Supplementary Figure Legends

1 Supplementary Figure legends

2 Supplementary Figure 1.

3 Experimental workflow.

5 Supplementary Figure 2.

6 IRF9 binding to promoters.

7 a) Verification of mIRF9 antibody by site-directed ChIP. IFNβ-stimulated binding of IRF9 to

8 the ISRE sequences of Mx2 was analyzed using BMDMs of WT and Irf9−/− (IRF9-/-) mice.

9 Cells were treated with 250 IU/ml of IFNβ for 1.5h. Data represent mean and SEM values of

10 three independent experiments. P-values were calculated using the paired ratio t-test (*P ≤

11 0.05; **P ≤ 0.01, ***P ≤ 0.001).

12 b) Browser tracks showing complexes assigned as STAT-IRF9 in IFNγ treated wild type

13 BMDMs. Input, STAT2, IRF9 (scale 0-200). STAT1 (scale 0-150).

15 Supplementary Figure 3.

16 Experimental system for BioID.

17 a) Kinetics of STAT1, STAT2 and IRF9 synthesis in Raw 264.7 macrophages and wild type

18 BMDMs treated with 250 IU/ml as indicated. Whole-cell extracts were tested in western blot

19 for STAT1 phosphorylation at Y701 and of STAT2 at Y689 as well as total STAT1, STAT2,

20 IRF9 and GAPDH levels. The blots are representative of three independent experiments. b)

21 Irf9-/- mouse embryonic fibroblasts (MEFs) were transiently transfected with the indicated

22 expression vectors, including constitutively active IRF7-M15. One day after transfection,

23 RNA was isolated and Mx2 expression determined by qPCR. c) Myc-BirA*-IRF9 transgenic

24 Raw 264.7 were treated with increasing amounts of doxycycline (dox) (0,2µg/ml, 0,4µg/ml,

25 0,6µg/ml, 0,8µg/ml, 1mg/ml) and 50µM biotin. Whole-cell extracts were collected and tested

26 in western blot for levels of IRF9, MYC, and GAPDH. Biotinylated IRF9 was visualized via

27 HRP-coupled streptavidin. d) Stat2-/- MEFs were transiently transfected with the indicated 28 expression vectors, including constitutively active IRF7-M15. One day after transfection,

29 RNA was isolated and Mx2 expression was determined by qPCR. e) Myc-BirA*-STAT2

30 transgenic Raw 264.7 macrophages were treated with increasing amounts of doxycycline as

31 in f) and 50µM biotin. Whole-cell extracts were collected and tested in western blot for levels

32 of STAT2, MYC, and GAPDH. Biotinylated STAT2 was visualized via HRP-coupled

33 streptavidin.

35 Supplementary Figure 4.

36 IRF9 and STAT2 interactome

37 a), b) IRF9 or STAT2 interactors, either pre-associated or after IFN-β or IFN-γ treatment,

38 were identified by streptavidin affinity purification and mass spectrometry. Proteins that

39 displayed a threefold enrichment (in two biological replicates) in the samples of interest

40 compared to the ligase control were counted as hits and are shown in the heatmaps.

41 c) Multi-scatter plot of LFQ-Intensities, displaying Pearson-correlation of each biological

42 replicate.

44 Supplementary table 1.

45 Genes bound by STAT1, STAT2-IRF9 and ISGF3 transcription factor complexes.

47 Supplementary table 2.

48 PRM analysis, mass spectrometry analysis and list of interactors.

50 Supplementary table 3.

51 RT-qPCR and ChIP primer sequences.

52 53 Supplementary Figure 1

1) Expression analysis

RNA-seq analysis No treatment Steady state

IFN-I (2h)

WT mRNA IRF9 -/- IFNg (2h)

2) Transcription factor complexes

ChIP-seq analysis

No treatment Steady state STAT1

IFN-I (1.5h) STAT2 IRF9 WT IRF9 -/- IFNg (1.5h) peak coincidence

BioID analysis biotin affynity capture No treatment mass spec Steady state tryptic digest + Dox + Bio IFN-I (1.5h) N STAT2 C STAT2 STAT2 BirA*

Raw 264.7 abundance rel. ~10nm IFNg (1.5h) m/z

biotin affynity capture

No treatment tryptic digest mass spec Steady state + Dox + Bio IFN-I (1.5h) N IRF9 C IRF9 IRF9 BirA*

Raw 264.7 abundance rel. ~10nm IFNg (1.5h) m/z Distal proteins Vicinal proteins Interacting proteins N-terminal BirA* Covalently bound biotin

