Table S1
Proteins Organisms Identity Accession Grx4 Ustilago hordei 68% CCF50760.1 Grx4 U. maydis 67% XP_011390702.1 Grx4 Schizosaccharomyces pombe 63% NP_596647.1 Grx4 Saccharomyces cerevisiae 61% NP_011101.3 Grx3 Saccharomyces cerevisiae 61% AJV06961.1 Grx4 Candida albicans 57% KHC50815.1 Grx3 Homo sapiens 60% AAH14372.2 Table S2. Transcripts up-regulated (639) in the grx4 mutant under both low iron and high iron conditions
Name Description WT-L vs grx4-L vs grx4-H vs grx4-L vs WT-H WT-L WT-H grx4-H CNAG_01138 cytochrome c mitochondrial 0.0674 181.0047 27.3521 0.4416 CNAG_07367 amino acid transporter 1.3827 171.4830 184.7434 1.2681 CNAG_07734 hypothetical protein CNAG_07734 #N/A 162.3821 #N/A 1.4436 CNAG_06312 hypothetical protein CNAG_06312 1.4841 92.1311 24.1057 5.6189 CNAG_04890 hypothetical protein CNAG_04890 #N/A 60.4644 56.2799 0.8687 CNAG_02049 proline dehydrogenase 3.8748 60.3503 181.0794 1.2793 CNAG_04325 extradiol ring-cleavage dioxygenase 0.1097 58.0079 16.7263 0.3774 CNAG_00162 alternative mitochondrial 0.0234 52.5633 1.7976 0.6774 CNAG_01056 conidiation-specific 6 1.5183 48.4784 62.4391 1.1734 CNAG_02548 cobalamin synthesis 0.0372 32.9091 3.4480 0.3518 CNAG_01995 hypothetical protein CNAG_01995 1.6683 31.8490 61.0448 0.8635 CNAG_07797 transcriptional regulator 0.2303 29.7806 7.5169 0.9035 CNAG_07969 hypothetical protein CNAG_07969 2.6971 26.5647 48.7649 1.4536 CNAG_02526 hypothetical protein CNAG_02526 4.0835 26.3516 72.6682 1.4685 CNAG_04469 4-aminobutyrate transaminase 1.0956 26.2596 38.6320 0.7373 CNAG_01965 hypothetical protein CNAG_01965 1.0586 24.6364 45.8429 0.5675 CNAG_06557 membrane protein 0.6055 23.1898 24.3277 0.5734 CNAG_06911 hypothetical protein CNAG_06911 1.4046 22.1450 26.6229 1.1598 CNAG_04138 hypothetical protein CNAG_04138 #N/A 21.4151 69.5919 0.7349 CNAG_00735 aldehyde dehydrogenase family 7 0.9299 20.9039 12.2606 1.5695 member A1 CNAG_01075 methylmalonate-semialdehyde 0.9694 18.9186 20.5325 0.8876 dehydrogenase (acylating) CNAG_07310 hypothetical protein CNAG_07310 0.0198 18.1849 1.8280 0.1952 CNAG_04951 3-deoxy-7-phosphoheptulonate 0.0895 17.7184 2.5099 0.6259 synthase CNAG_00540 pantothenate transporter 0.8985 17.3501 24.4641 0.6321 CNAG_01081 hypothetical protein CNAG_01081 1.6806 17.1068 24.9431 1.1408 CNAG_07798 amidohydrolase 3 1.2683 16.9140 26.3996 0.8050 CNAG_02777 phosphate:H symporter 0.2525 16.5855 5.8839 0.7057 CNAG_00844 MFS transporter 2.5539 15.7397 41.3074 0.9637 CNAG_04617 OPT family small oligopeptide 0.3903 15.4571 12.6314 0.4733 transporter CNAG_06651 amidohydrolase domain containing 3.8133 15.0222 48.3237 1.1766 CNAG_06194 hypothetical protein CNAG_06194 0.8417 14.8972 11.6879 1.0671 CNAG_06556 oxidoreductase 2.2135 14.6606 27.8259 1.1532 CNAG_03011 glycerate-and formate- 1.0051 14.5237 13.4020 1.0813 dehydrogenase CNAG_05341 hypothetical protein CNAG_05341 1.3695 13.9061 18.8981 0.9984 CNAG_02489 alcohol propanol-preferring 3.6222 13.2252 29.0500 1.6310 CNAG_05324 sugar transporter 1.1745 13.1136 32.7973 0.4663 CNAG_07550 hypothetical protein CNAG_07550 0.3946 13.0849 4.5497 1.1252 CNAG_06294 hypothetical protein CNAG_06294 0.5961 12.7594 3.9996 1.8842 CNAG_06145 RNA processing-related 0.9900 12.6552 11.8287 1.0493 CNAG_07811 hypothetical protein CNAG_07811 #N/A 12.3129 #N/A 1.5630 CNAG_01971 hypothetical protein CNAG_01971 #N/A 12.2413 13.3258 2.3594 CNAG_05847 thioredoxin reductase 1.2419 12.1215 10.1329 1.4726 CNAG_07827 hypothetical protein CNAG_07827 0.3947 11.8700 4.5258 1.0229 CNAG_01542 taurine catabolism dioxygenase 3.0635 11.8244 26.9105 1.3312 CNAG_05763 hypothetical protein CNAG_05763 0.0658 11.3559 1.9869 0.3724 CNAG_03906 hypothetical protein CNAG_03906 1.8999 10.8676 20.5230 0.9960 CNAG_01908 uroporphyrinogen-III synthase 0.0374 10.6025 2.7192 0.1444 CNAG_04242 hypothetical protein CNAG_04242 0.0876 10.3560 2.8665 0.3135 CNAG_03465 laccase precursor 0.9869 10.2230 7.5463 1.3249 CNAG_04357 hypothetical protein CNAG_04357 2.5840 10.1607 21.1378 1.2316 CNAG_00838 hypothetical protein CNAG_00838 1.2274 9.8372 9.0018 1.3296 CNAG_00177 hypothetical protein CNAG_00177 2.9313 9.7346 16.8224 1.6804 CNAG_05015 CAT1 catalase 0.6463 9.6326 5.6475 1.0920 CNAG_00237 3-isopropylmalate large subunit 0.2215 9.5446 3.0096 0.6958 CNAG_04988 Gly-Xaa carboxypeptidase 0.8066 9.3841 10.7020 0.6998 CNAG_04470 haloacid type II 1.5053 9.2869 14.5725 0.9491 CNAG_07693 high-affinity methionine permease 1.6159 9.2035 9.0353 1.6284 CNAG_00161 auxin-induced protein 0.6288 9.1133 5.7797 0.9814 CNAG_02525 hypothetical protein CNAG_02525 1.5647 9.0481 7.4881 1.8699 CNAG_02565 homoaconitate hydratase 0.0750 8.8141 1.6357 0.4007 CNAG_01947 2,4-dienoyl- reductase 0.9723 8.7902 7.1386 1.1854 CNAG_04103 hypothetical protein CNAG_04103 0.5039 8.7714 4.6227 0.9477 CNAG_04905 tRNA (uracil-5-)-methyltransferase 0.0345 8.6717 2.1425 0.1386 CNAG_06650 hypothetical protein CNAG_06650 1.2479 8.6178 15.9514 0.6682 CNAG_02093 hypothetical protein CNAG_02093 0.3308 8.5375 3.2635 0.8574 CNAG_00462 electron-transferring-flavo 0.0466 8.5136 1.3518 0.2907 dehydrogenase CNAG_06374 malate dehydrogenase 0.9460 8.2791 2.9930 2.5936 (oxaloacetate-decarboxylating) CNAG_02734 hypothetical protein CNAG_02734 #N/A 8.2062 14.3981 1.1959 CNAG_04461 ATP-dependent DNA helicase 1.3808 8.1050 8.9741 1.2368 HFM1 MER3 CNAG_07711 PLP-dependent transferase 2.2697 7.9350 7.9484 2.2286 CNAG_02771 DNA repair and recombination 1.0984 7.9051 8.7877 0.9793 RAD54B CNAG_07779 D-glycerate 3-kinase 0.5655 7.8306 4.1715 1.0538 CNAG_02900 hypothetical protein CNAG_02900 1.8792 7.7782 8.7260 1.6558 CNAG_01714 sulfonate dioxygenase 1.6220 7.5785 14.2426 0.8526 CNAG_07960 hypothetical protein CNAG_07960 1.2049 7.4172 9.1628 0.9665 CNAG_04862 glutamate synthase (NADPH 0.2156 7.3553 7.1494 0.2197 NADH) CNAG_05093 hypothetical protein CNAG_05093 #N/A 7.3241 6.1690 1.2384 CNAG_00720 DNA repair RAD51 1.5080 7.1115 10.7208 0.9912 CNAG_01400 3-deoxy-7-phosphoheptulonate 0.1111 6.8621 1.6968 0.4454 synthase CNAG_07552 DNA repair Rad8 0.8674 6.7453 4.9744 1.1664 CNAG_01969 zinc metalloprotease 1.1945 6.7145 3.5028 2.2700 CNAG_00840 