Table S1. Complete Gene List. Genbank Refseq and Description of Each Gene Were Provided By
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Deciphering the Functions of Ets2, Pten and P53 in Stromal Fibroblasts in Multiple
Deciphering the Functions of Ets2, Pten and p53 in Stromal Fibroblasts in Multiple Breast Cancer Models DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Julie Wallace Graduate Program in Molecular, Cellular and Developmental Biology The Ohio State University 2013 Dissertation Committee: Michael C. Ostrowski, PhD, Advisor Gustavo Leone, PhD Denis Guttridge, PhD Dawn Chandler, PhD Copyright by Julie Wallace 2013 Abstract Breast cancer is the second most common cancer in American women, and is also the second leading cause of cancer death in women. It is estimated that nearly a quarter of a million new cases of invasive breast cancer will be diagnosed in women in the United States this year, and approximately 40,000 of these women will die from breast cancer. Although death rates have been on the decline for the past decade, there is still much we need to learn about this disease to improve prevention, detection and treatment strategies. The majority of early studies have focused on the malignant tumor cells themselves, and much has been learned concerning mutations, amplifications and other genetic and epigenetic alterations of these cells. However more recent work has acknowledged the strong influence of tumor stroma on the initiation, progression and recurrence of cancer. Under normal conditions this stroma has been shown to have protective effects against tumorigenesis, however the transformation of tumor cells manipulates this surrounding environment to actually promote malignancy. Fibroblasts in particular make up a significant portion of this stroma, and have been shown to impact various aspects of tumor cell biology. -
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
PERK Antibody / EIF2AK3 (RQ4206)
PERK Antibody / EIF2AK3 (RQ4206) Catalog No. Formulation Size RQ4206 0.5mg/ml if reconstituted with 0.2ml sterile DI water 100 ug Bulk quote request Availability 1-3 business days Species Reactivity Human, Mouse, Rat Format Antigen affinity purified Clonality Polyclonal (rabbit origin) Isotype Rabbit IgG Purity Antigen affinity purified Buffer Lyophilized from 1X PBS with 2% Trehalose and 0.025% sodium azide UniProt Q9NZJ5 Applications Western Blot : 0.5-1ug/ml Flow cytometry : 1-3ug/10^6 cells Direct ELISA : 0.1-0.5ug/ml Limitations This PERK antibody is available for research use only. Western blot testing of human 1) HeLa, 2) COLO320, 3) A549, 4) SK-OV-3, 5) A431, 6) rat brain and 7) mouse brain lysate with PERK antibody at 0.5ug/ml. Predicted molecular weight ~125 kDa, observed here at ~140 kDa. Flow cytometry testing of human HepG2 cells with PERK antibody at 1ug/10^6 cells (blocked with goat sera); Red=cells alone, Green=isotype control, Blue= PERK antibody. Description Eukaryotic translation initiation factor 2-alpha kinase 3, also known as protein kinase R (PKR)-like endoplasmic reticulum kinase (PERK), is an enzyme that in humans is encoded by the EIF2AK3 gene. The protein encoded by this gene phosphorylates the alpha subunit of eukaryotic translation-initiation factor 2, leading to its inactivation, and thus to a rapid reduction of translational initiation and repression of global protein synthesis. This protein is thought to modulate mitochondrial function. It is a type I membrane protein located in the endoplasmic reticulum (ER), where it is induced by ER stress caused by malfolded proteins. -
Supporting Information
Supporting Information Celhar et al. 10.1073/pnas.1507052112 SI Materials and Methods using a Nanodrop spectrophotometer (Thermo Fisher Scien- Proteinuria. Proteinuria was assessed using Albustix (Bayer). Al- tific). A TaqMan RNA-to-CT 1-Step Kit (Applied Biosystems) bumin levels in urine were assayed using an Albumin Mouse was used to perform the reverse transcription and quantitative ELISA Kit (Abcam) according to the manufacturer’s instructions; PCR reactions according to the manufacturer’s instructions samples were assayed at a dilution of 1:400. Samples were nor- using TaqMan gene expression assays (Applied Biosystems) to malized for creatinine using a Creatinine (urinary) Colorimetric either Tlr7 (Mm00446590) or the B2m housekeeping gene Assay Kit (Cayman Chemical) according to the