EWS/ETS-Driven Ewing Sarcoma Requires BET Bromodomain Proteins

Home , FLI1

Author Manuscript Published OnlineFirst on June 13, 2018; DOI: 10.1158/0008-5472.CAN-18-0484 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

EWS/ETS-driven Ewing Sarcoma requires BET bromodomain proteins

Paradesi Naidu Gollavilli1, Aishwarya Pawar1, Kari Wilder-Romans2, Natesan Ramakrishnan1, Carl G. Engelke2, Vijaya L. Dommeti3, Pranathi M Krishnamurthy3, Archana Nallasivam3, Ingrid J. Apel3, Tianlei Xu4, Zhaohui S. Qin4, Felix Y. Feng2,5,6 and Irfan A. Asangani1,7,8

1. Department of Cancer Biology, Perelman School of Medicine, University of Pennsylvania. 421 Curie Boulevard, BRBII/III, Philadelphia, PA 19104, USA. 2. Department of Radiation Oncology, University of Michigan, Ann Arbor 3. Michigan Center for Translational Pathology, University of Michigan, Ann Arbor 4. Department of Biostatistics and Bioinformatics, Emory University, Atlanta 5. Department of Radiation Oncology, Urology, and Medicine University of California, San Francisco 6. Helen Diller Family Comprehensive Cancer Center, University of California, San Francisco 7. Abramson Family Cancer Research Institute, Perelman School of Medicine 8. Penn Epigenetics Institute, University of Pennsylvania.

Running title: Identification of PHF19 as an essential EWS/ETS target

*Corresponding Author: Irfan A. Asangani, Ph.D. Assistant Professor, Department of Cancer Biology Assistant Investigator, Abramson Family Cancer Research Institute Core Member, Penn Epigenetics Institute Perelman School of Medicine, University of Pennsylvania 611 BRB II/III, 421 Curie Boulevard, Philadelphia, PA 19104-6160 Office: (215)746-8780 Lab: (215)746-8781, Fax: (215)573-6725 Email: [email protected]

Conflict of Interest: The authors declare no conflict of interest.

Downloaded from cancerres.aacrjournals.org on September 24, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on June 13, 2018; DOI: 10.1158/0008-5472.CAN-18-0484 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Abstract The EWS/ETS fusion transcription factors drive Ewing sarcoma (EWS) by orchestrating an oncogenic transcription program. Therapeutic targeting of EWS/ETS has been unsuccessful; however, identifying mediators of the EWS/ETS function could offer new therapeutic options. Here we describe the dependency of EWS/ETS-driven transcription upon chromatin reader BET bromdomain proteins and investigate the potential of BET inhibitors in treating EWS. EWS/FLI1 and EWS/ERG were found in a transcriptional complex with BRD4, and knockdown of BRD2/3/4 significantly impaired the oncogenic phenotype of EWS cells. RNA-seq analysis following knockdown or inhibition of BRD4 with JQ1 revealed an attenuated EWS/ETS transcriptional signature. In contrast to previous reports, JQ1 reduced proliferation and induced apoptosis through MYC-independent mechanisms without affecting EWS/ETS protein levels; this was confirmed by depleting BET proteins using PROTAC-BET degrader (BETd). Polycomb repressive complex 2 (PRC2)-associated factor PHF19 was downregulated by JQ1/BETd or BRD4 knockdown in multiple EWS lines. EWS/FLI1 bound a distal regulatory element of PHF19, and EWS/FLI1 knockdown resulted in downregulation of PHF19 expression. Deletion of PHF19 via CRISPR-Cas9 resulted in a decreased tumorigenic phenotype, a transcriptional signature that overlapped with JQ1 treatment, and increased sensitivity to JQ1. PHF19 expression was also associated with worse prognosis in Ewing sarcoma patients. In vivo, JQ1 demonstrated anti-tumor efficacy in multiple mouse xenograft models of EWS. Together these results indicate that EWS/ETS requires BET epigenetic reader proteins for its transcriptional program and can be mitigated by BET inhibitors. This study provides a clear rationale for the clinical utility of BET inhibitors in treating Ewing sarcoma.

Significance Findings reveal the dependency of EWS/ETS transcription factors on BET epigenetic reader proteins and demonstrate the potential of BET inhibitors for the treatment of Ewing sarcoma.

Introduction Ewing sarcoma (EWS) represents the second-most common primary bone malignancy in children and young adults after osteosarcoma with an annual incidence of 2.9 cases per million population (1). Although, the 5-year survival rate for primary Ewing sarcoma has improved following the introduction of systemic chemotherapy in the adjuvant and neoadjuvant setting, several clinical studies indicate a plateau phase for conventional therapies (2). Further, the survival rate for patients with high-risk recurrent disease (< 2 years) is extremely poor with < 10% survival at 5 years, therefore, novel therapies are urgently needed to improve outcomes. Ewing sarcoma is driven by characteristic chromosomal translocations that generate fusions between the Ewing sarcoma breakpoint region 1 (EWSR1) gene with members of the ETS family of transcription factors, most commonly to FLI1 (3) and with less frequency to ERG (4). Unlike adult cancers, the EWS/ETS (EWS/FLI1 and EWS/ERG) oncogenic fusion proteins are often the only genetic alteration in these pediatric tumors functioning as an aberrant transcription factor (5,6). Importantly, Ewing sarcoma tumors are dependent on these fusion products and require their persistent expression/function to maintain a transformed phenotype (7). Similar to other transcription factors, direct pharmacological targeting of the EWS/ETS fusion proteins remains a formidable challenge, and proteins in this class are often considered undruggable due to a lack of small molecule recognizable pockets (8). Thus, identification and targeting of functionally relevant EWS/ETS associated factors should be considered to mitigate its oncogenic function. ETS-family gene fusions are also prominent drivers in prostate cancer (9), where our group recently identified BET bromodomain inhibition as a promising new therapeutic strategy (10). The bromodomain and extraterminal (BET) family of proteins includes ubiquitously- expressed BRD2, BRD3, and BRD4—and BRDT, which is specific to the testis. Each protein contains two tandem bromodomain motifs (BD1 and BD2)—deep hydrophobic pockets that have been described chiefly as chromatin readers that bind to acetylated lysine on histones, recruit chromatin modifying enzymes, and function as transcriptional co-activators (11). Of the BET family proteins, BRD4 is well studied and known to recruit mediator complex and positive transcription elongation factor b (P-TEFb) thereby helping in the release of promoter proximal pausing of RNA polymerase II (12,13). BRD4 also binds to acetylated non-histone proteins, such as acetylated transcription factors including FLI1 and ERG, and mediating their transcriptional

activity (14,15). Potent and selective small-molecule inhibitors that reversibly bind the BD1 and BD2 domains of BET proteins and prevent their interaction with acetylated histones and transcription factors have been developed and are being evaluated in the clinic for treatment of a variety of cancers, including NUT-midline carcinoma, acute leukemia, multiple myeloma and castration-resistant prostate cancer (16-18). Here we investigated the dependency of EWS/ETS driven transcription on BET bromodomain proteins in Ewing sarcoma. Using multiple EWS cell lines, we found BET proteins including BRD4, are essential for their proliferation and invasion. Through gel exclusion chromatography and pulldown assays, EWS/FLI1 and EWS/ERG protein were found to be in a transcriptional complex containing BRD4, and knockdown or pharmacologic inhibition of BRD4 resulted in downregulation of EWS/ETS target genes. Further, we discovered PHF19 – a PRC2 associated protein as a novel and essential EWS/ETS transcriptional target that requires BRD4 function. Moreover, in EWS mouse xenograft models, treatment with BET inhibitor JQ1 showed anti-tumor activity that was associated with PHF19 downregulation. These findings illustrates an important functional role for BET proteins in EWS/ETS mediated oncogenic transcription program and demonstrates the therapeutic potential of BET bromodomain inhibitors in treating Ewing sarcoma. Materials and methods Cell Culture and Compounds RD-ES (obtained from CLS), CADO-ES1 (obtained from DSMZ) and SK-N-MC cell lines (obtained from ATCC) maintained in RPMI-1640 media (Life Technologies) supplemented with 10% FBS. CHLA-10 cells (obtained from Children’s Oncology Group) were maintained in DMEM (Life Tech) supplemented with 10% FBS. Cell lines were STR profiling authenticated, and tested negative for mycoplasma by MycoAlert kit (Lonza). All cells were grown at 37°C in a

5% CO2 incubator. JQ1 was acquired from Cayman Chemical for in vitro studies and from Dieckmann (HK) Chemical Ind. for in vivo experiments. PRTOAC BET degrader compound ZBC260 was a gift from Dr. Shaomeng Wang from University of Michigan. Lenti virus preparation shRNAs against BRD2/3/4, FLI1 and ERG (Penn Core Facilities) were packaged using 2nd generation lentiviral packaging systems. Briefly, 1x106 HEK-293T cells were seeded in 10cm plates. shRNA plasmids (4µg) were co-transfected with pMD2.G [(VSVg) (1µg)] and pSPAX2