Affinity capture cell lysates oligonucleotide affinity capture detection via western blot bioTEG STAT2 STAT1 IRF9 ISRE No treatment Steady state

cell lysates immuno precipitation IFN-I (1.5h) Raw 264.7 STAT2

STAT1 IRF9 Supplementary Figure 1

1) Expression analysis

RNA-seq analysis No treatment Steady state

IFN-I (2h)

WT mRNA IRF9 -/- IFNg (2h)

2) Transcription factor complexes

ChIP-seq analysis

No treatment Steady state STAT1

IFN-I (1.5h) STAT2 IRF9 WT IRF9 -/- IFNg (1.5h) peak coincidence

BioID analysis biotin affynity capture No treatment mass spec Steady state tryptic digest + Dox + Bio IFN-I (1.5h) N STAT2 C STAT2 STAT2 BirA*

Raw 264.7 abundance rel. ~10nm IFNg (1.5h) m/z

biotin affynity capture

No treatment tryptic digest mass spec Steady state + Dox + Bio IFN-I (1.5h) N IRF9 C IRF9 IRF9 BirA*

Raw 264.7 abundance rel. ~10nm IFNg (1.5h) m/z Distal proteins Vicinal proteins Interacting proteins N-terminal BirA* Covalently bound biotin

Affinity capture cell lysates oligonucleotide affinity capture detection via western blot bioTEG STAT2 STAT1 IRF9 ISRE No treatment Steady state

cell lysates immuno precipitation IFN-I (1.5h) Raw 264.7 STAT2

STAT1 IRF9 Supplementary Figure 2 a

IRF9 binding to Mx2 ISRE 0.6 * * WT IRF9-/- 0.4

% of input of % 0.2

0.0 untreated IFN-β

Input

S1 IFN-γ WT

S1 IFN-γ IRF9-/-

S2 IFN-γ WT

S2 IFN-γ IRF9-/-

IRF9 IFN-γ WT

Treml2 Tarm1 Cish Gm4841 Supplementary Figure 3 a Raw 267.4 BMDMs IFN-β IFN-β 0 0.5 1.5 4 0 0.51.5 4 tSTAT2 tSTAT2 pSTAT2 pSTAT2 tSTAT1 tSTAT1 pSTAT1 pSTAT1 IRF9 IRF9 GAPDH GAPDH b c Mx2 mRNA expression

50 Dox - + + + + + - + + + + + 40 Biotin ------+ + + + + + ← myc-BirA*IRF9 30 strep IRF9 ← myc-BirA*IRF9 20 ← endog. IRF9 fold induction fold myc 10 0 GAPDH k 9 F moc IR 7-M15 F IR

myc-BirA*

IRF7-M15 + myc-BirA*IRF9 d e

Dox - + + + + + - + + + + + Mx2 mRNA expression Biotin ------+ + + + + + 100 strep ←myc-BirA*STAT2 80 ← STAT1 60 STAT2 ←myc-BirA*STAT2 40 ←endog. STAT2

fold induction fold 20 myc 0 Tubulin k 2 moc 7-M15 F IR

myc-BirA*STAT2

IRF7-M15 + myc-BirA*STAT Supplementary Figure 4 a Intensity

LFQ intensity IRF9 (B) LFQ intensity IRF9 IFN-β (B) LFQ intensity IRF9 IFN-γ (A)

LFQ intensity IRF9 (A) LFQ intensity IRF9 IFN-β (A) LFQ intensity IRF9 IFN-γ (B)

LFQ intensity myc (A) myc intensity LFQ LFQ intensity myc (A) myc intensity LFQ LFQ intensity myc (B) myc intensity LFQ

LFQ intensity myc (A) myc intensity LFQ LFQ intensity myc (B) myc intensity LFQ LFQ intensity myc (B) myc intensity LFQ 16 32

