in Tumor Volume p Value vs. Fas p Value vs. p Value vs. p Value vs. Gene Number of (Perturbed vs. alone Rprm alone Fas alone Rprm alone Name Injections (n) Control) (Wilcoxn) (Wilcoxn) (t-test) (t-test) Fas 10 -43 Rprm 12 -36 Fas + Rprm 8 -81 O.04 O.04 O.04 O.O2 For each gene perturbation, tumor volumes were compared to matched vector controls in the same experiment, Corresponding to the number of injections performed with perturbed cells, matched vector tumors numbered between 6 and 18, with perturbation experiments performed for small groups of genes and matched vector control.
0239 Given the increased efficacy of the Fas+Rprm com- response genes were analyzed (Table 5). As noted below bination in tumor inhibition as compared with their respective several combinations, such as, Dfb-Sfrp, Dapk-Perp, Dapk single perturbations, additional combinations of cooperation Noxa, Noxa-Rprm, Rprm-Sfrp, Noxa-Sfrp, and Dapk-Sfrp US 2012/01 14670 A1 May 10, 2012 34 resulted in significantly smaller tumor volume relative to the single perturbations. It is also important to note that not all TABLE 5-continued combinations had this synergistic effect (e.g., Dfb-Rprm). Tumor formation of mp53/Ras cells following dual perturbation of cooperation response genes TABLE 5 PValue Tumor formation of mp53/Ras cells following dual perturbation of Gene Number of % PValue PValue (vs. cooperation response genes Name Injections (n) Change (vs. Vect) (vs. Pert 1) Pert 2) PValue Fas-Perp 8 -62.64 O.OO O16 O.15 Gene Number of % PValue PValue (vs. Fas-Sfrp2 8 -59.97 O.OO O.20 O.O3 Name Injections (n) Change (vs. Vect) (vs. Pert 1) Pert 2) Dffb-Fas 8 -58.24 O.OO O.91 O.18 Perp-Rprm 8 -57.50 O.OO O.96 OSO Vector 24 Perp-Sfrp2 8 -51.53 O.OO O.80 O.O6 Dfb 8 -67.84 O.OOO Noxa-Perp 8 -49.51 O.OO O.09 O.83 Perp 16 -SS.87 O.OOO Fas-Noxa 8 -43.13 O.OO O.85 O.12 Rprm 16 -52.73 O.O1 Dffb-Noxa 8 -3316 O.O1 0.27 O.18 Noxa 12 -43.19 O.088 Dapk-Rprm 8 -16.80 O.O1 O.31 O.84 Fas 10 -32.93 O.O12 Dapk-Dffb 8 -13.80 O.O1 O.O3 O41 Dapk 12 -16.67 O.470 Sfrp2 8 -16.56 O.S9 For each gene perturbation, tumor volumes were compared to matched vector controls in the Tumor volume significantly smaller in dual than in single perturbations same experiment for calculation of change in tumor volume and statistical testing (T test, unequal variance), For statistical tests on combined perturbation vs. single perturbation, each combo wastested Dfb-Sfrp2 8 -92.70 O.OO O.O2 O.OO against the first perturbation listed (Pert 1), and against the second perturbation listed (Pert Dapk-Perp 8 -84.46 O.OO O.OO O.OO 2). Dapk-Noxa 8 -83.64 O.OO O.OO O.OO Noxa-Rprm 8 -71.73 O.OO O.OO O.O3 In contrast to the multitude of CRG-related effects on tumor Fas-Rprm 8 -71.65 O.OO O.04 O.O2 Rprm-Sfrp2 7 -70.66 O.OO O.O1 O.O1 inhibition, out of 14 perturbations of the non-cooperatively Noxa-Sfrp2 8 -58.22 O.OO O.O1 O.O3 regulated genes, only one showed a significant reduction in Dapk-Sfrp2 8 -48.91 O.OO O.OS O.04 tumor formation of mp53/Ras cells (FIG. 2A, right panel and Tumor volume not significantly Smaller in dual than in single perturbations Table 6). Taken together, the data indicate that among the Dffb-Rprm 8 -74.22 O.OO O.15 O.OO genes differentially expressed in cancer cells, malignant Dffb-Perp 8 -65.70 O.OO O.S3 O.09 transformation strongly relies on the class of genes Synergis Dapk-Fas 8 -64.49 O.OO O.O2 O.10 tically regulated by cooperating oncogenic mutations (FIG. 2B and FIG. 5).
TABLE 6 Tumor formation by mp53/Ras cells following perturbation of non-cooperatively regulated genes (non-CRGs % Change in Tumor Expression Ras and/or Number of Volume p Gene Gene Synergy mp53/Ras vs. mp53 Injections (Perturbed p Value Value Name Function Scores YAMC (fold) Response (n) vs. Control) (Wilcoxn) (t-test) Smaller
Tbx18 Transcription 140 O41 Ras 8 -84 O.OOO9 O.OO2 No Significant Change
St14 Migration 29 O.32 Ras & 2 -35 0.27 O.18 mp53 Kf2 Transcription .04 2.29 Ras O -34 O.21 O.S2 Ety1 Transcription .24 2.94 Ras 3 -27 1 O.S4 Igfbp4 Signaling .12 240 Ras & 6 -26 O.48 O.24 mp53 Tmcc3 Unknown 13 2.59 Ras 8 -20 O.62 0.44 Kh8 Unknown O8 0.37 mp53 O -13 0.67 O.69 Irf6 Transcription .83 O.39 Ras & 2 -10 O.69 O.74 mp53 Pax3 Transcription 60 1.96 Ras 8 10 O.98 O.68 Ddit41 Unknown .24 O.31 mp53 1 15 0.55 O.S6 Larger
Cox6b2 Metabolism .24 O.35 Ras & 1 74 O.OS O.O3 mp53 Dap Apoptosis .44 3.24 Ras & 4 104 O.004 O.OO1 US 2012/01 14670 A1 May 10, 2012
TABLE 6-continued Tumor formation by mp53/Ras cells following perturbation of non-cooperatively regulated genes (non-CRGs % Change in Tumor Expression Ras and/or Number of Volume p Gene Gene Synergy mp53, Ras vs. mp53 Injections (Perturbed p Value Value Name Function Scores YAMC (fold) Response (n) vs. Control) (Wilcoxn) (t-test) Nrp2 Migration 1.53 2.15 Ras 6 147 O.OO3 O.O2 Bnip3 Apoptosis 122 2.94 Ras 14 153 O.OOO9 O.OO2 For each gene perturbation, tumor volumes were compared to matched vector controls in the same experiment, Corresponding to the number of injections performed with perturbed cells, matched vector tumors numbered between 6 and 18, with perturbation experiments performed for small groups of genes and matched vector control. A synergy score 21 indicates a non-synergistic change in gene expression in response to multiple as compared to single oncogenic mutations. The lower synergy score derived from either raw or normalized microarray expression values are indicated. Synergy scores were calculated as described in Methods,
0240 Genetic perturbation experiments were carried out utilizing retrovirus-mediated re-expression of corresponding TABLE 7 cDNAs for down-regulated genes (Table 7) and shRNA-de cDNA clones used for gene re-expression perturbations pendent stable knock-down using multiple independent tar IMAGE gets for over-expressed genes (Table 8). In addition, Plac8 Gene Name Clone ID GenBank ID Species knock down was functionally rescued by expression of CRG Gift of Dr. NM O10588 Mouse shRNA-resistant Plac8, confirming specificity of the Plac8 L. Milner (Critical) 6171228 BCO90850 Human loss-of-function experiments. The extent of all gene pertur 6403143 BCOS3052 Mouse bations was assessed by quantitative PCR (FIG. 6). As 3985702 BCO21772 Mouse 4504518 BCO17644 Mouse expected, the genetic perturbations disrupt tumor formation 3O435371 BCO66165 Mouse downstream of the initiating oncogenic mutations. Expres 3O3O2649 BCO6116O MOSe 1434823 BCO3OO65 Mouse sion of both mutant p53 and activated Ras proteins was mea CRG 4487.469 BCO14722 Mouse sured by Western blots for H-Ras, p53 and B-tubulin expres (Non-Critical) 2655173 BCOO6921 Mouse sion in matched vector and mp53/Ras cells and remained 6517820 BCOSO821 Mouse S272175 BCO29590 Human unaffected by all genetic manipulations that inhibit the for S3498.69 BCOS7881 Mouse mation of tumors. Moreover, gene perturbations distin 4552357 BCO14941 Human Non-CRG (Critical) PCR cloned NM O23814 Mouse guished tumor growth from in vitro cell proliferation, as they Non-CRG 3488059 BCOO5496 Mouse generally did not perceivably affect cell accumulation in tis (Non-Critical) 30612176 BCO868O2 Mouse sue culture. Re-expression of the CRG Notch3, however, 3.592582 BCOO851S Mouse S2S4530 BCO38131 Mouse registered as a notable exception, resulting in cell growth 6773974 BC048670 Mouse inhibition in tissue culture, thus preventing tests of tumor formation in vivo in this case.
TABLE 8 Gene knock-down perturbations
Knock Down Gene Construct Efficiency Name GenBank IDName (%) shRNA. Target Sequence CRG Plac8 NM 139198 sh155 52 CTGGCAGACCAGCCTGTGTTT (SEO ID (Critical) NO: 1) sh240 86 GTGGCAGCTGACATGAATGTT (SEO ID NO: 2) sh461 74 GCTCAACT CAGCACACACTTT (SEO ID NO : 3) Sod3 NM_011435 sh414 SO GGCGACACGCATGCCAAAG (SEQ ID NO : 4) sh.11 O7 64 GGCCTCTAGGCGTCCTAGA (SEO ID NO : 5) sh1622 95 GGCGCTCTGGGACCACTCT (SEO ID NO : 6) Gpr149 BC119599 Sh2O6 69 TCCACGTAGTTTAGTAAGT (SEO ID NO : 7)
US 2012/01 14670 A1 May 10, 2012 37
TABLE 8- continued Gene knock-down perturbations
Knock Down Gene Construct Efficiency Name GenBank IDName (%) shRNA. Target Sequence sh.6 77 TGCGGTGTTCCTGAATTAG (SEO ID NO : 38) Relative levels of gene expression were determined by SYBR Green gPCR. ShRNA Knockdown efficiency values for independently derived replicate polyclonal Cell populations are indicated, separated by Comma. Perturbations with or without effects on tumor size average at 73% or 71.1% knockdown, respectively. In two instances, shRNA Constructs producing less than 50% reduction in gene expression induced a decrease (RgS2, 42% knockdown) or an increase (Nrp2, 27% knockdown) in tumor volume, Consistent with results derived from more extensive perturbations by alternate shRNAs for each target.
0241 Perturbations of CRGs in human cancer cells (Tables 9 and 10) had similarly strong tumor inhibitory TABLE 9 effects to those in the genetically tractable murine mp53/Ras cells, as assessed by Xenografts in nude mice. Perturbations of Tumor formation of human cancer cells following individual CRG both up-and down-regulated CRGs, i.e. Dffb, Fas, HoxC13, perturbations Jag2, Perp, Plac8, Rprim, Zfp385 and Fas+Rprm were per % Change in formed in human DLD-1 or HT-29 colon cancer cell lines Tumor Volume using retroviruses (FIG. 7, Tables 7 and 11) as described Cell Gene Number of (Perturbed pValue pValue above. Similar to mp53/Ras cells, both human cancer cell Type Name Injections (n) vs. Control) (Wilcoxn) (t-Test) lines have p53 mutations, whereas with K-Ras (DLD-1) and DLD-1 Perp 6 -75 O.OOO2 OOOOO1 B-Raf (HT-29) mutations they express activated members of Dfb 12 -69 0.00001 2 x 10 HoxC13 11 -69 O.OOO2 2 x 106 the Ras/Rafsignaling pathway distinct from activated H-Ras Jag2 5 -62 O.OO6 O.OOO6 in mp53/Ras cells. In addition, DLD-1 and HT29 cells carry Zip385 12 -49 O.OO2 O.OO8 further oncogenic lesions such as APC and PIK3CA muta Rprm 18 -47 O.O1 O.OOS tions, with HT29 cells also exhibiting a mutation in Smada. Fas 13 -34 O.O6 O.O6 The genetic perturbations had no effect on mutant Ras/Rafor HT-29 Pac3 5 -100.00 O.OOS O.O2 p53 protein expression levels in both DLD-1 and HT-29 cells HoxC13 5 -100.00 O.OOS O.O1 was measured by Western blot, indicating disruption of the Jag2 3 -81 O.09 O.O3 cancer phenotype downstream of oncogenic mutations. For each gene perturbation, tumor volumes were compared to matched vector controls in the same experiment, Taken together, these experiments indicate the relevance of Corresponding to the number of injections performed with perturbed cells, matched vector CRG expression levels to cancer in a variety of backgrounds tumors numbered between 6 and 18. and genetic contexts. TABLE 10 Tumor formation of human cancer cells following dual CRG perturbations % Change in Tumor Volume p Value vs. Fas p Value vs. p Value vs. p Value vs. Cell Gene Number of (Perturbed vs. alone Rprm alone Fas alone (t- Rprm alone Type Name Injections (n) Control) (Wilcoxn) (Wilcoxn) test) (t-test) DLD-1 Fas 13 -34 Rprm 18 -47 Fas + 6 -79 O.OO8 O.O7 O.OOS O.O2 Rprm
For each gene perturbation, tumor volumes were compared to matched vector controls in the same experiment, Corresponding to the number of injections performed with perturbed cells, matched vector tumors numbered between 6 and 18.