manufacturer’s (Mm00437762). Real-time PCR was performed on the 7900H instructions; initial sample dilution of 1:10. fast real-time PCR system and analyzed using SDS 2.4 (Applied Biosystems). Relative mRNA expression was calculated using the Cell Sorting, RNA Isolation, and RT-PCR. Splenic B cells were comparative C method. + − + + t sorted as live CD45 Gr1 B220 CD19 , splenic T cells as live + − + + CD45 Gr1 CD3 CD5 and peritoneal macrophages as live Imaging. Kidney sections from OCT embedded tissue were fixed + − CD45 Gr1 CD11bhiF4/80hi. Sorted cells were centrifuged, re- with 4% paraformaldehyde before permeabilization with acetone suspended in TRIzol (Life Technologies) and stored at −80°. RNA and stained with Phalloidin (AF647) and anti-CD3d (unlabeled was extracted by TRIzol/chloroform and purified with the Qiagen Ab followed by secondary staining with donkey anti-goat Dylight RNeasy Mini purification kit according to the manufacturer’s 550). -
Brief Genetics Report Haplotype Structures and Large
Brief Genetics Report Haplotype Structures and Large-Scale Association Testing of the 5 AMP-Activated Protein Kinase Genes PRKAA2, PRKAB1, and PRKAB2 With Type 2 Diabetes Maria W. Sun,1,2 Jennifer Y. Lee,1,2 Paul I.W. de Bakker,1,2,3 Noe¨l P. Burtt,2 Peter Almgren,4 Lennart Råstam,5 Tiinamaija Tuomi,6 Daniel Gaudet,7 Mark J. Daly,2,8 Joel N. Hirschhorn,2,3,9 David Altshuler,1,2,3,8,10 Leif Groop,4,6 and Jose C. Florez1,2,8,10 AMP-activated protein kinase (AMPK) is a key molecular plasma glucose, or insulin sensitivity. Several nominal asso- regulator of cellular metabolism, and its activity is induced ciations of variants in PRKAA2 and PRKAB1 with BMI appear by both metformin and thiazolidinedione antidiabetic med- to be consistent with statistical noise. Diabetes 55:849–855, ications. It has therefore been proposed both as a putative 2006 agent in the pathophysiology of type 2 diabetes and as a valid target for therapeutic intervention. Thus, the genes that encode the various AMPK subunits are intriguing ype 2 diabetes arises from the complex interplay candidates for the inherited basis of type 2 diabetes. We therefore set out to test for the association of common of various pathophysiologic mechanisms involv- variants in the genes that encode three selected AMPK ing peripheral insulin resistance and relative subunits with type 2 diabetes and related phenotypes. Of Tinsulin insufficiency. The final expression of the the seven genes that encode AMPK isoforms, we initially diabetic phenotype is strongly influenced by inheritance; chose PRKAA2, PRKAB1, and PRKAB2 because of their however, with the exception of rare monogenic forms of higher prior probability of association with type 2 diabetes, diabetes, common type 2 diabetes is thought to have a based on previous reports of genetic linkage, functional polygenic architecture (1). -
Molecular Mechanisms Involved Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis
Virginia Commonwealth University VCU Scholars Compass Theses and Dissertations Graduate School 2010 Molecular Mechanisms Involved Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis Ryan Fassnacht Virginia Commonwealth University Follow this and additional works at: https://scholarscompass.vcu.edu/etd Part of the Physiology Commons © The Author Downloaded from https://scholarscompass.vcu.edu/etd/2246 This Thesis is brought to you for free and open access by the Graduate School at VCU Scholars Compass. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. Ryan C. Fassnacht 2010 All Rights Reserved Molecular Mechanisms Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science at Virginia Commonwealth University. by Ryan Christopher Fassnacht, B.S. Hampden Sydney University, 2005 M.S. Virginia Commonwealth University, 2010 Director: Valeria Mas, Ph.D., Associate Professor of Surgery and Pathology Division of Transplant Department of Surgery Virginia Commonwealth University Richmond, Virginia July 9, 2010 Acknowledgement The Author wishes to thank his family and close friends for their support. He would also like to thank the members of the molecular transplant team for their help and advice. This project would not have been possible with out the help of Dr. Valeria Mas and her endearing -
A Functional C-Terminal TRAF3-Binding Site in MAVS Participates in Positive and Negative Regulation of the IFN Antiviral Response