Irf9 Irf9 Irf9 Znf148 Txnl1 2210010C04Rik 2210010C04Rik Txnl1 Txnl1 Chd1 Chd1 Chd1 2210010C04Rik Baz1a Zfp384 Zfp384 Mef2d Ep400 Ep400 Ppm1g Mef2d Zeb2 Baz1a Stat2 Ppm1g Mef2d Yy1 Fli1 Ppm1g Sub1 Slx4 Fli1 AU019823 Leng8 Snrnp70 Taf1 Ep400 Mast1 Parp1 Zfp384 Gtf2e1 Leng8 Slx4 Ccnt1 Ccnt1 Fli1 Sugp1 Gtf2e1 Leng8 Taf1 Cwc15 Hivep3 Sugp1 Taf1 Chaf1b Sugp1 Parp1 Slx4 Arid1a Cwc15 Hivep3 Taf2 Hivep3 Parp1 Champ1 Yy1 Mast1 Smarcc1 Stat2 Ccnt1 Hmgn2 Taf9 Taf9 Ctcf Snrnp70 Cbx3 Aldh9a1 Chaf1b Taf9 Gtf2i Cbx3 Gtf2i Gnl2 Ikzf1 Champ1 Gnl2 Hdgf Fip1l1 Cbx3 Ctcf Alyref Atic Elf2 Gff2e1 Ikzf1 Jmjd1c Arid1a Gnl2 Chd4 Champ1 Elf2 Mki67 Elf2 Acta1 Chd4 Jmjd1c Zfp62 Mki67 Chd4 Brd4 Zfp62 Mki67 Hp1bp3 Jmjd1c Zfp62 Baz1b Dsp Numa1 Numa1 Brd4 Hp1bp3 Baz1b Hcfc1 Hp1bp3 Chd8 Chaf1 Wdhd1 Smchd1 Ptma Znf148 Numa1 Pes1 Pes1 Baz1b Brd4 Ptma Wdhd1 Smchd1 Znf148 Ddx42 Tcerg1 Chd8 Smchd1 Rif1 Ptma Chd8 Chaf1a Pcnp Ca2 Trim28 Zbtb33 Rif1 Rif1 Trim28 Trim28 Set Set Smarca5 Smarca5 Zbtb33 Set Zbtb33 Hist1h1a Hist1h1a Hist1h1a Tpx2 Tpx2 Tpx2 Smarca5 Yeats2 Yeats2 Adnp Adnp Yeats2 Kdm3b Cux1 Cux1 Nasp Hmgb1 Adnp Cux1 Nucks1 Nucks1 Nucks1 b

LFQ intensity STAT2 (B) LFQ intensity STAT2 IFN-β (B)

LFQ intensity STAT2 (A) LFQ intensity STAT2 IFN-β (A)

LFQ intensity myc (A) myc intensity LFQ (A) myc intensity LFQ

LFQ intensity myc (B) myc intensity LFQ LFQ intensity myc (B) myc intensity LFQ

LFQ intensity STAT2 IFN-γ (B)

LFQ intensity STAT2 IFN-γ (A)

LFQ intensity myc (A) myc intensity LFQ LFQ intensity myc (B) myc intensity LFQ

Acta1 H2afv Ckb Cs Hmgn2 Mtco2 Acaa1a Atp50 Atp50 Ckb AU019823 Srsf5 Mast1 Atp5h Cdc42 Taf2 Aldh9a1 Rab7a Polr1d Hmgn2 Txn Snrnp70 Txnl1 Aldh9a1 Ep400 Atic Syncrip Atp50 Psma1 Irf9 Hmgn2 Actr2 Snrnp70 Ckb Snrnp70 Parp1 Ncf1 Atic Cyb5r3 Trap1 Cbx3 Aldh9a1 AU019823 A430005L14Rik Atic Lmna AU019823 Lgals3 Tkt Cyb5r3 Atp5b Cyb5r3 S100a4 Akr1b1 Dbt Fabp5 Atp5b Mdh1 Dsp Cct2 Arhgdia Srsf1 Hist1h1e Hist1h1e Hmgb1 Nme1 S100a4 Got2 S100a4 Rps10 Rps19 2210010C04Rik Hist1h1e Ppia Stat2 Gapdh Stat2 Stat2 Stat1 Stat1 Stat1 c

0.9920 0.9857 0.9858

LFQ intensity IRF9 (B) IRF9 intensity LFQ

LFQ intensity IRF9 IFN-β (Β) IFN-β IRF9 intensity LFQ LFQ intensityIRF9 IFN-γ (Β) IFN-γ intensityIRF9 LFQ

LFQ intensity IRF9 (A) LFQ intensity IRF9 IFN-β (A) LFQ intensity IRF9 IFN-γ (Β) 0.9764

0.9683 0.9885

LFQ intensity STAT2 (B) STAT2 intensity LFQ

LFQ intensity STAT2 IFN-β (Β) IFN-β STAT2 intensity LFQ LFQ intensityIRF9 IFN-γ (Β) IFN-γ intensityIRF9 LFQ

LFQ intensity STAT2 (A) LFQ intensity STAT2 IFN-β (A) LFQ intensity STAT2 IFN-γ (Β)