TABL E 11 Gene knock-down perturbations in human cells
Knock Down Efficiency Gene Name GenBank ID Construct Name (%) shRNA. Target Sequence Plac8 NM 016619. 1 sh259 GTT GCA GCT GAT ATG AAT G. (SEQ ID NO: 39) sh464 GCT. CTT ACC GAA GCA ACA A (SEQ ID NO: 40) Relative levels of gene expression were determined by SYER. Green gPCR. US 2012/01 14670 A1 May 10, 2012
0242. The data described here indicate that the cooperative (Panagopoulos, I. et al. (2003) Genes Chromosomes Cancer nature of malignant cell transformation, to a considerable 36, 107-12) can play oncogenic roles in haematopoietic degree, depends on synergistic deregulation of downstream malignancies, but are involved in promoting differentiation of effector genes by multiple oncogenic mutations. The coop epithelial cells (Nicolas, M. et al. (2003) Nat Genet. 33, eration response genes (CRGs) identified here contain a strik 416-21; Godwin, A. R. & Capecchi, M. R. (1998) Genes Dev ingly large fraction of genes (14 out of 24) that are critical to 12, 11-20) consistent with the tumor-inhibitory function of the malignant phenotype, and that their perturbation, singly Jag2 and HoxC13 in the context of the solid tumor models or in combination, can inhibit formation of tumors containing investigated here. Plac8 is a little investigated gene encoding multiple oncogenic lesions, including p53 deficiency. In con a cysteine-rich highly conserved peptide expressed in pla trast, few of the genes differentially expressed in a non centa, haematopoietic and epithelial cells that is non-essential synergistic manner (1 out of 14) significantly reduced tumor for mouse development (Ledford, J. G. et al. (2007).JImmu growth upon perturbation. Synergistic behavior found in gene nol 178,5132-43). When over-expressed, Plac8 can suppress expression data thus appears highly informative for identifi p53 (Rogulski, K. et al. (2005) Oncogene 24, 7524-41). Its cation of genes critically involved in malignant cell transfor essential role for tumor formation of p53-deficient cancer mation (FIG. 2B) and provides a rational path to discovery of cells, however, is novel and unexpected. Among the eight both cancer cell-specific vulnerabilities and targets for inter down-regulated CRGs is Zfp385, another gene of unknown vention in cancer cells harboring multiple mutations, includ function. Moreover, there is a considerable number of pro ing p53 loss-of-function. apoptotic/anti-proliferative genes such as Perp, Rprm, Fas, 0243 CRGs represent a set of 95 annotated cellular genes, Dfb and Wnt 9a, indicating that Ras activation and p53 defi many of which have been associated with human cancer by ciency cooperate to extinguish the expression of multiple virtue of altered gene expression (FIG. 1C, Table 1). They are growth inhibitory genes, each of which contributes signifi involved in the regulation of cell signaling, transcription, cantly to restricting tumor growth in the YAMC model when apoptosis and metabolism, and based on the data represent re-expressed. Out of these genes, Perp, Rprm, and Fas previ key control points in many facets of cancer cell behavior. ously have been identified as direct p53 targets, indicating Thus CRGs are critical nodes in gene networks underlying the that their regulation by p53 is highly conditional on Ras malignant phenotype, providing an attractive rationale to activity (Table 1). Most of the up-regulated CRGs contribut explain why several features of cancer cells emerge simulta ing to tumor growth affect signal transduction. This involves neously out of the interaction of a few geneticlesions (Xia, M. Fgf7, RgS2, Gpr149, an uncharacterized orphan seven-trans & Land, H. (2007) Nat Struct Mol Biol 14, 215-23). membrane receptor, and Sod3, which acts on signaling via 0244 Among CRGs and other differentially expressed modulation of metabolites (Fattman, C. L., et al. (2003) Free effector genes examples were also identified that when per Radic Biol Med 35,236-56). For all of these genes including turbed produce significantly larger tumors (FIG. 2, Tables 3 Pla2g7 a role in promoting tumor growth is reported here for and 6). This is consistent with the notion that oncogenic the first time. mutations can induce strongly anti-proliferative cellular 0246 Notably, the efficacy of CRG perturbations per stress responses (Ridley, A.J., et al. (1998) Embo J. 7, 1635 formed in human colon cancer cells was comparable to that in 45; Hirakawa, T. & Ruley, H. E. (1988) Proc Natl Acad Sci the murine colon cell transformation model, indicating USA85, 1519-23; Fanidi, A., et al. (1992) Nature 359,554-6: dependence of the malignant state on a similar set of genes in Denoyelle, C. et al. (2006) Nat Cell Biol 8, 1053-63). The both backgrounds. This is remarkable in light of the fact that existence of genes that while responding to oncogenic muta these human cancer cells carry oncogenic mutations in genes tions restrict tumor formation provides direct evidence to in addition to Ras or Raf and p53 and indicates that CRGs Support the idea that the state of malignant transformation play key roles in the generation and maintenance of the cancer arises as the result of a finely tuned balance between opposing cell phenotype in a variety of contexts. CRGs thus provide a signals generated by oncogenic mutations (Xia, M. & Land, valuable source for identification of much sought Achilles H. (2007) Nat Struct Mol Biol 14, 215-23; Fanidi, A., et al. heels in human cancer by rational means. (1992) Nature 359,554-6; Lloyd, A. C. et al. (1997) Genes 0247 a) Methods Dev 11, 663-77; Serrano, M., et al. (1997) Cell 88,593-602; 0248 (1) Cells: Sewing, A., et al. (1997) Mol Cell Biol 17, 5588-97: Lowe, S. 0249 Four polyclonal cell populations, control (Bleo/ W., et al. (2004) Nature 432,307-15). It is thus reasonable to Neo), mp53 (p.53175H/Neo), Ras (Bleo/RasV12) and mp53/ speculate that tumor Suppression via perturbation of CRGs, as Ras (p53175H/RasV12) were derived by retroviral infection shown here, disrupts this delicate balance. In fact, Such tar of low-passage polyclonal young adult mouse colon (YAMC) geted disruption downstream of oncogenic mutations can cells (Xia, M. & Land, H. (2007) Nat Struct Mol Biol 14, allow for selective cancer cell deconstruction yielding inter 215-23). YAMC cells (a gift from R. Whitehead and A. W. vention strategies with high specificity for cancer cells. Burgess) derived from the Immorto-mouse (aka H-2 0245. For many of the 14 tumor-inhibitory CRGs identi Kb?tSA58 transgenic mouse) expressing temperature-sensi fied, a clear causal role in tumor formation has been shown tive simian virus 40 large T (tSA58) under the control of an here for the first time. Moreover, the data indicate that both interferon Y-inducible promoter (Whitehead, R. H., et al. gene extinctions (eight genes) and gene inductions (six (1993) Proc Natl Acad Sci USA 90, 587-91; Jat, P. S. et al. genes) play important roles in this process. For example, (1991) Proc Natl Acad Sci USA 88, 5096-100) were main re-expression of the down-regulated CRGs Jag2, a Notch tained at the permissive temperature (33°C.) for large T in the ligand, or of HoxC13, a homeobox transcription factor, as presence of interferon Y to support conditional immortaliza well as shRNA-dependent knock down of Plac8 gene expres tion in vitro. This permits expansion of the cells in tissue sion are each strongly tumor inhibitory in p53 defective culture. In contrast, exposure of YAMC cells to the non murine and human cancer cells. Both Notch signaling permissive temperature for large T (39°C.) in the absence of (Houde, C. et al. (2004) Blood 104,3697-704) and HoxC13 interferon Y leads to growth arrest followed by cell death US 2012/01 14670 A1 May 10, 2012 39
(Whitehead, R. H., et al. (1993) Proc Natl AcadSci USA90, mal RNA from YAMC, mp53/neo, bleo/Ras and mp53/Ras 587-91; D'Abaco, G. M., et al. (1996) Mol Cell Biol 16, cells isolated under conditions described above (10 884-91), indicating the absence of spontaneous immortaliz ug/sample) were mixed with 1x SuperScript II reverse tran ing mutations in the cell population. The cells were cultured scriptase buffer, 10 mM DTT, 400 uM dNTP mixture, 0.3 ng on Collagen IV-coated dishes (1 lug/cm2 for 1.5 hr at room random hexamer primer, 2 LL RNase0UT RNase inhibitor temp; Sigma) in RPMI 1640 medium (Invitrogen) containing and 2 LL of SuperScript II reverse transcriptase in a 100 uL 10% (v/v) fetal bovine serum (FBS) (Hyclone), 1XITS-A reaction (all components from Invitrogen). RT reactions were (Invitrogen), 2.5 Lig/ml gentamycin (Invitrogen), and 5 U/ml carried out by denaturing RNA at 70° C. for 10 minutes, interferon Y (R&D Systems). All experiments testing the plunging RNA on to ice, adding other components, incubat effects of Ras V12 and p53175H were carried out at the non permissive temperature for large T function (39°C.) and in ing at 42°C. for 1 hour and heat inactivating the RT enzyme the absence of interferon Y. by a final incubation at 70° C. for 10 minutes. (0250) Human colon cancer cells HT-29, which harbor p53, 0256 For each sample, 82 uL of cDNA was combined B-Raf, APC, PIK3CA and Smada mutations (Ikediobi, O. N. with 328 ul of nuclease free water (Invitrogen) and an equal et al. (2006) Mol Cancer Ther 5, 2606-12), were obtained volume of TaqMan Universal PCR Master Mix No Amperase from the ATCC. DLD-1 cells were provided by Dr. J. Filmus. UNG (Applied Biosystems). The mixture was loaded into They carry p53 (Rodrigues, N. R. et al. (1990) Proc Natl Acad each of 8 ports on the card at 100 uL per port. Each reaction Sci USA 87, 7555-9), K-Ras (Shirasawa, S., et al. (1993) contained forward and reverse primer at a final concentration Science 260, 85-8), APC (Rubinfeld, B. et al. (1993) Science of 900 nM and a TaqMan MGB probe (6-FAM) at 250 nM 262, 1731-4) and PIK3CA (Samuels, Y. et al. (2005) Cancer final concentration. The cards were sealed with a TaqMan Cell 7, 561-73) mutations. Both cell lines were maintained at Low-Density Array Sealer (Applied Biosystems) to prevent 37°C. in DMEM medium (Invitrogen) containing 10% FBS cross-contamination. The real-time RT-PCR amplifications (Hyclone) and 2.5 g/ml gentamycin (Invitrogen). were run on an ABI Prism 7900HT Sequence Detection Sys 0251 b) Microarray Experiments: tem (Applied Biosystems) with a TaqMan Low Density Array 0252 Polysomal RNA was harvested from YAMC, bleo/ Upgrade. Thermal cycling conditions were as follows: 2 min neo, mp53/neo, bleo/Ras and mp53/Ras cells to obtain gene at 50° C., 10 min at 94.5° C., 40 cycles of 97° C. for 30 expression profiles reflective of protein synthesis rates. RNA seconds, and annealing and extension at 59.7°C. for 1 minute. was harvested from ten replicates for each cell population Each individual replicate cDNA sample was processed on a grown in non-permissive conditions for 48 hr, followed by 24 separate card. hr in media with 0% FBS to maximize the contribution of 0257 Gene expression values were derived using SDS 2.0 oncogenic signaling to gene expression. RNA was collected Software package (Applied BioSystems). Differential gene while cells were sub-confluent and all cell populations were expression was calculated by the AACt method. Briefly, using actively cycling. Cells were lysed in Extraction Buffer (50 threshold cycle (Ct) for each gene, change in gene expression mM MOPS, 15 mM MgC1, 150 mM NaCl, 0.5% Triton was calculated for each sample comparison by the formulae: X-100 with 100 ug/mL cycloheximide, 1 mg/mL heparin, 200 AC(test sample) Octarget gene, test sample) Coreference gene, U RNAsin (2 uL/mL of buffer), 2 mM PMSF). Supernatants test sanpie) 1. were applied to 10-50% sucrose gradients, centrifuged at 36,000 rpm for 2 hr at 4°C. and fractions were collected using AC control sample) Octarget gene, control sampleCorefer an ISCO gradient fractionator reading absorbance at 254 nm. ence gene, control sanpie) 2. Polysome containing fractions were pooled and RNA was purified using the RNeasy Mini Kit (Qiagen) following the AACACtes-ACiccitato) 3. standard protocol for animal cells, except that Sucrose frac 0258 d) Statistical Analysis and CRG Identification: tions were mixed with 3.5 volumes Buffer RLT before bind 0259 Expression values from the 50 microarrays pro ing to the RNeasy column. RNA was DNase digested follow cessed were obtained using the RMA procedure in Biocon ing the on-column digestion as part of the RNeasy RNA ductor. Differentially expressed genes were identified by the extraction protocol. step-down Westfall-Young procedure (Westfall, P. H. & 0253 Five micrograms of RNA was reverse transcribed Young, S. S. Resampling-based multiple testing: examples and labeled using the mAMP kit (Ambion), with the 1x and methods for P-value adjustment (Wiley, New York, amplification protocol. The crNA yield was fragmented and 1993)) in conjunction with the permutation N-test (Klebanov, hybridization cocktails were prepared using Affymetrix stan L., et al. (2006) Computational Statistics & Data Analysis 50. dard protocol for eukaryotic target hybridization. Targets 3619-3628). The latter test is nonparametric and does not were hybridized to Affymetrix Mouse Genome 430 2.0 require log-expression levels to be normally distributed. The Expression Arrays at 45° C. for 16 hours, washed and stained family-wise error rate (FWER) was controlled at a level of using Affymetrix Fluidics protocol EukGE-WS2v4 450 in 0.01. Gene expression values derived from mp53/Ras RNA the Fluidics Station 450. Arrays were scanned with the samples were compared to those from two control cell popu Affymetrix GeneChip Scanner 3000. lations, YAMC and bleo/neo cells, and differentially 0254 c) TLDA QPCR: expressed genes within the intersection of both comparisons 0255. The TaqMan Low-Density Array (Applied Biosys were selected for further analysis (p value of mp53/Ras vs. tems) consists of TaqMan qPCR reactions targeting the coop YAMC <0.01 ?hp value of mp53/Ras vs. Bleo/Neo <0.01). eration response genes available (76 genes, listed in Table 2) This selection process was executed in parallel using both raw and control genes (18S rRNA, GAPDH) in a microfluidic and quantile normalized expression values, with the genes card. TLDA were used to independently test gene expression forming the union of both procedures being selected for fur differences observed by Affymetrix arrays. To generate ther analysis (RawUNormalized). All ESTs and “Transcribed cDNA for qPCR analysis, quadruplicate samples of polyso loci' were rejected from the set of genes thus selected. US 2012/01 14670 A1 May 10, 2012 40
0260 The following procedure was applied for further sequence yielded appropriate levels of knock-down, reducing Sub-selection of genes with a synergistic response to mutant levels of gene expression comparable to those in YAMC cells p53 and activated Ras. Let a be the mean expression level of (Hmga2, Igfbp4, and Klf2) (FIG. 12D). Retroviral infection a given gene in mp53, b represent the mean expression level of target cells was carried out as described above, except that of a gene in Ras and d represent the mean expression in infections of mp53/Ras cells were performed at 39° C. to mp53/Ras. Then, the selection criterion defines CRGs as maximize shRNA-mediated gene knockdown. HT-29 cells (a+b)+ds:0.9 for genes over-expressed in mp53/Ras and as were infected at 37° C. ShRNA experiments with DLD1 and (d+a)+(d+b)sO.9 for genes under-expressed in mp53/Ras. HT-29 cells were constrained by low efficiencies of mRNA Unlike a similar criterion based on the general isobol equation knock down and instability of knock down maintenance dur (Berenbaum, M. C. (1989) Pharmacol Rev 41, 93-141), this criterion has no rigorous theoretical justification. However, it ing tumor formation. is heuristically appealing and served well for the purposes of 0266 The specificity of Plac8 knock-down was indepen the study. dently confirmed by expression of Plac8 cDNA rendered shRNA-resistant by introduction of appropriate silent muta 0261 e) Genetic Perturbation of Gene Expression: tions (FIG. 6B). This shRNA resistant cDNA was cloned 0262 (1) Re-Expression of Down-Regulated Genes: (Genbank ID: NM 139198, Wild Type sequence: 239 0263 For stable gene re-expression, cDNA clones were AAGTGGCAGCTGACATGAATG-259 (SEQ ID NO: 41), obtained from the IMAGE consortium collection, distributed Mutated Sequence: 239-AGGTCGCCGCGGACAT by Open Biosystems (Table 4), except for murine Jag2 (gift of GAACG-259 (SEQID NO: 42)) into the pBabe-hygro retro Dr. L. Milner), and murine Tbx 18, which was PCR-cloned viral vector and introduced into mp53/Ras cells harboring from YAMC cDNA using sequence-specific primers. All Plac8sh240 shRNA using the methods described above. cDNAs were sequence-verified prior to use and were cloned into the retroviral vector pBabe-puro (Morgenstern, J. P. & 0267 (3) Quantitation of Gene Perturbation: Land, H. (1990) Nucleic Acids Res 18, 3587-96). For com 0268. The efficiency of gene perturbations was tested by bined perturbation of Fas+Rprm, cDNA for Fas was sub comparison of RNA expression levels in empty vector-in cloned into the p3abe-hygro retroviral vector, allowing for fected mp53/Ras cells and cells subjected to gene perturba consecutive selection for each gene introduced. Retroviruses tion. Re-expression or knock-down was also compared with for infection of mp53/Ras cells were produced following the respective levels of RNA expression in YAMC control transient transfection of dNX-eco cells (ATCC). For produc cells. For collection of RNA, mp53/Ras cells were grown at tion of pseudotyped, human cell infectious retrovirus, p3abe the 39°C. for 2 days, followed by serum withdrawal for 24hr. retroviral vectors were co-transfected with the VSV-G gene For quantitation of gene perturbations in HT-29 and DLD-1 driven by the CMV promoter into dNX-gp cells (ATCC). cells, genetically manipulated cell populations and respective Infections were carried out in media with 8 ug/mL polybrene vector controls were grown in the absence of serum for 24hr at 33°C. for mp53/Ras cells and at 37° C. for DLD-1 cells. prior to harvesting RNA. Total RNA was extracted from cells Selection with 5 ug/mL puromycin, and where applicable, following the standard RNeasy Mini Kit protocol for animal 200 ug/mL hygromycin B, was used to generate polyclonal cells, with on-column DNase digestion (Qiagen). populations of cells stably expressing the indicated cDNAs. 0269 SYBR Green-based quantitative PCR was run using Polyclonal cell populations expressing each cDNA were gen cDNA produced as described above for TLDA, with 1x Bio erated. To test reproducibility of the highly frequent effects of Radio SYBR Green master mix, 0.2 uM forward and reverse CRG gene perturbations on tumor formation 2-4 independent primer mix, with gene-specific qPCR primers for each gene replicates of such cell populations were derived (FIG. 6A). tested. Reactions were run on the iCycler (Bio-Rad), as fol No significant effects on tumor formation were found upon lows: 5 mM at 95°C., 45 cycles of 95°C. for 30 seconds, 58 testing cell populations each expressing one offive non-CRG to 61° C. for 30 seconds, 68 to 72° C. for 45 seconds to cDNAs. The tumor-inhibitory effect of non-CRG cDNA amplify products, followed by 40 cycles of 94°C. with 1 °C. Tbx18 was confirmed by multiple independent replicates step-down for 30 seconds to produce melt curves. Primers (FIG. 6C). As expected, the magnitude of perturbation varies were identified using the Primer Bank database (Wang, X. & between cINAs and replicates, and falls into the following Seed, B. (2003) Nucleic Acids Res 31, e154) or designed groups. For tumor-inhibitory CRGs, all replicates express using the IDT PrimerQuest tool. Differential gene expression cDNAs at levels below, at or moderately above YAMC mRNA was calculated by the AACt method, described above. expression levels. For non-tumor-inhibitory CRGs and for (0270 f) Western Blotting: non-CRGs, cDNA expression levels were found at or above (0271 mp53/Ras cells were grown at 39° C. for 2 days the levels of the corresponding YAMC mRNAs (FIG. 6). prior to lysis for Western blots. HT-29 and DLD-1 cells were 0264 (2) Knock Down of Up-Regulated Genes: grown in standard conditions, described above. Cell pellets 0265 For stable gene knock-down, shRNA molecules were lysed for 20 minat 4°C. with rotation in RIPA buffer (50 were designed using an algorithm (Yuan, B., et al. (2004) mM Tris-HCL, pH 7.4, 150 mM NaCL, 1% NP-40, 5 mM Nucleic Acids Res 32, W 130-4). Target sequences (Table 8) EDTA, 0.1% SDS, 0.5% deoxycholic acid, protease inhibitor were synthesized as forward and reverse oligonucleotides cocktail tablet). Lysates were clarified by centrifugation at (IDT), which were annealed and cloned into the pSuper-retro 13,000 g for 10 min at 4°C. and quantitated using Bradford vector (Brummelkamp, T. R., et al. (2002) Science 296, 550 protein assay (Bio-Rad).25ug of protein lysate was separated 3) (Oligoengine). For each up-regulated gene, two or three by SDS-PAGE and transferred to PVDF membrane (Milli independent shRNA target sequences were identified yield pore) Immunoblots were blocked in 5% non-fat dry milk in ing at least 50% reduction in gene expression with the goal to PBS with 0.2% Tween-20 for 1 hour at RT, probed with guard against off-target effects (Table 8 and FIG.12B, D). For antibodies against p53 (FL-393, Santa Cruz) for all cell lines, this purpose between four and six shRNA targets for each H-Ras (C-20, Santa Cruz) for mp53/Ras cells, Raf(F-7, Santa gene were tested. In three cases, only one shRNA target Cruz) for HT-29 cells, Ras (Ab-1, Calbiochem) for DLD-1 US 2012/01 14670 A1 May 10, 2012