hypothetical protein CNAG_00840 1.0858 6.7080 7.0795 1.0150 CNAG_01061 serine threonine kinase 0.8509 6.6970 3.5515 1.5900 CNAG_04691 hypothetical protein CNAG_04691 1.6368 6.6851 9.8670 1.1007 CNAG_01949 chlorophyll synthesis pathway 1.1026 6.6275 4.2999 1.6845 CNAG_00937 hypothetical protein CNAG_00937 2.2718 6.5750 12.1553 1.2163 CNAG_00133 hypothetical protein CNAG_00133 1.5715 6.5230 8.5936 1.1814 CNAG_06203 hypothetical protein CNAG_06203 1.8022 6.4872 11.8841 0.9753 CNAG_04267 mitochondrial genome maintenance 0.1757 6.4779 1.8168 0.6212 CNAG_05357 hypothetical protein CNAG_05357 0.4443 6.3234 10.0395 0.2775 CNAG_03635 hypothetical protein CNAG_03635 2.3143 6.2838 8.2472 1.7453 CNAG_06724 DNA strand annealing 0.9782 6.2332 5.1202 1.1803 CNAG_04025 transaldolase 3.3044 6.2280 11.6005 1.7590 CNAG_00868 hypothetical protein CNAG_00868 #N/A 6.1763 28.2635 0.6187 CNAG_01139 hypothetical protein CNAG_01139 1.1402 6.1707 8.5893 0.8103 CNAG_02690 pirin 0.5476 6.1675 3.6292 0.9226 CNAG_00178 DNA repair REV1 1.4024 6.1169 7.1227 1.1940 CNAG_07796 uroporphyrinogen-III C- 0.1576 6.1121 4.0700 0.2345 methyltransferase CNAG_00235 ammonium transporter MEP1 0.3930 6.0989 5.3938 0.4405 CNAG_04416 major facilitator superfamily 1.9562 6.0243 10.8708 1.0746 transporter CNAG_04704 MFS SHS lactate transporter 1.1383 6.0188 8.8688 0.7671 CNAG_04758 amt family ammonium transporter 1.0069 5.9385 7.2679 0.8153 CNAG_00549 hypothetical protein CNAG_00549 1.6754 5.9136 7.3539 1.3310 CNAG_06166 ATP-dependent DNA helicase 1.0006 5.8870 5.1294 1.1385 MPH1 CNAG_05497 dihydroxy-acid dehydratase 0.1018 5.8595 1.2357 0.4784 CNAG_01865 hypothetical protein CNAG_01865 1.0995 5.8442 3.5143 1.8123 CNAG_05509 imidazoleglycerol-phosphate 0.1518 5.7671 1.5800 0.5486 dehydratase CNAG_06259 alpha-glucoside:hydrogen 2.2069 5.7356 7.7041 1.6279 symporter CNAG_02147 cytochrome c peroxidase 0.0695 5.7103 1.9396 0.2030 CNAG_07309 mRNA surveillance pelota 0.0610 5.6856 1.2366 0.2780 CNAG_04055 cell cycle checkpoint 1.1605 5.6600 6.4664 1.0062 CNAG_07908 aconitate mitochondrial 0.2025 5.6433 2.1318 0.5310 CNAG_06152 hypothetical protein CNAG_06152 1.0972 5.6164 5.9372 1.0284 CNAG_02312 patatin-like phospholipase domain- 0.5349 5.6160 2.9479 1.0108 containing CNAG_01668 hypothetical protein CNAG_01668 1.3717 5.6106 8.8101 0.8638 CNAG_00275 hypothetical protein CNAG_00275 2.2412 5.6053 7.1015 1.7522 CNAG_06910 Metallo-hydrolase oxidoreductase 1.0787 5.6044 9.9525 0.6010 CNAG_05875 cytochrome c heme-lyase 0.1690 5.6019 2.9866 0.3140 CNAG_00575 catalase A 0.4810 5.5936 3.3113 0.8059 CNAG_05147 hypothetical protein CNAG_05147 2.2247 5.5009 5.0017 2.4232 CNAG_05198 DNA repair RAD7 1.2712 5.4930 7.2702 0.9515 CNAG_07766 DNA polymerase lambda subunit 1.8657 5.4920 9.2050 1.1031 CNAG_03696 hypothetical protein CNAG_03696 2.0365 5.4865 7.0896 1.5601 CNAG_05434 NADH dehydrogenase (ubiquinone) 0.1220 5.4461 2.0856 0.3153 1 alpha subcomplex 2 CNAG_06404 hypothetical protein CNAG_06404 0.0486 5.4382 2.2028 0.1190 CNAG_00587 hypothetical protein CNAG_00587 3.0111 5.4370 19.0413 0.8522 CNAG_06817 NCS2 family nucleobase:cation 1.2780 5.4368 6.0479 1.1384 symporter-2 CNAG_00331 alpha beta hydrolase 1.2721 5.4169 4.7831 1.4265 CNAG_05631 NADH-ubiquinone oxidoreductase 0.0723 5.3982 1.2922 0.2991 49 kDa mitochondrial CNAG_05079 hypothetical protein CNAG_05079 0.3577 5.3745 1.3516 1.4076 CNAG_07476 hypothetical protein CNAG_07476 1.1350 5.3380 4.9168 1.2214 CNAG_06946 hypothetical protein CNAG_06946 0.0624 5.3378 1.4449 0.2285 CNAG_01980 hypothetical protein CNAG_01980 #N/A 5.3297 #N/A 4.9605 CNAG_01354 hypothetical protein CNAG_01354 0.7645 5.2909 4.8607 0.8246 CNAG_00033 hypothetical protein CNAG_00033 #N/A 5.2437 9.5015 0.8065 CNAG_06180 NADH dehydrogenase (ubiquinone) 0.0902 5.2372 1.1501 0.4069 Fe-S 4 CNAG_05253 hypothetical protein CNAG_05253 0.2129 5.2055 2.6169 0.4196 CNAG_05154 membrane fraction 0.5716 5.2033 5.5044 0.5355 CNAG_05313 hypothetical protein CNAG_05313 1.0204 5.1710 3.6962 1.4157 CNAG_06096 tricarboxylate carrier 0.1216 5.1391 1.1675 0.5305 CNAG_01846 flavoprotein 0.0382 5.1133 1.8860 0.1025 CNAG_03482 thioredoxin-dependent peroxide 1.3127 5.0984 4.6206 1.4351 reductase CNAG_05358 hypothetical protein CNAG_05358 1.2189 5.0690 5.3158 1.1513 CNAG_06524 hypothetical protein CNAG_06524 2.5003 5.0654 16.2524 0.7722 CNAG_02544 DNA repair Swi5 Sae3 1.5561 5.0624 7.0387 1.1043 CNAG_05090 quinone oxidoreductase 0.4250 5.0418 2.9779 0.7131 CNAG_03552 hypothetical protein CNAG_03552 0.7673 5.0328 4.9036 0.7802 CNAG_00597 amino acid transporter 1.3407 5.0132 5.5552 1.2009 CNAG_04056 hypothetical protein CNAG_04056 0.1410 5.0121 1.5863 0.4417 CNAG_04241 cytoplasmic variant 0.3579 4.9806 4.2021 0.4205 CNAG_05170 hypothetical protein CNAG_05170 0.9555 4.9390 2.9829 1.5684 CNAG_01040 carboxypeptidase D 2.3152 4.9025 5.6796 1.9804 CNAG_03481 ribonuclease P component 0.6635 4.8874 2.7856 1.1529 CNAG_01076 4-aminobutyrate aminotransferase 1.9274 4.8704 8.9790 1.0364 CNAG_00654 sulfiredoxin 4.3449 4.8477 14.4082 1.4488 CNAG_03654 ATP-dependent DNA helicase 1.0658 4.8455 4.9104 1.0425 CNAG_02512 DNA repair RAD16 1.9665 4.8413 8.8648 1.0644 CNAG_03133 UDP-glucose,sterol transferase 1.4069 4.8378 4.5804 1.4713 CNAG_05515 hypothetical protein CNAG_05515 1.5680 4.8046 6.6661 1.1200 CNAG_02589 hypothetical protein CNAG_02589 2.0335 4.7574 9.5254 1.0060 CNAG_05316 inositol oxygenase 0.3989 4.7536 3.0503 0.6161 CNAG_01287 NADH-ubiquinone oxidoreductase 0.0529 4.7372 0.9781 0.2538 51 kDa subunit CNAG_02893 hypothetical protein CNAG_02893 2.6993 4.7303 3.8962 3.2450 CNAG_05258 glucose-methanol-choline (GMC) 5.6800 4.7204 17.3553 1.5288 oxidoreductase CNAG_02143 hypothetical protein CNAG_02143 1.6372 4.7070 2.9921 2.5523 CNAG_02581 hypothetical protein CNAG_02581 0.1411 4.6756 1.9810 0.3303 CNAG_02463 GTP binding and negative regulator 0.7417 4.6574 3.4346 0.9957 of the Ran Tc4 GTPase cycle Gtr1p CNAG_05706 hypothetical protein CNAG_05706 0.1247 4.6309 2.0775 0.2753 CNAG_05729 hypothetical protein CNAG_05729 #N/A 4.6288 2.4482 2.8459 CNAG_00978 NADH dehydrogenase (ubiquinone) 0.0883 4.6163 1.2017 