[(GAG-POL) (3µg)] using 25µl Lipofectamine 2000 (Life Tech). Media was collected after 48h of transfection, centrifuged and clarified using 0.45µm filter before infection. RNA extraction and quantitative RT-PCR Total RNA was isolated from cells using the miRNeasy kit (QIAGEN) and cDNA was synthesized from 1,000 ng total RNA using SuperScript IV (Life Tech). qPCR was performed using SYBR™ Green PCR Master Mix (Life Tech) on QuantStudio3 (Applied Biosystems). Relative expression was calculated using ΔΔCT values after being normalized against GAPDH expression. All primers were designed using primer 3 (http://frodo.wi.mit.edu/primer3/) and synthesized by Integrated DNA Technologies. The primer sequences used is provided in the Supplementary Table 1. siRNA knockdown For siRNA mediated PHF19 knockdown experiments, cells were seeded in 10cm plates and transfected with 50 nM ON-TARGETplus SMARTpool siRNA non-targeting control or siRNA pools targeting PHF19 (Dharmacon) using Oligofectamine (Invitrogen 12252011). Two successive transfections were carried out at an interval of 24h. Cells were harvested 48h post first transfection for western blot, qRT-PCR validation and cell proliferation assay. Cell Viability Assay Cells were seeded onto a 96-well cell culture plate at a density of 2,000 cells/well in 100ul of normal cell culture medium. 100ul of serially diluted compound was added to each well 12h later. After 96h of exposure to the compound, cell viability was assessed using the CellTiter- GLO assay (Promega). IC50 values were calculated using GraphPad Prism software. For knockdown studies, cells were infected with respective lentiviruses and selected for 3 days. After antibiotic selection, cells were seeded in 24well plates at a density of 10,000 cells/well and counted on day 2, 4 and 6 post seeding. Graphs were plotted as percent growth compared to cells at Day0. For the long term growth assay cells were seeded in 6-well plates at 5,000 cells/well and grown in media containing desired concentrations of drugs. Media was changed every 4 days and after 12 days cells were fixed with 10% methanol and stained with 0.1% crystal violet. Absorbance was taken at 590nm on BioTek Synergy Multimode reader. Antibodies and Immunoblot Analysis For immunoblot analysis, cells were lysed in RIPA buffer (Boston BioProducts) supplemented with Halt protease and phosphatase inhibitor and Pierce Protease Inhibitor (Life Tech).

Quantified protein lysates (Life Tech; 23250) were boiled in Lemmeli buffer (Biorad) and 10- 20μg of protein was resolved using SDS-PAGE and transferred to PVDF membrane followed by blocking for 1h with blocking buffer (Tris-buffered saline, 0.1% Tween (TBS-T), 5% non-fat dry milk), and incubated overnight at 4°C in primary antibody. Blots were washed with TBS-T and incubated with HRP-conjugated secondary antibody for 1h at room temperature. Blots were washed again with TBS-T and visualized after incubation with SuperSignal West Femto (Life Tech). Primary antibodies include: FLI1 (Abcam; ab15289), BRD4 (Bethyl Laboratories A301- 985A50), BRD3 (Santa Cruz; sc-81202), BRD2 (Cell Signaling; 5848) ERG (Abcam; ab92513), MYC (Abcam; ab32072), cPARP (Cell Signaling; 9541), PHF19 (Cell Signaling; 77271) and GAPDH-HRP (Cell Signaling; 3683). Gel-filtration chromatography Nuclear extracts were obtained using the NE-PER nuclear extraction kit (Thermo Scientific), and dialyzed against FPLC buffer (20 mM Tris-HCl, 0.2 mM EDTA, 5 mM MgCl2, 0.1 M KCl, 10% (vol/vol) glycerol, 0.5 mM DTT, 1 mM benzamidine, 0.2 m MPMSF, pH 7.9). 2.5 mg of nuclear protein was concentrated to 500μl using a Microcon centrifugal filter (Millipore) and then applied to a Superose 6 size-exclusion column (10/300 GL GE Healthcare) pre-calibrated using the Gel Filtration HMW Calibration Kit (GE Healthcare). 500μl of eluate was collected for each fraction at a flow rate of 0.5 ml/min, and eluted fractions were subjected to SDS-PAGE and immunoblotting. Immunoprecipitation Nuclear pellet was lysed in IP buffer (20 mM Tris pH 7.5, 150mM NaCl, 1% Triton-X 100, Protease Inhibitor) by sonication. Nuclear lysates (0.5-1.0mg) were pre-cleaned by incubation with protein G Dynabeads (Life Technologies) for 1h on a revolver at 4°C. 5μg antibody was added to the pre-cleared lysates and incubated on a rotator at 4°C overnight prior to the addition of protein G Dynabeads for 1h. Beads were washed thrice in IP buffer and resuspended in 40μL of 2x loading buffer and boiled at 90°C for 10mins for separation of the protein and beads. Samples were then analyzed by immunoblotting as described above. Cellular Thermal Shift Assay (CETSA) Cells were seeded in 10cm cell culture plates at a density of 7 x 106 cells. Cells were exposed to DMSO or JQ1 for 3h. The cells were washed once with PBS to remove excess compound and trypsinized. Cells were resuspended in PBS containing protease and phosphatase inhibitors

(Thermo Fisher) and divided in 50 µl aliquots. The aliquots were heated at different temperatures for 3mins (Veriti thermal cycler, Applied Biosystems), followed by cooling for 3mins at room temperature. Cells were lysed using 2 cycles of freeze-thawing in liquid nitrogen. Lysates were centrifuged at 20,000xg for 20mins at 4°C to separate soluble fractions from precipitates. The supernatants were transferred to new microtubes and analyzed by SDS-PAGE followed by immunoblot analysis. Chromatin immunoprecipitation Post treatment with the compound, cells were trypsinized, washed, and crosslinked with 1% formaldehyde solution in PBS for 10mins. Freshly prepared 0.125mol/L Glycine was added followed by gently shaking the cells at room temperature to stop the crosslinking process. ChIP was performed using Diagenode kit following manufacturer’s instructions. Briefly, cells were collected by centrifugation and resuspended in ChIP buffer (100 mmol/L NaCl; 50 mmol/L Tris- HCL, pH 8.1; 5mmol/L EDTA, pH 8.0; 0.5% SDS; 5% triton X-100, 1 × protease inhibitor). Cells were then subjected to sonication in a Bioruptor pico machine on 30s on/off cycle for 5mins. Sonication efficiency was confirmed by observing 200bp DNA fragments. Chromatin equivalent to 10x106 cells were used for ChIP using various antibodies (anti-FLI1 Abcam Cat. # ab15289, anti-BRD4 Bethyl Laboratories Cat. # A301-985A50, IgG Diagenode Cat. # C01010061). ChIP DNA was isolated (IPure Kit, Diagenode) from samples by incubation with the antibody at 4˚C overnight followed by washing and reversal of crosslinking. The eluted DNA was used for SYBRgreen qPCR. The primer sequences used for ChIP-qPCR are provided in Table S1. Matrigel invasion assays After 3 days of infection with respective shRNA containing lentiviruses, cells were selected for another 3 days with puromycin. Post selection and expansion cells were trypsinized, and 100,000 cells were resuspended in serum-free medium and added into the invasion chamber (BD Biosciences). The bottom of the chamber was filled with media containing 10% serum. Cells that had degraded the matrix and migrated through the porous membrane (8μm pore size) to the other end after a period of 48h were ﬁxed and stained with crystal violet (0.5%), and images were captured using phase contrast microscopy. Chicken chorioallantoic membrane (CAM) Assay Fertilized chicken eggs were incubated in a rotary humidified incubator at 38°C for 10 days. A

small hole was drilled through the eggshell into the air sac and another hole was drilled near the allantoic vein that penetrates the eggshell, keeping the CAM intact. The CAM was dropped by applying mild vacuum to the hole over the air sac. Subsequently, a cutoff wheel (Dremel, Racine, WI) was used to cut a 1cm2 window encompassing the second hole near the allantoic vein to expose the underlying CAM. Cells were prepared for implantation by trypsinizing and re- suspending in media (without FBS) at the density of 1x106 cells/50μl. The CAM was gently abraded with a sterile cotton swab to provide access to the mesenchyme and 50ul cell suspension was implanted on top of it. The windows were sealed and the eggs were returned to a stationary incubator. The eggs were incubated for 7 more days, after which the extra-embryonic tumor were isolated and weighed to determine the difference in tumor growth between control and test group. For metastatic assay, embryonic liver was harvested analyzed for the presence of tumor cells by isolating genomic DNA by Puregene DNA purification system (Qiagen) and quantitative Human Alu PCR. RNA-seq library preparation for next generation sequencing Total RNA was isolated using miRNeasy kit (QIAGEN) and the quality of the RNA was analyzed on Bio-analyzer (Agilent). After confirming that all of the RNA samples have RNA integrity number (RIN) more than 8, RNA-seq libraries were constructed using the TruSeq sample Prep Kit V2 (Illumina) according to the manufacturer’s instructions. Briefly, 2μg of purified RNA was poly-A selected and fragmented with fragmentation enzyme. After first and second strand synthesis from a template of poly-A selected/fragmented RNA, other procedures from end-repair to PCR amplification were done according to library construction steps. Libraries were purified and validated for appropriate size (~300bp) on a 2100 Bioanalyzer High Sensitivity DNA chip (Agilent Technologies, Inc.). The DNA library was quantified using Qubit and normalized to 4nM concentration prior to pooling. Libraries were pooled in an equimolar fashion and diluted to 1.8pM concentration. Library pools were clustered and run on Nextseq500 platform with paired-end reads of 151 or 75 bases, according to the manufacturer's recommended protocol (Illumina Inc.). Raw reads passing the Illumina RTA quality filter were pre-processed using FASTQC for sequencing base quality control. Mapping and expression quantification The raw fastq data were adaptor-trimmed and mapped to hg19 human reference genome using the STAR Alignment Tool within the Illumina BaseSpace app suite