cells, and tubulin (H-235, Santa Cruz) for all cell lines. Bands pression of mutant p53 '' (mp53) and Ras' (Ras) were were visualized using the ECL+kit (Amersham). perturbed by infection with retroviral constructs containing 0272 g) Xenograft Assays: appropriate shRNA or cDNA molecules. The extent of gene (0273 Murine mp53/Ras cells were grown at 39° C. for 2 perturbation was controlled at the level of mRNA expression. days prior to injection. Human HT-29 and DLD-1 cells were Perturbed cells were compared to vector-infected mp53/Ras grown in standard conditions, described above. Tumor for cells, as well as normal YAMC cells, to assess whether gene mation was assessed by sub-cutaneous injection of 5x10 expression was in the range of normal cell expression or cells (mp53/Ras and DLD-1 cells) or 1.25x105 cells (HT-29) vastly different. Perturbation of all genes was at or about the into CD-1 nude mice (Crl:CD-1-Foxnlnu, Charles River level of expression in YAMC cells, with the exception of the Laboratories) in appropriate media (RPMI 1640 or DMEM) Lass4 gene (FIG. 9). This cDNA appears to express to a with no additives. For each replicate of all gene perturbations, substantially higher level than normal cells, but despite this, 2-12 injections were performed for perturbed cells and vector fails to show a biological effect on tumor formation capacity controls, as indicated in FIGS. 12 and 16. Tumor size was of cells. Polyclonal cell populations stably expressing these measured by caliper at 2.3 and 4 weeks post-injection. Tumor constructs were selected and implanted Sub-cutaneously on volume was calculated by the formula volume=(4/3)7tr3. nude mice. Tumor formation was assessed at four weeks post using the average of two radius measurements. Tumor reduc injection, with tumor Volume measured by caliper. tion was calculated based on the average tumor Volume fol 0279 (2) Crgs are Co-Regulated in Pancreatic and Pros lowing each gene perturbation as compared to the directly tate Cancer matched vector control tumors. Statistical significance of dif 0280. If CRGs represent the synergistic response of cells ference in tumor size was calculated by the Wilcoxn signed to cooperating oncogenic mutations, this gene signature may rank test (Hollander, M. & Wolfe, D. A. Nonparametric Sta appear disregulated in cancers with a similar spectrum of tistical Methods (Wiley-Interscience, Hoboken, N.J., 1998)). mutations as the murine model. Thus, CRG expression pat comparing tumors derived from perturbed cells with tumors terns were examined in human pancreatic cancer, which fre induced by directly matching vector control cells. quently has mutations in the p53 and Ras genes (Hrubanet al., 2000; Rozenblum et al., 1997), and prostate cancer, fre 2. Example 2 quently characterized by p53 and PTEN mutation (Isaacs and Significance and Selection of Cooperation Response Kainu, 2001). The results show that a substantial proportion Genes of CRGs are co-regulated in both pancreatic and prostate cancer, in addition to colon cancer (FIG. 10). Specifically, of (0274) a) Results 69 CRGs represented in the pancreatic tumor data set, 33 0275. In order to further assess the extent of CRG involve appear co-regulated, with similar disregulation in pancreatic ment in malignant transformation, perturbation of an addi cancer as in the murine model system (FIG.11A). Of these 33 tional 10 CRGs has been performed, revealing 6 new genes genes, 25 are significantly differentially expressed in pancre with an essential role in tumor formation. Substantial CRG atic cancer. For human prostate cancer, of 47 CRGs repre co-regulation in human pancreatic and prostate cancer, which sented on the arrays, 31 appear co-regulated, with significant commonly contain p53 and Ras pathway mutations was also differences between cancer and normal samples for 23 of found. Finally, a number of aspects of the original process for these genes (FIG.11B). Notably, there is a substantial overlap identifying CRGs were examined and found that there are between these cancers and colon cancer, with 9 genes simi multiple paths to find this critically important gene set. Taken larly disregulated in all three cancers and the murine model. together, these results confirm the essential role for CRGs in For these comparisons, publicly available data sets were used malignant cell transformation, and indicate that CRGS play a to compare cancer samples with normal controls for pancre role in other cancers with p53 and Ras pathway alterations. atic (Lowe et al., 2007) and prostate (Lapointe et al., 2004) This class of genes provide new opportunities for therapeutic cancer. Differential expression in human tumor material was intervention in multiple human cancers. plotted against the differential expression pattern in mp53/ 0276 (1) Cooperation Response Genes Contain High Pro Ras cells, relative to YAMC cells. These results show that portion of Tumor Regulatory Genes CRGs are disregulated in cancers other than colon cancer, and 0277 Because a subset of CRGs has been shown to playan indicates that CRGs have a similar biological role in pancre essential role in tumor formation, additional CRGs were atic and prostate cancer cells. assessed to determine if they have a similar role in malignant 0281 (3) Oncogene Cooperation Limits Extracellular transformation. To test this, an additional 10 CRGs were Cues Contribution to Gene Expression perturbed and found that a high proportion, 6 out of 10, are 0282 Identification of CRGs was done using RNA from essential to tumor formation, producing significant reduc cells grown in the absence of serum prior to harvesting, with tions in tumor Volume as compared to matched, empty vector the intent to reduce the contribution of growth and survival expressing cells (FIGS. 8A and B). Disclosed herein above, factors to gene expression patterns. The presence of extracel perturbation of 14 out of 24 CRGs produced a significant lular signals from serum alters Substantially the gene expres decrease in tumor formation upon Xenograft in nude mice. sion pattern in cells expressing mp53 or Ras alone. Interest The similar proportion of tumor inhibitory CRGs found here ingly, while gene expression in these cells is highly reinforces the observation that the CRG set contains many conditional on external signals, the mp53/Ras gene expres genes that regulate tumor formation capacity of cancer cells. sion pattern is largely independent of external cues contrib 0278 CRG perturbations were made by retroviral intro uted by serum. In order to assess this, CRG expression pro duction of cDNA, encoding each target gene, or shRNA, files from cells grown in the presence or absence of serum for targeting each gene for mRNA knock-down, using multiple 24 hours were compared, using TaqMan Low-Density Arrays independent shRNA targets to control for potential off-target (TLDA), with four replicates of RNA from normal YAMC effects. Murine colon cells (YAMC) transformed by co-ex cells, cells expressing mp53 alone or Ras alone, and mp53/ US 2012/01 14670 A1 May 10, 2012 42
Ras cells. Gene expression is shown as expression in mp53, cells, as compared to cells with mp53 alone and Ras alone, Ras or mp53/Ras cells relative to YAMC cells under the same indentifies tumor inhibitory genes in similar numbers. growth condition. Thus, by removing serum from the cells 0288. In order to test such methods for segregating essen prior to RNA extraction, the contribution of the individual tial genes from non-essential, the results of the original addi oncogenes were separated from the noise of serum-derived tive synergy criterion was compared with a multiplicative external signals. Because CRG identification uses the gene expression values in mp53, Ras and mp53/Ras cells in a ratio, synergy criterion, and with using the N-test to identify genes termed the synergy score, noise in the expression values of significantly differentially expressed in mp53/Ras cells as mp53 or Ras cells might have obscured synergistically regu compared to mp53 or Ras alone. While the multiplicativity lated genes. In addition, the observation that individual onco score and differential expression via the N-test identify some gene effects are highly conditional, while cells with multiple what different sets of genes than the additive synergy score, mutations control gene expression regardless of their envi all three methods perform similarly at isolating genes critical ronment, may begin to explain how tumor cells gain indepen to tumor formation from non-essential genes. The multipli dence from extracellular signals in the transformation process cativity score has the drawback of generating a longer list of (Hanahan and Weinberg, 2000). Such independence can be genes that meet the test, which increases the number of false driven by cooperating oncogenic lesions. positives, genes included on the list that do not contribute to (0283 (4) N-Test is more selective of CRGs than T-Test tumor formation capacity of transformed cells. The use of 0284. In order to identify CRGs, a newly developed sta differential expression in mp53/Ras vs. mp53 and Ras alone tistical test, the N-test (Klebanov et al., 2006), was used to via the N-test generates a list of candidate genes similar in identify genes differentially expressed in mp53/Ras cells, as length to the additive synergy score list (~100 genes), but this compared to two sets of control cells, YAMC, and YAMC criterion fails to capture 5 genes that are critical to tumor infected with empty retroviral vectors (bleo/Neo). In order to formation, and which are identified as Synergistic by the determine whether this procedure detected a gene set that additive synergy score. Thus, for the purpose of using would otherwise have been obscured, the original microarray genomic data to identify functionally significant genes, the data was re-analyzed, comparing the gene list resulting from greater than additive synergistic expression criterion origi the N-test with that derived by using the more commonly nally used provides the most robust separation of genes essen applied t-test (Welch's t-test), each done with Westfall-Young tial to tumor formation than do other criteria, but there are adjustment. Both procedures identify a common set of 1127 clearly multiple paths to identify genes required for malig genes with p-values<0.05 as compared to both normal cell nant transformation. controls (YAMC and empty vector-expressing bleo/Neo), but while the N-test only declares an additional 154 genes as 0289 b) Discussion differentially expressed, the t-test calls an additional 988 0290) Identification of the genome-wide set of genes syn genes differentially expressed. Interestingly, using the Syn ergistically regulated by p53 loss-of-function and constitutive ergy score criterion to identify CRGs produces similar lists of Ras activation, provides a roadmap to find downstream tar synergistically regulated genes, regardless of the statistical gets of critical importance to the cancer cell. Characterization test used to identify differentially expressed genes, with the of this gene set reveals additional genes essential for trans N-test list containing only 19 more CRGs than the t-test. formation, with an overall proportion of ~60% of CRGs criti Thus, CRGs can be found by multiple statistical methods. cal to malignant transformation individually. However, for the original purpose of comparing the biologi 0291 Because the CRGs effectively inhibit tumor forma cal roles of synergistically regulated genes to those regulated tion of p53-deficient cells, they can represent targets of great in a non-synergistic manner, while using the t-test produces a interestin colon, pancreatic and prostate cancer, for which the similar list of CRGs, the t-test also yields a substantially prognosis is poor once p53 mutations are acquired. This longer list of non-CRGs, which complicates the process of appears more likely given the substantial overlap in CRG choosing Such genes for perturbation. disregulation between these 3 types of cancer. If CRG depen 0285 (5) Synergy can be Found in Multiple Ways dence is similar in pancreatic and prostate cancer, then tar 0286 Based on previous studies of changes in gene geting CRGs in other cancer cells can yield similar results as expression in response to single oncogenic mutations in cells, in colon cancer cells, and ultimately lead to additional thera there might be hundreds or even thousands of genes that peutic opportunities in pancreatic and prostate cancer. respond to the activity of a single oncogene (Fernandez et al., 0292. In order to identify CRGs, appropriate methods 2003; Huang et al., 2003). Therefore, a strategy was must be used. If synergistic regulation is obscured by noise in employed to sort the relevant changes, those on which tumor the data generated, valuable information may be lost. Based formation depends, from those that are not essential for tumor on analysis of the methodology, there are multiple paths to formation. Synergistic responses were utilized to cooperating finding CRGs, with the limitations of each taken into consid oncogenes because of the Substantial evidence that Such eration. In particular, the choice to remove serum from cells cooperation induces transformation (Fanidiet al., 1992; Hahn prior to harvesting RNA appears to have greatly reduced the et al., 1999; Hirakawa and Ruley, 1988: Land et al.). The context-dependent noise in the single oncogene expressing synergy score metric was derived to identify genes whose cells RNA populations. While the gene expression pattern in expression showed a greater than additive change in mp53/ the mp53/Ras cells is largely independent of extracellular Ras cells, as compared to cues, gene expression in cells with mp53 or Ras alone show 0287 mp53 or Ras alone. One can define synergistic greater integration of the oncogenic and extracellular signals. changes those that show a greater than multiplicative relation This feature relates to the biological capacity of tumor cells to ship, rather than the greater than additive relationship that was ignore normal extracellular cues to cease proliferation, com utilized in the original analysis. Alternatively, simply identi mit Suicide or remain within a confined tissue context (Hana fying genes with a unique expression pattern in mp53/Ras han and Weinberg, 2000). It is likely that cancer cells must US 2012/01 14670 A1 May 10, 2012 become independent of extracellular cues in order to progress trast, exposure ofYAMC cells to the non-permissive tempera to full malignancy, and this appears to be a consequence of ture for large T (39°C.) in the absence of interferon leads to oncogene cooperation. growth arrest followed by cell death, indicating the absence of 0293. The statistical methodology used for the original spontaneous immortalizing mutations in the cell population. analysis was important to the comparison of CRGS with non The cells were cultured on Collagen IV-coated dishes (1 synergistically regulated genes. The N-test produces a shorter ug/cm2 for 1.5 hr at room temp; Sigma) in RPMI 1640 list of differentially expressed genes, facilitating identifica medium (Invitrogen) containing 10% (v/v) fetal bovine tion and perturbation of an appropriate number of non-CRGs. serum (FBS) (Hyclone), 1 xITS-A (Invitrogen), 2.5 lug/ml By using the t-test, the list of non-CRGs is substantially gentamycin (Invitrogen), and 5 U/ml interferony (R&D Sys longer, and requires perturbation of many more non-CRGs. tems). All experiments testing the effects of Rasv 12 and Because the number of synergistically regulated genes in the p53175H were carried out at the non-permissive temperature whole genome is independent of statistical differentials, hav for large T function (39°C.) and in the absence of interferon ing a longer list of non-synergistically regulated genes as a Y. starting point is a significant barrier. For simple identification 0299 (2) Genetic Perturbation of Gene Expression of CRGs, however, both tests perform similarly. 0300 Re-expression of down-regulated genes: For stable 0294. In terms of finding synergistically regulated genes, gene re-expression, cDNA for each gene was cloned into the the Synergy score appears to perform the best in terms of pBabe retroviral vector, which was used to produce ecotropic segregating tumor inhibitory perturbations from those which or pseudotyped retrovirus for infection of mp53/Ras, HT-29 do not alter tumor formation capacity of cells. Identification or DLD-1 cells. Cells were drug selected to derive polyclonal of genes by a greater than multiplicative relationship in mp53/ cell populations for Xenograft assays. Ras cells, as compared to mp53 and Ras alone, includes the 0301 Knock down of up-regulated genes: For stable gene same number of tumor-regulatory CRGs, but has the limita knock-down, shRNA targeting each gene was cloned into the tion of generating a longer list. This increases the false-posi pSuper-retro retroviral vector, which was used as pBabe vec tive rate among the so-called CRGs. By choosing to find tors above. The specificity of Plac8 knock-down was inde genes differentially expressed in mp53/Ras cells, as com pendently confirmed by expression of Plac8 cDNA rendered pared to mp53 and Ras alone, a similar number of CRGs were shRNA-resistant by introduction of appropriate silent muta identified, but lose a Subset of genes essential to transforma tions. This shRNA resistant cDNA was cloned into the tion. Thus, the synergy score is a slightly better measure for pBabe-hygro retroviral vector and introduced into mp53/Ras identification of CRGs, which are enriched for tumor inhibi cells harboring Plac8sh240 shRNA. tory genes. Clearly, other criteria for finding Such genes also 0302 Quantitation of gene perturbation: The efficiency of enrich the proportion of genes that play an essential role in gene perturbations was tested by comparison of RNA expres malignant transformation. sion levels in empty vector-infected mp53/Ras cells and cells 0295 The results demonstrate a means by which to dis subjected to gene perturbation via SYBR Green qPCR with cern functionally important features in genomic scale gene gene-specific primers. Re-expression or knock-down was expression data. Genes regulated by the cooperation between also compared with the respective levels of RNA expression oncogenic mutations represent an enriched set of targets with in YAMC control cells. the capacity to control tumor formation of transformed cells, 0303 (3) Xenograft Assays both mouse and human. Such "cooperation response addic 0304 Tumor formation was assessed by sub-cutaneous tion' opens up a wide range of potential cancer therapeutic injection of cells into CD-1 nude mice (Cr1: CD-1-Foxn1", targets from among these genes. Therapies that act down Charles River Laboratories). Tumor size was measured by stream of initiating oncogenic lesions have the potential to caliper at 2, 3 and 4 weeks post-injection. Significance of ablate tumor formation despite the persistence of these onco difference in tumor size was calculated by the Wilcoxn genes. Importantly, CRG perturbation can reduce or ablate signed-rank test and by the t-test using directly matching tumor formation on a background of loss of p53 function, vector control cells for each perturbation. which currently confounds most chemotherapeutic strate 0305 Comparison of CRG expression in human colon gies. The data indicates that restoring p53 function is not cancer and mp53/Ras cells: Expression values from microar essential for disrupting tumor formation but can be replaced rays examining primary human cancer Samples and normal by targeting p53-negative tumors at the level of CRGs down tissue samples were obtained from the Stanford Microarray stream of oncogenic mutations. database. Representative probe sets were identified on the 0296 c) Materials and Methods cDNA microarrays for 69 of the CRGs in colon and pancre 0297 (1) Cells atic samples and 47 of the CRGs for prostate samples. T-sta 0298 Four polyclonal cell populations, control (Bleo/ tistics and unadjusted p-values were calculated by Welch's Neo), mp53 (p53175H/Neo), Ras (Bleo/RasV12) and mp53/ t-test, comparing the expression values for these probe sets in Ras (p53175H/RasV12) were derived by retroviral infection human cancer samples, compared to normal tissue samples, of low-passage polyclonal young adult mouse colon (YAMC) and for mp53/Ras compared to YAMC samples. cells (Xia and Land, 2007). YAMC cells (a gift from R. (0306 (4) TLDA QPCR Whitehead and A. W. Burgess) derived from the Immorto 0307 The TaqMan Low-Density Array (Applied Biosys mouse (Jat et al., 1991; Whitehead et al., 1993) (aka H-2 tems) consists of TaqMan qPCR reactions targeting the coop Kb?tSA58 transgenic mouse) expressing temperature-sensi eration response genes available (76 genes, listed in Table 2) tive simian virus 40 large T (tSA58) under the control of an and control genes (18S rRNA, GAPDH) in a microfluidic interferon Y-inducible promoter were maintained at the per card. To generate cDNA for qPCR analysis, quadruplicate missive temperature (33°C.) for large T in the presence of samples of total RNA (10 ug/sample) from YAMC, mp53/ interferon Y to support conditional immortalization in vitro. neo, bleo/Ras and mp53/Ras cells isolated from cells grown This permits expansion of the cells in tissue culture. In con in the presence or absence of serum were mixed with 1x US 2012/01 14670 A1 May 10, 2012 44
