DOCSLIB.ORG

Table S1. Complete Gene List. Genbank Refseq and Description of Each Gene Were Provided By

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Table S1. Complete Gene List. Genbank Refseq and Description of Each Gene Were Provided By Document downloaded from http://www.elsevier.es, day 24/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Table S1. Complete gene list. GenBank RefSeq and description of each gene were provided by the array supplier. Unigene GeneBank Symbol Description Gene Name/s Rn.11422 NM_033230 Akt1 V-akt murine thymoma viral oncogene homolog 1 Akt Rn.2104 NM_019288 App Amyloid beta (A4) precursor protein - Rn.23323 NM_001034933 Arsa Arylsulfatase A MGC125207 Rn.94004 NM_033443 Arsb Arylsulfatase B - Rn.6224 NM_001038495 Atg12 ATG12 autophagy related 12 Apg12l, MGC125080 Rn.101734NM_001108809 Atg16l1 ATG16 autophagy related 16-like 1 Apg16l, Wdr30 Rn.104199NM_001191560 Atg16l2 ATG16 autophagy related 16-like 2 RGD1311400 Rn.3084 NM_134394 Atg3 ATG3 autophagy related 3 Apg3l, PIG-1, Pig1 Rn.163086NM_001025711 Atg4b ATG4 autophagy related 4 homolog B Apg4b, MGC112887 Rn.23378 NM_001107948 Atg4c ATG4 autophagy related 4 homolog C - Rn.98385 NM_001014250 Atg5 ATG5 autophagy related 5 - Rn.162765NM_001012097 Atg7 ATG7 autophagy related 7 Apg7l Rn.35248 NM_001014218 Atg9a ATG9 autophagy related 9 homolog A MGC105908, RGD1310450 Rn.36696 NM_022698 Bad BCL2-associated agonist of cell death MGC72439 Rn.14598 NM_053812 Bak1 BCL2-antagonist/killer 1 MGC108627 Rn.10668 NM_017059 Bax Bcl2-associated X protein - Rn.9996 NM_016993 Bcl2 B-cell CLL/lymphoma 2 Bcl-2 Rn.10323 NM_031535 Bcl2l1 Bcl2-like 1 Bcl-xl, Bcl2l, Bclx, bcl-X Rn.2776 NM_053739 Becn1 Beclin 1, autophagy related - Rn.31142 NM_022684 Bid BH3 interacting domain death agonist - Rn.2060 NM_053420 Bnip3 BCL2/adenovirus E1B interacting protein 3 MGC93043 Rn.10562 NM_012922 Casp3 Caspase 3 Lice, MGC93645 Rn.54474 NM_022277 Casp8 Caspase 8 - Rn.29897 NM_031762 Cdkn1b Cyclin-dependent kinase inhibitor 1B CDKN4, Cdki1b, Kip1, P27KIP1, p27 Rn.48717 NM_031550 Cdkn2a Cyclin-dependent kinase inhibitor 2A Arf, INK4A, MTS1, p16, p16Cdkn2a, p19ARF Rn.102386NM_001006971 Cln3 Ceroid-lipofuscinosis, neuronal 3 MGC94583 Rn.100909 NM_022597 Ctsb Cathepsin B - Rn.11085 NM_134334 Ctsd Cathepsin D - Rn.11347 NM_017320 Ctss Cathepsin S - Rn.44431 NM_022205 Cxcr4 Chemokine (C-X-C motif) receptor 4 MGC108696 Rn.23108 NM_001107335 Dapk1 Death associated protein kinase 1 - Rn.24897 NM_031599 Eif2ak3 Eukaryotic translation initiation factor 2 alpha kinase PEK 3 Rn.101803 XM_213569 Eif4g1 Eukaryotic translation initiation factor 4 gamma, 1 - Rn.10595 NM_012689 Esr1 Estrogen receptor 1 ER-alpha, Esr, RNESTROR Rn.16183 NM_152937 Fadd Fas (TNFRSF6)-associated via death domain Mort1 Rn.162521 NM_139194 Fas Fas (TNF receptor superfamily, member 6) Tnfrsf6 Rn.162368 NM_199118 Gaa Glucosidase, alpha, acid MGC72625 Rn.8411 NM_172036 Gabarap GABA(A) receptor-associated protein - Rn.64537 NM_022706 Gabarapl2 GABA(A) receptor-associated protein like 2 Gef2, MGC108686 Rn.1863 NM_001025409 Hdac1 Histone deacetylase 1 - Rn.13453 XM_228753 Hdac6 Histone deacetylase 6 - Rn.21 NM_019387 Hgs Hepatocyte growth factor-regulated tyrosine kinase Hrs substrate Rn.119867 NM_175761 Hsp90aa1 Heat shock