(www.basespace.illumina.com) to generate the BAM files. Cufflinks Assembly & DE (BaseSpace Workflow) with default setting was used to generate expression matrix. Differential expression and GSEA gene enrichment analysis Pairwise comparisons between treatment groups (shBRD4, shFLI1, JQ1 treatment) and control group (DMSO treatment) were performed to detect differentially expressed (DE) genes using the Bioconductor package DESeq2 (Version 1.10.1) (19). DE genes were selected with a threshold of 10-7 on adjusted p-value. Heatmap of DE genes was generated using the R package pheatmap (Version 1.0.8). GSEA (Version v2.2.3) was used to perform enrichment analysis (20). GSEA Preranked function was used to perform enrichment analysis for RNA-seq data, following the official user guide of GSEA. Ranked list is constructed with the log2 fold change values from DE analysis. Geneset/signature is constructed with the name of selected gene (e.g. common down-regulated genes between shBRD4 and shFLI1). Deletion of PHF19 using CRISPR-Cas9 system CRISPR-Cas9 mediated genome editing was used to delete PHF19 in SK-N-MC cells. The genomic region in the human PHF19 exon 10 was targeted using gRNA (CACCGTTGATGTCCAAACTGACGGA) designed using CRISPR Design Tool (http://tools.genomeengineering.org). The gRNA was ligated into the one vector lentiCRISPRv2 plasmid system (Addgene #52961) as previously described (21). The resulting plasmid was sequence verified before packaging into pMD2.G (VSVg) along with pSPAX2 (GAG-Pol) into a lentiviral system. Cells were infected with the guide RNA containing lentivirus along with a control virus (without guide RNA) for 48h and selected using Puromycin for 4-7 days. PHF19 deletion was verified using immunoblot analysis. Tumor xenograft studies All procedures involving mice were approved by the University Committee on Use and Care of Animals (UCUCA) at the University of Michigan and conform to their relevant regulatory standards. Four-to-six week-old male CB17 SCID mice were anesthetized using 2% Isofluorane (inhalation) and 1-2 x 106 Ewing sarcoma cells (SK-N-MC, CHLA-10, or CADO-ES1) suspended in 100ul of PBS with 50% Matrigel (BD Biosciences) were implanted subcutaneously into the dorsal flank on both sides of the mice. Once the tumors reached an average size of 80- 100 mm3 the animals were randomized and treated once per day with JQ1 (50 mg/kg) or vehicle

(10% hydroxypropyl--cyclodextrin) via I.P. injection five days per week. Growth in tumor volume was recorded using digital calipers and tumor volumes were estimated using the formula (/6) (L × W2), where L = length of tumor and W = width. Body weight was monitored throughout the course of the study. At the end of the studies, mice were sacrificed post-6h drug treatment and tumors extracted for further analysis. Statistical Analysis Statistical analysis was performed using GraphPad Prism 6 software. For individual comparisons, unpaired Student’s t-test used and p<0.05 were considered significant. Statistical significance for Kaplan–Meier analysis was determined by the log-rank (Mantel–Cox) test. Data Availability The Raw RNA-seq data is deposited at Gene Expression Omnibus under accession number (GSE113604). FPKM values for all transcripts from the RNA-seq dataset are in Supplementary TableS2.

Results BET bromodomain proteins are essential for EWS oncogenic phenotype To investigate the dependency of the EWS fusion proteins on BET bromodomain proteins in Ewing sarcoma, we knocked down BRD2, BRD3 or BRD4 by shRNA in CHLA-10 and RD-ES cells characterized by EWS/FLI1, and CADO-ES1 cells characterized by EWS/ERG fusion. Since EWS/ETS are critical for EWS growth (1), as a positive control we knockdown the fusions using shRNA against FLI and ERG respectively (21). BET protein levels and mRNA expression as well as the expression of EWS/FLI1 and EWS/ERG were significantly downregulated by shRNA (Figure 1a and 1b). Similar to the anti-proliferative effect of EWS/FLI1 or EWS/ERG knockdown, reduced BRD2, BRD3 or BRD4 expression also led to a significant reduction (P <0.05) in the growth of all three EWS cell lines (Figure 1c). Additionally, we evaluated colony formation by the knockdown cells as a measure of transformation and observed significantly reduced colony numbers for cells with BRD2/3/4 or EWS/ETS knockdown in comparison to controls (Figure 1d). As expected, EWS cells with knockdown of EWS-FLI or EWS/ERG displayed reduced invasion in Boyden chamber assay, while surprisingly EWS cells with BET knockdown also showed a significant reduction in invasion, suggesting the importance of these epigenetic readers in EWS invasion (Figure 1e). To test the pro-tumorigenic and metastatic functions of the BET protein BRD4 -a well-characterized

member of the BET family, the chick chorioallantoic membrane (CAM) model was employed in which tumor growth and spontaneous metastasis in vivo can be measured in a short period of time (22). Similar to EWS/FLI1, knockdown of BRD4 in CHLA-10 cells led to a significant reduction in tumor growth and impaired ability to metastasize (P <0.01) to the embryonic liver as compared to control cells (Figure 1f). These data suggests that BET proteins, in particular BRD4, are critical in driving Ewing sarcoma proliferation and metastasis. BRD4 exists in a large protein complex along with EWS-FLI/ERG, RNA Pol II and mediator complex 1 Physical association of BRD4 with other transcription factors has been described in other cancers [18, 19]. As BRD4 knockdown displayed a phenotype similar to EWS/FLI1 or EWS/ERG knockdown, we hypothesized that EWS/ETS fusions might exist in a transcriptional complex consisting of BRD4, playing a critical role in regulating genes essential for EWS growth and survival. To test this, we performed gel filtration chromatography using nuclear lysates from CHLA-10 and CADO-ES1 cell lines. A majority of EWS/FLI1 and EWS/ERG existed in complexes devoid of BRD4 supporting the previous observations of self-aggregation of these fusion proteins due to intrinsically disordered low-complexity prion-like EWS domains (23,24). However, a fraction of EWS/FLI1 and EWS/ERG fusion proteins and BRD4 eluted together in a high-molecular weight complex (Figure 2a and 2b). Additionally, we found evidence for the presence of RNA Polymerase II and the Mediator complex (Med1) —known members of the BRD4 transcriptional coregulatory network, in the same complex (25,26). To further confirm the endogenous association between EWS/ETS and BRD4, we immunoprecipitated ERG in EWS/ERG positive CADO-ES1 nuclear extracts and probed for BRD4. Immunoblot with BRD4 antibody confirmed the endogenous interaction with EWS/ERG (Figure 2c). PARP and DNA-PK that is known to interact with EWS/ERG were used as positive control (27). Reciprocal immunoprecipitation experiments using antibody specific to BRD4 confirmed these interactions (Figure 2d). However, treatment with the BET inhibitor JQ1, that binds the acetyl-binding pockets of BRD4 (Supplementary Fig. S1a), did not disrupt the interaction between EWS/ERG and BRD4 (Figure 2e) indicating an indirect interaction between these two proteins in EWS cells. A physical interaction between ERG and BRD4 has been reported in AML and prostate cancer cells, that was shown to be dependent on the N-terminal (K96/99) acetylation of ERG (14,15). However, the ERG portion of EWS/ERG fusion lacks

K96/99 which might explain the inability of the BET inhibitor to disrupt the ERG/BRD4 interaction. Consistent with this, treatment with an HDAC inhibitor did not result in an increased EWS/ERG pulldown by BRD4 further implicating an acetylation-independent indirect interaction (Supplementary Fig. S1b). Additionally, endogenous EWS/FLI1 and BRD4 interaction were observed in EWS/FLI1 positive CHLA-10 cells (Supplementary Fig. S1c). Collectively, these data demonstrate that EWS/ETS associates indirectly with BRD4 in a complex that includes Med1/RNAPolII in an acetylation independent manner in EWS cells. Genetic or pharmacologic targeting of BRD4 inhibits EWS/ETS transcriptional activity Our data supports a model in which BRD4 is involved in EWS/ETS driven transcriptional programs. To directly test this, we conducted RNA-seq experiments after EWS/FLI1 and BRD4 knockdown or JQ1 treatment of CHLA-10 cells (Supplementary Fig. S2a). As expected, knockdown of EWS/FLI1 had profound effects on transcription, with 3,200 genes significantly altered of which 1,057 genes overlapped with genes modulated upon BRD4 knockdown (Figure 3a). Importantly, integrating the EWS/FLI1 ChIP-seq data (21) showed greater than 50% (573/1,057) of these overlapping genes associated with EWS/FLI1 peaks (P <0.0001) in their regulatory regions. Interestingly, JQ1 treatment led to transcriptional changes in genes that showed significant overlap with genes associated with EWS/FLI1 and BRD4 knockdown, including known EWS/FLI1 targets such as NGFR, FOXM1, STEAP1, and SYT4 (Figure 3b and 3c). Subsequent gene ontology analysis of the downregulated genes revealed enrichment of processes such as RNA splicing, cell cycle and DNA replication, all of which are known to be associated with EWS/ETS function (Figure 3d). Next, RNA-seq analysis of RD-ES, SK-N-MC and CADO-ES1 cells treated with JQ1 also showed overlapping expression profiles of genes that included EWS/ETS targets (Figure 3e). Interestingly, gene set enrichment analysis (GSEA) with a EWS/FLI1 /BRD4 knockdown signature (common downregulated genes) revealed negative enrichment upon BET inhibitor treatment, strongly indicating its potential inhibition of EWS/ETS driven transcription program (Figure 3f). Although MYC has been shown to be a major downstream target of BET inhibitor in multiple cancers including Ewing sarcoma (28,29), GSEA analysis did not reveal modulation of any MYC associated concepts in all four JQ1 treated cells and this was associated with lack of MYC downregulation (Figure 3g). Interestingly, JQ1 treated cells showed slightly increased MYC expression compared to vehicle treated controls. Moreover, knockdown of EWS/FLI1 or BRD2/3/4 had no effect on MYC