0.9787 LFQ intensity myc (B) myc intensity LFQ

LFQ intensity myc (A) Supplementary Figure 3 a Raw 267.4 BMDMs IFN-β IFN-β 0 0.5 1.5 4 0 0.51.5 4 tSTAT2 tSTAT2 pSTAT2 pSTAT2 tSTAT1 tSTAT1 pSTAT1 pSTAT1 IRF9 IRF9 GAPDH GAPDH b c Mx2 mRNA expression

50 Dox - + + + + + - + + + + + 40 Biotin ------+ + + + + + ← myc-BirA*IRF9 30 strep IRF9 ← myc-BirA*IRF9 20 ← endog. IRF9 fold induction fold myc 10 0 GAPDH k 9 F moc IR 7-M15 F IR

myc-BirA*

IRF7-M15 + myc-BirA*IRF9 d e

Dox - + + + + + - + + + + + Mx2 mRNA expression Biotin ------+ + + + + + 100 strep ←myc-BirA*STAT2 80 ← STAT1 60 STAT2 ←myc-BirA*STAT2 40 ←endog. STAT2

fold induction fold 20 myc 0 Tubulin k 2 moc 7-M15 F IR

myc-BirA*STAT2

IRF7-M15 + myc-BirA*STAT Supplementary Figure 4 a Intensity

LFQ intensity IRF9 (B) LFQ intensity IRF9 IFN-β (B) LFQ intensity IRF9 IFN-γ (A)

LFQ intensity IRF9 (A) LFQ intensity IRF9 IFN-β (A) LFQ intensity IRF9 IFN-γ (B)

LFQ intensity myc (A) myc intensity LFQ LFQ intensity myc (A) myc intensity LFQ LFQ intensity myc (B) myc intensity LFQ

LFQ intensity myc (A) myc intensity LFQ LFQ intensity myc (B) myc intensity LFQ LFQ intensity myc (B) myc intensity LFQ 16 32

LFQ intensity STAT2 (B) LFQ intensity STAT2 IFN-β (B)

LFQ intensity STAT2 (A) LFQ intensity STAT2 IFN-β (A)

LFQ intensity myc (A) myc intensity LFQ (A) myc intensity LFQ

LFQ intensity myc (B) myc intensity LFQ LFQ intensity myc (B) myc intensity LFQ

LFQ intensity STAT2 IFN-γ (B)

LFQ intensity STAT2 IFN-γ (A)

LFQ intensity myc (A) myc intensity LFQ LFQ intensity myc (B) myc intensity LFQ

0.9920 0.9857 0.9858

LFQ intensity IRF9 (B) IRF9 intensity LFQ

LFQ intensity IRF9 IFN-β (Β) IFN-β IRF9 intensity LFQ LFQ intensityIRF9 IFN-γ (Β) IFN-γ intensityIRF9 LFQ

LFQ intensity IRF9 (A) LFQ intensity IRF9 IFN-β (A) LFQ intensity IRF9 IFN-γ (Β) 0.9764

0.9683 0.9885

LFQ intensity STAT2 (B) STAT2 intensity LFQ

LFQ intensity STAT2 IFN-β (Β) IFN-β STAT2 intensity LFQ LFQ intensityIRF9 IFN-γ (Β) IFN-γ intensityIRF9 LFQ

LFQ intensity STAT2 (A) LFQ intensity STAT2 IFN-β (A) LFQ intensity STAT2 IFN-γ (Β)

0.9787 LFQ intensity myc (B) myc intensity LFQ

LFQ intensity myc (A) 1 Supplementary table 3 2 Primers qPCR Gene name Forward 5‘-3‘ Reverse 5‘-3‘ Irf1 CCGAAGACCTTATGAAGCTCTTTG GCAAGTATCCCTTGCCATCG Irf8 GGCTGCATGAGCGAAGTTC CTCCTCTTGGTCATACCCATGTA Usp18 TGCCTCGGAGTGCAGAAGA CGTGATCTGGTCCTTAGTCAGG Irf7 ATTTCGGTCGTAGGGATCTGG GCACAGCGGAAGTTGGTCT Oas1a GGGTCATGTTAATACTTCCAGCA CAATGGCTTCCCCAGCTTCT Gapdh CATGGCCTTCCGTGTTCCTA GCGGCACGTCAGATCCA Primers ChIP qPCR Gene name Forward 5‘-3‘ Reverse 5‘-3‘ Mx2 ISRE CTTCTGCCCAGAATCAGGC AGTTTCACTTTCATTTCTCTGGTTC 3