SuperScript II reverse transcriptase buffer, 10 mM DTT, 400 selected as CRGs for further analysis, CRG Raw OR CRG uM dNTP mixture, 0.3 ng random hexamer primer, 2 ul Normalized. Leta be the mean expression value for a given RNase0UT RNase inhibitor and 2 uL of SuperScript II gene in mp53 cells, b represent the mean expression value for reverse transcriptase in a 100 uL reaction (all components the same gene in Ras cells and d represent the mean expres from Invitrogen). RT reactions were carried out by denaturing sion value for this gene in mp53/Ras cells. Then, the selection RNA at 70° C. for 10 minutes, plunging RNA on to ice, criterion defines CRGs as adding other components, incubating at 42°C. for 1 hour and heat inactivating the RT enzyme by a final incubation at 70° C. for 10 minutes. 0308 For each sample, 82 uL of cDNA was combined with 328 ul of nuclease free water (Invitrogen) and an equal volume of TaqMan Universal PCR Master Mix No Amperase UNG (Applied Biosystems). The mixture was loaded into each of 8 ports on the card at 100 uL per port. Each reaction contained forward and reverse primer at a final concentration of 900 nM and a TaqMan MGB probe (6-FAM) at 250 nM final concentration. The cards were sealed with a TaqMan Low-Density Array Sealer (Applied Biosystems) to prevent cross-contamination. The real-time RT-PCR amplifications for genes under-expressed in mp53/Ras cells, as compared to were run on an ABI Prism 7900HT Sequence Detection Sys controls. tem (Applied Biosystems) with a TaqMan Low Density Array 0313 The multiplicativity score was calculated as (ab)/ Upgrade. Thermal cycling conditions were as follows: 2 min dis0.9 for genes over-expressed in mp53/Ras cells and as at 50° C., 10 min at 94.5° C., 40 cycles of 97° C. for 30 (d/a)*(d/b)sO.9 for genes under-expressed in mp53/Ras seconds, and annealing and extension at 59.7°C. for 1 minute. cells, as compared to controls. Each individual replicate cDNA sample was processed on a separate card. 3. Example 3 0309 Gene expression values were derived using SDS 2.0 Cooperation Response Genes as Targets for Anti Software package (Applied BioSystems). Differential gene Tumor Agents expression was calculated by the AACt method. Briefly, using threshold cycle (Ct) for each gene, change in gene expression 0314 Genomic analysis of tumor gene expression has was calculated for each sample comparison by the formulae: identified gene signatures that can predict tumor behavior (Alizadeh et al., 2000; Ramaswamy et al., 2003; van de Vijver AC(test sample) Octarget gene, test sampleCoreference gene, et al., 2002) and drug sensitivity (Bild et al., 2006: Hassane et test sanpie) 1. al., 2008: Lamb et al., 2006; Stegmaier et al., 2004), to aid AC control sample) Catarget gene, control sampleCorefer cancer diagnosis and treatment decisions (Nevins et al., 2003; ence gene, control sanpie) 2. Nevins and Potti, 2007: vant Veer and Bernards, 2008). Numerous studies indicate the utility of gene expression AACACtest-ACiccitato) 3. based strategies for identifying drugs that mimic or reverse 0310 (5) Statistical Analysis and CRG Identification biological states across different cell types and species (Has 0311 Expression values from the 50 microarrays pro sane et al., 2008; Hieronymus et al., 2006; Hughes et al., cessed were obtained using the RMA procedure with back 2000; Lamb et al., 2006; Stegmaier et al., 2004; Stegmaier et ground correction in Bioconductor. Differentially expressed al., 2007: Wei et al., 2006). To facilitate such comparisons, the genes were identified by the step-down Westfall-Young pro Connectivity Map (CMap) was created (Lamb et al., 2006). cedure in conjunction with the permutation N-test, or with The CMap is a compendium of gene expression signatures Welch's t-test. The family-wise error rate (FWER) was con from human cancer cells treated with pharmacologic agents, trolled at a level of 0.05. Gene expression values derived from which uses a pattern-matching strategy to connect query gene mp53/Ras RNA samples were compared to those from two expression signatures with reference profiles (Lamb et al., control cell populations, YAMC and bleo/neo cells, and dif 2006). Positive connectivity can identify common biological ferentially expressed genes within the intersection of both effects of compounds (Lamb et al., 2006). The CMap can also comparisons were selected for further analysis, p value of identify antagonists of disease states, via negative connectiv mp53/Ras vs. YAMC <0.05 AND {p value of mp53/Ras vs. ity, including novel putative inhibitors of Alzheimer's dis Bleo/Neo <0.05}. This selection process was executed in ease, dexamethasone-resistant acute lymphoblastic leukemia parallel using both raw and quantile normalized expression and acute myeloid leukemia stem cells (Hassane et al., 2008: values, with the genes forming the union of both procedures Lamb et al., 2006: Wei et al., 2006). 0315. The CMap was utilized to identify instances of being selected for further analysis, Raw OR Normalized. negative connectivity to the CRG signature, in order to find ESTs and “Transcribed loci' were rejected from the set of pharmacologic agents that reverse the CRG signature and genes thus selected. function to inhibit malignant transformation. This identified 0312 Genes that respond synergistically to the combina histone deacetylase inhibitors (HDACi) among the most tion of mutant p53 and activated Ras, i.e. with a fold-change negatively connected compounds in multiple instances. A larger than the Sum of fold-changes induced by mutant p53 variety of natural and synthetic compounds function as and activated Ras individually, were termed CRGs. The fol HDACi (Minucci and Pelicci, 2006) and induce cell cycle lowing procedure was applied in parallel to mean values of arrest, differentiation, and apoptosis in human cancer cell raw and quantile normalized expression measurements, with lines in vitro (Butler et al., 2000: Gottlicher et al., 2001; the genes forming the union of both procedures being Hague et al., 1993; Heerdt et al., 1994). These drugs inhibit US 2012/01 14670 A1 May 10, 2012 45 the function of the histone deacetylase enzymes (HDACs), direct relationship between drug effects on gene expression which remove acetyl groups from lysine residues on histone and biological behavior of treated cells. Thus, reversion of the tails, condensing chromatin structure and preventing tran CRG signature can serve as an attractive tool set for the scription factor binding (Marks et al., 2000), associated with identification of new anti-cancer drugs. heterochromatin formation and transcriptional silencing (Ili 0317 a) Results Zuka and Smith, 2003; Jenuwein and Allis, 2001). Gene expression is highly dependent upon chromatin structure that 0318 (1) Identification of Compounds that Reverse the is regulated by the opposing activities of histone acetyltrans CRG Signature ferases (HATs) and HDACs (Marks et al., 2000). HDACiare 0319. The CRG signature represents the malignant state of currently under clinical evaluation as single agents (Carducci cells transformed by the cooperative effects of mp53 and Ras. et al., 2001; Gilbert et al., 2001; Gore et al., 2002; Kelly et al., Reversion of individual CRG expression by genetic means 2005; Kelly et al., 2003; Patnaiket al., 2002) or in combina has been shown to abrogate tumor formation capacity of tion with existing chemotherapeutic agents (Kuendgen et al., perturbed cells. Given that CRG reversal inhibits tumor for 2006). mation, reversal of the CRG signature by pharmacologic 0316 HDACiappeared to be an attractive test case for the means similarly compromises the transformed State of cancer idea that pharmacologically-induced reversion of CRG cells. The CMap was utilized to identify compounds that expression can mediate tumor inhibitory activity for several reverse CRG expression in the human cancer cells tested, by reasons: first, because of the large number of HDACi hits searching for highly negatively connected instances from associated with reversal of CRG expression in the CMap among the hundreds of CMap gene profiles (Hassane et al., search; second, the observation that expression of most CRGs 2008: Lamb et al., 2006). Among the most negatively con are Suppressed in the transformation process, and third, nected compounds were multiple instances of HDACi. because of the potential clinical utility of HDACi in cancer including valproic acid (VA), which reverses much of the intervention. Accordingly, whether HDACi reverses the CRG CRG expression pattern, according to the gene profiles con signature was tested in the system in which CRGs were iden tained in the CMap (FIG. 12). Connectivity scores for the top tified, young adult mouse colon cells transformed by mutant 20 hits from the CMap (build 1) are shown in Table 12. p53 and activated Ras (mp53/Ras cells). Exposure to either of Although the most negatively connected compound is the two HDACi, valproic acid (VA) or sodium butyrate (NB), PI3-Kinase pathway inhibitor, LY-294.002, experimental vali induces an extensive reversal of the CRG expression signa dation was focused on HDAC1 because of their translational ture, significantly altering ~55% of CRGs. This includes five value, multiple instances of identification and strong negative down-regulated genes that promote apoptosis, Dapk, Fas, connectivity scores.
TABLE 12 Results of Connectivity Map comparison with CRG expression signature
CMAP Connectivity Instance Perturbagen Concentration Cells Score ESup ESdown 258 LY-294.002 OOOO1M MCF7 -1 -0.38 0.18 433 valproic acid .001M PC3 -O.96 -0.34 0.21 448 trichostatin A OOOOOO1M PC3 -O.96 -O.16 O.38 409 valproic acid .001M HIL60 -0.95 -0.36 O.18 1024 haloperidol OOOO1M MCF7 -0.94 -O.28 O.25 327 arachidonyltrifluoromethane OOOO1M MCF7 -0.91 -O42 (0.09 1014 trichostatin A OOOOO1M MCF7 -O.90 -O.23 O.28 901, S114445 OOOO1M MCF7 -O.90 -O.39 O.12 421 trifluoperazine OOOO1M MCF7 -O.89 -O.35 0.15 869 wortmannin OOOOO1M MCF7 -O.89 -O.19 O.31 255 dexamethasone OOOOO1M MCF7 -0.86 -0.24 O.25 915 topiramate OOOOO3M MCF7 -0.86 -0.34 0.14 1022 sirolimus OOOOOO1M MCF7 -0.86 -O.30 O.18 1113 doxycycline OOOO144M MCF7 -0.84 -O.33 O.14 833 5255229 OOOO13M. MCF7 -0.81 -O.32 O.13 603 nifedipine OOOO1M MCF7 -0.81 -O.29 O16 308 Sulindac sulfide OOOOSM MCF7 -O.80 -O.33 O.12 543 15-isoquinolinediol OOO1M HL60 -O.80 -0.20 O.25 458 valproic acid .001M PC3 -O.79 -O.29 O16 332 trichostatin A OOOOOO1M MCF7 -O.78 -O.26 O.19
Noxa, Perp, and Sfrp2. Gene perturbation experiments in 0320 (2) HDAC Inhibitors Antagonize the Transformed mp53/Ras cells show that inhibiting HDACi-mediated induc Phenotype tion of three of these five CRGs reduces death sensitivity and permits tumor formation by HDACi-treated cells. This indi 0321) To investigate whether and how HDACiaffected the cates that the anti-tumor effects of HDACi are dependent transformed phenotype, young adult mouse colon (YAMC) upon restoring expression of the CRGS tested. A similar cells and their derivatives transformed mutant p53 and acti causal relationship between the anti-tumor effects of HDACi vated H-Ras (mp53/Ras) (Xia and Land, 2007) were exposed and induction of CRG expression was found in the human to either sodium butyrate (NB) or valproic acid (VA), two colon cancer cell line, SW480. Taken together, the data shows carboxylic acid HDACi that inhibit the activity of both class that changes in the CRG signature underlie HDACi sensitiv I and class II HDACs (Villar-Garea and Esteller, 2004). ity in both murine and human cancer cells, demonstrating a Transformed cells treated with 5 mMNB for three days in US 2012/01 14670 A1 May 10, 2012 46
10% FBS medium underwent a dramatic morphological connected compound, and NB, a related HDACi, were highly change, where the treated cells became larger, less refractile, similar, with 31/32 regulated genes in common between the and reached confluence at a lower cell density, while YAMC two drugs. As expected, increased expression of HDACi cell morphology appeared unaffected. HDACitreatment also induced genes correlated with an increase in histone acetyla inhibited Mp53/Ras cell proliferation over a range of concen tion at these gene promoters, while genes whose expression trations, where the maximal effects of NB and VA were was unaffected by HDACitreatment show little difference in reached at 1 to 2.5 mM and 2.5 to 5 mM, respectively. These promoter acetylation upon drug treatment (FIG. 15). compounds affect human cancer cell line behavior in vitro in 0325 The antagonism of CRG expression correlates with the millimolar range and even higher concentrations are a reversion in phenotypes associated with cell transformation. required in vivo (Villar-Garea and Esteller, 2004). Therefore mp53/Ras orYAMC cells were treated with 2.5 mMNBorVA HDACi treatment sensitized cells to anoikis, Suspension-in to examine the effects of these compounds on cell prolifera duced apoptosis, without causing an increase in apoptosis tion over time. mp53/Ras cell proliferation was completely when cells were cultured on substratum (FIGS. 14B and C). inhibited by NB or VA treatment, indicating that HDACi Cells, pre-treated with VA or NB, were suspended in meth induce cell cycle arrest, apoptosis, or both in mp53/Ras cells. ylcellulose to induce cell death, which was measured by In contrast, YAMC cells did not proliferate under these con TUNEL staining. Importantly, reversion of the CRG signa ditions, and HDACi treatment did not alter this behavior. ture also correlated with strong tumor inhibitory activity of 0322 The dramatic anti-proliferative effects of HDACion both HDACi (FIG. 14D). Pre-treatment of cells with either mp53/Ras cells indicated that these compounds inhibit criti VA or NB in vitro, followed by xenografting HDACi-treated cal properties of transformed cells, such as growth factor cells into nude mice, produced significantly Smaller tumors independent proliferation, resistance to growth-inhibitory than those caused by untreated control cells. In this context, signals, or decreased sensitivity to pro-apoptotic signals (Ha HDACiapparently act downstream of the oncogenic proteins, nahan and Weinberg, 2000). HDACi was investigated to mp53 and Ras, as their levels remain unaltered and the GTP determine if it abrogated the transformed phenotype by per binding activity of mutant Ras remains unaffected. These data forming two cell transformation assays, in vitro colony for indicate that HDACiantagonize both the CRG expression mation in Soft agar and in vivo tumor formation in immuno signature and malignant transformation in mp53/Ras cells compromised (nude) mice. HDACi treatment completely downstream of the cooperating oncogenic mutations. inhibited the ability of mp53/Ras cells to form colonies in soft 0326 (4) Suppression of CRG induction by HDACi agar, and tumors in nude mice, indicating that HDACiantago nize the transformed phenotype of mp53/Ras cells. To 0327. Among the many changes in CRG expression directly investigate whether HDACi-treated mp53/Ras cells induced by HDACi, a number of pro-apoptotic genes, includ lost the ability to divide or resist detachment-induced cell ing Dapk (Deiss et al., 1995; Raveh et al., 2001), Fas (Mus death under these conditions, HDACi-treated mp53/Ras or chen et al., 2000), Noxa (Chen et al., 2005: Oda et al., 2000; YAMC cells were suspended in methylcellose, either in the Shibue et al., 2003; Villungeret al., 2003), Perp (Attardiet al., presence or absence of 10% FBS and ITS-A. In methylcellu 2000; Ihrie et al., 2003), and Sfrp2 (Lee et al., 2006), show lose supplemented with 10% FBS and ITS-A, the prolifera increased expression. A causal role for reversion of the Fas tion of both mp53/RasandYAMC cells, as measured by BrdU gene in the pro-apoptotic and anti-tumor effects of HDACi incorporation, was reduced by HDACitreatment (FIG. 13A). was established in a murine model of leukemia (Insinga et al., HDACi treatment also induced cell death in mp53/Ras cells 2005). To test whether such alterations in gene expression under these conditions, as measured by TUNEL staining, contribute to the biological effects of HDACitreatment in the while the percentage of apoptotic YAMC cells decreased system, cells were established in which gene induction in the (FIG. 13B), indicating that HDACi can selectively restore context of HDACi treatment was blocked or significantly sensitivity to detachment-induced cell death, or anoikis, in inhibited. To do this, polyclonal cell populations of mp53/Ras transformed cells. In methylcellose without FBS or ITS-A, cells stably expressing shRNA molecules targeting CRGs of NB induced a greater than five-fold increase in cell death in interest were generated (Table 13). Cell populations exhibited mp53/Ras cells (FIG. 13C). Under these culture conditions, a reduction in CRG expression in mp53/Ras cells without NB did not decrease apoptosis in YAMC cells, which had lost HDACitreatment. Importantly, upon HDACitreatment, CRG viability to approximately 90% regardless of HDACi treat expression was induced in control cells, but in shRNA-ex ment. pressing cells, this induction was diminished or, in the case of 0323 (3) HDACi Reverse Cooperation Response Gene Fas, completely blocked. Similar effects were observed with Signature in mp53/Ras Cells multiple, independent shRNA targeting sequences, utilized to 0324. Although the CMap identifies HDACiasantagoniz control for off-target effects of each shRNA (FIG. 16). In ing the CRG signature in the human cancer cells included in addition, the reduction in Noxa or Perp expression was res the database, the effect of these drugs on CRG expression in cued by expression of a shRNA-resistant form of the cDNA genetically tractable cell transformation systems has not been for each of these genes (FIG. 16). Finally, neither HDACi tested. Thus, the response of 56 CRGs in mp53/Ras cells to treatment by itself, nor interference with CRG re-expression treatment with VA or sodium butyrate (NB) was examined to upon HDACi treatment affected the expression of the mp53 determine whether these compounds have similar effects on or Ras oncogenes, demonstrating that RNA interference with CRG expression in cells where CRG expression is known to HDACi-mediated gene induction operates downstream of the be essential for tumor formation. Gene expression profiles initiating oncogenic mutations. Taken together, these data were examined using TaqMan Low-Density Arrays (TLDA) show that the response of CRG expression to HDACi can be with probes to all available CRGs, comparing gene expres strongly inhibited. Moreover, the expression of four other sion in mp53/Ras cells treated with VA or NB to untreated pro-apoptotic genes that are not down-regulated in mp53/Ras controls. Notably, the expression of about 55% of the 56 vis-a-vis YAMC cells, i.e. Bad, Bakl, Bax, and Bid, was CRGs tested responded to HDACiexposure with a clear trend unaffected by HDACitreatment. The data thus indicates that towards reversion of the expression pattern (FIG. 14A). The HDACi revert the CRG expression signature in mp53/Ras responses to both VA, identified by the CMap as a negatively cells with some degree of selectivity.
US 2012/01 14670 A1 May 10, 2012 48
TABLE 13 - continued Short interfering hairpin RNA constructs generated to interfere with HDACi induced gene expression. Gene Target Region Oligonucleotide Sequences
3745 Forward: 5 - GATCCCCCAGCATATATCTCCTAATCTTCAAGA GAGATTAGGAGATATATGCTGTTTTTGGAAA-3 (SEO ID NO: 69) Rever Se: 5 - AGCTTTTCCAAAAACAGCATATATCTCCTAATC TCTCTTGAAGATTAGGAGATATATGCTGGGG-3 (SEO ID NO: 7O) Specific shRNA molecules were designed using the Whitehead siRNA algorithm. The shRNA oligonucleotides were produced by Integrated DNA Technologies, annealed, and ligated into pRetroSuper. Gene names, target region/identifier and oligonucleotide sequences are indicated.