protein 90, alpha (cytosolic), class A Hsp86, Hsp90, Hspca, member 1 MGC105293 Rn.120392 NM_024351 Hspa8 Heat shock protein 8 Hsc70, MGC114311 Rn.11193 NM_024357 Htt Huntingtin Hd, Hdh N/A XM_233152 Ifna2 Interferon alpha family, gene 2 - Rn.218577NM_001106667 Ifna4 Interferon, alpha 4 - Rn.10795 NM_138880 Ifng Interferon gamma IFNG2 Rn.6282 NM_178866 Igf1 Insulin-like growth factor 1 - Rn.989 NM_019130 Ins2 Insulin 2 - Rn.20356 NM_001012007 Irgm Immunity-related GTPase family, M Ifi1 Rn.40177 NM_012857 Lamp1 Lysosomal-associated membrane protein 1 LGP120 Rn.3135 NM_199500 Map1lc3a Microtubule-associated protein 1 light chain 3 alpha MGC105263 Rn.41412 NM_022867 Map1lc3b Microtubule-associated protein 1 light chain 3 beta MGC93422, Map1lc3, Mpl3, zbs559 Rn.88085 NM_031020 Mapk14 Mitogen activated protein kinase 14 CRK1, CSBP, CSPB1, Csbp1, Csbp2, Exip, Hog, MGC105413, Mxi2, Prkm14, Prkm15, RK, Sapk2A, p38, p38Hog, p38alpha Document downloaded from http://www.elsevier.es, day 24/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Rn.4090 XM_341399 Mapk8 Mitogen-activated protein kinase 8 JNK Rn.2411 XM_342346 Nfkb1 Nuclear factor of kappa light polypeptide gene NF-kB enhancer in B-cells 1 Rn.133954NM_001134341 Ambra1 Autophagy/beclin 1 regulator 1 Nyw1 Rn.30010 NM_022958 Pik3c3 Phosphoinositide-3-kinase, class 3 - Rn.152697NM_001106723 Pik3cg Phosphoinositide-3-kinase, catalytic, gamma Pi3k polypeptide Rn.8917 NM_001108777 Pik3r4 Phosphoinositide-3-kinase, regulatory subunit 4 - Rn.87789 NM_019142 Prkaa1 Protein kinase, AMP-activated, alpha 1 catalytic 5'-AMP- subunit activatedproteinkinasealpha- 1catalyticsubunit, 5-AMP- activatedproteinkinasealpha- 1catalyticsubunit Rn.64583 NM_023991 Prkaa2 Protein kinase, AMP-activated, alpha 2 catalytic AMPK subunit Rn.44440 NM_019163 Psen1 Presenilin 1 - Rn.22158 NM_031606 Pten Phosphatase and tensin homolog MMAC1, Mmac, TEP1 Rn.6295 NM_001015023 Rab24 RAB24, member RAS oncogene family MGC108835 Rn.55115 NM_017045 Rb1 Retinoblastoma 1 - Rn.33137 NM_001107901 Rb1cc1 RB1-inducible coiled-coil 1 - Rn.4038 NM_001007659 RGD1359310 Similar to RIKEN cDNA 9430023L20 Atg101, MGC94201 Rn.88166 NM_021661 Rgs19 Regulator of G-protein signaling 19 Camki, Gaip, MGC108699 Rn.4042 NM_031985 Rps6kb1 Ribosomal protein S6 kinase, polypeptide 1 - Rn.1827 NM_019169 Snca Synuclein, alpha (non A4 component of amyloid MGC105443 precursor) Rn.107103 NM_181550 Sqstm1 Sequestosome 1 Osi, ZIP, ZIP3 Rn.40136 NM_021578 Tgfb1 Transforming growth factor, beta 1 - Rn.10 NM_019386 Tgm2 Transglutaminase 2, C polypeptide TgaseII Rn.12071 NM_001012155 Tm9sf1 Transmembrane 9 superfamily member 1 - Rn.1279 NM_001025018 Dram2 DNA-damage regulated autophagy modulator 2 MGC109061, Tmem77 Rn.2275 NM_012675 Tnf Tumor necrosis factor (TNF superfamily, member 2) MGC124630, RATTNF, TNF-alpha, Tnfa Rn.83627 NM_145681 Tnfsf10 Tumor necrosis factor (ligand) superfamily, member Trail 10 Rn.54443 NM_030989 Tp53 Tumor protein p53 MGC112612, Trp53, p53 Rn.103860NM_001108696 Tp73 Tumor protein p73 P73, Trp73 Rn.24509 NM_001108341 Ulk1 Unc-51 like kinase 1 (C. elegans) - Rn.99218 NM_001107536 Uvrag UV radiation resistance associated gene - Rn.203725NM_001127297 Wipi1 WD repeat domain, phosphoinositide interacting 1 RGD1307754 Rn.973 NM_001007604 