transcript levels in all three tested cells (Figure 3g and Supplementary Fig. S2b). In contrast to previous reports, these observations rules out MYC as a direct transcriptional target of EWS/ETS or BET inhibitors. A commonly altered gene was PHF19 - PHD finger protein 19, a polycomb like protein which forms a subcomplex with the polycomb repressive complex 2 (PRC2) core complex. PHF19 was one of the top downregulated transcripts in all treatment conditions suggesting it may be a novel EWS/ETS target that requires BET proteins for its transcription (Figure 3h and Supplementary Fig. S2c). These results imply that knockdown of BRD4 or its inhibition by JQ1 selectively targets a subset of EWS/ETS dependent transcripts. BET inhibitor downregulates PHF19 and reduce proliferation of EWS cells Recent reports of BET inhibitor efficiency in cancer cells including Ewing sarcoma led us to examine the effect of JQ1 on a panel of EWS cell lines. We treated CHLA-10, CADO-ES1, SK-N-MC, and RD-ES cells with JQ1 and found them to be sensitive with IC50 values ranging from 250-500nM (Figure 4a). Similar results were obtained in a long-term cell viability assay where cell lines displayed a concentration-dependent decrease in colony formation in response to JQ1 treatment (Figure 4b). Interestingly, unlike previous reports (28,29), treatment with JQ1 had no effect on the expression of EWS/FLI1 mRNA or protein in CHLA-10, SK-N-MC, and RD-ES cells or EWS/ERG in CADO-ES1 cells (Figure 4c and Supplementary Fig. S2d) but apoptosis was apparent as increased level of cleaved-PARP was observed in all four cell lines. Furthermore, no change in MYC protein levels was found in accordance with our transcript data, suggesting no correlation between MYC and sensitivity to BET inhibitors in the Ewing sarcoma cells. Consistent with our transcript data, PHF19 protein levels were decreased in JQ1 treated cells compared to vehicle-treated controls. Importantly, treatment with a pan-BET degrader compound- ZBC260, led to a dose-dependent decrease in the PHF19 levels without affecting EWS/FLI1 or MYC (Figure 4d), further validating our observation that BET inhibition does not affect EWS/ETS fusion or MYC levels, whereas PHF19 expression seems to be dependent on BET proteins in Ewing sarcoma cells. PHF19 is a direct EWS/ETS target and is required for EWS tumorigenesis PHF19, also known as PCL3 is a substoichiometric component of PRC2 (30). PHF19 is involved in the recruitment of the PRC2 complex to gene bodies to silence its expression through histone H3 lysine 27 trimethylation (H3K27me3) (31). As our data strongly indicate a role for EWS/ETS and BRD4 in regulating the expression of PHF19, we investigated whether it is a

direct transcriptional target of EWS/ETS fusion. Analysis of publicly available EWS/FLI1 ChIP- Seq data (GSE61953) (21) from A675 and SK-N-MC cells showed strong binding of EWS/FLI1 to the downstream regulatory region approximately 20kb from the PHF19 gene (Figure 5a). Further, RNA-seq from the same data set showed reduced expression of PHF19 upon EWS/FLI1 knockdown, supporting the notion that PHF19 is a direct transcriptional target of the fusion protein (Figure 5b). Interestingly, the immediate neighboring genes located on 5’ and 3’ ends of PHF19 such as PSMD5, FBXW2, MEG9 and TRAF1 did not show change in the expression upon EWS/FLI1 knockdown, BRD4 knockdown or JQ1 treatment, further implicating PHF19 as the sole transcriptional target of EWS/FLI1 in that locus (Supplementary Fig. S3a, S3b, and S3c). To validate this further, we examined PHF19 expression levels after knockdown of EWS/FLI1 or EWS/ERG and found significant downregulation in all the Ewing sarcoma cell lines (Figure 5c and 5d). As expected, knockdown of BRD4 led to the loss of PHF19 expression indicating the dependency of EWS/ETS protein on BRD4 to regulate PHF19 gene expression. Furthermore, treatment with JQ1 led to significant reduction in the recruitment of BRD4 to the PHF19 regulatory region, whereas EWS/FLI1 binding was unchanged compared to vehicle control (Supplementary Fig. S4a) suggesting that fusion protein binding to its target region on the chromatin is independent of BRD4. Next, to investigate the role of PHF19 in Ewing sarcoma cells, we performed CRISPR-Cas9 mediated knock-out (ko) of PHF19 gene and validated its loss of expression by western blotting (Figure 5e). Deletion of PHF19 led to a significant reduction in proliferation, colony forming ability and invasive potential of SK-N-MC cells (Figure 5f, 5g and 5h). We then performed RNA-seq analysis in SK-N-MC cells with PHF19 ko or JQ1 treatment (500nM for 48h) and found differential expression of 861 transcripts in PHF19 ko of which 47% (n=401) overlapped with transcripts affected by JQ1 (Figure 5i). Interestingly, GSEA using PHF19 ko signature (downregulated genes) revealed negative enrichment upon JQ1 treatment in all four cell lines (Figure 5j). These data suggest that the PHF19 mediates the regulation of a significant subset of genes including FOXM1 that gets downregulated by JQ1. Interestingly, FOXM1, is overexpressed in Ewing sarcoma and identified as an indirect target of EWS/ETS (32). These observations strongly indicate the role of PHF19 in partially mediating the JQ1 phenotype. To further support this, we performed transient knockdown of PHF19 and tested whether it synergizes with BET inhibition. Interestingly, PHF19 knockdown which resulted in decreased proliferation of SK-N-MC cells was further affected by JQ1 treatment compared to

non-target control (Supplementary Figure S4b and S4c). Additionally, the PHF19 knockout cells displayed increased sensitivity to JQ1, suggesting a synthetic lethal relationship between these two epigenetic regulators (Supplementary Figure S4d). To further validate the potential prognostic significance of PHF19, we explored SurvExpress – a publicly available platform of gene expression and associated survival data (33). The prognostic value of high PHF19 mRNA expression was significantly correlated with overall survival rates in 88 Ewing sarcoma patients (Supplementary Fig. S5). Furthermore, the PHF19 levels in the high-risk cohort were significantly up-regulated compared to the low-risk cohort. These results indicate that PHF19 is a bona fide EWS/ETS target gene requiring BRD4 for its expression, and plays a significant role in the EWS/ETS mediated pathogenesis of Ewing Sarcoma. BET bromodomain inhibition blocks EWS growth in vivo Collectively, our data indicate BRD4 function is critical for the EWS/ETS transcriptional program in Ewings sarcoma. We treated xenograft models of SK-N-M-C, CHLA-10, and CADO-ES1 daily with the BET inhibitor JQ1 and examined tumor growth. Our studies show that daily treatment with JQ1 alone was sufficient to significantly attenuate tumor growth as compared to vehicle control (Figure 6a and Supplementary Fig. S6a) with no toxicity to mice (Supplementary Fig. S6b). Further, to determine the effect of drug treatment on progression free survival, we assessed the tripling of tumor volume for all three xenografts (time interval between initiation of treatment to tumor progression) by generating Kaplan-Meier survival curves and compared the treatment groups using long-rank test. Tumor progression for all three xenograft models was delayed for the JQ1-treated group with a median progression free survival for SK-N- MC xenograft of 13.5 days vs 8 days for vehicle (P = 0.0007), for CHLA-10 xenograft 10 days vs 6 days for vehicle (P =0.0003), and for CADO-ES1 xenograft 10 days vs 7 days for vehicle treated control group (P = 0.0009) (Figure 6b). SK-N-MC and CHLA-10 tumors from the JQ1 treated group displayed down regulation of PHF19 at the transcript and protein levels in addition to increased cleaved PARP levels (Figure 6c-e and Supplementary Figure S6c-e). As expected, MYC expression was unaffected both at the transcript and protein level in tumors from JQ1 treated animals. These observations strongly suggest that BET inhibitor affects the transcriptional program of EWS/ETS fusion and in particular PHF19 to reduce tumor growth in vivo. Discussion