0328 (5) HDACi Act Downstream of Ras 0332 (7) CRG Induction is Essential for Tumor Inhibition 0329 Intransformed liver cells, the induction of apoptosis by HDACi by NB has been reported to be associated with decreased 0333. To determine whether the tumor inhibitory effects of farnesylated Ras expression and ERK 1/2 phosphorylation HDACi are also dependent on CRG induction, control and (Jung et al., 2005). To determine whether the pro-apoptotic shRNA expressing mp53/Ras cells were pre-treated with and anti-tumorigenic effects of HDACi on mp53/Ras cells HDACi, and tested the tumor formation capacity of these correlates with decreased Ras expression, the expression of cells in xenograft assays in nude mice. Because both HDACi exogenous mutant H-Ras was examined in NB-treated Ras, VA and NB show similar effects on CRG expression (FIG. and mp53/Ras cells. The data show that the expression levels 14), and NB is a stronger death sensitizing agent (FIG. 16A). of the exogenous mutant H-Ras protein were unaffected by animal experiments were restricted to NB treatment to mini NB treatment. In addition, expression levels of p21Cip1, a mize animal use. Interference with Dapk, Fas, Noxa, Perp, cyclin-dependent kinase inhibitor that is reportedly up-regu and Sfrp2 induction destroyed tumor inhibition by HDACi, lated by HDACi treatment (Archer et al., 1998; Gui et al., with multiple, independent shRNA targets producing similar 2004; Jung et al., 2005; Richon et al., 2000), were also deter results, demonstrating a role for these genes in HDACi-me mined in NB-treated YAMC, mp53, Ras, and mp53/Ras cells. diated tumor inhibition. However, untreated cells with Notably, NB did not affect p21Cip1 expression in any of the reduced expression of Fas or Sfrp2 formed significantly cell lines tested. HDACithus appears to antagonize the cancer larger tumors than controls, indicating that these genes con phenotype downstream of activated Ras and independent of trol tumor formation in general, rather than in an HDACi p21Cip1. dependent manner. To again control for off-target effects of shRNAS, tumor formation capacity of cells expressing 0330 (6) Interference with CRG Induction by HDACi shRNA-resistant Noxa or Perp in combination with shRNA Mediates Anoikis Resistance targeting these genes was compared to cells expressing only 0331 Because CRG induction by HDACi correlates with shRNA targeting these genes (FIG. 16B). Rescue of Noxa or increased sensitivity to anoikis, the contribution of pro-apo Perp gene expression restored HDACi sensitivity to these ptotic CRGs to this response was investigated. Anoikis was cells, reducing tumor formation by HDACi-treated cells with induced by cell suspension in methylcellulose after pre-treat high levels of Noxa or Perp expression. Moreover, interfer ment of cells with HDACi. Interference with Dapk, Fas, ence with Elk3 or Etv 1 expression did not alter tumor forma Noxa, Perp and Sfrp2 induction reduced anoikis in HDACi tion in HDACi-treated mp53/Ras cells, demonstrating that treated mp53/Ras cells (FIG. 17A), demonstrating that tumor formation is not altered by shRNA expression per se. HDACi-induced death sensitization depends on the induction Thus, while Fas and Sfrp2 control tumor formation capacity of these CRGs. Only Sfrp2 reduction altered death sensitivity of cells in an HDACi-independent manner, the CRGs Dapk, in untreated cells, indicating this gene controls apoptosis in an Noxa and Perp appear to mediate the tumor inhibitory effects HDACi-independent manner. Similar results were observed of HDAC1. with multiple, independent shRNA targeting molecules, indi 0334 Interference with Dapk1, Fas, Noxa, Perp, Sfrp2 or cating that the effects are specific to the targeted genes (FIG. Zac 1 re-expression also rescued the ability of HDACi-treated 18). To further control for shRNA-mediated off-target effects, mp53/Ras cells to form tumors in vivo, indicating that the genetic rescue experiments were performed. Cells expressing anti-tumorigenic effects of HDACi also depend on the restored expression of all six cooperation response genes. The shRNA-resistant Noxa cDNA were assayed for death sensi rescued tumor formation in HDACi-treated mp53/Ras cells tization by HDACi. The protective effects of Noxa reduction expressing Noxa or Zac 1 shRNAs was reversed by introduc were reversed by restoration of Noxa expression (FIG. 17B tion of shRNA-resistant Noxa or Zac1 cDNAs, respectively and FIG. 16B), showing that HDACi-induced death sensitiv (Table 14). Moreover, interference with Elk3 or Etv 1 expres ity is Noxa dependent. In addition, to control for interference sion did not rescue tumor formation in HDACi-treated mp53/ between HDACi effects and shRNA expression in general, Ras cells (Table 14). The ability of the shRNAs to rescue cells with shRNA knock down of the CRGs Elk3 or Etv 1. tumor formation in HDACi-treated mp53/Ras cells is there (FIG.16C), which are not induced by HDACitreatment, did fore due to specifically interfering with the re-expression of not influence HDACi-induced anoikis (FIG. 17C). Taken Dapk1, Fas, Noxa, Perp, Sfrp2, or Zac1. HDACi thus com together, these results indicate that HDACi-induced anoikis promise the malignant phenotype of cancer cells through sensitization is dependent upon the re-expression of the antagonizing the regulation of cooperation response genes CRGs Dapk, Fas, Noxa, and Perp, while Sfrp2 controls cell essential to the transformation process downstream of coop death in an HDACi-independent manner. erating oncogenic mutations. US 2012/01 14670 A1 May 10, 2012 49
cells. Reversion of the CRG signature by pharmacologic TABLE 1.4 means likewise antagonizes the transformed State. Here, is disclosed that the CRG signature can be pharmacologically Interference with cooperation response gene re-expression rescues tumor formation in HDACi-treated Mp33/Ras cells. reversed by HDACi, and importantly, that the anti-tumor activity of HDACi is mediated via induction of CRG expres UT NB sion. Treatment of mp53/Ras cells with VA or NB, two car Cell Line Tumors Tumors boxylic acid HDACi, reversed the expression of about 55% of Vector 1616 1.16 the 56 CRGs tested. Among the regulated CRGs area number Dapk1 shRNA 44 44 of pro-apoptotic genes that are repressed in cancer cells and Fas shRNA 44 44 Perp shRNA 44 44 reactivated by HDACi. These include the CRGs Dapk, Fas, Sfrp2 shRNA 44 44 Noxa, Perp, and Sfrp2, whose induction contributes to the cell Noxa shRNA 8.8 7/8 death sensitivity and tumor formation capacity of cells in two Noxa 44 1.f4 Noxa shRNA Noxa 44 Of4 modes. Dapk, Noxa and Perp underlie the apoptosis-inducing Zac1 shRNA 10.10 8.10 and tumor-inhibitory activities of HDACi in a specific man Zac1 2.2 O2 ner. Fas and Sfrp2 act to control these behaviors in a more Zac1 shRNAZac1 2.2 O2 Ek3 shRNA 44 Of4 general way, thus blocking HDACi effects in a non-specific Etv1 shRNA 44 Of4 fashion. The consistent dependence of HDACi on CRGs in both murine mp53/Ras-transformed cells and in human colon mp53, Ras cells infected with shRNA constructs against Dapk1, Elk3, Etv1, Fas, Noxa, Sfrp2, and Zac1 were plated at 458,000 cells per 15 cm collagen IV-coated dish and treated cancer cells with similar mutations indicates that this is a with 2.5 mMNB for three days in 10% FBS medium for three days. The cells were then re-suspended in additive-free medium and injected subcutaneously into general relationship, extending beyond the genetically trac the flanks of CD1 nude mice at 500,000 cells per 150 LL. table murine model system. Dependence of the biological Tumor volume was measured using electronic Wernier calipers after four weeks, The results for multiple independent shRNA constructs for Dapk1, Fas, Noxa, Perp, Sfrp2, effects of HDACi on the restored expression of CRGs dem and Zac1 are shown, including cells expressing shRNA-resistant Noxa or Zac1 cDNAs, onstrates that HDACiantagonize the transformed phenotype, 0335 (8) CRG Induction Mediates HDACiSensitivity in at least in part, by reversing oncogene-dependent repression Human Cancer Cells of gene expression. 0336 While the murine model system allows a high 0339. In addition to establishing a role for CRGs underly degree of genetic control, it is critical to determine whether ing the activity of these pharmacologic agents, the data shown similar gene dependencies exist in human cancer cells. In here reveal a role for three additional CRGs not previously order to test whether the dependence of HDACi on CRG found to be essential in transformation. These genes, Sfrp2. induction is similar in human colon cancer cells, the SW480 Dapk, and Noxa, appear to act in two separate ways to control cell line was used because it harbors mutations in p53 and tumor formation. Because reduced expression of Sfrp2 leads Ras, among a number of oncogenic mutations (McCoy et al., to reduced apoptosis and formation of larger tumors in both 1984; Rodrigues et al., 1990). HDACitreatment of these cells untreated and HDACitreated cells, Sfrp2 expression appears significantly increases expression of the CRGs Dapk, Fas, to act as a restriction point in transformation, despite the fact Noxa, Perp and Sfrp2, as measured by SYBR Green QPCR that Sfrp2 over-expression in mp53/Ras cells fails to reduce with gene specific primers. Because Dapk is the gene most the tumor formation capacity of these cells. A role for Sfrp2 in strongly induced by NB treatment of SW480 cells, and malignant transformation is consistent with the observation because it mediates the anti-tumor effect of NB in mp53/Ras that expression of this gene is frequently lost in human cancer cells in an HDACi-dependent manner, this gene was chosen (Qi et al., 2006: Zou et al., 2005). While the CRGs Dapk (Chu to test for CRG dependence of HDACi in human cells. RNA et al., 2006: Kong et al., 2005; Kong et al., 2006; Kuester et interference reduced the levels of Dapkin untreated SW480 al., 2007: Schildhaus et al., 2005) and Noxa (Mestre-Escori cells by ~80%, and interfered with the induction of Dapk by huela et al., 2007) can also be lost in human cancer, they HDACi, suppressing Dapk levels to less than half that of cells appear to play a different type of role in malignant transfor without shRNA. Interference with Dapkinduction by HDACi mation. Their importance is only revealed in the context of restored tumor formation in nude mice of HDACi-treated HDACi-induced changes in cell behavior, with no observed SW480 cells with minimal effects on untreated tumor size, difference in cell death potential or tumor formation when demonstrating the dependence of HDACi on expression of these genes are perturbed individually (FIGS. 17A and B). the CRG Dapkin human cancer cells. Again, multiple inde This indicates the necessity for changes in other CRGs in pendent shRNA targets were used to inhibit Dapk induction addition to Dapk or Noxa levels in order for the effects of by HDACi, to control for off-target effects of shRNA mol Dapk or Noxa to be apparent, consistent with the idea that ecules, with similar effects on Dapk expression and tumor CRGs can act together to more effectively control malignant formation. In addition, levels of the oncogenic p53 and Ras transformation. proteins are unaffected by either HDACi treatment or Dapk 0340 One critical finding here is the ease with which knock-down in SW480 cells, showing that the effects of transformed cells can escape cell death and tumor inhibition HDACi and Dapk shRNA are downstream of the initiating by HDACi. The loss of any of 5 CRGs tested can reduce or oncogenic mutations. Therefore, the anti-tumor effects of prevent the biological effects of HDACitreatment. This indi HDACi appear to depend on CRG induction in both murine cates simple and parallel paths for tumors to evade the effects and human cancer cells. of HDACi, a feature that does not extend to other pharmaco 0337 b) Discussion logical agents. Nevertheless, the reletive ease with which 0338 Synergistic regulation of gene expression by coop HDACi resistance can beachieved reaffirms the importance erating oncogenic mutations is a key feature of malignant of multi-drug combinations, with different modes of action or transformation, demonstrated by the dependence on CRG target sets of genes, in order to restrict the ability of tumor levels in control of tumor formation capacity of transformed cells to avoid drug effects. The complexity of the CRG sig US 2012/01 14670 A1 May 10, 2012 50 nature allow for identification and testing of compounds HDACi. Suspended cells were pelleted, washed and fixed in alone and in combination that affect non-overlapping Sub 4% paraformaldehyde for TUNEL staining. groups of CRGs. 0349 For tumor formation studies, cells were treated with 0341 Finally, the observation that reversion of the CRG HDACi as indicated above, then trypsinized, counted and signature underlies the tumor inhibitory activity of HDACi, injected sub-cutaneously into the flanks of CD-1 nude mice at which depend on altered CRG expression for their effects, has a multiplicity of 5x10 cells per injection. Mice were important practical implications. The responsiveness of the observed and tumors measured for 4 weeks post-injection by CRG signature to pharmacologic agents is expected to func caliper. tion as a diagnostic indicator to predict tumor sensitivity to 0350 SW480 cells were grown at 37° C. in DMEM with such agents. Moreover, because the CRGs are known to be 10% FBS and antibiotics. For HDACi treatment of SW480, essential regulators of cancer, the mechanism of action of cells were plated into medium containing either 2.5 mMNB, drugs that reverse the CRG signature can work through Such 2.5 mMVA or no drug for 72 hours at a density of 1.37x10° changes in gene expression. The significance of CRG rever cells per 15-cm dish. Cells were then harvested for RNA sion in the response of cancer cells to pharmacological isolation, or used for tumor formation studies as described agents, such as HDACi, provides proof of principle that the above, except that SW480 cells were injected at a multiplicity CRG signature can be used as a powerful tool for anti-cancer of 5x10° cells per injection. drug screening. This is an exciting prospect for the identifi 0351 (3) TLDA QPCR: cation of new Small molecular drugs with potential for cancer 0352. The TaqMan Low-Density Array (Applied Biosys therapy. tems) consists of TaqMan qPCR reactions targeting the coop eration response genes available and control genes (18S 0342 c) Materials and Methods rRNA, GAPDH) in a microfluidic card. TLDA were used to 0343 (1) Connectivity Map Query: independently test gene expression differences observed in 0344) To facilitate rapid cross-species queries, a local ver the CMap database which used Affymetrix arrays. To gener sion of the CMap database was created in which the CMap ate cDNA for qPCR analysis, quadruplicate samples of RNA dataset was downloaded from GEO (accessioni GSE5258) was isolated from untreated YAMC cells or mp53/Ras cells and treatment-control instances for each drug were generated treated with either 2.5 mMVA, 2.5 mMNB or no drug for 72 using annotation provided in Lamb et al. (Lamb et al., 2006). hours, using the RNeasy and Qiashredder kits (Qiagen). Ten Since Affymetrix IDs are human-specific in the CMap, ug of RNA per sample were mixed with 1x SuperScript II Affymetrix IDs for each drug treatment instance were First Strand buffer, 10 mM DTT, 400 uM dNTP mixture, 0.3 mapped to gene symbols. The median expression difference ngrandom hexamer primer, 2 LL RNaseGUT RNase inhibitor of multiple Affymetrix IDs was used when a many-to-one and 2 LL of SuperScript II reverse transcriptase in a 100 uL relationship existed between Affymetrix IDs and unique gene reaction (all components from Invitrogen). RT reactions were symbols. This local gene symbol-based version of the CMap carried out by denaturing RNA at 70° C. for 10 minutes, performed similarly to the Affymetrix ID-based version plunging RNA on to ice, adding other components, incubat originally described by Lamb et al. (Hassane and Jordan, ing at 42°C. for 1 hour and heat inactivating the RT enzyme unpublished). by a final incubation at 70° C. for 10 minutes. 