0.3362 1 alpha subcomplex 9 CNAG_00163 general transcription factor 3C 0.4549 4.5974 1.9471 1.0640 polypeptide 4 CNAG_03128 lincomycin-condensing lmbA 0.3281 4.5694 2.4720 0.6013 CNAG_02016 hypothetical protein CNAG_02016 3.2269 4.5664 8.9781 1.6257 CNAG_07844 amino acid transporter 2.0228 4.5498 10.7498 0.8480 CNAG_06029 peptidyl-tRNA hydrolase ICT1 0.2304 4.5400 2.7034 0.3835 CNAG_05169 L-lactate dehydrogenase 0.2067 4.5389 1.8602 0.4997 (cytochrome) CNAG_06204 high-affinity nicotinic acid 0.7061 4.5307 6.9915 0.4536 transporter CNAG_05010 hypothetical protein CNAG_05010 1.2696 4.5117 4.6917 1.2091 CNAG_01470 NADH dehydrogenase (ubiquinone) 0.0813 4.4945 1.5216 0.2379 flavo 2 CNAG_01118 AAT family amino acid transporter 1.6365 4.4830 5.1192 1.4192 CNAG_00905 MFS transporter 0.9150 4.3957 2.0576 1.9378 CNAG_05868 glutamate-1-semialdehyde 2,1- 2.0512 4.3940 9.7058 0.9211 aminomutase CNAG_01144 damaged DNA binding 1.4350 4.3748 6.4065 0.9714 CNAG_00433 hypothetical protein CNAG_00433 1.1771 4.3334 3.6739 1.3756 CNAG_06818 fungal Zn(2)-Cys(6) binuclear 0.9382 4.3261 3.9765 1.0114 cluster domain-containing CNAG_02579 hypothetical protein CNAG_02579 0.6135 4.3094 2.3879 1.0973 CNAG_00123 hypothetical protein CNAG_00123 2.1495 4.3074 2.1451 4.2744 CNAG_06539 monocarboxylic acid transporter 2.4315 4.3068 5.3219 1.9495 CNAG_03629 NADH dehydrogenase (quinone) G 0.0533 4.2998 1.1451 0.1982 subunit CNAG_06503 uridine permease 2.8297 4.2950 8.7000 1.3813 CNAG_03813 replication factor A3 1.3486 4.2851 6.0230 0.9504 CNAG_03912 AE016780 membrane 1.5831 4.2718 9.9365 0.6736 CNAG_00010 cation transporter 0.3704 4.2327 1.6900 0.9195 CNAG_03363 hypothetical protein CNAG_03363 0.1119 4.2321 1.9848 0.2364 CNAG_06555 aromatic amino acid 0.5290 4.2281 2.0092 1.1032 aminotransferase I CNAG_07862 fumarate reductase (NADH) 0.1478 4.2279 2.5529 0.2427 CNAG_07924 RNA polymerase II transcription 0.6864 4.2217 2.3738 1.2098 factor CNAG_02028 CMGC SRPK kinase 0.1223 4.2216 1.0037 0.5097 CNAG_07324 hypothetical protein CNAG_07324 1.6082 4.2085 4.2810 1.5666 CNAG_06512 pirin domain 1.0225 4.2057 5.7608 0.7399 CNAG_03551 hypothetical protein CNAG_03551 #N/A 4.1987 8.4248 0.8324 CNAG_02849 glutathione transferase 1.1683 4.1959 2.2457 2.1619 CNAG_07177 NADH dehydrogenase (ubiquinone) 0.1267 4.1936 1.1869 0.4435 Fe-S 3 CNAG_02684 hypothetical protein CNAG_02684 0.9464 4.1799 2.8884 1.3583 CNAG_00078 vacuolar protein 0.4958 4.1599 2.8033 0.7293 CNAG_07661 hypothetical protein CNAG_07661 1.1837 4.1599 4.3964 1.1108 CNAG_01816 hypothetical protein, variant 2.1060 4.1520 7.8521 1.1028 CNAG_04960 hypothetical protein CNAG_04960 0.7073 4.1399 3.6282 0.8000 CNAG_02387 hypothetical protein CNAG_02387 0.5046 4.1207 2.5717 0.8019 CNAG_04707 hypothetical protein CNAG_04707 2.0485 4.1187 6.1825 1.3514 CNAG_07564 hypothetical protein CNAG_07564 1.5809 4.1125 5.4770 1.1758 CNAG_06227 fanconi-associated nuclease 1 1.0918 4.1029 4.2955 1.0335 CNAG_00664 hypothetical protein CNAG_00664 1.1295 4.0952 4.4397 1.0307 CNAG_05041 NADH-ubiquinone oxidoreductase 0.0577 4.0928 1.1206 0.2086 subunit 8 CNAG_06876 alpha-ketoglutarate-dependent 0.9483 4.0689 3.1907 1.1985 taurine dioxygenase CNAG_05899 pyrroline-5-carboxylate reductase 0.4138 4.0492 1.4052 1.1819 CNAG_02966 carboxypeptidase D 3.2243 4.0425 3.2744 3.9448 CNAG_00891 ATP-binding subfamily member 2 0.1974 4.0122 2.0252 0.3880 CNAG_04837 hypothetical protein CNAG_04837 1.9389 3.9953 4.0145 1.9130 CNAG_03923 crossover junction endonuclease 0.6503 3.9680 2.5042 1.0216 MUS81 CNAG_04753 gluconolactonase 0.8124 3.9677 3.2360 0.9872 CNAG_00796 ATP-binding subfamily B (MDR 0.6072 3.9490 3.1144 0.7628 TAP) member 1 CNAG_00247 alpha-aminoadipic semialdehyde 1.3477 3.9479 1.7713 2.9776 synthase CNAG_00663 hypothetical protein CNAG_00663 0.7254 3.9241 3.2372 0.8713 CNAG_07387 siderophore-iron transporter Str3 2.8105 3.9216 10.5485 1.0354 CNAG_01229 L-mandelate dehydrogenase 0.1334 3.9091 2.0502 0.2521 CNAG_05264 alpha-amylase variant 0.8429 3.9023 2.9067 1.1216 CNAG_03122 hypothetical protein CNAG_03122 1.6417 3.8916 3.4641 1.8265 CNAG_05913 alpha-glucosidase 0.9028 3.8873 3.8714 0.8984 CNAG_00898 multidrug efflux pump 2.2256 3.8830 7.4021 1.1548 CNAG_04872 mitochondrial protein 0.2843 3.8829 1.4789 0.7398 CNAG_04870 hypothetical protein CNAG_04870 0.3499 3.8593 2.4009 0.5567 CNAG_00992 homocitrate mitochondrial 0.4791 3.8374 1.3854 1.3161 CNAG_01612 SNF1 family kinase 2.4248 3.8107 8.9815 1.0178 CNAG_03614 hypothetical protein CNAG_03614 1.8332 3.8012 2.7641 2.4995 CNAG_07573 DNA ligase (ATP) 1.6963 3.8002 5.9728 1.0697 CNAG_03395 iron ion homeostasis-related 0.1045 3.7827 1.5862 0.2469 CNAG_05114 peroxisomal copper amine oxidase 1.6886 3.7763 4.3170 1.4664 CNAG_04869 carboxylesterase 1.9253 3.7608 4.2547 1.6864 CNAG_05330 MFS SP general alpha glucoside:H 4.4123 3.7372 11.2336 1.4569 symporter CNAG_07549 hypothetical protein CNAG_07549 0.3113 3.7298 2.9351 0.3927 CNAG_00315 HHE domain-containing 0.1187 3.7138 3.3092 0.1319 CNAG_06373 mitotic spindle assembly checkpoint 0.4084 3.7128 1.2389 1.2130 MAD2B CNAG_06226 NADH dehydrogenase (ubiquinone) 0.1049 3.7121 1.5150 0.2545 1 alpha subcomplex 5 CNAG_04486 hypothetical protein CNAG_04486 1.8274 3.7074 6.2864 1.0683 CNAG_04085 oxidoreductase 1.4816 3.7010 4.6998 1.1561 CNAG_05075 sodium:inorganic phosphate 1.2374 3.6905 3.3173 1.3602 symporter CNAG_04901 hypothetical protein CNAG_04901 0.3149 3.6903 3.2193 0.3576 CNAG_02266 NADH-quinone oxidoreductase 0.1352 3.6866 1.4922 0.3308 subunit B 2 CNAG_00812 cohesin complex subunit SA-1 2 0.8956 3.6833 3.2761 0.9980 CNAG_06828 solute carrier family 36 (proton- 0.1450 3.6705 1.3886 0.3800 coupled amino acid transporter) CNAG_06802 hypothetical protein CNAG_06802 3.8404 3.6558 10.5844 1.3132 CNAG_00451 cytoplasmic protein 0.7043 3.6527 3.1164 0.8180 CNAG_02765 3-hydroxyisobutyrate 0.9781 3.6508 5.4911 0.6443 dehydrogenase CNAG_06188 hypothetical protein CNAG_06188 0.7632 3.6498 2.8422 0.9714 CNAG_06027 aryl-alcohol dehydrogenase 2.2637 3.6385 7.5813 1.0747 CNAG_07802 class III aminotransferase 9.6913 3.6090 18.5303 1.8726 CNAG_03637 damaged