Cell Research (2011) 21:895-910. © 2011 IBCB, SIBS, CAS All rights reserved 1001-0602/11 $ 32.00 npg ORIGINAL ARTICLE www.nature.com/cr A functional C-terminal TRAF3-binding site in MAVS participates in positive and negative regulation of the IFN antiviral response Suzanne Paz1, 2, Myriam Vilasco3, Steven J Werden1, Meztli Arguello1, Deshanthe Joseph-Pillai1, 2, Tiejun Zhao1, Thi Lien-Anh Nguyen1, Qiang Sun1, Eliane F Meurs3, Rongtuan Lin1, 4, John Hiscott1, 2, 4 1Terry Fox Molecular Oncology Group, Lady Davis Institute, Jewish General Hospital, Montreal, Quebec H3T1E2, Canada; 2Department of Microbiology and Immunology, McGill University Montreal, Quebec H3A 2B4, Canada; 3Department of Virology, Unit of Hepacivirus and Innate Immunity, Pasteur Institute, Paris 75724 France; 4Department of Medicine, McGill University Montreal, Quebec H3A 2B4, Canada Recognition of viral RNA structures by the cytosolic sensor retinoic acid-inducible gene-I (RIG-I) results in the activation of signaling cascades that culminate with the generation of the type I interferon (IFN) antiviral response. Onset of antiviral and inflammatory responses to viral pathogens necessitates the regulated spatiotemporal recruitment of signaling adapters, kinases and transcriptional proteins to the mitochondrial antiviral signaling protein (MAVS). We previously demonstrated that the serine/threonine kinase IKKε is recruited to the C-terminal region of MAVS following Sendai or vesicular stomatitis virus (VSV) infection, mediated by Lys63-linked polyubiquitination of MAVS at Lys500, resulting in inhibition of downstream IFN signaling (Paz et al, Mol Cell Biol, 2009). In this study, we demonstrate that C-terminus of MAVS harbors a novel TRAF3-binding site in the aa450- 468 region of MAVS. -
Genetic Basis of Simple and Complex Traits with Relevance to Avian Evolution
Genetic basis of simple and complex traits with relevance to avian evolution Małgorzata Anna Gazda Doctoral Program in Biodiversity, Genetics and Evolution D Faculdade de Ciências da Universidade do Porto 2019 Supervisor Miguel Jorge Pinto Carneiro, Auxiliary Researcher, CIBIO/InBIO, Laboratório Associado, Universidade do Porto Co-supervisor Ricardo Lopes, CIBIO/InBIO Leif Andersson, Uppsala University FCUP Genetic basis of avian traits Nota Previa Na elaboração desta tese, e nos termos do número 2 do Artigo 4º do Regulamento Geral dos Terceiros Ciclos de Estudos da Universidade do Porto e do Artigo 31º do D.L.74/2006, de 24 de Março, com a nova redação introduzida pelo D.L. 230/2009, de 14 de Setembro, foi efetuado o aproveitamento total de um conjunto coerente de trabalhos de investigação já publicados ou submetidos para publicação em revistas internacionais indexadas e com arbitragem científica, os quais integram alguns dos capítulos da presente tese. Tendo em conta que os referidos trabalhos foram realizados com a colaboração de outros autores, o candidato esclarece que, em todos eles, participou ativamente na sua conceção, na obtenção, análise e discussão de resultados, bem como na elaboração da sua forma publicada. Este trabalho foi apoiado pela Fundação para a Ciência e Tecnologia (FCT) através da atribuição de uma bolsa de doutoramento (PD/BD/114042/2015) no âmbito do programa doutoral em Biodiversidade, Genética e Evolução (BIODIV). 2 FCUP Genetic basis of avian traits Acknowledgements Firstly, I would like to thank to my all supervisors Miguel Carneiro, Ricardo Lopes and Leif Andersson, for the demanding task of supervising myself last four years. -
Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7 -
Biogenesis and Maintenance of Cytoplasmic Domains in Myelin of the Central Nervous System
Biogenesis and Maintenance of Cytoplasmic Domains in Myelin of the Central Nervous System Dissertation for the award of the degree “Doctor rerum naturalium” of the Georg-August-Universität Göttingen within the doctoral program Molecular Biology of Cells of the Georg-August University School of Science (GAUSS) submitted by Caroline Julia Velte from Usingen, Germany Göttingen 2016 Members of the Thesis Committee: Prof. Dr. Mikael Simons, Reviewer Max Planck Institute of Experimental Medicine, Göttingen Prof. Dr. Andreas Janshoff, Reviewer Georg-August University, Göttingen Prof. Dr. Dirk Görlich Max Planck Institute of Biophysical Chemistry, Göttingen Date of the thesis defense: 27th of June 2016 Don't part with your illusions. When they are