As a master transcription factor EWS/ETS activates an oncogenic transcriptional program by modulating the chromatin landscape in Ewing sarcoma. Unfortunately, targeting this oncogenic fusion protein represent a drug discovery challenge, not only because of the difficulty of targeting transcription factors but also contributed by the unstructured prion-like domains in the EWSR1 portion of the fusions (34). In this study, our findings reveal a critical role for chromatin reader BET bromodomain proteins, mainly BRD4, in regulating oncogenic transcriptional program of the two main EWS/ETS fusions namely EWS/FLI1 and EWS/ERG. Genetic knockdown or small-molecule blockade of BRD4 with the potent inhibitor, JQ1, comprehensively disrupted the transcriptional signature of EWS/FLI and EWS/ERG as well as the consequent downstream malignant features of EWS cells (Figure 6f). The anti-tumorigenic effect of JQ1 was found to be MYC-independent. MYC is a pleiotropic transcription factor which contributes to proliferation, metabolic adaptation, tumorigenesis, and resistance to apoptosis in cancer. Indeed, amplification of MYC is one of the most common genetic alterations in cancer genomes (35). MYC has been suggested as a major oncogenic target for the BET inhibitors in many different malignancies including Ewing Sarcoma (18,28,29,36,37). Though we observed exquisite sensitivity to JQ1 in EWS cells, however, MYC expression was unaffected upon treatment with JQ1 or BET degrader. It would be worth exploring whether MYC knockdown or inhibitors targeting MYC transcription such as CDK7 inhibitors (38) will synergize with the BET inhibitors to elicit a more robust anti-tumorigenic effect in EWS cells. Furthermore, unlike previously reported studies (28,29), we did not observe downregulation of EWS/FLI1 or EWS/ERG at both mRNA and protein levels upon JQ1 or BET degrader treatments. This discrepancy in the result we believe is most likely due to the secondary effects and toxicity caused by high concentrations of JQ1 used in those studies. Additionally, a recent report also showed a lack of effect of JQ1 on the EWS/ETS mRNA and proteins (39). However, PHF19 appears to be one of the essential EWS/ETS targets dependent on BRD4 function that were downregulated by JQ1 or the PROTAC BET degrader. Mechanistically, EWS/FLI1 preferentially binds to chromatin regions enriched for microsatellite GGAA repeats, induces the formation of de novo enhancers and super-enhancers marked by H3K27ac, and activates transcription of target genes (21,40,41). BET proteins as chromatin readers bind to H3K27ac in addition to other acetylated lysine residues on histone H4, and regulate the enhancer activity and gene expression. Recently, proteins involved in chromatin

remodeling have been shown to interact with EWS/FLI1 in this process. In EWS cells, the BRG1/BRM-associated factor (BAF) chromatin remodeling complex was found to be recruited by the EWS-FLI1 fusion protein to tumor-specific enhancers contributing to target gene activation (24). Unlike the BAF complex, in our study no direct interaction of BRD4 with EWS/ETS fusions was observed. However, their assembly into a transcriptional complex comprising MED1 and RNAPolII further indicates a central role for BET proteins in EWS/ETS transcriptional program. The ChIP-PCR data showing lack of de-recruitment of the EWS/FLI1 from the target site upon JQ1 treatment highlights an indirect interaction between EWS/FLI1 and BRD4; nonetheless, the transcriptional downregulation of PHF19 suggests its dependency on BRD4 for target transcription. The mechanisms mediating the indirect interactions between EWS/FLI1 or EWS/ERG and BRD4 need further investigation. Furthermore, a more comprehensive ChIP-seq study with EWS/ETS and all the three BET proteins along with histone modifications will provide additional mechanistic insights into the role of BET proteins in maintaining the EWS/ETS transcriptional network. PcG (Polycomb Group) proteins such as PRC2, which is composed of EZH2, EED and SUZ12 core complex, mediates transcriptional repression through heterochromatin formation by trimethylating the K27 of histone H3 tails (H3K27me3). Interestingly; deregulation of EZH2 – the catalytic SET domain containing subunit - is associated with Ewing sarcoma, and is known to be a downstream mediator of EWS/FLI1-induced transformation of human mesenchymal stem cells into Ewing sarcoma phenotype (5,42,43). PRC2 also associates with PHF19 (also known as PCL1, PCL2 and PCL3, respectively) and forms subcomplexs that bind H3K36 tri-methyl (H3K36me3) marks through its N-terminal Tudor domain and induces a switch to the H3K27me3 mark on the gene bodies, thereby switching from active transcription to repressed transcription state (30,44). Although the EWS/FLI1-bound PHF19 regulatory element lacked the canonical GGAA repeat, our transcriptional and phenotypic data does suggest PHF19 is an essential BRD4 dependent EWS/ETS target, and represents a plausible mechanism by which EWS/ETS induces transcriptional silencing of differentiation genes in mesenchymal stem cells (42). Future investigations should include a comprehensive study of PHF19 role in the transcriptional control of direct and indirect EWS/ETS targets and the potential involvement of PHF19 in PRC2-mediated oncogenesis in EWS. PHF19 was shown to induce proliferation, migration and invasion in hepatocellular carcinoma (HCC) cells (45) and was also found to be

overexpressed in glioblastoma (46), supporting its involvement in pro-tumorigenic activities. In summary, our findings identify BET proteins especially BRD4 as an essential dependency factor in EWS/ETS transcriptional program and Ewing sarcoma carcinogenesis. Further, we show that the therapeutic inhibition of BET proteins using a pan-BET inhibitor JQ1 in multiple EWS xenograft models has single agent anti-tumor activity which was associated with decreased PHF19 expression and increased apoptosis. Though BET inhibition was not curative in our xenograft studies, we anticipate our findings to have far-reaching implications for developing future combinatory therapeutics such as PARP inhibitor or CDK7 inhibitor along with standard chemotherapy in treating Ewing sarcoma. Additionally, our discovery of PHF19 as an essential gene provides further rationale to develop therapeutics against this promising epigenetic target.

Acknowledgments: We thank Dr. S. Wang for providing BETd ZBC260 and Dr. S. Ryeom for critically reading the manuscript. We thank Dr. A. Chinnaiyan for insightful discussion and material support. Research in I.A.A laboratory is funded by Department of Defense Idea Development Award (W81XWH-17-1-0404 to I.A.A) and the NCI R00 award (5R00-CA187664 to I.A.A). We also acknowledge the Richard “Buz” Cooper Foundation pilot award to I.A.A.

Reference

1. Pishas, K. I., and Lessnick, S. L. (2016) Recent advances in targeted therapy for Ewing sarcoma. F1000Res 5 2. Stahl, M., Ranft, A., Paulussen, M., Bolling, T., Vieth, V., Bielack, S., Gortitz, I., Braun-Munzinger, G., Hardes, J., Jurgens, H., and Dirksen, U. (2011) Risk of recurrence and survival after relapse in patients with Ewing sarcoma. Pediatr Blood Cancer 57, 549-553 3. Delattre, O., Zucman, J., Plougastel, B., Desmaze, C., Melot, T., Peter, M., Kovar, H., Joubert, I., de Jong, P., Rouleau, G., and et al. (1992) Gene fusion with an ETS DNA-binding domain caused by chromosome translocation in human tumours. Nature 359, 162-165 4. Sorensen, P. H., Lessnick, S. L., Lopez-Terrada, D., Liu, X. F., Triche, T. J., and Denny, C. T. (1994) A second Ewing's sarcoma translocation, t(21;22), fuses the EWS gene to another ETS-family transcription factor, ERG. Nat Genet 6, 146-151 5. Tirode, F., Surdez, D., Ma, X., Parker, M., Le Deley, M. C., Bahrami, A., Zhang, Z., Lapouble, E., Grossetete-Lalami, S., Rusch, M., Reynaud, S., Rio-Frio, T., Hedlund, E., Wu, G., Chen, X., Pierron, G., Oberlin, O., Zaidi, S., Lemmon, G., Gupta, P., Vadodaria, B., Easton, J., Gut, M., Ding, L., Mardis, E. R., Wilson, R. K., Shurtleff, S., Laurence, V., Michon, J., Marec-Berard, P., Gut, I., Downing, J., Dyer, M., Zhang, J., Delattre, O., St. Jude Children's Research Hospital-Washington University Pediatric Cancer Genome, P., and the International Cancer Genome, C. (2014) Genomic landscape of Ewing sarcoma defines an aggressive subtype with co-association of STAG2 and TP53 mutations. Cancer Discov 4, 1342-1353 6. Crompton, B. D., Stewart, C., Taylor-Weiner, A., Alexe, G., Kurek, K. C., Calicchio, M. L., Kiezun, A., Carter, S. L., Shukla, S. A., Mehta, S. S., Thorner, A. R., de Torres, C., Lavarino, C., Sunol, M., McKenna, A., Sivachenko, A., Cibulskis, K., Lawrence, M. S., Stojanov, P., Rosenberg, M., Ambrogio, L., Auclair, D., Seepo, S., Blumenstiel, B., DeFelice, M., Imaz-Rosshandler, I., Schwarz- Cruz, Y. C. A., Rivera, M. N., Rodriguez-Galindo, C., Fleming, M. D., Golub, T. R., Getz, G., Mora, J., and Stegmaier, K. (2014) The genomic landscape of pediatric Ewing sarcoma. Cancer Discov 4, 1326-1341 7. Kovar, H., Aryee, D. N., Jug, G., Henockl, C., Schemper, M., Delattre, O., Thomas, G., and Gadner, H. (1996) EWS/FLI-1 antagonists induce growth inhibition of Ewing tumor cells in vitro. Cell Growth Differ 7, 429-437 8. Koehler, A. N. (2010) A complex task? Direct modulation of transcription factors with small molecules. Curr Opin Chem Biol 14, 331-340 9. Tomlins, S. A., Rhodes, D. R., Perner, S., Dhanasekaran, S. M., Mehra, R., Sun, X. W., Varambally, S., Cao, X., Tchinda, J., Kuefer, R., Lee, C., Montie, J. E., Shah, R. B., Pienta, K. J., Rubin, M. A., and Chinnaiyan, A. M. (2005) Recurrent fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer. Science 310, 644-648 10. Asangani, I. A., Dommeti, V. L., Wang, X., Malik, R., Cieslik, M., Yang, R., Escara-Wilke, J., Wilder- Romans, K., Dhanireddy, S., Engelke, C., Iyer, M. K., Jing, X., Wu, Y. M., Cao, X., Qin, Z. S., Wang, S., Feng, F. Y., and Chinnaiyan, A. M. (2014) Therapeutic targeting of BET bromodomain proteins in castration-resistant prostate cancer. Nature 510, 278-282 11. Filippakopoulos, P., and Knapp, S. (2012) The bromodomain interaction module. FEBS Lett 586, 2692-2704 12. Yang, Z., Yik, J. H., Chen, R., He, N., Jang, M. K., Ozato, K., and Zhou, Q. (2005) Recruitment of P- TEFb for stimulation of transcriptional elongation by the bromodomain protein Brd4. Mol Cell 19, 535-545