DNA binding 1.0924 3.6090 3.7124 1.0530 CNAG_05070 sulfite reductase (NADPH) beta- 0.1371 3.6029 2.1312 0.2297 component CNAG_01316 replication factor A2 0.8638 3.5894 3.2602 0.9425 CNAG_05112 hypothetical protein CNAG_05112 0.4429 3.5851 2.2601 0.6966 CNAG_00545 cohesin loading factor subunit 0.8387 3.5677 2.8195 1.0525 SCC2 CNAG_01725 hypothetical protein CNAG_01725 1.3797 3.5508 3.4188 1.4187 CNAG_03659 DNA replication regulator DPB11 1.0853 3.5462 3.5118 1.0864 CNAG_03101 efflux protein EncT 1.6672 3.5374 3.6643 1.5939 CNAG_06573 hypothetical protein CNAG_06573 1.0165 3.5223 3.0312 1.1708 CNAG_02715 alpha-1,6-mannosyltransferase 1.0651 3.5169 3.1462 1.1792 CNAG_03206 endonuclease III 0.2266 3.5026 1.8853 0.4172 CNAG_07361 hypothetical protein CNAG_07361 0.2198 3.4908 1.7173 0.4427 CNAG_04504 hypothetical protein CNAG_04504 1.0617 3.4884 4.0938 0.8968 CNAG_02586 sugar transporter 2.1526 3.4834 5.4154 1.3726 CNAG_05578 hypothetical protein CNAG_05578 0.2144 3.4806 2.0508 0.3604 CNAG_02317 arginine N-methyltransferase 3 0.2618 3.4700 2.3441 0.3838 CNAG_03167 CAMK CAMKL Chk1 kinase 1.3448 3.4664 4.7795 0.9669 CNAG_02043 hypothetical protein CNAG_02043 1.5448 3.4589 2.8451 1.8617 CNAG_00536 hypothetical protein CNAG_00536 0.2392 3.4409 2.1986 0.3705 CNAG_04631 ribitol kinase 0.6044 3.4203 2.6164 0.7832 CNAG_01163 DNA repair and recombination 1.2403 3.4198 3.9817 1.0558 RAD54 CNAG_07691 hypothetical protein CNAG_07691 1.3562 3.4119 4.3537 1.0537 CNAG_07938 hypothetical protein CNAG_07938 0.7822 3.4114 2.4459 1.0821 CNAG_06593 rhamnogalacturonan lyase 1.6037 3.4108 4.6677 1.1616 CNAG_06311 cytoplasmic variant 1.3776 3.4072 2.9864 1.5571 CNAG_03461 hypothetical protein CNAG_03461 2.3096 3.3984 7.5388 1.0314 CNAG_01244 hypothetical protein CNAG_01244 2.3011 3.3939 4.8117 1.6057 CNAG_02062 glycoside hydrolase family 2 0.6433 3.3859 2.7783 0.7772 CNAG_04220 ATP-dependent DNA helicase II 1.0000 3.3779 3.3821 0.9893 subunit 1 CNAG_06743 mitochondrial genome 1.3631 3.3738 4.7181 0.9657 maintenance-related CNAG_01953 hypothetical protein CNAG_01953 1.3753 3.3692 2.9407 1.5600 CNAG_03927 hypothetical protein CNAG_03927 0.2701 3.3597 2.1486 0.4183 CNAG_00843 salicylate hydroxylase 1.1199 3.3587 3.7170 1.0027 thioesterase #N/A 1.0266 3.3581 2.6419 1.2938 family protein CNAG_04271 hypothetical protein CNAG_04271 0.7229 3.3262 2.3498 1.0137 CNAG_00869 ATP-binding cassette (ABC) 0.6234 3.2950 2.8852 0.7057 transporter CNAG_05449 hypothetical protein CNAG_05449 0.6234 3.2870 3.4197 0.5938 CNAG_05404 histone-lysine n-methyltransferase 0.4639 3.2856 1.5843 0.9540 CNAG_04471 FAD dependent oxidoreductase 1.3638 3.2750 4.3573 1.0151 superfamily CNAG_04675 hypothetical protein CNAG_04675 2.7412 3.2728 5.1688 1.7195 CNAG_08014 hypothetical protein CNAG_08014 0.8798 3.2540 3.2219 0.8797 CNAG_01527 hypothetical protein CNAG_01527 1.3096 3.2446 3.1393 1.3385 CNAG_03183 nuclear protein 0.1414 3.2333 1.1270 0.4022 CNAG_05881 alpha-1,2-mannosyltransferase 0.2668 3.2318 1.8961 0.4507 CNAG_02968 hypothetical protein CNAG_02968 1.6339 3.2226 3.8803 1.3439 CNAG_02204 endonuclease mitochondrial 0.2601 3.2206 2.0748 0.4001 CNAG_02540 hypothetical protein CNAG_02540 1.5713 3.2189 1.5000 3.3407 CNAG_06904 hypothetical protein CNAG_06904 1.3378 3.2100 2.0197 2.1067 CNAG_06558 NADPH-ferrihemo reductase 0.8052 3.2042 1.8194 1.4057 CNAG_07909 meiotic recombinase Dmc1 0.6827 3.2027 3.3818 0.6405 CNAG_01323 ubiquinol-cytochrome c reductase 0.2675 3.1955 1.9649 0.4308 subunit 7 CNAG_03544 hypothetical protein CNAG_03544 0.2016 3.1858 1.4702 0.4328 CNAG_05909 cytochrome heme mitochondrial 0.1198 3.1845 1.1843 0.3193 CNAG_03934 hypothetical protein CNAG_03934 #N/A 3.1733 5.9792 1.0171 CNAG_03910 D-xylose-proton symporter 1.1794 3.1501 3.8904 0.9468 CNAG_04546 multidrug transporter 2.2902 3.1438 6.1663 1.1552 CNAG_04759 hypothetical protein CNAG_04759 2.0337 3.1408 3.9425 1.6044 CNAG_03085 hypothetical protein CNAG_03085 2.0388 3.1236 2.6988 2.3339 CNAG_02549 hypothetical protein CNAG_02549 1.0044 3.1196 3.1576 0.9828 CNAG_05115 sarcosine oxidase 0.6317 3.1180 2.8213 0.6918 CNAG_01944 hypothetical protein CNAG_01944 0.5645 3.1179 1.6435 1.0617 CNAG_06642 Atypical PIKK FRAP kinase 0.6594 3.1169 1.8805 1.0833 CNAG_05016 hypothetical protein CNAG_05016 1.8153 3.1116 3.9953 1.4013 CNAG_02580 hypothetical protein CNAG_02580 0.4460 3.1087 2.5735 0.5340 CNAG_01802 Fe-S cluster assembly DRE2 0.4955 3.1037 2.4124 0.6319 CNAG_07188 hypothetical protein CNAG_07188 1.7241 3.1012 4.3511 1.2174 CNAG_05138 glucan 1,3-beta-glucosidase 1.4154 3.0969 3.9676 1.0949 CNAG_01545 hypothetical protein, variant 0.3032 3.0692 2.3531 0.3919 CNAG_03755 hypothetical protein CNAG_03755 0.2327 3.0617 1.9792 0.3568 CNAG_04599 3-methyl-2-oxobutanoate 0.2668 3.0610 1.7417 0.4648 hydroxymethyltransferase CNAG_02047 hypothetical protein CNAG_02047 1.6516 3.0504 4.8379 1.0328 CNAG_03166 hypothetical protein CNAG_03166 1.5775 3.0501 4.0136 1.1875 CNAG_04202 cytosolic Fe-S cluster assembly 0.1498 3.0430 1.6148 0.2798 factor NAR1 CNAG_04768 hypothetical protein CNAG_04768 0.3783 3.0361 1.7331 0.6571 CNAG_05267 NADH dehydrogenase (ubiquinone) 0.2106 3.0313 1.3374 0.4728 Fe-S 5 CNAG_02221 solute carrier family 39 (zinc 0.3018 3.0303 1.5250 0.5945 transporter) member 9 CNAG_05508 hypothetical protein CNAG_05508 1.1990 3.0272 3.7071 0.9701 CNAG_00022 cytochrome c heme-lyase 0.1537 3.0267 1.6626 0.2771 CNAG_02892 phosphatidylinositol class B 1.6291 3.0258 4.3771 1.1169 CNAG_03663 L-lactate dehydrogenase 0.1027 3.0248 1.3071 0.2355 CNAG_07869 hypothetical protein CNAG_07869 3.1796 3.0045 4.1094 2.2982 CNAG_02140 NADH dehydrogenase (ubiquinone) 0.2071 2.9993 1.6137 0.3814 1 alpha subcomplex 12 CNAG_04446 hypothetical protein CNAG_04446 0.6519 2.9970 3.1478 0.6150 CNAG_04681 hypothetical protein CNAG_04681 1.6375 2.9891 3.2451 1.4955 CNAG_00627 specific transcriptional repressor 1.9566 2.9732 4.3516 1.3250 CNAG_03695 hypothetical protein CNAG_03695 1.1432 2.9725 3.5011 0.9621 CNAG_05867 L-fucose transporter 0.9686 2.9658 2.2190 1.2817 CNAG_07314 hypothetical protein CNAG_07314 1.9358 2.9655 3.7544 1.5157 