0345 The query signature consisted of 19 up-regulated 0353 For each sample, 82 uL of cDNA was combined CRGs and 39 down-regulated CRGs for which gene symbol with 328 ul of nuclease free water (Invitrogen) and an equal annotation was present in the CMap data set. The Kolmog volume of TaqMan Universal PCR Master Mix No Amperase orov-Smirnov-based gene set enrichment analysis (GSEA) UNG (Applied Biosystems). The mixture was loaded into algorithm (Subramanian et al., 2005) was used to obtain each of 8 ports on the card at 100 uL per port. Each reaction enrichment scores (ES) for both up-regulated (ES) and contained forward and reverse primer at a final concentration down-regulated (ES) CRGs for each CMap drug treat of 900 nM and a TaqMan MGB probe (6-FAM) at 250 nM ment instance. The values ofES, and ES, were combined final concentration. The cards were sealed with a TaqMan to generate a CMap “connectivity score” as described (Lamb Low-Density Array Sealer (Applied Biosystems) to prevent et al., 2006). Drugs that mimic the CRG signature attain a cross-contamination. The real-time RT-PCR amplifications positive connectivity score whereas drugs that oppose the were run on an ABI Prism 7900HT Sequence Detection Sys CRG signature (and thereby are predicted as potential anti tem (Applied Biosystems) with a TaqMan Low Density Array cancer drugs) attain a negative connectivity Score. Upgrade. Thermal cycling conditions were as follows: 2 min 0346 (2) Cell Culture. Anoikis and Tumor Formation at 50° C., 10 min at 94.5° C., 40 cycles of 97° C. for 30 Assays: seconds, and annealing and extension at 59.7°C. for 1 minute. (0347 The YAMC cell system (Jat et al., 1991; Whitehead Each individual replicate cDNA sample was processed on a et al., 1993) and transformation of these cells by mp53/Ras separate card. are described elsewhere (Xia and Land, 2007). YAMC and 0354 Gene expression values were derived using SDS 2.2 mp53/Ras cells were cultured for two days at 39°C. in RPMI Software package (Applied BioSystems). Differential gene with 10% FBS without interferon-Y on collagen IV-coated expression was calculated by the AACt method. Briefly, using dishes. Cells were then re-plated on collagen IV-coated threshold cycle (Ct) for each gene, change in gene expression dishes into the same medium containing either 2.5 mMNB, was calculated for each sample comparison by the formulae: 2.5 mMVA, or no drug for 72 hours at a density of 4.58x10 AC(test sample) Octarget gene, test sample) Coreference gene, cells per 15-cm dish. Cells were harvested for RNA isolation test sanpie) 1. at this point, or used for biological assays as described below. AC control sample) Octarget gene, control sampleCorefer 0348 For anoikis assays, cells were then trypsinized, ence gene, control sanpie) 2. counted and Suspended in methylcellulose at a density of 1.5x10 cells/mL for an additional 72 hours in the absence of AACACtes-ACiccitato) 3. US 2012/01 14670 A1 May 10, 2012
0355 (4) Semi-Quantitative PCR 0356. Cells were cultured for two days at 39° C. in 10% - Continued FBS medium w/o interferon-Y on collagen IV-coated 15 cm mouse Fas receptor : dishes. Then, the cells were washed twice in PBS and cultured Forward: for an additional day w/o serum at 39°C. Cells were plated at (SEQ ID NO: 75) the following densities:YAMC 321,430, Mp53/Ras 250, 5 - CCG. AGA GTT TAA AGC TGA. GG-3 000, and Mp53/Ras derivatives 250,000. Cells were then Rewerse: trypsinized, pelleted down at 1,500 rpm for 5 minutes at 4°C., (SEQ ID NO: 76) snap-frozen in liquid N and stored at -80°C. Total RNA was 5 - CCA. GGA GAA TCG CAG TAG AAG TCT GG-3 extracted using Qiashredder and RNeasy Mini RNA extrac human Fas receptor : tion kits (Qiagen). Five ug of total RNA was used for reverse Forward: transcription reactions. The RNA was first mixed with 10 LIL (SEQ ID NO: 109) 5x First strand buffer, 5 uL 0.1 M dithiothrietol, 5 uL 10 s" -TAT CAC CAC TAT TGG AGT CA-3' pmol/LL random hexamers (Invitrogen) and 2 uL 10 mM Rewerse: dNTPs (Invitrogen) and denatured for 10 minutes at 70° C. (SEQ ID NO: 110) After a quick chill on ice, 1 uL of Single Strand II reverse 5 - ACG AAG CAG TTG AAC TTT CTG TT-3' transcriptase (Invitrogen) and 1 uL of RNaseGUT (Invitro gen) were added to each reaction. Reverse transcription reac mouse GAPDH: tions were then incubated at 42° C. for one hour. Semi Forward: quantitative PCR reactions were performed using 1 uI. (SEQ ID NO: 77) cDNA, 5 uL 10x Taq Polymerase buffer (-MgCl), 1.5 LL 5'-ACC ACA GTC CAT GCC ATC AC-3' MgCl2, 1.5 LL 10 umol/LL forward and reverse primers, 2 LL Rewerse: DMSO, 1 uL 10 mM dNTPs, and 0.5 uL Taq Polymerase (SEQ ID NO: 78) (Invitrogen). All primers used an annealing temperature of s" -TCC ACC ACC CTG TTG CTG TA-3' 58° C. All cDNAs were amplified for 32 cycles with the mouse Noxa: exception of GAPDH, which was amplified for 28 cycles. Forward: (SEQ ID NO: 79) s" -TGA GTT CGC AGC TCA ACT C-3' SemiQuantitative RT-PCR primers used mouse Dapk: Rewerse: Forward: (SEQ ID NO : 80) (SEO ID NO : 71.) s" -TCA GGT TAC TAA ATT GAA GAG CTT GGA. AAT C-3 5 " - GGA. GAC ACC AAG CAA. GAA. A-3 human Noxa: Reverse: Forward: (SEO ID NO : 72) (SEQ ID NO: 111) 5'-ACA AGG AGC CCA. GGA. GAT-3' 5-TCT CAG GAG CAC GTT TCA TCA-3' human Dapk1: Rewerse: Forward: (SEQ ID NO: 112) (SEQ ID NO: 107) 5'-ATT CCA TCT TCC GTT TCC AAG GGC-3' s' - GGG TGT TTC GTC GAT TAT CAA. GA-3' mouse Perp: Reverse: Forward: (SEQ ID NO: 108) (SEQ ID NO: 81) s' - TCG CCC ATA CTT GTT GGA GAT-3' s' - CCA CAT CCA GAC ATC GTC-3' mouse Dffo : Rewerse: Forward: (SEQ ID NO: 82) (SEO ID NO : 73) 5 - TAC CAG GGA GAT GAT CTG G-3 5'-ACC CAA. ATG CGT CAA GTT-3' human Perp: Reverse: Forward: (SEO ID NO : 74) (SEQ ID NO: 113) s' - GCT GCT. TCA TCC ACC ATA-3' s" -TGG TTG CAG TCT ACG GAC C-3 mouse Elk3 : (Same as SQ RT-PCR) Rewerse: Forward: (SEQ ID NO: 114) (SEO ID NO: 89) 5 - TCA. GGA, AGA CAA GCA TCT GGG-3' 5-TCC TCA CGC GGT AGA. GAT CAG-3 mouse Reprimo : Reverse: Forward: (SEO ID NO: 90) (SEQ ID NO: 83) 5 - GTG GAG GTA CTC GTT GCG G-3 5-TGA, ATT CAG TGG GC-3 mouse EtW1: Rewerse: Forward: (SEQ ID NO: 84) (SEQ ID NO: 91) s" - CAC TGC CTC CAC CTC TTT AG-3' 5 - GCA AGT, GCC TTA CGT GGT CA-3' mouse Sfro2: Reverse: Forward: (SEQ ID NO: 92) (SEQ ID NO: 85) s' - GCT. TCA GCA AGC CAT GTT TCT, T-3' 5-ATG ATG ATG ACA ACG ACA. TAA TG-3 US 2012/01 14670 A1 May 10, 2012 52
- Continued - Continued Reverse: (SEQ ID NO: 86) mouse EtW1: 5 " - GAT GAC AAC GAC ATA ATG GAA. ACG-3 Forward: (SEQ ID NO: 91) human Sfro2: 5 - GCA AGT, GCC TTA CGT GGT CA-3' Forward: (SEQ ID NO: 115) Rewerse: 5-ATG ACC TAG ACG. AGA CCA TCC-3' (SEQ ID NO: 92) s' - GCT. TCA GCA AGC CAT GTT TCT, T-3' Reverse: (SEQ ID NO: 116) mouse Fas receptor : (Same as SQ RT-PCR) 5 - GTC GCA CTC AAG CAT GTC G-3 Forward: (SEO ID NO : 75) mouse Zac1: 5 - CCG. AGA GTT TAA AGC TGA. GG-3 Forward: (SEO ID NO : 87) Rewerse: 5'-ATC CTG TTC CTA CCT CAT ATG C-3' (SEO ID NO : 76) 5 - CCA. GGA GAA TCG CAG TAG AAG TCT GG-3 Reverse: (SEQ ID NO: 88) mouse Noxa: (Same as SQ RT-PCR) 5 - CTG GAT. CTG CAA CTG AAA CT-3' Forward: (SEO ID NO : 79) 0357 (5) Real-Time Quantitative PCR: s" -TGA GTT CGC AGC TCA ACT C-3' 0358 Total RNA was extracted using the RNeasy and Rewerse: Qiashredder kits (Qiagen). Five ug of RNA was mixed with (SEQ ID NO: 80) 1x SuperScript II First Strand buffer, 10 mM DTT, 4001 uM 5-TCA GGT TAC TAA ATT GAA GAG CTT GGA AAT C-3 dNTP mixture, 0.15 ng random hexamer primer, 1 uL RNase mouse Perp: OUT RNase inhibitor and 1 uL of SuperScript II reverse Forward: transcriptase in a 50LL reaction (all components from Invit (SEO ID NO: 93) rogen). RT reactions were carried out by denaturing RNA at 5 -ATG GAG TAC GCA TGG GGA C-3 70° C. for 10 minutes, plunging RNA on to ice, adding other Rewerse: components, incubating at 42°C. for 1 hour and heat inacti (SEQ ID NO: 94) vating the RT enzyme by a final incubation at 70° C. for 10 5 - GAT TAC CAG GGA GAT GAT. CTG GA-3 minutes. mouse Reprimo : 0359 PCR reactions were prepared in triplicate using (per Forward: reaction) 1 uL cDNA (diluted 1:10), 1xSYBR Green Univer (SEO ID NO: 95) sal Master Mix (Bio-Rad), and 5 umol forward and reverse 5 - GTG TGG. T.GC AGA TCG CAG T-3 primers in a 25uI reaction Volume. All primers sets, listed in Rewerse: Table 13, used an annealing temperature of 58° C. PCR reac (SEQ ID NO: 96) tions were run on an iCycler (Bio-Rad). Fluorescence inten s' - ATC ATG CCT TCG GAC TTG ATG-3' sity values were analyzed by the AACt method to generate mouse RhoA: relative fold expression values. Forward: (SEO ID NO: 97) 5'-AGC TTG TGG TAA GAC ATG CTT G-3 Real-time PCR primers used mouse Dapk1 : (Same as SQ RT-PCR) Rewerse: Forward: (SEO ID NO: 98) (SEO ID NO : 71.) 5 - GTG TCC CAT AAA GCC AAC TCT AC-3 5 " - GGA. GAC ACC AAG CAA. GAA. A-3 mouse Sfro2: Reverse: Forward: (SEO ID NO : 72) (SEO ID NO: 99) 5'-ACA AGG AGC CCA. GGA. GAT-3' 5 - CAT CGA GTA. CCA GAA CAT GCG-3 mouse Dffb : (Same as SQ RT-PCR) Rewerse: Forward: (SEQ ID NO: 1.OO) (SEO ID NO : 73) 5 - GAA GAG CGA, GCA CAG GAA CT-3' 5'-ACC CAA. ATG CGT CAA GTT-3' mouse Zac1: Reverse: Forward: (SEO ID NO : 74) (SEQ ID NO: 101) s' - GCT GCT. TCA TCC ACC ATA-3' 5'-ACC TCA AGT CTC ACG CGG AAG AAA-3 mouse Elk3 : (Same as SQ RT-PCR) Rewerse: Forward: (SEQ ID NO: 102) (SEO ID NO: 89) 5-TGA CAC AGG AAG TCC TTG CAT CCT-3 5-TCC TCA CGC GGT AGA. GAT CAG-3 0360 (6) TUNEL Assay and Flow Cytometry Analysis: Reverse: (SEO ID NO: 90) 0361 Paraformaldehyde-fixed cells were pelleted and 5 - GTG GAG GTA CTC GTT GCG G-3 washed with PBS containing 0.1% BSA. Cells were perme abilized in 0.1% sodium citrate, 0.1% Triton X-100 for 2 US 2012/01 14670 A1 May 10, 2012
minutes on ice. Cells were washed and re-suspended in 50LL. w/0.1% BSA and then permeabilized for 10 minutes at room of TUNEL enzyme and labeling solution (Roche) or 50 uL., of temperature in PBS w/0.1% BSA, 0.1% Tween 20 (PBS-T) labeling solution alone as a negative control for one hour at with occasional vortexing. Permeabilized cells were then 37°C. The positive control sample was first incubated for 10 incubated in a 1:10 dilution of monoclonal anti-BrdU anti minutes at room temperature with DNase enzyme (Invitro body (Becton Dickinson) in a total volume of 100 uL of gen), washed and then re-suspended in 50 uL., of TUNEL PBS-T for 20 minutes at room temperature. Cells were then enzyme with labeling solution. Following TUNEL labeling, washed twice in PBS-T and then incubated in 100 uL of cells were washed and re-suspended in PBS. TUNEL-stained PBS-T with 1.125 uL of anti-mouse Alexa Fluor 488 (Mo cells were analyzed by flow cytometry using a FACScalibur lecular Probes) for 20 minutes at room temperature. Cells (Becton Dickinson). The percentage of TUNEL-positive were then washed twice in PBS and incubated for 15 minutes cells was analyzed using ModFit LT for Mac v2.0. at room temperature in 100 uL of 100 ug/mL RNase in 0362 (7) Chromatin Immunoprecipitation and Promoter ddHO. Finally, cells were re-suspended in PBS with 10 QPCR: ug/mL PI (Sigma). BrdU/PI-stained cells were analyzed by 0363 Cells were incubated at 37° C. for 15 minutes in the flow cytometry using the FLT-1 channel of a FASCalibur to presence of 1% formaldehyde. This reaction was stopped measure anti-BrdU fluorescence intensity and the FLT-3 with the addition of glycine to a final concentration of 0.125M channel to measure PI fluorescence intensity. Cellduest soft and incubation at room temperature for five minutes. Cells ware was used to analyze flow cytometry data. were then washed 2 times with ice-cold PBS. Cells were scraped off of the dishes, pelleted and stored at -80° C. until 4. Example 4 ready for lysis and sonication. An Acetyl-Histone H3 Immu noprecipitation (ChIP) Assay Kit (Millipore) was then used Identification of Compounds Inhibiting Tumor according to the manufacturer's protocol. SYBR Green based quantitative PCR was run using 1x Bio-Rad iOSYBR Growth Green master mix, 0.2 mM forward and reverse primer mix, with gene-specific qPCR primers for each gene tested. Reac 0368 a) Use of CRGs to Query the Connectivity Map tions were run on the iCycler (Bio-Rad), as follows: 5 min at Identifies Drugs that Abrogate the Malignant Phenotype. 95° C., 45 cycles of 95° C. for 30 seconds, 60° C. for 30 0369. The malignant phenotype is diminished by antago seconds, 72°C. for 45 seconds to amplify products, followed nism of individual or combinations of CRGs using either by 40 cycles of 94°C. with 1 °C. step-down for 30 seconds to molecular genetic perturbations or treatment with histone produce melt curves. deacetylase inhibitors (HDACi). Based on these observa 0364 (8) Western Blotting: tions, it is known that an important general characteristic of 0365 mp53/Ras cells were grown at 39° C. for 2 days, efficacious anti-cancer drugs is the ability to reverse the followed by plating into 2.5 mMVA or NB for 3 days prior to expression pattern of CRGs that results upon transformation. lysis for Western blots. SW480 cells were grown in standard Since numerous studies indicate the utility of the gene expres conditions, then plated into 2.5 mMVA or NB for 3 days prior Sion-based strategies for identifying drugs that mimic or to Western analysis. Cell pellets were lysed for 20 min at 4°C. reverse biological states across different cell types and spe with rotation in RIPA buffer (50 mM Tris-HCL, pH 7.4, 150 cies (Hassane et al., 2008; Hieronymus et al., 2006; Hughes et mM NaCL, 1% NP-40, 5 mM EDTA, 0.1% SDS, 0.5% al., 2000; Lamb et al., 2006; Stegmaier et al., 2004; Stegmaier deoxycholic acid, protease inhibitor cocktail tablet). Lysates were clarified by centrifugation at 13,000 g for 10 min at 4°C. et al., 2007: Wei et al., 2006), the CMap database (build 2.0) and quantitated using Bradford protein assay (Bio-Rad). 25 was queried for drug signatures that reverse the CRG signa ug of protein lysate was separated by SDS-PAGE and trans ture. ferred to PVDF membrane (Millipore). Immunoblots were 0370 b) Query of the Connectivity Map Database. blocked in 5% non-fat dry milk in PBS with 0.2% Tween-20 0371 To facilitate rapid cross-species queries using for 1 hour at RT, probed with antibodies against p53 (FL-393, human-specific Affymetrix IDs contained in the CMap, Santa Cruz) for all cell lines, H-Ras (C-20, Santa Cruz) for murine Affymetrix IDs for CRGs were mapped to gene sym mp53/Ras cells, Raf (F-7, Santa Cruz) for HT-29 cells, Ras bols, which were then mapped to Affymetrix IDs contained (Ab-1, Calbiochem) for DLD-1 cells, and tubulin (H-235, within the CMap. All available probe sets were used when a Santa Cruz) for all cell lines. Bands were visualized using the many-to-one relationship existed between Affymetrix IDs ECL+kit (Amersham). and unique gene symbols. The query signature consisted of 0366 (9) BrdU Labeling and Staining 23 up-regulated CRGs and 59 down-regulated CRGs for 0367 Cells were cultured for two days at 39° C. in 10% which gene symbol annotation was present in the CMap data FBS in the absence of interferon-Y on collagen IV-coated 10 set. Using the web-based Connectivity Map, the Kolmog cm dishes. Cells were then washed twice in PBS and cultured orov-Smirnov-based gene set enrichment analysis (GSEA) for an additional day at 39°C. without FBS or interferon-Y. Cells were finally labeled for 90 minutes with 10 uM bro algorithm (Subramanian et al., 2005) was used to obtain modeoxyuridine (BrdU). Note: a separate plate of unlabeled enrichment scores (ES) for both up-regulated (ES) and cells served as a negative control. Cells were then trypsinized down-regulated (ES) CRGs for each CMap drug treat and washed in PBS. After the final spin, all but 200 uL of the ment instance. The values of ES, and ES, are combined PBS was aspirated and with gentle vortexing, 2 mL of cold to generate a CMap “connectivity score” as described (Lamb 80% ethanol was added to each sample. Ethanol-fixed et al., 2006). Drugs that mimic the CRG signature attain a samples were then stored at 4°C. For BrdU/propidium iodide positive connectivity score whereas drugs that oppose the (PI) staining, cells were first spun out of ethanol at 2,500 rpm CRG signature (and thereby are predicted as potential anti for 5 minutes, washed twice in PBS w/0.1% BSA and then cancer drugs) attain a negative connectivity score. Highly incubated at room temperature for 30 minutes in 2M HCl with negatively connected drugs, with connectivity scores <-0.5 occasional Vortexing. All Subsequent spins were at 1,500 rpm, are indicated in Table 15. These compounds generally target for 5 minutes at 4°C. Cells were again washed twice in PBS both the up-and down-regulated CRG sets.