Rplp1 Ribosomal protein, large, P1 MGC72935 Rn.47 NM_012583 Hprt1 Hypoxanthine phosphoribosyltransferase 1 Hgprtase, Hprt, MGC112554 Rn.92211 NM_173340 Rpl13a Ribosomal protein L13A - H05 Rn.94978 NM_031144 Actb Actin, beta Rn.107896 NM_017025 Ldha Lactate dehydrogenase A Ldh1 Document downloaded from http://www.elsevier.es, day 24/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Table S2. Array components. Functional gene grouping. Autophagy Machinery Components: Components Involved in Autophagic Vacuole Formation: AMBRA1, ATG12, ATG16L1, ATG4A, ATG4B, ATG4C, ATG4D, ATG5, ATG9A, ATG9B, BECN1, GABARAP, GABARAPL1, GABARAPL2, IRGM, MAP1LC3A, MAP1LC3B, RGS19, ULK1. Components Responsible for Protein Targeting to Membrane / Vacuole: ATG4A, ATG4B, ATG4C, ATG4D, GABARAP. Components Responsible for Protein Transport: ATG10, ATG16L1, ATG16L2, ATG3, ATG4A, ATG4B, ATG4C, ATG4D, ATG7, ATG9A, GABARAP, GABARAPL2, RAB24. Components Linking Autophagosome to Lysosome: DRAM1, GABARAP, FAM176A. Components Involved in Protein Ubiquitination: ATG3, ATG7. Components with Protease Activity: ATG4A, ATG4B, ATG4C, ATG4D. Regulation of Autophagy: Co-Regulators of Autophagy and Apoptosis: AKT1, APP, ATG12, ATG5, BAD, BAK1, BAX, BCL2, BCL2L1, BECN1, BID, BNIP3, CASP3, CASP8, CDKN1B, CDKN2A, CLN3, CTSB, CXCR4, DAPK1, DRAM1, EIF2AK3, FADD, FAS, HDAC1, HTT, IFNA2, IFNG, IGF1, INS, MAPK8, NFKB1, PIK3CG, PRKAA1, PTEN, SNCA, SQSTM1, TGFB1, TGM2, TNF, TNFSF10, TP53, TP73. Co-Regulators of Autophagy and the Cell Cycle: BAX, CDKN1B, CDKN2A, IFNG, PTEN, RB1, TGFB1, TP53, TP73. Autophagy Induction by Intracellular Pathogens: EIF2AK3, IFNA2, IFNA4, IFNG. Autophagy in Response to Other Intracellular Signals: ARSA, CTSS, EIF4G1, ESR1, GAA, HGS, MAPK14, PIK3C3, PIK3R4, PRKAA2, RPS6KB1, TMEM74, DRAM2, ULK2, UVRAG. Chaperone-Mediated Autophagy: HSP90AA1, HSPA8. Document downloadedfromhttp://www.elsevier.es,day24/09/2021.Thiscopyisforpersonaluse.Anytransmissionofthisdocumentbyanymediaorformatstrictlyprohibited. Tables S3-S4. Supplementary gene expression data associated with this article. Gene expression after infections with L. monocytogenes in rat brain organotypic cultures at different time points (5 h and 12 h respectively). Table S3 AVG Ct Standard Deviation 2^(-Avg.(Delta(Ct)) Up-Down Regulation (comparing to control group) p-value (comparing to Symbol Description Control Infected Control Infected Control Infected Fold Regulation control group) Akt1 V-akt murine thymoma viral oncogene homolog 1 30.23 30.75 0.269162 0.928754 0.017726 0.009685 0.207264 -1.8302 App Amyloid beta (A4) precursor protein 23.88 23.98 0.216028 0.373154 1.445932 1.060688 0.100173 -1.3632 Arsa Arylsulfatase A 30.87 31.35 0.252602 1.045118 0.011375 0.006412 0.192415 -1.774 Arsb Arylsulfatase B 28.11 28.22 0.23231 0.528568 0.077053 0.055939 0.244029 -1.3775 Atg12 ATG12 autophagy related 12 28.71 29.43 0.345526 0.75923 0.050836 0.024265 0.033417 -2.0951 Atg16l1 ATG16 autophagy related 16-like 1 29.87 30.23 0.39689 0.704157 0.022697 0.013888 0.156155 -1.6343 Atg16l2 ATG16 autophagy
Load more

Recommended publications
  • Deciphering the Functions of Ets2, Pten and P53 in Stromal Fibroblasts in Multiple