CNAG_04689 hypothetical protein CNAG_04689 0.4867 2.9597 3.3002 0.4326 CNAG_03386 solute carrier family 25 0.8484 2.9578 1.2239 2.0314 (mitochondrial carnitine acylcarnitine transporter) member 20 29 CNAG_00328 single-stranded DNA specific 0.5219 2.9569 1.6040 0.9539 endodeoxyribonuclease CNAG_04975 hypothetical protein CNAG_04975 0.8001 2.9554 1.5559 1.5047 CNAG_03830 hypothetical protein CNAG_03830 1.4546 2.9542 4.8467 0.8799 CNAG_03781 hypothetical protein CNAG_03781 0.9139 2.9462 2.6157 1.0202 CNAG_04725 hypothetical protein CNAG_04725 0.8557 2.9445 2.3980 1.0417 CNAG_02826 amino-acid mitochondrial 0.8414 2.9388 1.9929 1.2293 CNAG_07911 streptomycin biosynthesis 0.1861 2.9282 2.5791 0.2092 CNAG_05660 hypothetical protein CNAG_05660 1.0011 2.9272 2.7254 1.0656 CNAG_03767 cohesin complex subunit psm1 0.7659 2.9269 2.1751 1.0217 CNAG_04392 sterol-binding protein 1.3321 2.9236 2.9920 1.2894 CNAG_00269 sorbitol dehydrogenase 1.6756 2.9230 4.1368 1.1695 CNAG_00276 hypothetical protein CNAG_00276 1.8349 2.9178 4.2088 1.2599 CNAG_00498 cell division cycle 14 1.5134 2.9173 3.7111 1.1797 CNAG_05501 hypothetical protein, variant 1.7063 2.9142 5.4053 0.9102 CNAG_01167 chromosome associated 0.9181 2.9088 2.4330 1.0881 CNAG_02039 integral to membrane 1.8350 2.9083 2.1956 2.4090 CNAG_03966 hypothetical protein CNAG_03966 0.2822 2.9071 1.6373 0.4968 CNAG_02203 karyopherin importin that interacts 0.2084 2.9044 1.1258 0.5331 with the nuclear pore complex CNAG_07572 elongator complex 3 0.2724 2.9011 1.7641 0.4441 CNAG_00144 hypothetical protein CNAG_00144 2.1671 2.9006 3.0929 2.0099 CNAG_03154 hypothetical protein CNAG_03154 0.5514 2.8994 2.2211 0.7132 CNAG_00321 dRaptor 1.4951 2.8911 3.6066 1.1876 CNAG_02490 meiotic DNA double-strand break 1.0656 2.8809 2.7460 1.1083 processing-related CNAG_00653 hypothetical protein CNAG_00653 1.8192 2.8730 3.6378 1.4227 CNAG_00306 hypothetical protein CNAG_00306 0.6975 2.8661 2.3460 0.8444 CNAG_05612 hypothetical protein CNAG_05612 1.3072 2.8578 3.8212 0.9686 CNAG_07388 hypothetical protein CNAG_07388 5.2372 2.8550 9.6367 1.5293 CNAG_00176 glutamate carboxypeptidase 0.2556 2.8516 0.9773 0.7391 CNAG_07386 GTP binding and negative regulator 0.9990 2.8478 2.4985 1.1282 of the Ran Tc4 GTPase cycle Gtr1p CNAG_04735 extracellular elastinolytic metallo 1.8824 2.8452 3.6613 1.4500 ase CNAG_03666 acyl- dehydrogenase 0.0559 2.8344 1.1617 0.1351 CNAG_07512 hypothetical protein CNAG_07512 2.9008 2.8269 6.2138 1.3076 CNAG_06715 hypothetical protein CNAG_06715 1.3573 2.8219 3.5630 1.0630 CNAG_00754 ATP-binding sub-family member 1 0.1325 2.8209 1.3826 0.2680 CNAG_00299 DNA repair RAD5 0.7534 2.8207 2.1946 0.9596 CNAG_02596 hypothetical protein CNAG_02596 1.7575 2.8180 4.4462 1.1025 CNAG_00933 hypothetical protein CNAG_00933 2.0104 2.8165 3.9880 1.4061 CNAG_03436 alanine transaminase 0.3312 2.8147 0.8980 1.0288 CNAG_04201 hypothetical protein CNAG_04201 1.5426 2.8077 2.4128 1.7763 CNAG_04713 citrate lyase subunit beta 0.4783 2.7975 1.6954 0.7821 CNAG_03543 hypothetical protein CNAG_03543 0.4328 2.7958 1.8492 0.6488 CNAG_01601 lipase 1.5767 2.7852 3.2517 1.3379 CNAG_00425 hypothetical protein CNAG_00425 1.0752 2.7803 1.6324 1.8152 CNAG_05300 mitochondrial carrier 0.9014 2.7797 2.1362 1.1617 CNAG_01952 aryl-alcohol dehydrogenase 1.4529 2.7782 3.4265 1.1673 CNAG_05318 L-mandelate dehydrogenase 0.4106 2.7764 1.8402 0.6139 CNAG_05514 hypothetical protein CNAG_05514 3.1842 2.7757 5.9178 1.4741 CNAG_02343 hypothetical protein CNAG_02343 1.1079 2.7625 3.1769 0.9548 CNAG_06517 C2 domain 1.1392 2.7604 2.2178 1.4050 CNAG_02448 hypothetical protein CNAG_02448 1.9306 2.7530 4.1440 1.2672 CNAG_05820 aromatic-amino-acid transaminase 1.0214 2.7483 1.2394 2.2446 CNAG_02738 hypothetical protein CNAG_02738 0.3642 2.7448 2.0184 0.4906 CNAG_07698 hypothetical protein CNAG_07698 0.7343 2.7439 2.5261 0.7883 CNAG_07943 hypothetical protein CNAG_07943 1.3016 2.7424 3.4218 1.0334 CNAG_07782 oxidoreductase 0.6774 2.7369 2.1346 0.8606 CNAG_00799 cellulase 0.6842 2.7356 1.9211 0.9658 CNAG_01577 glutamate dehydrogenase (NADP+) 0.2713 2.7300 1.3297 0.5516 CNAG_06901 UDP-N-acetylglucosamine-dolichyl- 0.9241 2.7269 2.7154 0.9186 phosphate N- acetylglucosaminephosphotransfera se CNAG_05861 hypothetical protein CNAG_05861 1.5259 2.7200 2.8266 1.4551 CNAG_05602 1-pyrroline-5-carboxylate 0.7468 2.7183 1.4946 1.3462 dehydrogenase CNAG_01983 cAMP-independent regulatory 0.9418 2.7129 1.9444 1.3026 CNAG_05755 Glutathione S-transferase 6 0.2959 2.7118 2.1372 0.3718 CNAG_03476 spermidine synthase 0.4871 2.7102 1.1625 1.1255 CNAG_04717 hypothetical protein CNAG_04717 2.1974 2.7072 3.9596 1.4879 CNAG_04472 membrane protein 1.6272 2.7016 3.8689 1.1247 CNAG_02305 hypothetical protein CNAG_02305 0.5974 2.6990 1.9390 0.8242 CNAG_01836 long-chain acyl- synthetase 2.1370 2.6951 3.6870 1.5463 CNAG_07933 hypothetical protein CNAG_07933 1.1662 2.6944 3.1844 0.9809 CNAG_04595 hypothetical protein CNAG_04595 0.3845 2.6929 1.2803 0.8013 CNAG_04648 sister chromatid cohesion PDS5 0.8396 2.6856 1.9391 1.1530 CNAG_02299 hypothetical protein CNAG_02299 1.6895 2.6760 4.5228 0.9900 CNAG_02318 hypothetical protein CNAG_02318 0.6220 2.6598 1.5968 1.0270 CNAG_06897 hypothetical protein CNAG_06897 0.9111 2.6541 1.9750 1.2122 CNAG_06554 FAD dependent oxidoreductase 1.7399 2.6331 3.1433 1.4446 superfamily ser/Thr #N/A 1.5119 2.6260 4.1579 0.9457 protein phosphatase family protein CNAG_05379 regucalcin 0.4518 2.6246 1.3920 0.8441 CNAG_05365 ribose-phosphate 0.3560 2.6216 1.8178 0.5089 pyrophosphokinase CNAG_07758 hypothetical protein CNAG_07758 1.0422 2.6209 2.7472 0.9852 CNAG_04476 hypothetical protein CNAG_04476 1.6461 2.6209 3.6506 1.1723 CNAG_01721 porphobilinogen deaminase 0.1471 2.6174 1.7145 0.2225 CNAG_06008 asparaginase 0.8288 2.6154 1.6902 1.2708 CNAG_03838 MFS transporter 2.0260 2.6114 2.4170 2.1686 CNAG_05907 pyruvate carboxylase 0.3490 2.6063 1.1800 0.7641 CNAG_00883 transcription factor 0.7683 2.5963 1.9164 1.0309 CNAG_03411 hypothetical protein CNAG_03411 1.1271 2.5927 3.1231 0.9272 CNAG_01856 hypothetical protein CNAG_01856 1.9225 2.5925 4.7012 1.0488 CNAG_06777 