gone, you may still exist, but you have ceased to live. (Mark Twain) III Affidavit I hereby declare that my PhD thesis “Biogenesis and Maintenance of Cytoplasmic Domains in Myelin of the Central Nervous System” has been written independently with no other aids or sources than quoted. Furthermore, I confirm that this thesis has not been submitted as part of another examination process neither in identical nor in similar form. Caroline Julia Velte April 2016 Göttingen, Germany V Publications Nicolas Snaidero*, Caroline Velte*, Matti Myllykoski, Arne Raasakka, Alexander Ignatev, Hauke B. Werner, Michelle S. Erwig, Wiebke Moebius, Petri Kursula, Klaus-Armin Nave, and Mikael Simons Antagonistic Functions of MBP and CNP Establish Cytosolic Channels in CNS Myelin, Cell Reports 18 *equal contribution (January 2017) E. d’Este, D. Kamin, C. Velte, F. Göttfert, M. Simons, S.W. Hell Subcortical cytoskeleton periodicity throughout the nervous system, Scientific Reports 6 (March 2016) K.A. -
De Novo EIF2AK1 and EIF2AK2 Variants Are Associated with Developmental Delay, Leukoencephalopathy, and Neurologic Decompensation
bioRxiv preprint doi: https://doi.org/10.1101/757039; this version posted September 16, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. De novo EIF2AK1 and EIF2AK2 variants are associated with developmental delay, leukoencephalopathy, and neurologic decompensation Dongxue Mao1,2, Chloe M. Reuter3,4, Maura R.Z. Ruzhnikov5,6, Anita E. Beck7, Emily G. Farrow8,9,10, Lisa T. Emrick1,11,12,13, Jill A. Rosenfeld12, Katherine M. Mackenzie5, Laurie Robak2,12,13, Matthew T. Wheeler3,14, Lindsay C. Burrage12,13, Mahim Jain15, Pengfei Liu12, Daniel Calame11,13, Sebastien Küry17,18, Martin Sillesen19, Klaus Schmitz-Abe20, Davide Tonduti21, Luigina Spaccini22, Maria Iascone23, Casie A. Genetti20, Madeline Graf16, Alyssa Tran12, Mercedes Alejandro12, Undiagnosed Diseases Network, Brendan H. Lee12,13, Isabelle Thiffault8,9,24, Pankaj B. Agrawal#,20, Jonathan A. Bernstein#,3,25, Hugo J. Bellen#,2,12,26,27,28, Hsiao- Tuan Chao#,1,2,11,12,13,28,27,29 #Correspondence should be addressed: [email protected] (P.A.), [email protected] (J.A.B.), [email protected] (H.J.B.), [email protected] (H.T.C.) 1Department of Pediatrics, Baylor College of Medicine (BCM), Houston, TX 2Jan and Dan Duncan Neurological Research Institute, Texas Children’s Hospital, Houston, TX 3Stanford Center for Undiagnosed Diseases, Stanford University, Stanford, CA 4Stanford Center for Inherited Cardiovascular Disease, Division of Cardiovascular Medicine, -
A General Binding Mechanism for All Human Sulfatases by the Formylglycine-Generating Enzyme
A general binding mechanism for all human sulfatases by the formylglycine-generating enzyme Dirk Roeser*, Andrea Preusser-Kunze†, Bernhard Schmidt†, Kathrin Gasow*, Julia G. Wittmann*, Thomas Dierks‡, Kurt von Figura†, and Markus Georg Rudolph*§ *Department of Molecular Structural Biology, University of Go¨ttingen, Justus-von-Liebig-Weg 11, D-37077 Go¨ttingen, Germany; †Department of Biochemistry II, Heinrich-Du¨ker-Weg 12, University of Go¨ttingen, D-37073 Go¨ttingen, Germany; and ‡Department of Biochemistry I, Universita¨tsstrasse 25, University of Bielefeld, D-33615 Bielefeld, Germany Edited by Carolyn R. Bertozzi, University of California, Berkeley, CA, and approved November 8, 2005 (received for review September 1, 2005) The formylglycine (FGly)-generating enzyme (FGE) uses molecular tases, suggesting a general binding mechanism of substrate sulfa- oxygen to oxidize a conserved cysteine residue in all eukaryotic tases by FGE. sulfatases to the catalytically active FGly. Sulfatases degrade and The details of how O2-dependent cysteine oxidation is mediated remodel sulfate esters, and inactivity of FGE results in multiple by FGE are unknown. As a first step toward the elucidation of the sulfatase deficiency, a fatal disease. The previously determined FGE molecular mechanism of FGly formation, we have previously crystal structure revealed two crucial cysteine residues in the active determined crystal structures of FGE in various oxidation states site, one of which was thought to be implicated in substrate (8). FGE adopts a novel fold with surprisingly little regular sec- 2ϩ binding. The other cysteine residue partakes in a novel oxygenase ondary structure and contains two structural Ca ions and two mechanism that does not rely on any cofactors.