13. Jang, M. K., Mochizuki, K., Zhou, M., Jeong, H. S., Brady, J. N., and Ozato, K. (2005) The bromodomain protein Brd4 is a positive regulatory component of P-TEFb and stimulates RNA polymerase II-dependent transcription. Mol Cell 19, 523-534 14. Roe, J. S., Mercan, F., Rivera, K., Pappin, D. J., and Vakoc, C. R. (2015) BET Bromodomain Inhibition Suppresses the Function of Hematopoietic Transcription Factors in Acute Myeloid Leukemia. Mol Cell 58, 1028-1039 15. Blee, A. M., Liu, S., Wang, L., and Huang, H. (2016) BET bromodomain-mediated interaction between ERG and BRD4 promotes prostate cancer cell invasion. Oncotarget 7, 38319-38332 16. Stathis, A., and Bertoni, F. (2018) BET Proteins as Targets for Anticancer Treatment. Cancer Discov 8, 24-36 17. Dawson, M. A., Prinjha, R. K., Dittmann, A., Giotopoulos, G., Bantscheff, M., Chan, W. I., Robson, S. C., Chung, C. W., Hopf, C., Savitski, M. M., Huthmacher, C., Gudgin, E., Lugo, D., Beinke, S., Chapman, T. D., Roberts, E. J., Soden, P. E., Auger, K. R., Mirguet, O., Doehner, K., Delwel, R., Burnett, A. K., Jeffrey, P., Drewes, G., Lee, K., Huntly, B. J., and Kouzarides, T. (2011) Inhibition of BET recruitment to chromatin as an effective treatment for MLL-fusion leukaemia. Nature 478, 529-533 18. Delmore, J. E., Issa, G. C., Lemieux, M. E., Rahl, P. B., Shi, J., Jacobs, H. M., Kastritis, E., Gilpatrick, T., Paranal, R. M., Qi, J., Chesi, M., Schinzel, A. C., McKeown, M. R., Heffernan, T. P., Vakoc, C. R., Bergsagel, P. L., Ghobrial, I. M., Richardson, P. G., Young, R. A., Hahn, W. C., Anderson, K. C., Kung, A. L., Bradner, J. E., and Mitsiades, C. S. (2011) BET bromodomain inhibition as a therapeutic strategy to target c-Myc. Cell 146, 904-917 19. Love, M. I., Huber, W., and Anders, S. (2014) Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550 20. Subramanian, A., Tamayo, P., Mootha, V. K., Mukherjee, S., Ebert, B. L., Gillette, M. A., Paulovich, A., Pomeroy, S. L., Golub, T. R., Lander, E. S., and Mesirov, J. P. (2005) Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A 102, 15545-15550 21. Riggi, N., Knoechel, B., Gillespie, S. M., Rheinbay, E., Boulay, G., Suva, M. L., Rossetti, N. E., Boonseng, W. E., Oksuz, O., Cook, E. B., Formey, A., Patel, A., Gymrek, M., Thapar, V., Deshpande, V., Ting, D. T., Hornicek, F. J., Nielsen, G. P., Stamenkovic, I., Aryee, M. J., Bernstein, B. E., and Rivera, M. N. (2014) EWS-FLI1 utilizes divergent chromatin remodeling mechanisms to directly activate or repress enhancer elements in Ewing sarcoma. Cancer Cell 26, 668-681 22. Asangani, I. A., Ateeq, B., Cao, Q., Dodson, L., Pandhi, M., Kunju, L. P., Mehra, R., Lonigro, R. J., Siddiqui, J., Palanisamy, N., Wu, Y. M., Cao, X., Kim, J. H., Zhao, M., Qin, Z. S., Iyer, M. K., Maher, C. A., Kumar-Sinha, C., Varambally, S., and Chinnaiyan, A. M. (2013) Characterization of the EZH2-MMSET histone methyltransferase regulatory axis in cancer. Mol Cell 49, 80-93 23. Couthouis, J., Hart, M. P., Erion, R., King, O. D., Diaz, Z., Nakaya, T., Ibrahim, F., Kim, H. J., Mojsilovic-Petrovic, J., Panossian, S., Kim, C. E., Frackelton, E. C., Solski, J. A., Williams, K. L., Clay- Falcone, D., Elman, L., McCluskey, L., Greene, R., Hakonarson, H., Kalb, R. G., Lee, V. M., Trojanowski, J. Q., Nicholson, G. A., Blair, I. P., Bonini, N. M., Van Deerlin, V. M., Mourelatos, Z., Shorter, J., and Gitler, A. D. (2012) Evaluating the role of the FUS/TLS-related gene EWSR1 in amyotrophic lateral sclerosis. Hum Mol Genet 21, 2899-2911 24. Boulay, G., Sandoval, G. J., Riggi, N., Iyer, S., Buisson, R., Naigles, B., Awad, M. E., Rengarajan, S., Volorio, A., McBride, M. J., Broye, L. C., Zou, L., Stamenkovic, I., Kadoch, C., and Rivera, M. N. (2017) Cancer-Specific Retargeting of BAF Complexes by a Prion-like Domain. Cell 171, 163-178 e119 25. Wu, S. Y., and Chiang, C. M. (2007) The double bromodomain-containing chromatin adaptor Brd4 and transcriptional regulation. J Biol Chem 282, 13141-13145

26. Jeronimo, C., and Robert, F. (2017) The Mediator Complex: At the Nexus of RNA Polymerase II Transcription. Trends Cell Biol 27, 765-783 27. Brenner, J. C., Feng, F. Y., Han, S., Patel, S., Goyal, S. V., Bou-Maroun, L. M., Liu, M., Lonigro, R., Prensner, J. R., Tomlins, S. A., and Chinnaiyan, A. M. (2012) PARP-1 inhibition as a targeted strategy to treat Ewing's sarcoma. Cancer Res 72, 1608-1613 28. Hensel, T., Giorgi, C., Schmidt, O., Calzada-Wack, J., Neff, F., Buch, T., Niggli, F. K., Schafer, B. W., Burdach, S., and Richter, G. H. (2016) Targeting the EWS-ETS transcriptional program by BET bromodomain inhibition in Ewing sarcoma. Oncotarget 7, 1451-1463 29. Jacques, C., Lamoureux, F., Baud'huin, M., Rodriguez Calleja, L., Quillard, T., Amiaud, J., Tirode, F., Redini, F., Bradner, J. E., Heymann, D., and Ory, B. (2016) Targeting the epigenetic readers in Ewing sarcoma inhibits the oncogenic transcription factor EWS/Fli1. Oncotarget 7, 24125-24140 30. Ballare, C., Lange, M., Lapinaite, A., Martin, G. M., Morey, L., Pascual, G., Liefke, R., Simon, B., Shi, Y., Gozani, O., Carlomagno, T., Benitah, S. A., and Di Croce, L. (2012) Phf19 links methylated Lys36 of histone H3 to regulation of Polycomb activity. Nat Struct Mol Biol 19, 1257-1265 31. Cai, L., Rothbart, S. B., Lu, R., Xu, B., Chen, W. Y., Tripathy, A., Rockowitz, S., Zheng, D., Patel, D. J., Allis, C. D., Strahl, B. D., Song, J., and Wang, G. G. (2013) An H3K36 methylation-engaging Tudor motif of polycomb-like proteins mediates PRC2 complex targeting. Mol Cell 49, 571-582 32. Cidre-Aranaz, F., and Alonso, J. (2015) EWS/FLI1 Target Genes and Therapeutic Opportunities in Ewing Sarcoma. Front Oncol 5, 162 33. Aguirre-Gamboa, R., Gomez-Rueda, H., Martinez-Ledesma, E., Martinez-Torteya, A., Chacolla- Huaringa, R., Rodriguez-Barrientos, A., Tamez-Pena, J. G., and Trevino, V. (2013) SurvExpress: an online biomarker validation tool and database for cancer gene expression data using survival analysis. PLoS One 8, e74250 34. Ng, K. P., Potikyan, G., Savene, R. O., Denny, C. T., Uversky, V. N., and Lee, K. A. (2007) Multiple aromatic side chains within a disordered structure are critical for transcription and transforming activity of EWS family oncoproteins. Proc Natl Acad Sci U S A 104, 479-484 35. Beroukhim, R., Mermel, C. H., Porter, D., Wei, G., Raychaudhuri, S., Donovan, J., Barretina, J., Boehm, J. S., Dobson, J., Urashima, M., Mc Henry, K. T., Pinchback, R. M., Ligon, A. H., Cho, Y. J., Haery, L., Greulich, H., Reich, M., Winckler, W., Lawrence, M. S., Weir, B. A., Tanaka, K. E., Chiang, D. Y., Bass, A. J., Loo, A., Hoffman, C., Prensner, J., Liefeld, T., Gao, Q., Yecies, D., Signoretti, S., Maher, E., Kaye, F. J., Sasaki, H., Tepper, J. E., Fletcher, J. A., Tabernero, J., Baselga, J., Tsao, M. S., Demichelis, F., Rubin, M. A., Janne, P. A., Daly, M. J., Nucera, C., Levine, R. L., Ebert, B. L., Gabriel, S., Rustgi, A. K., Antonescu, C. R., Ladanyi, M., Letai, A., Garraway, L. A., Loda, M., Beer, D. G., True, L. D., Okamoto, A., Pomeroy, S. L., Singer, S., Golub, T. R., Lander, E. S., Getz, G., Sellers, W. R., and Meyerson, M. (2010) The landscape of somatic copy-number alteration across human cancers. Nature 463, 899-905 36. Filippakopoulos, P., Qi, J., Picaud, S., Shen, Y., Smith, W. B., Fedorov, O., Morse, E. M., Keates, T., Hickman, T. T., Felletar, I., Philpott, M., Munro, S., McKeown, M. R., Wang, Y., Christie, A. L., West, N., Cameron, M. J., Schwartz, B., Heightman, T. D., La Thangue, N., French, C. A., Wiest, O., Kung, A. L., Knapp, S., and Bradner, J. E. (2010) Selective inhibition of BET bromodomains. Nature 468, 1067-1073 37. Mertz, J. A., Conery, A. R., Bryant, B. M., Sandy, P., Balasubramanian, S., Mele, D. A., Bergeron, L., and Sims, R. J., 3rd. (2011) Targeting MYC dependence in cancer by inhibiting BET bromodomains. Proc Natl Acad Sci U S A 108, 16669-16674 38. Christensen, C. L., Kwiatkowski, N., Abraham, B. J., Carretero, J., Al-Shahrour, F., Zhang, T., Chipumuro, E., Herter-Sprie, G. S., Akbay, E. A., Altabef, A., Zhang, J., Shimamura, T., Capelletti, M., Reibel, J. B., Cavanaugh, J. D., Gao, P., Liu, Y., Michaelsen, S. R., Poulsen, H. S., Aref, A. R., Barbie, D. A., Bradner, J. E., George, R. E., Gray, N. S., Young, R. A., and Wong, K. K. (2014)