fructosyl amino acid oxidase 1.1304 2.5879 1.9360 1.4974 CNAG_00936 lipid particle 0.8533 2.5847 2.0804 1.0506 CNAG_00329 NADH dehydrogenase (ubiquinone) 0.1970 2.5818 1.0596 0.4755 1 beta subcomplex 8 CNAG_05250 telomere maintenance 0.7582 2.5704 1.6961 1.1390 CNAG_07912 hypothetical protein CNAG_07912 0.5634 2.5671 1.9551 0.7317 CNAG_06815 hypothetical protein CNAG_06815 1.2924 2.5577 3.0996 1.0551 CNAG_05821 hypothetical protein CNAG_05821 1.4610 2.5523 2.8246 1.3070 CNAG_06147 hypothetical protein CNAG_06147 0.1879 2.5512 0.9642 0.4926 CNAG_02660 hypothetical protein CNAG_02660 2.9868 2.5508 5.1733 1.4570 CNAG_04871 hypothetical protein CNAG_04871 0.8179 2.5504 1.9785 1.0441 CNAG_04576 hypothetical protein CNAG_04576 1.4558 2.5446 2.7313 1.3438 CNAG_00972 hypothetical protein CNAG_00972 0.1529 2.5430 1.6032 0.2402 CNAG_02600 tartrate transporter 0.6428 2.5401 2.3144 0.6988 CNAG_04612 hypothetical protein CNAG_04612 0.1397 2.5379 0.8436 0.4165 CNAG_04968 hypothetical protein CNAG_04968 0.3182 2.5374 1.6290 0.4913 CNAG_03772 glucose transporter 1.9956 2.5354 3.8951 1.2866 CNAG_04153 hypothetical protein CNAG_04153 1.6491 2.5347 4.5019 0.9202 CNAG_00791 hypothetical protein CNAG_00791 1.0925 2.5295 2.0578 1.3314 CNAG_06403 hypothetical protein CNAG_06403 0.6671 2.5276 1.8491 0.9041 CNAG_06009 cyclohydrolase 2.2775 2.5224 2.7819 2.0453 CNAG_03939 5-aminolevulinic acid synthase 0.1860 2.5214 1.0995 0.4226 CNAG_03578 hypothetical protein CNAG_03578 0.3985 2.5134 2.3182 0.4272 CNAG_03252 hypothetical protein CNAG_03252 #N/A 2.5124 4.4345 1.4392 CNAG_05329 myo-inositol 2-dehydrogenase 3.3141 2.5081 6.7949 1.2125 CNAG_04307 urate oxidase 3.1247 2.4885 4.4225 1.7404 CNAG_01936 sugar transporter 1.8612 2.4881 2.2745 2.0143 CNAG_00877 adenylate kinase 0.3404 2.4873 1.2519 0.6702 nucleoside- #N/A 1.6774 2.4823 2.8667 1.4373 diphosphate- sugar epimerase family protein CNAG_05002 hypothetical protein CNAG_05002 2.1364 2.4774 3.8336 1.3677 CNAG_01681 cytosine permease 0.6044 2.4748 1.6110 0.9201 CNAG_02315 ubiquinol-cytochrome c iron-sulfur 0.2213 2.4742 1.3029 0.4163 subunit CNAG_06529 hypothetical protein CNAG_06529 1.2838 2.4727 2.3803 1.3212 CNAG_00830 hypothetical protein CNAG_00830 0.4338 2.4717 1.1080 0.9589 CNAG_03504 hypothetical protein CNAG_03504 1.3405 2.4670 2.9717 1.1042 CNAG_06486 hypothetical protein CNAG_06486 0.9573 2.4643 2.4392 0.9587 CNAG_02311 hypothetical protein CNAG_02311 1.1500 2.4522 2.1222 1.3157 CNAG_00800 nicotinamidase 0.1186 2.4449 1.3763 0.2084 CNAG_06079 proliferating cell nuclear antigen 0.6213 2.4436 1.7831 0.8439 (pcna) CNAG_05244 hypothetical protein CNAG_05244 1.4748 2.4435 2.0117 1.7744 CNAG_01960 efflux protein EncT 2.9376 2.4429 4.5461 1.5631 CNAG_03445 hypothetical protein CNAG_03445 1.4204 2.4406 2.6812 1.2822 CNAG_05803 exo-beta-1,3-glucanase 1.0573 2.4346 2.7089 0.9418 CNAG_06372 hypothetical protein CNAG_06372 2.8474 2.4304 5.5415 1.2368 CNAG_01603 hypothetical protein CNAG_01603 2.6826 2.4268 3.8009 1.6966 CNAG_01443 hypothetical protein CNAG_01443 0.1457 2.4207 1.1925 0.2930 CNAG_03764 integral to membrane 1.6559 2.4198 4.8303 0.8203 CNAG_00389 mitochondrial protein 0.2521 2.4177 1.1671 0.5176 CNAG_02598 chitinase 0.6844 2.4155 2.4209 0.6760 CNAG_06751 hypothetical protein CNAG_06751 0.9909 2.4065 2.0879 1.1315 CNAG_01994 hypothetical protein CNAG_01994 3.3231 2.4039 4.8819 1.6175 CNAG_03713 efflux variant 1.8730 2.4035 3.0506 1.4589 CNAG_02935 malonic semialdehyde reductase 0.5898 2.4035 1.5649 0.8972 CNAG_07685 UMF1 family MFS transporter 0.3721 2.4027 1.6634 0.5327 CNAG_04796 serine threonine- phosphatase 2B 0.2895 2.3980 1.1539 0.5963 catalytic subunit A1 CNAG_01078 Aldehyde dehydrogenase (ALDDH) 1.5127 2.3937 2.9968 1.1969 CNAG_00798 hypothetical protein CNAG_00798 1.9816 2.3918 3.1398 1.4925 CNAG_01223 hypothetical protein CNAG_01223 2.1785 2.3907 4.5027 1.1457 CNAG_06136 hypothetical protein CNAG_06136 0.9577 2.3861 1.1972 1.8920 CNAG_02319 hypothetical protein CNAG_02319 1.0712 2.3855 2.8619 0.8852 CNAG_03369 Wee kinase 0.7776 2.3849 2.3182 0.7934 CNAG_01237 hypothetical protein CNAG_01237 0.3589 2.3832 1.2862 0.6590 CNAG_04908 hypothetical protein CNAG_04908 0.8441 2.3786 1.6969 1.1723 CNAG_05144 carbonic anhydrase 0.1677 2.3779 0.8485 0.4660 CNAG_01635 hypothetical protein CNAG_01635 0.7197 2.3739 1.8650 0.9083 CNAG_04846 membrane protein 0.4715 2.3728 1.8370 0.6038 CNAG_07625 plasma membrane 0.3487 2.3719 1.7128 0.4791 CNAG_02508 hypothetical protein CNAG_02508 2.4720 2.3659 1.1930 4.8476 CNAG_05595 hypothetical protein CNAG_05595 0.8536 2.3602 3.4120 0.5853 CNAG_05523 hypothetical protein CNAG_05523 1.6299 2.3536 3.7346 1.0178 CNAG_01424 myosin heavy chain (Zipper ) 1.2889 2.3534 2.3935 1.2563 (Myosin II) (Non-muscle MHC) CNAG_05818 chitin synthase 1.4452 2.3531 2.7024 1.2469 CNAG_03076 hypothetical protein CNAG_03076 1.4407 2.3495 2.3852 1.4061 CNAG_02759 hypothetical protein CNAG_02759 2.3310 2.3466 4.2200 1.2842 phytanoyl- #N/A 0.7423 2.3418 1.3204 1.3043 CoA dioxygenase family protein_2 CNAG_00911 phytanoyl- dioxygenase 1.1580 2.3407 2.8039 0.9574 CNAG_05997 hypothetical protein CNAG_05997 0.2762 2.3394 1.4119 0.4535 CNAG_00768 hypothetical protein CNAG_00768 1.3468 2.3375 2.9317 1.0642 CNAG_06932 sugar transporter 1.1259 2.3325 6.1672 0.4218 CNAG_05299 oxidoreductase 1.8532 2.3323 3.2307 1.3231 CNAG_03304 hypothetical protein CNAG_03304 0.5565 2.3283 1.8495 0.6941 CNAG_02990 nuclear protein 0.6356 2.3219 1.2909 1.1327 CNAG_02436 hypothetical protein CNAG_02436 1.1359 2.3216 2.3239 1.1245 CNAG_04891 hypothetical protein CNAG_04891 1.9268 2.3163 8.0109 0.5528 CNAG_00780 hypothetical protein CNAG_00780 0.8830 2.3161 1.7956 1.1289 CNAG_07751 siderophore iron transporter 3.6321 2.3151 8.3477 0.9988 CNAG_02360 hypothetical protein CNAG_02360 1.3423 2.3120 3.2207 0.9551 CNAG_05685 neutral amino acid transporter 0.9898 2.3116 2.2386 1.0129 CNAG_00155 hypothetical protein CNAG_00155 #N/A 2.3077 #N/A 1.8780 CNAG_02758 NADH:flavin oxidoreductase NADH 1.5184 2.3062 3.9857 0.8707 oxidase CNAG_05197 NADH dehydrogenase (ubiquinone) 0.2947 2.3055 1.3542 0.4970 1 alpha subcomplex 8 