US 2012/01 14670 A1 May 10, 2012 55
TABLE 15-continued Compounds predicted to reverse the overall CRG signature, identified by the Connectivity Map Rank Batch CMap Name Dose Cell Score ESup ES own Instance ID 6030 615 meclofenamic acid -0.637 -O.193 2 1445 6029 683 diethylstilbestrol -0.636 -O.253 3 3812 6028 758 biperiden -0.635 -O.227 2 5644 6027 645 amprofazone -0.633 -0.159 2174 6O2S 660 Erichostatin A 1 O l -0.632 -O.O86 : 3.077 6026 741 halidomide -0.632 -O.257 5990 6024 612 idoxuridine -0.628 -O.263 1980 6023 615 alverine -0.6.27 -0.247 1426 6022 646 bambuterol -0.6.27 -0.261 31.99 6O20 617 nimeSulide -0.626 -O.236 55 2112 6021 6SO LY2940O2 -0.626 -O.275 47 2696 6019 1079 Erichostatin A -0.623 -0.191 7105 6O18 750 trifluoperazine -0.623 -O.257 61.83 6017 35 Erichostatin A O l -0.619 -0.213 364 6O15 737 gemfibrozil -0.619 -0.281 S488 6O16 686 indapamide -0.619 -O.307 3859 6014 632 4-hydroxyphenaZone 2O -0.6.18 -0.29 6 1497 6O12 698 Erichostatin A O O l -0.6.17 -0.145 7387 6013 630 buspirone -0.6.17 -O.259 222 1282 6O11 731 Erichostatin A O O l -0.616 -0.131 5745 6010 632 naphazoline -0.615 -O.285 1466 6009 750 alvespimycin O O l -0.614 -0.201 22 6172 6008 762 iobenguane -0.614 -O.229 7299 6007 651 methazolamide -0.613 -O.225 2733 6006 771 pinacidil M -0.612 -O3O8 7437 600S 629 trichostatin A O O l -0.611 -0.128 1835 6004 692 probenecid -0.61 -O.316 418S 60O2 728 trichostatin A O O l -0.609 -0.165 4483 6003 750 valproic acid -0.609 -0.217 61.99 6001 623 vanoxerine -0.608 -0.2 1625 6000 623 methyldopa -0.6O7 -0185 1619 5999 612 naphazoline -0.606 -O.223 1966 S998 733 Erichostatin A O -0.605 -0136 S822 5997 630 lupentixol -0.605 -0.138 1288 S994 6SO valproic acid l M -0.602 -0.247 2669 S996 692 naftopidil -0.602 -0.304 4193 5995 705 ethionamide 2 -0.602 -0.32 4418 5993 631 bacampicillin -0.601 -0.191 1337 5992 19 LY2940O2 -0.601 -O.287 258 5991 6SO valproic acid 5 O -0.599 -0.218 2700 S989 734 vidarabine -0.598 -0.234 5850 5990 654 SR-95531 -0.598 -O.282 3253 S988 660 tyloxapol -0.597 -O.196 3074 5985 762 epirizole -0.596 -O.197 7292 S986 1054 Scriptaid -0.596 -0.247 6896 5987 715 ynestrenol -0.596 -O.295 6756 S984 603 Erichostatin A l -0.594 -0.128 212 S982 734 Erichostatin A g -0.594 -O153 598O 641 cinchonidine -0.594 -0186 5983 703 2,6-dimethylpiperidine 2 -0.594 -O.254 5979 44 valproic acid l M -0.594 -O.274 5981 610 pheniramine -0.594 -O.318 5978 6SO Erichostatin A 1 O l -0.593 -0.163 5977 771 niflumic acid -0.593 -0.304 5976 751 diphenylpyraline -0.591 -O.254 5975 602 vorinostat -0.591 -O.253 5974 736 piribedil -0.59 -O.286 5973 640 audanosine -0.589 -O152 5972 622 ketotifen -0.589 -0169 5971 659 Erichostatin A 1 O l -0.589 -0.212 5970 646 mepacrine -0.586 -0.16 S969 513 ulvestrant -O.S85 -O.27 5968 513 wortmannin -0.584 -O.256 5965 644 Solanine -0.582 -0.18 2 1 1 5967 699 atractyloside -0.582 -0.22 72 S966 690 canadine -0.582 -0.264 28 5964 101S trichostatin A -0.581 -O.197 95 S963 614 trichostatin A 1 O -0.581 -O.252 39 5961 683 pramocaine -0.58 -O.192 98 S962 762 ketorolac -0.58 -O-235 55 S960 612 diflunisal -0.58 -O.236 S4
US 2012/01 14670 A1 May 10, 2012 58
TABLE 15-continued Compounds predicted to reverse the overall CRG signature, identified by the Connectivity Map Rank Batch CMap Name Dose Cell Score ESup ES own Instance ID S818 613 baclofen -0.5 -O-237 S819 26b arachidonyltrifluoromethane -0.5 -O.258 327 S816 612 niclosamide -0.5 -0.134 1998 5815 658 fosfosal -0.5 -0.134 2997 S811 690 boldine -0.5 -0.234 4122 S813 772 esculetin 2 -0.5 -O-237 7459 S810 709 liothyronine -0.5 -O-237 66O2 S812 710 lisuride -0.5 -0.245 6682 S814 699 guanadrel -0.5 -0.249 472O S809 649 medrysone -0.5 -O.O94 2544 S808 614 mefloquine -0.5 -0.18 1364 S806 1078 -0.5 -O.223 7099 5805 732 azlocillin -0.5 -0.241 5788 5807 692 spectinomycin -0.5 -O.259 4187 S804 762 homochlorcyclizine -0.5 -0.262 7295 S800 622 chlortalidone -0.5 -0.131 1581 S801 688 carbarSone -0.5 -0.2O3 3991 S802 682 sulfadimidine -0.5 -0.216 3765 S803 71.4 estradiol -0.5 -O.239 6718 5799 664 harpagoside -0.5 -0.114 2935 5798 683 2,6-dimethylpiperidine 2 -0.5 -O.225 3806 5797 602 15-delta prostaglandin -0.5 -O.229 1172
5795 735 chlorhexidine CF7 -0.5 -0.248 S403 5796 745 racecadotril M CF7 -0.5 -0.26 6231 5793 664 etofenamate HL60 -0.5 -0139 2907 5792 661 Prestwick-981 HL60 -0.5 -0.181 3125 5791 661 esculetin 2 HL60 -0.5 -0.217 312O 5794 6SO tanespimycin HL60 -0.5 -O.236 2686 5790 613 hydroxyzine HL60 -0.5 -0.154 2O24 5787 750 LY-294.002 1 O l HL60 -0.5 -0.16 6175 5786 644 diflorasone HL60 -0.5 -0.161 2142 5788 6SO Sirolimus 1 O l HL60 -0.5 -O.199 2681 5789 617 antimycin A PC3 -0.5 -0.209 2098 5784 733 isoetarine PC3 -0.5 -0.182 S812 5782 746 ifosfamide MCF7 -0.5 -0183 6279 5.783 771 trifluoperazine MCF7 -0.5 -0.2O3 742O 5781 708 bromocriptine MCF7 -0.5 -0.249 5665 5785 726 azathioprine MCF7 -0.5 -O.272 5262 5778 618 Erichostatin A 1 O l HL60 -0.5 -O.091 2370 5777 695 doxylamine MCF7 -0.5 -0. 64 4819 57.76 6SO alpha-estradiol l HL60 -0.5 -0. 78 2670 578O 640 ceftazidime HL60 -0.5 -0.201 1721 5779 683 Santonin PC3 -0.5 -O.225 3795 5775 1030 Erichostatin A MCF7 -0.509 -0. 59 6434 5774 655 cephaeline MCF7 -0.509 -0.244 3290 5772 699 evomepromazine MCF7 -0.508 -0. 94 4723 5771 755 dexibuprofen MCF7 -0.508 -0.209 6471 5770 758 haloperidol MCF7 -0.508 -0.231 S638 5773 703 inidazole PC3 -0.508 -O-232 4548 5766 751 Erichostatin A 1 O l MCF7 -O.SO7 119 6064 5769 664 etrozole HL60 -O.SO7 138 2916 5765 729 MCF7 -O.SO7 73 5316 5767 651 2 HL60 -O.SO7 -0.208 2709 5768 707 MCF7 -O.SO7 -0.28 5025 5762 745 cefepime MCF7 -0.506 -0. 65 6237 5764 688 6-azathymine 3 PC3 -0.506 -0. 78 3987 5763 728 riboflavin PC3 -0.506 -O-232 4485 5760 681 meclofenoxate PC3 -O.SOS -0. 77 3707 5761 629 noretynodrel HL60 -O.SOS -0. 91 1860 5758 41 estradiol l HL60 -O.SOS -0.204 387 5757 753 dextromethorphan PC3 -O.SOS -0.222 6300 5759 736 tolfenamic acid MCF7 -O.SOS -O.225 S4S4 5755 688 gramine PC3 -0.504 162 3999 5753 660 aminohippuric acid s HL60 -0.504 172 3076 5756 613 periphenazine HL60 -0.504 188 2040 5754 644 canawanine HL60 -0.504 99 2141 5751 687 phenelzine MCF7 -0.504 -0.218 3884 5752 1061 carmustine 1 O MCF7 -0.504 -O.254 6914 5750 641 papaverine HL60 -0.503 -0. 21 1755 5747 658 trichostatin A 1 O l HL60 -0.503 -0. 45 2993 US 2012/01 14670 A1 May 10, 2012 59
TABLE 15-continued Compounds predicted to reverse the overall CRG signature, identified by the Connectivity Map Rank Batch CMap Name Dose Cell Score ESup ESdown Instance ID 5748 632 diphemanil metilsulfate 10 IM MCF7 -0.503 -0.2 O.139 1494 5749 753 pralidoxime 23 M PC3 -0.503 -0.239 O.1 6283 5744 513 vorinostat 10 IM MCF7 -0.502 -0.128 0.209 1058 5746 736 trichostatin A 100 nM. MCF7 -O.SO2 -0.15 0.188 5441 5745 671 butacaine 13 M MCF7 -0.502 -0.245 0.093 3469 5742 689 yohimbic acid 11 M PC3 -0.5O1 -0.196 O.141 4082 S743 720 CP-3206SO-O1 10 IM MCF7 -0.5O1 -0.24 0.097 4379 5741 734 nomifensine 11 M PC3 -0.5 -0.208. O.128 S863 5740 26b monorden 100 nM. MCF7 -0.5 -0.232 0.105 325
0372 c) Drugs with Negative Connectivity Scores that extracted and compared. This comparison revealed that the Reverse CRG Expression Suppress the Malignant Phenotype. subsets of CRGs modulated by the two drug classes were 0373 The general utility of the CRGs in identifying anti distinct, consistent with their different mechanisms of action. (FIG. 19). cancer agents was immediately validated by the query results, 0374 d) Drugs which Preferentially Target Up- or Down which indicate that the list of negatively-connected drugs Regulated CRGs can Interact to Inhibit Malignant Transfor contains a variety of HDACi, such as valproic acid, which was mation previously shown be effective in reversing CRG expression 0375. Further analysis of the CMap data shows that many and abrogating the malignant phenotype, as well as others drugs preferentially target either up- or down-regulated e.g., trichostatin A and vorinostat. In addition to HDACi, the CRGs (Tables 16 and 17). Because only part of the overall CRG-based query revealed several negatively-connected signature is targeted, such compounds do not attain a negative compounds. Such as LY-294.002, wortmannin, and sirolimus connectivity score, but they clearly reversea proportion of the (rapamycin), acting along the PI3K pathway, a well-known CRG signature. Based on the CRG perturbation experiments, mediator of cancer Survival, progression, and resistance to these compounds have tumor-inhibitory efficacy on their own chemotherapy (Tokunaga et al., 2008; Zhang et al., 2007). To and in combination with other compounds that affect expres investigate whether HDAC1 and PI3K pathway inhibitors sion of complementary sets of CRGs. For example, this demonstrating strong negative connectivity antagonized includes combinations of any of the compounds targeting similar or complementary Subsets of CRGs, the gene expres up-regulated CRGs shown in Table 16 with any of the com sion changes of individual CRGs for these drugs were pounds that target down-regulated CRGs shown in Table 17.
TABLE 16 Compounds predicted to increase the expression of down-regulated CRGs with minimal effect on up-regulated CRGs, identified by the Connectivity Map Rank Batch CMap Name Dose Cell Score ESup ESdown Instance ID 2333 682 trichostatin A OO nM PC3 O 0.18 O.379 3787 3239 727 valproic acid 500 IM PC3 O 0.103 0.372 4464 3124 718 trichostatin A OO nM PC3 O O. 118 O.339 5065 3070 732 trichostatin A OO nM PC3 O O.122 O.318 S802 2248 637 trichostatin A OO M MCF7 O 0.187 0.313 2268 3211 603 vorinostat 10 IM PC3 O O. 106 0.288 1220 2232 603 trichostatin A 1 M PC3 O O.188 O.284 1234 1514 744 trichostatin A OO M MCF7 O O.259 O.281 6820 3137 680 trichostatin A OO nM PC3 O O. 116 O.28 3688 2314 671 pipenzolate bromide 9 M MCF7 O O.182 0.28 3460 2767 659 iOverSol 5 M HIL60 O 0.145 0.278 3026 2697 686 trichostatin A OO M MCF7 O 0.151 O.276 3868 3173 658 mestranol 13 M HIL60 O 0.112 O.273 3008 3306 664 pronetalol 15 M HIL60 O O.O9 O.271 2902 2999 636 trichostatin A OO M MCF7 O O.128 0.271 2247 2812 706 trichostatin A OO M MCF7 O O.142 O.271 4954 2649 60 trichostatin A OO nM PC3 O O.1SS O.271 448 1427 663 trichostatin A OO M MCF7 O O.273 0.27 2794 2686 648 trichostatin A OO nM HIL60 O 0.152 0.269 2523 2138 685 trichostatin A OO M MCF7 O O.195 0.269 3643 2494 671 trichostatin A OO M MCF7 O 0.167 0.268 3462 2472 725 trichostatin A OO M MCF7 O O.169 O.266 5209 3062 660 desoxycortone 12 M HIL60 O O.123 O.264 3099 3298 634 dicloxacillin 8 M HIL60 O O.O91 O.262 2445 1916 654 trichostatin A OO M MCF7 O O.213 O.261 3243 1641 694 trichostatin A OO M MCF7 O O.241 O.26 4770 US 2012/01 14670 A1 May 10, 2012 60
TABLE 16-continued Compounds predicted to increase the expression of down-regulated CRGs with minimal effect on up-regulated CRGs, identified by the Connectivity Map Rank Batch CMap Name Dose Cell Score ESup ESdown Instance ID 3313 629 allantoin 25 M O.088 O.258 1842 3222 659 rolitetracycline 8 M O.1OS O.258 3O31 2108 33 valproic acid 2 mM MC O.197 O.258 346 2961 687 rifabutin 5 M MC O.131 0.255 3873 2745 616 Erichostatin A OO nM PC3 O.147 0.255 2O84 2432 729 Erichostatin A OO nM MC O.172 O.253 S3O8 1699 611 Erichostatin A OO nM PC3 O-234 O.252 1951 3.276 648 metoprolol 6 M O.097 O.251 2543 1968 700 metoclopramide 12 M MC O.209 O.25 4750 1832 730 Erichostatin A OO nM MC O.22 O.25 5336 3O36 645 benfotiamine 9 M O. 25 O.249 2177 3231 645 Erichostatin A OO nM O4 O.248 2208 1458 653 procainamide 15 M MC 268 O.247 2618 2941 618 6-benzylaminopurine 18 M 33 O.246 2351 2876 743 Erichostatin A OO nM MC O.246 6784 2995 700 Erichostatin A OO nM MC O.244 4768 3348 629 Sulfaphenazole 13 M O.243 836 1871 626 Erichostatin8. A OO nM O.243 637 1799 695 Erichostatin8. A OO nM O.243 1679 752 Erichostatin8. A OO nM O.243 3152 628 Erichostatin8. A OO nM O.242 3346 629 chloramphenicol O.241 3O37 610 Erichostatin A O.24 2857 629 8-azaguanine O.24 2101 640 propafenone O.239 1771 764 Erichostatin A O.238 2881 629 morantel 0.237 2886 641 ipratropium bromide O.236 2775 659 carbachol O.235 2436 665 pyrvinium O.235 21.93 660 cantharidin O.235 2153 732 alpha-yohimbine O.235 32O1 640 trifusa O.233 3006 648 skimmianine O.233 2386 735 Erichostatin A O.233 2O24 738 Erichostatin A O.233 1902 630 Sulocticil O.233 3321 749 trifluridine O.231 3O81 659 benegride O.231 3267 720 rifabutin C O.23 3O16 658 propantheline bromide M O.23 1917 630 hioguanosine O.23 3270 612 isoXSuprine O.229 3177 708 Erichostatin A O.229 2834 645 ethotoin O.228 2744 699 Erichostatin A O.226 2090 630 (OCX O.226 2448 613 metolazone O.225 2388 647 Erichostatin A O.225 2004 602 geldanamycin O.225 1775 45 Erichostatin A O.225 1624 676 Erichostatin A O.225 3.078 1043 Erichostatin A O.223 2557 705 Erichostatin A O.223 1896 618 phenelzine O.223 2977 1014 Erichostatin A O.222 1567 671 vidarabine O.222 3317 630 acrine O.221 2378 655 Erichostatin A O.221 3147 737 Erichostatin A O.22 3020 644 picrotoxinin O.22 2730 664 epitiostanol O.22 1959 640 Erichostatin A O.219 2002 767 Erichostatin A O.218 3223 615 etofylline O.217 3063 648 fluorometholone O.217 2840 S1.4 Erichostatin A O.217 2152 659 ethaverine O.217 3323 664 Sanguinarine O.216 3O3O 662 Erichostatin A O.216 2231 660 etynodio O.215 US 2012/01 14670 A1 May 10, 2012 61
TABLE 16-continued Compounds predicted to increase the expression of down-regulated CRGs wi h minimal effect on up-regulated CRGs, identified by the Connectivity Map Rank Batch CMap Name Dose Cell Score ESup ESdown Instance ID 2025 1084 daunorubicin 1 O 204 7507 1683 691 Erichostatin A 100 O 236 4153 1700 757 vorinostat O O 234 558O 3213 659 Sulconazole O. O6 3035 3117 642 Erichostatin A 1 OO 18 2330 3022 645 bromopride 26 2182 2776 750 acetylsalicylic acid 1 O 44 61.64 3079 602 anespimycin 22 1147 282O 649 meclofenoxate 41 2546 2624 634 neostigmine bromide 2432 2416 618 mebendazole 2338 1828 670 enoprofen 3412 1585 613 hesperetin 2031 1444 646 quinidine 3.191 3214 752 napelline 6084 2968 758 Erichostatin A 1 O 5625 2527 664 tracazolate 2919 21.59 737 trimetazidine 5479 3051 634 iohexol 2461 2442 757 Erichostatin A 1 O 5572 2266 665 S-propranolol 2961 2O85 731 trioxysalen 5736 1295 1071 MS-275 7074 3227 651 azlocillin 2727 3172 631 ginkgolide A 1324 1535 738 isinopril 5504 3091 612 pyrimethamine M 1974 1644 651 Sulfametoxydiazine 2712 2987 641 Syrosingopine 1761 2921 629 meticrane 1834 2435 502 Erichostatin A 981 2523 711 Erichostatin A 1 O 3979 2116 635 olazamide 2482 1792 645 25 2176 3071 755 100 6454 2893 690 100 4112 1309 642 22 2304 2493 619 10 2395 1418 765 100 6972 3.192 741 12 S986 298O 651 15 2722 3O46 641 berberine 11 1778 2573 756 Erichostatin A 100 s 6493 2418 649 enoprofen 7 iM HL60 2553 2348 665 ioxaglic acid 3 iM HL60 2966 Reversal of down-regulated CRG expression is indicated by a positive ES score for the down-regulated genes. Drugs are considered to target the down-regulated genes if the ESdownvalue is greater than 0.2, Alack of reversal of up-regulated genes is indicated by a positive ES score for this segment of the CRG signature.