Targeting transcriptional addictions in small cell lung cancer with a covalent CDK7 inhibitor. Cancer Cell 26, 909-922 39. Loganathan, S. N., Tang, N., Fleming, J. T., Ma, Y., Guo, Y., Borinstein, S. C., Chiang, C., and Wang, J. (2016) BET bromodomain inhibitors suppress EWS-FLI1-dependent transcription and the IGF1 autocrine mechanism in Ewing sarcoma. Oncotarget 7, 43504-43517 40. Gangwal, K., Sankar, S., Hollenhorst, P. C., Kinsey, M., Haroldsen, S. C., Shah, A. A., Boucher, K. M., Watkins, W. S., Jorde, L. B., Graves, B. J., and Lessnick, S. L. (2008) Microsatellites as EWS/FLI response elements in Ewing's sarcoma. Proc Natl Acad Sci U S A 105, 10149-10154 41. Tomazou, E. M., Sheffield, N. C., Schmidl, C., Schuster, M., Schonegger, A., Datlinger, P., Kubicek, S., Bock, C., and Kovar, H. (2015) Epigenome mapping reveals distinct modes of gene regulation and widespread enhancer reprogramming by the oncogenic fusion protein EWS-FLI1. Cell Rep 10, 1082-1095 42. Riggi, N., Suva, M. L., Suva, D., Cironi, L., Provero, P., Tercier, S., Joseph, J. M., Stehle, J. C., Baumer, K., Kindler, V., and Stamenkovic, I. (2008) EWS-FLI-1 expression triggers a Ewing's sarcoma initiation program in primary human mesenchymal stem cells. Cancer Res 68, 2176- 2185 43. Staege, M. S., Hutter, C., Neumann, I., Foja, S., Hattenhorst, U. E., Hansen, G., Afar, D., and Burdach, S. E. (2004) DNA microarrays reveal relationship of Ewing family tumors to both endothelial and fetal neural crest-derived cells and define novel targets. Cancer Res 64, 8213- 8221 44. Li, H., Liefke, R., Jiang, J., Kurland, J. V., Tian, W., Deng, P., Zhang, W., He, Q., Patel, D. J., Bulyk, M. L., Shi, Y., and Wang, Z. (2017) Polycomb-like proteins link the PRC2 complex to CpG islands. Nature 549, 287-291 45. Xu, H., Hu, Y. W., Zhao, J. Y., Hu, X. M., Li, S. F., Wang, Y. C., Gao, J. J., Sha, Y. H., Kang, C. M., Lin, L., Huang, C., Zhao, J. J., Zheng, L., and Wang, Q. (2015) MicroRNA-195-5p acts as an anti- oncogene by targeting PHF19 in hepatocellular carcinoma. Oncol Rep 34, 175-182 46. Li, G., Warden, C., Zou, Z., Neman, J., Krueger, J. S., Jain, A., Jandial, R., and Chen, M. (2013) Altered expression of polycomb group genes in glioblastoma multiforme. PLoS One 8, e80970

Figure Legends: Figure 1. Knockdown of BET proteins or EWS/FLI1 /ERG fusion inhibits EWS cell proliferation, invasion and tumor growth. a) Heat map showing RT-qPCR validation of BRD2, BRD3, BRD4, FLI1 and ERG mRNA expression in the indicated EWS cells stably expressing NT-shRNA or shBRD2/shBRD3/shBRD4/shFLI1/shERG. Target gene expression was normalized using GAPDH with values in NT-shRNA control set to 1. b) Representative immunoblot showing the knockdown of the indicated target protein in EWS cells as in a. GAPDH was used as a loading control. sh-targets (BRD2, BRD3, BRD4, FLI1 or ERG) c) Control or knockdown cells were seeded at a density of 10,000cells/well in a 24-well plate and counted after 2, 4 and 6 days. Cell growth was plotted as % of growth compared to Day0. Data

show mean ± s.e.m. with * P <0.05. d) Colony formation assays. Indicated cells were seeded at a density of 5000/well in a 6-well plate and grown for 12-14 days, followed by staining (top) and quantification (bottom; mean ± s.e.m. n = 3). * P <0.05. e) Matrigel-Invasion assay with the indicated cells. 48hrs post incubation; invaded cells were fixed in methanol and stained with 0.5% crystal violet. Percentage cell invasion is shown with mean ± s.e.m. n = 3. * P <0.05. f) BRD4 or EWS/FLI1 knockdown reduces tumor growth and attenuates distant metastasis in a chicken chorioallantoic membrane (CAM) model. Control, BRD4 or EWS/FLI1 knockdown CHLA-10 cells were inoculated atop CAM of 10-day-old chick embryos. Tumors growing on top of the CAM and fetal liver were extracted after 7-days. Tumor weights were measured (left panel). Genomic DNA from lungs was extracted, and metastasized cells were detected by human Alu-qPCR. Graphs plotted as percentage metastasized cells with mean ±s.e.m. (right panel). Statistical significance was calculated by two-tailed Students t-test.

Figure 2. A fraction of EWS/ERG or EWS/FLI1 protein exists in transcription complex consisting of BRD4, MED1, and PolII. a) Nuclear lysates from CHLA-10 and CADO-ES1 cells were fractionated on a Superose-6 column and BRD4, EWS/FLI1, EWS/ERG, RNA Pol II, and MED1 were analyzed by immunoblot analysis. The red and blue box indicates EWS/ERG and EWS/FLI1 that exist in complex and monomeric form respectively. b) ImageJ quantification of EWS/ERG or EWS/FLI1 containing fractions with (red) or without BRD4 (blue). c) Endogenous association of EWS/ERG and BRD4. CADO-ES1 nuclear extracts were subjected to immunoprecipitation using anti-ERG antibody. Immunoprecipitates were analyzed for the presence of BRD4 by immunoblotting. PARP and DNA-PK that is known to interact with EWS/ERG (27) were used as positive control. 5% nuclear extract was used as input control. d) Immunoprecipitation as in c using anti-BRD4 antibody followed by immunoblotting for EWS/ERG. IgG was used as negative control. e) JQ1 does not disrupt the interaction between BRD4 and EWS/ERG. Nuclear extracts from control or JQ1 treated CADO-ES1 were subjected to immunoprecipitation with BRD4 antibody followed by immunoblotting with ERG antibody. IgG was used as a negative control.

Figure 3. Genetic or pharmacologic targeting of BRD4 disrupts EWS/ETS transcriptional activity. a) Venn diagram showing significantly altered genes (>2 fold, p<0.001) between BRD4

or EWS/FLI1 knockdown (shFLI1) in CHLA-10 cells. 573/1057 overlapping genes are bound by EWS/FLI1 (GSE61953). The 2 determined P value is indicated. b) Venn diagram as in a, including genes altered by JQ1 treatment. c) Heatmap displaying common up- and downregulated genes between BRD4 knockdown, EWS/FLI1 knockdown and JQ1 treatment in CHLA-10 cells. d) DAVID- Gene Ontology analysis of common genes downregulated by BRD4 or FLI1 knockdown or JQ1 treatment in CHLA-10 cells. e) Heatmap showing commonly altered genes in control vs. JQ1 treated EWS cells. Log2 fold change compared to control is plotted. f) GSEA plot with shBRD4/shFLI1 common down-regulated gene signature in JQ1 treated CHLA- 10, RD-ES, SK-NM-C and CADO-ES1 cells. g) MYC is not a transcriptional target of EWS/FLI1 or BRD4. RNA-seq FPKM values of MYC in the indicated cells. Mean ± standard error from two independent RNA-seq is plotted. h) RNA-seq FPKM values as in g for the PHF19 transcript.