CNAG_01592 #NAME? 1.4063 2.2974 4.3273 0.7390 CNAG_04302 ER to Golgi transport-related 1.2686 2.2945 2.7044 1.0668 CNAG_01533 rho GTPase activator 0.6921 2.2889 1.5253 1.0294 CNAG_04885 phytanoyl- dioxygenase 0.7170 2.2883 2.0104 0.8075 CNAG_04982 cytosine-purine permease 1.0236 2.2851 2.2460 1.0316 CNAG_04221 6-phosphofructo-2-kinase fructose- 0.3459 2.2840 1.0950 0.7150 2,6-bisphosphatase CNAG_01883 hypothetical protein CNAG_01883 2.3162 2.2838 3.2225 1.6239 CNAG_07936 hypothetical protein CNAG_07936 1.1571 2.2824 2.3643 1.1081 CNAG_00749 alternative sulfate transporter 0.5309 2.2806 2.8373 0.4227 CNAG_03057 hypothetical protein CNAG_03057 1.3569 2.2766 2.9659 1.0324 CNAG_00476 hypothetical protein CNAG_00476 1.2742 2.2734 4.8749 0.5877 CNAG_06329 high-affinity nicotinic acid 1.2431 2.2732 2.6386 1.0623 transporter CNAG_01772 hypothetical protein CNAG_01772 0.2031 2.2587 1.5159 0.3000 CNAG_04773 hypothetical protein CNAG_04773 2.1438 2.2580 3.5920 1.3348 CNAG_04736 hypothetical protein CNAG_04736 1.1080 2.2554 2.8184 0.8788 CNAG_01077 hypothetical protein CNAG_01077 2.0400 2.2493 3.2705 1.3893 CNAG_00997 hypothetical protein CNAG_00997 0.2260 2.2480 1.3650 0.3685 CNAG_05302 amine oxidase 2.3183 2.2479 2.8630 1.8031 CNAG_02125 hypothetical protein CNAG_02125 1.8497 2.2450 2.5748 1.5970 CNAG_03444 hypothetical protein CNAG_03444 1.4564 2.2440 3.0459 1.0632 CNAG_01596 hypothetical protein CNAG_01596 0.1907 2.2422 1.1488 0.3688 CNAG_03589 adrenodoxin-type ferredoxin 0.5372 2.2385 2.2234 0.5357 CNAG_00492 hypothetical protein CNAG_00492 1.7214 2.2294 3.0864 1.2311 CNAG_04474 monocarboxylic acid transporter 1.8164 2.2258 4.1769 0.9589 CNAG_07687 hypothetical protein CNAG_07687 1.5349 2.2253 2.3460 1.4427 CNAG_06414 cytochrome c oxidase-assembly 0.6386 2.2244 1.9840 0.7092 factor mitochondrial CNAG_03160 DNA cross-link repair 1A 1.5487 2.2244 2.7799 1.2279 CNAG_07858 hypothetical protein CNAG_07858 #N/A 2.2233 #N/A 1.9217 CNAG_01963 CMP dCMP deaminase zinc- 1.7562 2.2210 3.9011 0.9912 binding CNAG_02834 UDP-glucose:sterol 1.8057 2.2201 3.0039 1.3234 glucosyltransferase CNAG_02532 D-amino-acid oxidase 1.1357 2.2148 2.0728 1.2019 CNAG_05880 hypothetical protein CNAG_05880 0.3406 2.2097 1.5450 0.4826 CNAG_02418 asparagine-tRNA ligase 0.7120 2.2041 0.5902 2.6362 CNAG_02564 tRNA-splicing endonuclease 0.3674 2.2023 1.6995 0.4718 subunit Sen54 CNAG_02131 iron-sulfur cluster assembly 0.3165 2.2005 1.5811 0.4362 CNAG_03664 high-affinity nickel-transporter 1.1056 2.1937 2.4502 0.9813 CNAG_07356 succinate cytochrome b556 subunit 0.1641 2.1933 1.1275 0.3163 CNAG_01023 nuclear cohesin complex 0.9363 2.1867 1.8755 1.0826 CNAG_01964 OPT family small oligopeptide 0.9079 2.1854 1.9987 0.9840 transporter CNAG_07672 hypothetical protein CNAG_07672 0.6357 2.1845 2.3239 0.5921 CNAG_04073 hypothetical protein CNAG_04073 0.3141 2.1844 1.3088 0.5198 CNAG_00904 aflatoxin efflux pump AFLT 0.6062 2.1741 1.6321 0.8000 CNAG_02409 hypothetical protein CNAG_02409 1.2280 2.1711 2.4040 1.0982 CNAG_07423 hypothetical protein CNAG_07423 1.3166 2.1686 2.9067 0.9730 CNAG_01993 hypothetical protein CNAG_01993 1.4200 2.1674 2.1622 1.4097 CNAG_02537 hypothetical protein CNAG_02537 #N/A 2.1632 #N/A 2.1483 CNAG_00827 ribose 5-phosphate isomerase 2.7506 2.1614 4.8941 1.2037 CNAG_00887 hypothetical protein CNAG_00887 2.0730 2.1600 2.3353 1.8950 CNAG_07547 hypothetical protein CNAG_07547 1.9705 2.1532 1.5857 2.6506 CNAG_00908 hypothetical protein CNAG_00908 2.4596 2.1518 2.2495 2.3280 CNAG_05425 asparagine synthase (glutamine- 0.6188 2.1488 0.8161 1.6144 hydrolyzing) CNAG_00836 2-hydroxyacid dehydrogenase 1.2047 2.1470 2.5696 0.9969 CNAG_00751 hypothetical protein CNAG_00751 0.8523 2.1457 1.4231 1.2717 CNAG_05527 senataxin 0.8541 2.1429 1.7458 1.0401 CNAG_02420 hypothetical protein CNAG_02420 1.9554 2.1417 4.4089 0.9387 CNAG_00716 cytochrome c 0.2159 2.1379 1.9578 0.2335 CNAG_03044 hypothetical protein CNAG_03044 0.5596 2.1373 1.6591 0.7139 CNAG_03464 laccase precursor 1.6865 2.1197 3.1558 1.1224 CNAG_05179 ubiquinol-cytochrome c reductase 0.1674 2.1182 0.9486 0.3705 core subunit 2 CNAG_06827 hypothetical protein CNAG_06827 2.6699 2.1163 4.0542 1.3810 CNAG_07701 hypothetical protein CNAG_07701 0.5156 2.1141 1.7022 0.6342 CNAG_02872 hypothetical protein CNAG_02872 #N/A 2.1110 #N/A 1.8372 CNAG_04457 hypothetical protein CNAG_04457 4.5031 2.1087 6.7359 1.3965 CNAG_05184 glycosyl transferase family 8 2.6837 2.1079 2.9196 1.9208 CNAG_04077 hypothetical protein CNAG_04077 2.0419 2.1073 3.3661 1.2657 CNAG_02602 flavonol synthase 1.5249 2.1036 2.4061 1.3223 CNAG_04898 MFS transporter 2.1138 2.1016 2.7065 1.6252 CNAG_03669 hypothetical protein CNAG_03669 1.0466 2.0996 1.5485 1.4066 CNAG_06723 succinate dehydrogenase 0.1395 2.0979 1.5056 0.1926 (ubiquinone) membrane anchor subunit CNAG_07443 hypothetical protein CNAG_07443 2.4300 2.0961 3.5914 1.4031 CNAG_04154 hypothetical protein CNAG_04154 3.1421 2.0931 5.2522 1.2386 CNAG_05420 RNA polymerase II transcription 0.8468 2.0925 1.1434 1.5354 factor CNAG_03179 hypothetical protein CNAG_03179 0.9023 2.0892 1.3669 1.3666 CNAG_05429 hypothetical protein CNAG_05429 0.9981 2.0862 1.9056 1.0821 CNAG_04310 hypothetical protein CNAG_04310 0.7952 2.0862 0.5396 3.0473 CNAG_04053 hypothetical protein CNAG_04053 1.5270 2.0829 3.6956 0.8521 CNAG_07823 solute carrier family 35 (UDP- 2.4068 2.0796 2.5159 1.9712 galactose transporter) member B1 CNAG_06186 DUF895 domain membrane 0.8143 2.0783 1.6942 0.9905 CNAG_07432 hypothetical protein CNAG_07432 1.3798 2.0780 1.9691 1.4423 CNAG_03918 hypothetical protein CNAG_03918 1.2177 2.0730 2.1098 1.1859 CNAG_00662 carboxymethylenebutenolidase 1.1647 2.0712 2.4574 0.9726 CNAG_02466 hypothetical protein CNAG_02466 0.7260 2.0698 1.4501 1.0269 CNAG_06617 hypothetical protein CNAG_06617 0.3268 2.0691 1.3683 0.4898 CNAG_01121 hypothetical protein CNAG_01121 3.1948 2.0691 3.8117 1.7161 CNAG_04616 hypothetical protein CNAG_04616 2.1919 2.0675 3.9552 1.1354 CNAG_06405 hypothetical protein CNAG_06405 0.9262 2.0652 1.9621 0.9663 CNAG_03195 hypothetical protein CNAG_03195 1.6901 2.0617 2.7938 1.2358 CNAG_06122 