TABLE 17 Compounds predicted to decrease the expression of up-regulated CRGs with minimal effect on down-regulated CRGs, identified by the Connectivity Map Rank Batch CMap Name Dose Cell Score ESup ESdown Instance ID 4652 766 pergolide 10 MMCF7 -0.386 -0.109 7031 4651 683 withaferin A 1 MPC3 -0.371 -0.141 3819 46SO 676 alprostadil 11 MMCF7 -0.365 -0.128 7358 4649 715 betamethasone 10 MPC3 -0.358 -0.121 6728 4648 1048 fulvestrant 1 MPC3 -0.357 -0.137 6867 4647 747 doxycycline 8 MMCF7 -0.354 -0.109 7195 4646 627 atracurium besilate 3 MMCF7 -0.349 -0.083 1702 4645 632 metronidazole 23 MMCF7 -0.347 -O-115 1503 4644 746 demecarium bromide 6 MMCF7 -0.346 -0.149 6269 4643 676 harpagoside 8 MMCF7 -0.343 -0.127 7355 4642 728 Securinine 18 MPC3 -0.341 -0.284 4493 4641 626 fulvestrant 10 nMMCF7 -0.339 -O.098 1663 4640 748 bambuterol 10 MMCF7 -O.338 -O.097 7239
US 2012/01 14670 A1 May 10, 2012 64
TABLE 17-continued Compounds predicted to decrease the expression of up-regulated CRGs with minimal effect on down-regulated CRGs, identified by the Connectivity Map Rank Batch CMap Name Dose Cell Score ESup ESdown Instance ID 4501 680 Prestwick-685 PC3 -O-254 -0.087 3683 4498 767 haloperidol -O.253 -0.209 6960 4496 612 amiloride -O.253 -0.143 1970 4495 730 ceforanide -O.253 -0.113 5351 4497 1054 pioglitaZone -O.253 -0.061 6893 4494 623 metergoline -O.252 -0.193 1606 4492 747 isoniazid 2 M C -0.252 -0.162 71.97 4493 701. ketoprofen PC3 -0.252 -0.112 4286 4491 734 abamectin PC3 -O.252 -0.108 S864 4485 1078 thapsigargin 1 O -0.251 -0.243 7100 4487 706 arcaine -O.251 -0.135 4974 4489 513 valproic acid 50 s -0.251 -0.126 1078 4490 701 benzami PC3 -0.251 -0.104 4294 4486 617 oxymetazoline PC3 -O.251 -0.099 2114 4488 56 fasudi PC3 -O.251 -0.071 436 4482 656 collistin -0.25 -0. 2851 4483 733 teraZosin -0.25 -O.O73 S831 4484 734 sulfadoxine -0.25 -O.O7 5852 4481 702 helveticoside -0.25 -O.O68 4327 4480 727 troglitazone -0.249 -0.081 4456 4477 706 cefaclor -0.248 -0.134 4967 4476 720 CP-690334-01 -0.248 -0.116 438O 4475 646 oxybutynin -0.248 -0.099 31.68 4479 764 methylprednisolone -0.248 -0.094 7137 4473 772 methocarbamol -0.248 -0.092 74.67 4474 704 thiostrepton -0.248 -0.09 4563 4478 626 sirolimus 10 M C F7 -0.248 -0.085 1667 4467 663 yohimbic acid MMCF7 -0.247 -0.141 28O3 4469 1004 pioglitaZone O MMCF7 -0.247 -0.105 5925 4471. 673 felbinac 9 MMCF7 -0.247 -0.102 3398 4472 754 propafenone -0.247 -0.097 6336 4468 633 edrophonium chloride 20 MMCF7 -0.247 -0.096 1519 4470 743 naproxen 6 MMCF7 -0.247 -0.088 6794 446S 1041 S155877 O MMCF7 -0.246 -0.185 6574 4463 663 Prestwick-642 4 MMCF7 -0.246 -0.094 2815 4464 735 dobutamine 2 MMCF7 -0.246 -0.066 S386 4466 610 minoxidil -0.246 -0.057 1914 4462 662 cinchonidine 4 MMCF7 -0.245 -0.176 2772 4456 659 2 -0.245 -0.149 3063 aminobenzenesulfonamide 4459 728 stachydrine -0.245 -0.101 4469 4460 632 minaprine -0.245 -0.091 1468 4461 SO6 LY2940O2 -0.245 -0.089 1016 4457 733 doxycycline -0.245 -0.086 S838 4458 683 ethotoin -0.245 -0.084 3.809 4455 765 haloperidol O MMCF7 -0.244 -0.112 7003 4453. 693 cefalonium -0.244 -0.108 4245 4452 506 clozapine O M M C F7 -0.244 -0.104 1009 4454. 728 furosemide -0.244 -0.102 4503 4451 683 oxaprozin -0.243 -0.151 3794 4450 735 dinoprost 8 MMCF7 -0.243 -0.114 S409 4449 767 tanespimycin 1 MMCF7 -0.242 -0.11 6943 4448 662 diclofenac 3 MMCF7 -0.242 -0.073 2756 4446 747 diazoxide 7 MMCF7 -0.241 -0.13 71.68 4447 655 dicloxacillin 8 MMCF7 -0.241 -0.111 3307 4444 1062 H-89 -0.241 -0.101 6921 4443 771 fenofibrate -0.241 -0.09 7432 4445 673 capsaicin -0.241 -0.08 3372 4442 728 sertaconazole -0.241 -0.07 4475 4440 734 neomycin -0.24 -0.148 5867 4436 735 coralyne -0.24 -0.137 S418 4438 754 pinacidil -0.24 -0.13 6356 4441 676 fluticasone -0.24 -0.125 7348 4437 626 LY2940O2 -0.24 -0.097 1664 4439 663 cinchonine -0.24 -0.094 2789 4428 747 sulfamonomethoxine -0.239 -0.199 7200 4431 706 SR-95639A -0.239 -0.185 4977 4432 648 abamectin -0.239 -0.157 2519 4429 747 cefotaxime 8 MMCF7 -0.239 -0.135 7186 4434 615 oxymetazoline 3 MHL60 -0.239 -0.13 1431 4427 710 ketanserin 7 MPC3 -0.239 -0.125 6649 US 2012/01 14670 A1 May 10, 2012 65
TABLE 17-continued Compounds predicted to decrease the expression of up-regulated CRGs with minimal effect on down-regulated CRGs, identified by the Connectivity Map Rank Batch CMap Name Dose Cell Score ESup ESdown Instance ID 4426 1094 vinblastine 100 nMMC 7 -0.239 -0.118 7551 4433 SO6 LY-294.002 10 MMCF7 -0.239 -0.098 1019 4430 734 estriol 14 MPC3 -0.239 -0.086 S866 4435 702 PHA-008S1261E 10 MPC3 -0.239 -0.086 4330 4424 632 levodopa 20 MMCF7 -0.238 -0.135 1472 442O 689 trimethadione 28 MPC3 -0.238 -0.127 4086 4422 646 chlortalidone 12 MMCF7 -0.238 -0.118 31.98 4423 676 gabexate 10 MMCF7 -0.238 -0.097 7357 4.425 SO6 estradiol 10 nMMCF7 -0.238 -0.084 1021 4421 71 Sodium phenylbutyrate 200 MSKMEL5 -0.238 -0.073 502 4419 747 tetrandrine 6 MMCF7 -O-237 -0.233 7178 44.17 725 Sirolimus 100 MMCF7 -O-237 -0.125 5239 4418 690 fluticaSone 8 MMCF7 -O-237 -0.113 4129 44.15 655 iohexol 5 MMCF7 -O-237 -0.112 3322 4414 617 chlorZoxazone 2 MPC3 -O-237 -0.103 2100 4416 701 metoclopramide MPC3 -O-237 -0.084 428S 4410 747 ursolic acid MMCF7 -0.236 -0.143 7181 4413 661 nabunnetOne MHL60 -0.236 -0.125 3.108 4411 735 clebopride MMCF7 -0.236 -0.12 S412 4412 1065 AH-68.09 MPC3 -0.236 -0.087 7049 44O7 68O halcinonide MPC3 -O-235 -0.087 368O 4409 655 methoxsalen MMCF7 -O-235 -0.086 33O2 4408 708 guanabenz MMCF7 -O-235 -0.079 5703 4406 743 ribostamycin MMCF7 -O-235 -0.054 6765 4400 623 betamethasone MHL60 -0.234 -0.153 1590 4404 614 disulfiram MHL60 -0.234 -0.152 1369 4405 703 orphenadrine MPC3 -0.234 -0.136 4537 44O1 699 PNU-O2S1126 MMCF7 -0.234 -0.134 4714 4403 1021 orlistat MPC3 -0.234 -0.112 6388 4399 720 spiradoline MMCF7 -0.234 -0.108 4375 4402 690 nadolol MMCF7 -0.234 -0.083 4139 4396 691 alprostadil MMCF7 -O-233 -0.098 4179 4398 690 nafcillin MMCF7 -O-233 -0.096 4103 4397 681 Sulfamethoxypyridazine MPC3 -O-233 -0.087 3711 4393 68O kawain MPC3 -O-232 -0.156 3670 4392 771 isotretinoin MMCF7 -0.232 -0.124 7438 439S 734 quipazine MPC3 -0.232 -0.116 5887 4391 736 S-propranolol MMCF7 -O-232 -0.115 5444 4394 705 dicycloverine MMCF7 -0.232 -0.101 4405 4389 633 amplicillin MMCF7 -0.231 -0.13 1530 4390 1010 tanespimycin MMCF7 -0.231 -0.101 5953 4387 757 trifluoperazine MMCF7 -0.23 -O.225 SS84 4388 659 MHL60 -0.23 -O152 3059 4386 757 MMCF7 -0.23 -O.O87 S603 4384 663 MMCF7 -O.229 -0.119 2.795 4383 746 MMCF7 -0.229 -0. 6263 4385 676 MMCF7 -O.229 -0.085 7347 4379 702 mexiletine MPC3 -0.228 -0.127 4338 4376 730 metanephrine MMCF7 -0.228 -0.12 5334 4381 502 rottlerin MMCF7 -0.228 -0.118 941 4378 732 methazolamide MPC3 -0.228 -0.115 5794 4377 701 betonicine 2 MPC3 -0.228 -0.097 4301 438O 711 mexiletine MMCF7 -0.228 -0.088 3973 4382 677 penbutolol MMCF7 -0.228 -0.075 3534 4374 632 khellin MMCF7 -0.227 -0.104 1504 4375 757 genistein MMCF7 -O.227 -0.098 5595 4369 695 Zuclopenthixol MMCF7 -0.226 -0.18 4843 4368 654 lactobionic acid MMCF7 -0.226 -0.13 3246 4371 68O dilazep MPC3 -0.226 -0.102 3665 4373 53 trifluoperazine MMCF7 -O.226 -0.097 421 4370 713 loperamide MPC3 -O.226 -0.095 4672 4367 706 Prestwick-857 MMCF7 -0.226 -0.091 498O 4372 726 haloperidol MMCF7 -O.226 -0.086 52.73 4362 702 Vincamine MPC3 -0.225 -0.134 4341 436S 611 lisuride MPC3 -O.225 -0.117 1962 4361 632 phenaZone 2 MMCF7 -O.225 -0.102 1489 4366 681 Sulfamerazine MPC3 -O.225 -0.072 3718 4364 738 dropropizine MMCF7 -O.225 -O.O68 5531 43.63 767 estradiol O MMCF7 -0.225 -0.046 6957 4360 623 ascorbic acid 22 MHL60 -0.224 -0.167 1610 4356 728 diperodon 9 MPC3 -0.224 -0.117 4498 US 2012/01 14670 A1 May 10, 2012 66
TABLE 17-continued Compounds predicted to decrease the expression of up-regulated CRGs with minimal effect on down-regulated CRGs, identified by the Connectivity Map Rank Batch CMap Name Dose Cell Score ESup ESdown Instance ID 4359 707 brinzolamide -0.224 -0.116 SO16 4354 710 diloxanide -0.224 -0.104 6679 4355 673 primidone -0.224 -0.096 34O2 4358 689 moxonidine -0.224 -0.092 4084 4357 626 tanespimycin -0.224 -0.059 16SO 4351 699 monensin g -0.223 -0.143 4726 4347 713 flurbiprofen Ns -0.223 -0.129 4674 4352 685 finasteride -0.223 -0.124 3641 4353 654 metrizamide -0.223 -0.112 3255 4349 647 metitepine -O.223 -0.107 3231 4350 703 ciclacillin -O.223 -0.105 4536 4348 116 estradiol -O.223 -0.067 665 4342 743 butirosin MCF7 -0.222 -0.143 6779 4341 708 felbinac -0.222 -0.127 5700 4336 648 podophyllotoxin -0.222 -0.121 2S4O 4338 743 tamoxifen -0.222 -0.12 6768 4343 631 carbarsone -0.222 -0.116 1313 4334 743 pyrithyldione 2 MCF7 -0.222 -0.109 68O1 4345 698 riluzole -0.222 -0.109 7365 4335 712 colchicine -0.222 -0.103 4614 4339 772 trapidil MCF7 -0.222 -0.091 7475 4340 90 splitomicin 2 -O.222 -0.088 661 4344 37 rofecoxib -O.222 -0.083 371 4337 695 tocainide MCF7 -O.222 -0.07 4838 4346 719 parthenolide -0.222 -0.068 5105 4332 729 tacrine -0.221 -0173 5297 4329 683 tinidazole PC3 -0.221 -0.11 3813 4333 617 pentetraZol 2 PC3 -0.221 -0.081 2092 4330 734 harmine PC3 -0.221 -0.078 5855 4328 713 piremperone PC3 -0.221 -0.076 46.79 4331 626 genistein -0.221 -0.066 1660 4327 676 decamethonium bromide -0.22 -0.168 7353 4325 732 dexamethasone PC3 -0.22 -0.158 5797 4324 109 benserazide O MSKMEL5 -0.22 -0.141 631 4321 725 LY2940O2 F7 -0.22 -0.126 5233 4323 678 ramipril F7 -0.22 -0.11 3572 4322 673 aminophylline o F7 -O.22 -0.099 3374 4326 71 LY2940O2 O MSKMEL5 -O.22 -0.087 5O1 4320 703 fenbendazole PC3 -0.219 -0.132 4542 4318 1066 collforsin 5 O -0.219 -0.122 7055 4319 737 tridihexethyl -O.219 -0.092 54.86 4316 754 doxepin PC3 -O.219 -0.086 6337 4315 730 erythromycin -O.219 -0.082 5329 4317 505 ikarugamycin M -O.219 -0.08 918 4314 712 practolol -O.219 -0.066 4603 4313 706 methoxamine -O.218 -0.178 4972 4311 602 fluphenazine -O.218 -0173 1178 4312 725 fluphenazine -0.218 -0.084 S234 4310 718 harmalol -O.218 -0.076 5076 4309 741 lincomycin -O.218 -0.069 5992 4304 1079 thapsigargin 1 O -0.217 -0.185 7103 4308 725 tanespimycin -0.217 -0.146 5215 4307 701 lomefloxacin -0.217 -0.124 4281 4306 1003 roteinone -0.217 -0.119 5920 4301 702 fluocinonide -0.217 -0.109 4314 4300 701 Prestwick-674 -0.217 -0.104 4276 4296 772 penbutolol -0.217 -0.103 7476 4303 676 Zalcitabine M -0.217 -0.094 7352 4299 734 mepyramine PC3 -0.217 -0.091 S869 4297 718 pizotifen PC3 -0.217 -0.09 5072 4302 676 3-acetamidocoumarin 2 -0.217 -0.086 7361 4305 632 acebutolol M -0.217 -0.069 1493 4298 611 metolazone PC3 -0.217 -0.067 1932 4293 729 naftidrofuryl F7 -0.216 -0.145 5287 4295 677 naftifine E. M F7 -0.216 -0.133 3536 4292 735 nimodipine O MMCF7 -0.216 -0.108 S421 4294 745 fluorocurarine 2 MMCF7 -0.216 -0.102 6219 4291 656 tiaprofenic acid 5 MMCF7 -O.215 -0.107 2852 4290 671 sulfamonomethoxine 4 MMCF7 -O.215 -0.099 3484 4289 626 wortmannin O MMCF7 -O.215 -0.096 1668 4284 704 witexin 9 MPC3 -0.214 -0.187 4588 US 2012/01 14670 A1 May 10, 2012 67
TABLE 17-continued Compounds predicted to decrease the expression of up-regulated CRGs with minimal effect on down-regulated CRGs, identified by the Connectivity Map Rank Batch CMap Name Dose Cell Score ESup ESdown Instance ID 4286 747 podophyllotoxin O MMC -0.2 -0183 71.98 4285 772 triflupromazine O MMC -0.2 -0171 7466 4282 670 cefamandole 8 MMC -0.2 -0.146 3436 4288 673 esculin 2 MMC -0.2 -0107 3390 4287 758 probucol 8 MMC -0.2 -0.103 S626 4283 753 nizaticine PC3 -0.2 -0.061 630S 4278 626 estradiol -0.2 -0.151 1666 4280 651 securinine -0.2 -0.122 2729 4281 706 acebutolol -0.2 -0.113 4976 4277 714 forfenicol PC3 -0.2 -0.103 6701 4279 663 Prestwick-682 -0.2 -OO67 2819 4272 730 fluoxetine M -0.2 -0.132 5356 4274 714 naftidrofuryl PC3 -0.2 -0107 6687 4273 754 scopolamine N-oxide PC3 -0.2 -0.104 6335 4276 734 Oxprenolol PC3 -0.2 -0.102 5871 4275 506 prochlorperazine -0.2 -O.091 995 4270 729 nitrofural 2 M -0.2 -0.083 5321 4271 734 convolamine PC3 -0.2 -O.077 5876 4264 676 tracazolate -0.2 -0.134 7339 4269 602 LY2940O2 -0.2 -0.128 1177 4268 623 alfuzosin -0.2 -0.122 1586 4265 602 nordihydroguaiaretic acid -0.2 -0.111 1164 4266 672 arcaine -0.2 -0.083 3349 4267 1011 estradiol PC3 -0.2 -O.O79 S960 4261 514 phentolamine -0.209 -0178 1138 4257 661 tiletamine -0.209 -0169 3137 4260 730 neostigmine bromide M C -0.209 -0.131 5335 4258 616 dexamethasone -0.209 -0.128 2O79 4263 646 clotrimazole -0.209 -0.111 3166 42SS 700 PNU-O23OO31 -0.209 -0.111 4754 4254 686 metamizole sodium -0.209 -O-105 3835 4259 745 trichostatin A 1 O -0.209 -O.098 6222 4262 706 harmaline -0.209 -O.O86 4968 4256 738 metampicillin -0.209 -O.O7 5540 4249 707 metixene C -0.208 -O.192 SO18 4250 677 tribenoside -0.208 -0.15 3507 4251 662 Syrosingopine -0.208 -0.125 2753 4252 750 Sirolimus 1 O -0.208 -O.09 618O 42S3 1073 AH-6809 -0.208 -O.O89 7075 4248 658 iodixanol -0.2O7 -0.166 3O23 4244 658 oxolamine -0.2O7 -0.143 3006 4240 686 famprofazone -0.2O7 -0.129 3834 4245 505 topiramate -0.2O7 -0.114 915 4243 771 dyclonine -0.2O7 -0.102 7423 4247 765 estradiol -0.2O7 -0.101 7000 4241 687 thiamazole -0.2O7 -O.O94 3898 4242 506 haloperidol -0.2O7 -0.06 983 4246 693 Prestwick-967 23 -0.2O7 -0.057 42SO 4236 731 cyclopentolate -0.206 -0.144 5734 4238 743 anabasine 2 -0.206 -0.132 6774 4239 678 kaempferol -0.206 -0.129 3579 4234 771 enalapril -0.206 -O-117 7428 4235 741 ribavirin -0.206 -O-105 6O18 4237 505 decitabine -0.206 -O.066 920 4227 514 cytochalasin B -0.205 -O.175 1122 4228 731 alclometasone -0.205 -0.146 5752 4232 727 rosiglitaZone -0.205 -0139 4457 4229 762 dosulepin -0.205 -0.109 7284 4233 654 cefixime -0.205 -O.093 3247 4231 748 fluphenazine -0.205 -O.O79 7234 4230 1014 PF-0053974S-OO -0.205 -0.062 5974 4222 1047 5194442 2 -0.204 -0.144 6599 4226 648 benzethonium chloride -0.204 -0.112 2508 4221 1000 estradiol -0.204 -0.109 5905 4224 627 benzonatate -0.204 -0.104 1679 4225 657 tubocurarine chloride -0.204 -O.O99 2887 4223 729 loxapine -0.204 -0.084 5293 4217 671 bucladesine -0.2O3 -O152 3483 4216 676 gibberellic acid -0.2O3 -0.147 7330 4220 673 bemegride -0.2O3 -0.145 3389 4213 677 bethanechol -0.2O3 -0.128 3537