    Deciphering the Functions of Ets2, Pten and p53 in Stromal Fibroblasts in Multiple Breast Cancer Models DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Julie Wallace Graduate Program in Molecular, Cellular and Developmental Biology The Ohio State University 2013 Dissertation Committee: Michael C. Ostrowski, PhD, Advisor Gustavo Leone, PhD Denis Guttridge, PhD Dawn Chandler, PhD Copyright by Julie Wallace 2013 Abstract Breast cancer is the second most common cancer in American women, and is also the second leading cause of cancer death in women. It is estimated that nearly a quarter of a million new cases of invasive breast cancer will be diagnosed in women in the United States this year, and approximately 40,000 of these women will die from breast cancer. Although death rates have been on the decline for the past decade, there is still much we need to learn about this disease to improve prevention, detection and treatment strategies. The majority of early studies have focused on the malignant tumor cells themselves, and much has been learned concerning mutations, amplifications and other genetic and epigenetic alterations of these cells. However more recent work has acknowledged the strong influence of tumor stroma on the initiation, progression and recurrence of cancer. Under normal conditions this stroma has been shown to have protective effects against tumorigenesis, however the transformation of tumor cells manipulates this surrounding environment to actually promote malignancy. Fibroblasts in particular make up a significant portion of this stroma, and have been shown to impact various aspects of tumor cell biology.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • PERK Antibody / EIF2AK3 (RQ4206)
    PERK Antibody / EIF2AK3 (RQ4206) Catalog No. Formulation Size RQ4206 0.5mg/ml if reconstituted with 0.2ml sterile DI water 100 ug Bulk quote request Availability 1-3 business days Species Reactivity Human, Mouse, Rat Format Antigen affinity purified Clonality Polyclonal (rabbit origin) Isotype Rabbit IgG Purity Antigen affinity purified Buffer Lyophilized from 1X PBS with 2% Trehalose and 0.025% sodium azide UniProt Q9NZJ5 Applications Western Blot : 0.5-1ug/ml Flow cytometry : 1-3ug/10^6 cells Direct ELISA : 0.1-0.5ug/ml Limitations This PERK antibody is available for research use only. Western blot testing of human 1) HeLa, 2) COLO320, 3) A549, 4) SK-OV-3, 5) A431, 6) rat brain and 7) mouse brain lysate with PERK antibody at 0.5ug/ml. Predicted molecular weight ~125 kDa, observed here at ~140 kDa. Flow cytometry testing of human HepG2 cells with PERK antibody at 1ug/10^6 cells (blocked with goat sera); Red=cells alone, Green=isotype control, Blue= PERK antibody. Description Eukaryotic translation initiation factor 2-alpha kinase 3, also known as protein kinase R (PKR)-like endoplasmic reticulum kinase (PERK), is an enzyme that in humans is encoded by the EIF2AK3 gene. The protein encoded by this gene phosphorylates the alpha subunit of eukaryotic translation-initiation factor 2, leading to its inactivation, and thus to a rapid reduction of translational initiation and repression of global protein synthesis. This protein is thought to modulate mitochondrial function. It is a type I membrane protein located in the endoplasmic reticulum (ER), where it is induced by ER stress caused by malfolded proteins.