Figure 4. BET bromodomain inhibitor downregulates PHF19 and reduces proliferation of EWS cells independent of MYC. a) Cell viability curves for CHLA-10, CADO-ES1, SK-N- MC, and RD-ES cells on treatment with JQ1. Bottom panel, Table showing IC50 values for each cell line along with the EWS/ETS fusion status. b) Colony formation assay; cells were cultured in the presence or absence of JQ1 as indicated for 12 days, followed by staining. Representative images from multiple experiments are shown. c) Immunoblot analysis for EWS/FLI1, EWS/ERG, MYC, PHF19, cleaved-PARP (clPARP), and GAPDH in CHLA-10, CADO-ES1, SK-N-MC, and RD-ES cell lines treated with DMSO, 0.5µM or 2.5µM JQ1 for 48 hours. d) BET protein depletion results in reduced PHF19 levels but not does affect EWS/FLI1 or MYC protein levels. Immunoblot for the indicated target protein with total lysates from SK-N-MC cells treated with DMSO or PROTAC BET degrader (BETd) compound ZBC260 at increasing concentration for 24h.

Figure 5. PHF19 is a direct EWS/ETS target and is required for EWS cell proliferation and invasion. a) Genome browser tracks views showing enrichment of H3K27ac and EWS/FLI1 at PHF19 loci in SK-NM-C and A675 cells. The black line below the enrichment peaks is the region used to amplify for ChIP-qPCR with BRD4 and FLI1 antibody validation shown in Supplementary figure 4a. The ChIP-seq data were downloaded from NCBI GEO with accession

number GSE619534. b) and c) RNA-seq and qRT-PCR showing downregulation of PHF19 transcript upon EWS/FLI1, EWS/ERG or BRD4 knockdown in EWS cells. d) Immunoblot for PHF19 in EWS/FLI1, EWS/ERG or BRD4 knockdown cells. e) CRISPR knockout of PHF19 leads to reduced proliferation, invasion and increased sensitivity to JQ1 in SK-N-MC cells. Immunoblot for indicated targets in control gRNA or PHF19 gRNA CRISPR-Cas9 lentivirus infected cells. f) Control or PHF19 knockout cells were seeded at a density of 10,000/well in a 24-well plate and counted after 2, 4 and 6 days. Cell growth was plotted as % of growth compared to Day-0. g) Colony formation assays. Cells were seeded at a density of 5000/well in a six-well plate and grown for 12-14 days, followed by staining and quantification (mean ± s.e.m. n = 3). h) Matrigel-Invasion assay with control and PHF19 knockout cells. Top, Invaded cells were fixed with methanol and stained with 0.5% crystal violet. Bottom, percentage cell invasion is shown with mean ± s.e.m from n = 3. i) Venn diagram showing significantly altered genes between JQ1 or PHF19 knockout in SK-N-MC cells. Heatmap displaying common up- and downregulated genes. j) GSEA plot with PHF19 knockout signature in JQ1 treated CHLA-10, RD-ES, SK-NM-C and CADO-ES1 cells.

Figure 6: BET bromodomain inhibition blocks EWS growth in vivo. a) and b) SK-N-MC, CHLA-10, and CADO-ES1 cells were implanted subcutaneously in mice and grown until tumors reached a size of approximately 80-100 mm3. Xenografted mice were randomized (n = 8-12 mice/arm) and then received vehicle or JQ1 (50 mg/kg) as indicated 5-days/week. Mean tumor volume ± SEM is shown. P values for the final tumor volumes were determined by two-way ANOVA comparing the treatment to the vehicle group using GraphPad Prism. b) Kaplan-Meier plots are shown for progression-free survival (progression defined by tumor volume tripling); P- values were determined by the log-rank test using GraphPad Prism. c) qRT-PCR for PHF19 and MYC in the SK-N-MC tumor xenografts from control and JQ1 treated mice. N =5 tumors from each group. d) Immunoblot analysis of PHF19 and MYC in SK-N-MC xenograft tumors as in c. GAPDH was used as loading control. e) Quantification of PHF19 and MYC protein levels from d. P – values determined by Student’s t-test. f) Schematic illustrating the dependency of EWS/ETS on BRD4. Inhibition or knockdown of BRD4 disrupts the transcription complex consisting of EWS/ETS, Med1 and RNA PolII thereby impairing the ability of EWS/ETS fusion proteins to alter gene expression and cell death.

Downloaded from cancerres.aacrjournals.org on September 24, 2021. © 2018 American Association for Cancer Research. Figure 3 Top 5 GO terms d f shBRD4/shFLI1 common down a mRNA Splicing p = 1.35E-18 0.0 CHLA cells shFLI1 Author Manuscript Published OnlineFirst on June 13, 2018; DOI: 10.1158/0008-5472.CAN-18-0484-0.2 Author shBRD4manuscripts haveRNA been binding peer reviewedp = 6.36E-15 and accepted for publication but have not yet been edited. -0.4

cell cycle p = 6.22E-08 NES = -3.44 2841 -0.6 834 FDR q = 0.0 1057 Spliceosome p = 1.63E-13 -0.8 Enrichment Score

DNA Replication p = 5.15E-06 DMSO JQ1 573/1057 EWS-FLI1 bound 0 2 4 6 8 10 12 0.0 DAVID clusterm erichment score RD-ES cells (* p <0.0001) -0.1 DE genes with JQ1 b e -0.2 -0.3 NES = -1.91 shFLI1 shBRD4 SK-N-MC -0.4 CHLA-10 RD-ES CADO-ES FDR q = 0.0

Enrichment Score -0.5

2166 739 637 DMSO JQ1 318 198 0.0 675 IGFBP2 SK-N-MC cells -0.1 999 JQ1 -0.2

-0.3 NES = -1.09 FDR q = 0.20 c -0.4 Enrichment Score shFLI1 shBRD4 JQ1 FOXM1 Cado-ES cells DMSO JQ1

PRKCB 0.1 CADO-ES1 cells

0.0

-0.1

-0.2 NES = -1.16 -0.3 FDR q = 0.09

4 Enrichment Score

STEAP1 0 MYOM2 PHF19 DMSO JQ1 log2 fold change -4 PHF19 ETV5 g CHLA-10 CHLA-10 RD-ES SK-N-MC CADO-ES1 U2AF1 ETS2 MYC (FPKM)

NGFR h CHLA-10 CHLA-10 RD-ES SK-N-MC CADO-ES1 6 PLK1 STEAP1

0 MYOM2

FOXM1 log2 fold change -6 SYT4 PHF19 (FPKM)

Downloaded from cancerres.aacrjournals.org on September 24, 2021. © 2018 American Association for Cancer Research. Figure 6 a SK-N-MC b SK-N-MC c Vehicle tumors (n = 5) Author Manuscript Published OnlineFirst100 on June 13, 2018; DOI: 10.1158/0008-5472.CAN-18-0484

) 1500

3 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. vehicle JQ1 tumors (n = 5) 1200 JQ1 (50mg/kg) P = 0.0007 * p <0.01 n.s. 1.2 900 50 1 600 0.8 * vehicle 300 JQ1 (50mg/kg) 0.6 Tumor Volume (mm Volume Tumor P < 0.0001 Progression-Free Survival 0 0.4 0 0 5 10 15 20 1 4 7 9 11 14 16 18 21 22 Days Days 0.2 Relative mRNA expression Relative mRNA 0 CHLA-10 CHLA-10 PHF19 MYC 1800 100 d ) 3 vehicle Vehicle tumors JQ1 tumors 1500 JQ1 (50mg/kg) P = 0.0003 #1 #2 #3 #4 #5 #1 #2 #3 #4 #5 1200 PHF19

900 50 MYC cl.PARP 600 * vehicle GAPDH 300 P < 0.0001 JQ1 (50mg/kg) Tumor Volume (mm Volume Tumor Progression-Free Survival 0 0 147 9 11 14 16 18 22 0 5 10 15 20 e Vehicle tumors (n = 5) Days Days JQ1 tumors (n = 5) 1.2 CADO ES-1 CADO ES-1 n.s. 100 1 * p <0.0001 vehicle

) 900 3 JQ1 (50mg/kg) P = 0.0009 0.8

600 0.6 50 * 0.4 P < 0.001 300 vehicle JQ1 (50mg/kg) 0.2 Tumor Volume (mm Volume Tumor Normalized protein levels Progression-Free Survival 0 0 0 0 5 10 15 14 18 PHF19 MYC 1 4 8 11 16 Days Days

f BRD4

BRD4 Knockdown of BRD4 or EWS/ETS EWS/ETS BET inhibitors RNA PolII DNA Histones Med1 DNA Histones Med1 RNA PolII

1- expression eg: FOXM1, NKX2-2, STEAP1 etc.

EWS/ETS-driven Ewing Sarcoma requires BET bromodomain proteins

Paradesi Naidu Gollavilli, Aishwarya Pawar, Kari Wilder-Romans, et al.

Cancer Res Published OnlineFirst June 13, 2018.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-18-0484

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2021/03/16/0008-5472.CAN-18-0484.DC1

Author Author manuscripts have been peer reviewed and accepted for publication but have not yet been Manuscript edited.

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/early/2018/06/13/0008-5472.CAN-18-0484. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.