    [Show full text]
  • Supporting Information
    Supporting Information Celhar et al. 10.1073/pnas.1507052112 SI Materials and Methods using a Nanodrop spectrophotometer (Thermo Fisher Scien- Proteinuria. Proteinuria was assessed using Albustix (Bayer). Al- tific). A TaqMan RNA-to-CT 1-Step Kit (Applied Biosystems) bumin levels in urine were assayed using an Albumin Mouse was used to perform the reverse transcription and quantitative ELISA Kit (Abcam) according to the manufacturer’s instructions; PCR reactions according to the manufacturer’s instructions samples were assayed at a dilution of 1:400. Samples were nor- using TaqMan gene expression assays (Applied Biosystems) to malized for creatinine using a Creatinine (urinary) Colorimetric either Tlr7 (Mm00446590) or the B2m housekeeping gene Assay Kit (Cayman Chemical) according to the manufacturer’s (Mm00437762). Real-time PCR was performed on the 7900H instructions; initial sample dilution of 1:10. fast real-time PCR system and analyzed using SDS 2.4 (Applied Biosystems). Relative mRNA expression was calculated using the Cell Sorting, RNA Isolation, and RT-PCR. Splenic B cells were comparative C method. + − + + t sorted as live CD45 Gr1 B220 CD19 , splenic T cells as live + − + + CD45 Gr1 CD3 CD5 and peritoneal macrophages as live Imaging. Kidney sections from OCT embedded tissue were fixed + − CD45 Gr1 CD11bhiF4/80hi. Sorted cells were centrifuged, re- with 4% paraformaldehyde before permeabilization with acetone suspended in TRIzol (Life Technologies) and stored at −80°. RNA and stained with Phalloidin (AF647) and anti-CD3d (unlabeled was extracted by TRIzol/chloroform and purified with the Qiagen Ab followed by secondary staining with donkey anti-goat Dylight RNeasy Mini purification kit according to the manufacturer’s 550).
    [Show full text]
  • Brief Genetics Report Haplotype Structures and Large
    Brief Genetics Report Haplotype Structures and Large-Scale Association Testing of the 5؅ AMP-Activated Protein Kinase Genes PRKAA2, PRKAB1, and PRKAB2 With Type 2 Diabetes Maria W. Sun,1,2 Jennifer Y. Lee,1,2 Paul I.W. de Bakker,1,2,3 Noe¨l P. Burtt,2 Peter Almgren,4 Lennart Råstam,5 Tiinamaija Tuomi,6 Daniel Gaudet,7 Mark J. Daly,2,8 Joel N. Hirschhorn,2,3,9 David Altshuler,1,2,3,8,10 Leif Groop,4,6 and Jose C. Florez1,2,8,10 AMP-activated protein kinase (AMPK) is a key molecular plasma glucose, or insulin sensitivity. Several nominal asso- regulator of cellular metabolism, and its activity is induced ciations of variants in PRKAA2 and PRKAB1 with BMI appear by both metformin and thiazolidinedione antidiabetic med- to be consistent with statistical noise. Diabetes 55:849–855, ications. It has therefore been proposed both as a putative 2006 agent in the pathophysiology of type 2 diabetes and as a valid target for therapeutic intervention. Thus, the genes that encode the various AMPK subunits are intriguing ype 2 diabetes arises from the complex interplay candidates for the inherited basis of type 2 diabetes. We therefore set out to test for the association of common of various pathophysiologic mechanisms involv- variants in the genes that encode three selected AMPK ing peripheral insulin resistance and relative subunits with type 2 diabetes and related phenotypes. Of Tinsulin insufficiency. The final expression of the the seven genes that encode AMPK isoforms, we initially diabetic phenotype is strongly influenced by inheritance; chose PRKAA2, PRKAB1, and PRKAB2 because of their however, with the exception of rare monogenic forms of higher prior probability of association with type 2 diabetes, diabetes, common type 2 diabetes is thought to have a based on previous reports of genetic linkage, functional polygenic architecture (1).
    [Show full text]
  • Molecular Mechanisms Involved Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis
    Virginia Commonwealth University VCU Scholars Compass Theses and Dissertations Graduate School 2010 Molecular Mechanisms Involved Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis Ryan Fassnacht Virginia Commonwealth University Follow this and additional works at: https://scholarscompass.vcu.edu/etd Part of the Physiology Commons © The Author Downloaded from https://scholarscompass.vcu.edu/etd/2246 This Thesis is brought to you for free and open access by the Graduate School at VCU Scholars Compass. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. Ryan C. Fassnacht 2010 All Rights Reserved Molecular Mechanisms Involved in the Interaction Effects of HCV and Ethanol on Liver Cirrhosis A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science at Virginia Commonwealth University. by Ryan Christopher Fassnacht, B.S. Hampden Sydney University, 2005 M.S. Virginia Commonwealth University, 2010 Director: Valeria Mas, Ph.D., Associate Professor of Surgery and Pathology Division of Transplant Department of Surgery Virginia Commonwealth University Richmond, Virginia July 9, 2010 Acknowledgement The Author wishes to thank his family and close friends for their support. He would also like to thank the members of the molecular transplant team for their help and advice. This project would not have been possible with out the help of Dr. Valeria Mas and her endearing
    [Show full text]
  • A Functional C-Terminal TRAF3-Binding Site in MAVS Participates in Positive and Negative Regulation of the IFN Antiviral Response
    Cell Research (2011) 21:895-910. © 2011 IBCB, SIBS, CAS All rights reserved 1001-0602/11 $ 32.00 npg ORIGINAL ARTICLE www.nature.com/cr A functional C-terminal TRAF3-binding site in MAVS participates in positive and negative regulation of the IFN antiviral response Suzanne Paz1, 2, Myriam Vilasco3, Steven J Werden1, Meztli Arguello1, Deshanthe Joseph-Pillai1, 2, Tiejun Zhao1, Thi Lien-Anh Nguyen1, Qiang Sun1, Eliane F Meurs3, Rongtuan Lin1, 4, John Hiscott1, 2, 4 1Terry Fox Molecular Oncology Group, Lady Davis Institute, Jewish General Hospital, Montreal, Quebec H3T1E2, Canada; 2Department of Microbiology and Immunology, McGill University Montreal, Quebec H3A 2B4, Canada; 3Department of Virology, Unit of Hepacivirus and Innate Immunity, Pasteur Institute, Paris 75724 France; 4Department of Medicine, McGill University Montreal, Quebec H3A 2B4, Canada Recognition of viral RNA structures by the cytosolic sensor retinoic acid-inducible gene-I (RIG-I) results in the activation of signaling cascades that culminate with the generation of the type I interferon (IFN) antiviral response. Onset of antiviral and inflammatory responses to viral pathogens necessitates the regulated spatiotemporal recruitment of signaling adapters, kinases and transcriptional proteins to the mitochondrial antiviral signaling protein (MAVS). We previously demonstrated that the serine/threonine kinase IKKε is recruited to the C-terminal region of MAVS following Sendai or vesicular stomatitis virus (VSV) infection, mediated by Lys63-linked polyubiquitination of MAVS at Lys500, resulting in inhibition of downstream IFN signaling (Paz et al, Mol Cell Biol, 2009). In this study, we demonstrate that C-terminus of MAVS harbors a novel TRAF3-binding site in the aa450- 468 region of MAVS.
    [Show full text]
  • Genetic Basis of Simple and Complex Traits with Relevance to Avian Evolution
    Genetic basis of simple and complex traits with relevance to avian evolution Małgorzata Anna Gazda Doctoral Program in Biodiversity, Genetics and Evolution D Faculdade de Ciências da Universidade do Porto 2019 Supervisor Miguel Jorge Pinto Carneiro, Auxiliary Researcher, CIBIO/InBIO, Laboratório Associado, Universidade do Porto Co-supervisor Ricardo Lopes, CIBIO/InBIO Leif Andersson, Uppsala University FCUP Genetic basis of avian traits Nota Previa Na elaboração desta tese, e nos termos do número 2 do Artigo 4º do Regulamento Geral dos Terceiros Ciclos de Estudos da Universidade do Porto e do Artigo 31º do D.L.74/2006, de 24 de Março, com a nova redação introduzida pelo D.L. 230/2009, de 14 de Setembro, foi efetuado o aproveitamento total de um conjunto coerente de trabalhos de investigação já publicados ou submetidos para publicação em revistas internacionais indexadas e com arbitragem científica, os quais integram alguns dos capítulos da presente tese. Tendo em conta que os referidos trabalhos foram realizados com a colaboração de outros autores, o candidato esclarece que, em todos eles, participou ativamente na sua conceção, na obtenção, análise e discussão de resultados, bem como na elaboração da sua forma publicada. Este trabalho foi apoiado pela Fundação para a Ciência e Tecnologia (FCT) através da atribuição de uma bolsa de doutoramento (PD/BD/114042/2015) no âmbito do programa doutoral em Biodiversidade, Genética e Evolução (BIODIV). 2 FCUP Genetic basis of avian traits Acknowledgements Firstly, I would like to thank to my all supervisors Miguel Carneiro, Ricardo Lopes and Leif Andersson, for the demanding task of supervising myself last four years.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Biogenesis and Maintenance of Cytoplasmic Domains in Myelin of the Central Nervous System
    Biogenesis and Maintenance of Cytoplasmic Domains in Myelin of the Central Nervous System Dissertation for the award of the degree “Doctor rerum naturalium” of the Georg-August-Universität Göttingen within the doctoral program Molecular Biology of Cells of the Georg-August University School of Science (GAUSS) submitted by Caroline Julia Velte from Usingen, Germany Göttingen 2016 Members of the Thesis Committee: Prof. Dr. Mikael Simons, Reviewer Max Planck Institute of Experimental Medicine, Göttingen Prof. Dr. Andreas Janshoff, Reviewer Georg-August University, Göttingen Prof. Dr. Dirk Görlich Max Planck Institute of Biophysical Chemistry, Göttingen Date of the thesis defense: 27th of June 2016 Don't part with your illusions. When they are gone, you may still exist, but you have ceased to live. (Mark Twain) III Affidavit I hereby declare that my PhD thesis “Biogenesis and Maintenance of Cytoplasmic Domains in Myelin of the Central Nervous System” has been written independently with no other aids or sources than quoted. Furthermore, I confirm that this thesis has not been submitted as part of another examination process neither in identical nor in similar form. Caroline Julia Velte April 2016 Göttingen, Germany V Publications Nicolas Snaidero*, Caroline Velte*, Matti Myllykoski, Arne Raasakka, Alexander Ignatev, Hauke B. Werner, Michelle S. Erwig, Wiebke Moebius, Petri Kursula, Klaus-Armin Nave, and Mikael Simons Antagonistic Functions of MBP and CNP Establish Cytosolic Channels in CNS Myelin, Cell Reports 18 *equal contribution (January 2017) E. d’Este, D. Kamin, C. Velte, F. Göttfert, M. Simons, S.W. Hell Subcortical cytoskeleton periodicity throughout the nervous system, Scientific Reports 6 (March 2016) K.A.
    [Show full text]
  • De Novo EIF2AK1 and EIF2AK2 Variants Are Associated with Developmental Delay, Leukoencephalopathy, and Neurologic Decompensation
    bioRxiv preprint doi: https://doi.org/10.1101/757039; this version posted September 16, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. De novo EIF2AK1 and EIF2AK2 variants are associated with developmental delay, leukoencephalopathy, and neurologic decompensation Dongxue Mao1,2, Chloe M. Reuter3,4, Maura R.Z. Ruzhnikov5,6, Anita E. Beck7, Emily G. Farrow8,9,10, Lisa T. Emrick1,11,12,13, Jill A. Rosenfeld12, Katherine M. Mackenzie5, Laurie Robak2,12,13, Matthew T. Wheeler3,14, Lindsay C. Burrage12,13, Mahim Jain15, Pengfei Liu12, Daniel Calame11,13, Sebastien Küry17,18, Martin Sillesen19, Klaus Schmitz-Abe20, Davide Tonduti21, Luigina Spaccini22, Maria Iascone23, Casie A. Genetti20, Madeline Graf16, Alyssa Tran12, Mercedes Alejandro12, Undiagnosed Diseases Network, Brendan H. Lee12,13, Isabelle Thiffault8,9,24, Pankaj B. Agrawal#,20, Jonathan A. Bernstein#,3,25, Hugo J. Bellen#,2,12,26,27,28, Hsiao- Tuan Chao#,1,2,11,12,13,28,27,29 #Correspondence should be addressed: [email protected] (P.A.), [email protected] (J.A.B.), [email protected] (H.J.B.), [email protected] (H.T.C.) 1Department of Pediatrics, Baylor College of Medicine (BCM), Houston, TX 2Jan and Dan Duncan Neurological Research Institute, Texas Children’s Hospital, Houston, TX 3Stanford Center for Undiagnosed Diseases, Stanford University, Stanford, CA 4Stanford Center for Inherited Cardiovascular Disease, Division of Cardiovascular Medicine,
    [Show full text]
  • A General Binding Mechanism for All Human Sulfatases by the Formylglycine-Generating Enzyme
    A general binding mechanism for all human sulfatases by the formylglycine-generating enzyme Dirk Roeser*, Andrea Preusser-Kunze†, Bernhard Schmidt†, Kathrin Gasow*, Julia G. Wittmann*, Thomas Dierks‡, Kurt von Figura†, and Markus Georg Rudolph*§ *Department of Molecular Structural Biology, University of Go¨ttingen, Justus-von-Liebig-Weg 11, D-37077 Go¨ttingen, Germany; †Department of Biochemistry II, Heinrich-Du¨ker-Weg 12, University of Go¨ttingen, D-37073 Go¨ttingen, Germany; and ‡Department of Biochemistry I, Universita¨tsstrasse 25, University of Bielefeld, D-33615 Bielefeld, Germany Edited by Carolyn R. Bertozzi, University of California, Berkeley, CA, and approved November 8, 2005 (received for review September 1, 2005) The formylglycine (FGly)-generating enzyme (FGE) uses molecular tases, suggesting a general binding mechanism of substrate sulfa- oxygen to oxidize a conserved cysteine residue in all eukaryotic tases by FGE. sulfatases to the catalytically active FGly. Sulfatases degrade and The details of how O2-dependent cysteine oxidation is mediated remodel sulfate esters, and inactivity of FGE results in multiple by FGE are unknown. As a first step toward the elucidation of the sulfatase deficiency, a fatal disease. The previously determined FGE molecular mechanism of FGly formation, we have previously crystal structure revealed two crucial cysteine residues in the active determined crystal structures of FGE in various oxidation states site, one of which was thought to be implicated in substrate (8). FGE adopts a novel fold with surprisingly little regular sec- 2ϩ binding. The other cysteine residue partakes in a novel oxygenase ondary structure and contains two structural Ca ions and two mechanism that does not rely on any cofactors.
    [Show full text]