glycerol-1-phosphatase 0.5350 2.0604 1.5526 0.7036 CNAG_06193 CMGC RCK kinase 0.7083 2.0594 1.0679 1.3542 CNAG_01143 hypothetical protein CNAG_01143 1.2608 2.0592 3.0123 0.8541 CNAG_03216 CAMK kinase 0.3813 2.0583 1.1257 0.6910 CNAG_03498 variant 1 1.4529 2.0575 3.3853 0.8750 CNAG_03548 hypothetical protein CNAG_03548 1.5826 2.0539 2.2226 1.4474 CNAG_06913 L-serine ammonia-lyase 2.6756 2.0528 3.3455 1.6255 CNAG_04921 hypothetical protein CNAG_04921 0.7645 2.0517 1.1324 1.3706 CNAG_06138 NADH dehydrogenase (ubiquinone) 0.2215 2.0515 1.0108 0.4452 Fe-S 6 CNAG_07757 hypothetical protein CNAG_07757 1.2959 2.0514 1.9921 1.3228 CNAG_06728 kinesin 0.8348 2.0501 1.7259 0.9830 CNAG_03021 hypothetical protein CNAG_03021 1.5408 2.0488 2.5418 1.2305 CNAG_06758 efflux protein 1.4368 2.0479 4.9754 0.5860 CNAG_06144 E167 tumor 0.7378 2.0452 2.2555 0.6626 CNAG_02405 hypothetical protein CNAG_02405 0.9553 2.0415 2.1347 0.9050 CNAG_04535 tartrate dehydrogenase 0.6444 2.0403 0.7972 1.6337 CNAG_03560 hypothetical protein CNAG_03560 1.2643 2.0393 1.9777 1.2924 CNAG_06082 delayed-type hypersensitivity 0.0879 2.0372 0.3407 0.5205 antigen - related CNAG_02091 nucleosome assembly I 1.0271 2.0352 1.9469 1.0640 CNAG_03061 multiple drug resistance 0.7867 2.0341 1.3604 1.1657 CNAG_06239 hypothetical protein CNAG_06239 1.3914 2.0279 2.7005 1.0351 CNAG_03902 transcriptional regulatory 0.1933 2.0242 0.8410 0.4608 CNAG_05345 amino acid transporter 1.7347 2.0232 2.3391 1.4864 CNAG_06973 hypothetical protein CNAG_06973 2.4426 2.0221 3.0091 1.6267 CNAG_02478 glycerol dehydrogenase 1.1566 2.0196 1.9400 1.1924 CNAG_07548 cytoplasmic protein 0.5911 2.0174 1.4838 0.7964 CNAG_02011 PQQ enzyme repeat 1.1614 2.0162 2.6852 0.8638 CNAG_01538 ER to Golgi transport-related 2.1816 2.0092 2.6806 1.6202 CNAG_06209 hypothetical protein CNAG_06209 1.3007 2.0090 2.2572 1.1428 Table S3. Transcripts down-regulated in the grx4 mutant under both low iron and high iron conditions
Name Description WT-L vs grx4-L vs grx4-H vs grx4-L vs WT-H WT-L WT-H grx4-H CNAG_04865 mannitol dehydrogenase 2.3378 0.0012 0.0061 #N/A CNAG_04516 WSC domain-containing 0.2151 0.0018 0.0005 #N/A CNAG_07765 hypothetical protein CNAG_07765 2.2086 0.0198 0.0465 0.9363 CNAG_04864 iron regulator 1 0.8074 0.0216 0.0141 1.2282 CNAG_00052 hypothetical protein CNAG_00052 2.1283 0.0280 0.0576 1.0272 CNAG_00091 hypothetical protein CNAG_00091 2.8662 0.0327 0.0831 1.1184 CNAG_00834 phosphatidylserine decarboxylase 0.8413 0.0440 0.0674 0.5455 CNAG_00539 membrane transporter 2.0220 0.0440 0.1557 0.5663 CNAG_01052 hypothetical protein CNAG_01052 1.6285 0.0453 0.0907 0.8069 CNAG_04331 hypothetical protein CNAG_04331 4.9963 0.0556 0.2871 0.9635 CNAG_00848 LEA domain 3.4996 0.0579 0.2118 0.9504 CNAG_03495 hypothetical protein CNAG_03495 2.8037 0.0664 0.0983 1.8776 CNAG_00984 glucose and ribitol dehydrogenase 4.1195 0.0668 0.1621 1.6856 CNAG_03408 hypothetical protein CNAG_03408 1.0273 0.0723 0.0661 1.1169 CNAG_04105 LEA domain 1.9537 0.0738 0.1456 0.9815 CNAG_07939 hypothetical protein CNAG_07939 1.2954 0.0746 0.1442 0.6653 CNAG_01047 hypothetical protein CNAG_01047 2.4926 0.0763 0.1735 1.0873 CNAG_03873 hypothetical protein CNAG_03873 0.8951 0.0782 0.0707 0.9825 CNAG_02706 hypothetical protein CNAG_02706 2.4810 0.0810 0.1218 1.6427 CNAG_03238 dioxygenase subfamily 4.3098 0.0837 0.3068 1.1632 CNAG_02070 hypothetical protein CNAG_02070 0.7150 0.0846 0.0971 0.6192 CNAG_06267 rds1 stress response related 4.1767 0.0862 0.2456 1.4534 CNAG_04903 hypothetical protein CNAG_04903 1.8331 0.0892 0.2448 0.6637 CNAG_02701 hypothetical protein CNAG_02701 0.3122 0.0903 0.0838 0.3340 CNAG_05683 hypothetical protein CNAG_05683 1.1910 0.0911 0.1057 1.0188 CNAG_07022 hypothetical protein CNAG_07022 1.1955 0.1009 0.0666 #N/A CNAG_02815 glycerol-3-phosphate 1.0482 0.1010 0.1535 0.6856 dehydrogenase CNAG_04386 hypothetical protein CNAG_04386 1.7837 0.1034 0.1472 1.2441 CNAG_02950 Grx4 family monothiol glutaredoxin 1.7155 0.1055 0.1482 1.2097 CNAG_04106 hypothetical protein CNAG_04106 1.3367 0.1097 0.1468 0.9929 CNAG_00093 hypothetical protein CNAG_00093 1.1080 0.1097 0.1215 0.9935 CNAG_03143 12 kda heat shock (glucose and 1.8815 0.1113 0.2100 0.9889 lipid-regulated ) CNAG_02129 hypothetical protein CNAG_02129 1.1631 0.1114 0.1284 1.0028 CNAG_01031 hypothetical protein CNAG_01031 0.9825 0.1138 0.1055 1.0535 CNAG_04459 hypothetical protein CNAG_04459 6.1634 0.1161 1.6393 0.4331 CNAG_06169 (R,R)-butanediol dehydrogenase 4.1819 0.1170 0.4036 1.2025 CNAG_07319 hypothetical protein CNAG_07319 1.0706 0.1180 0.1037 1.2086 CNAG_06109 hypothetical protein CNAG_06109 1.1879 0.1219 0.1225 1.1747 CNAG_07868 hypothetical protein CNAG_07868 0.8955 0.1255 0.1334 0.8353 CNAG_03058 hypothetical protein CNAG_03058 1.1584 0.1259 0.1463 0.9890 CNAG_05607 cellulase like glycosyl hydrolase 1.3610 0.1265 0.1017 1.6787 CNAG_00254 NADH dehydrogenase 1.0013 0.1287 0.1916 0.6671 CNAG_07775 hypothetical protein CNAG_07775 2.5426 0.1400 0.1458 2.4239 CNAG_06668 mitochondrial protein 0.7803 0.1429 0.1483 0.7468 CNAG_02263 hypothetical protein CNAG_02263 0.9985 0.1439 0.1775 0.8036 CNAG_01102 oxidoreductase 1.6339 0.1453 0.1752 1.3461 CNAG_04076 hypothetical protein CNAG_04076 1.5231 0.1483 0.1987 1.1271 CNAG_02577 inositolphosphorylceramide-B C-26 2.9597 0.1495 0.4559 0.9622 hydroxylase (IPC-B hydroxylase) CNAG_04938 hypothetical protein CNAG_04938 1.4161 0.1495 0.1817 1.1554 CNAG_03728 hypothetical protein CNAG_03728 1.1395 0.1504 0.1750 0.9737 CNAG_05939 hypothetical protein CNAG_05939 3.3722 0.1509 0.3127 1.6138 CNAG_03771 DNA binding Ncp1 0.8748 0.1566 0.1366 0.9959 CNAG_04016 hypothetical protein CNAG_04016 2.6622 0.1586 0.4336 0.9651 CNAG_04163 hypothetical protein CNAG_04163 1.0064 0.1592 0.1059 1.5035 CNAG_00522 C2 domain-containing 1.1432 0.1598 0.1297 1.3989 CNAG_04744 mannose-6-phosphate class I 2.5720 0.1627 0.3214 1.2927 CNAG_00107 hypothetical protein CNAG_00107 0.8252 0.1629 0.0990 1.3483 CNAG_02398 hypothetical protein CNAG_02398 1.4785 0.1676 0.2676 0.9197 CNAG_03040 transketolase 1.6713 0.1683 0.1808 1.5440 CNAG_06800 hypothetical protein CNAG_06800 1.7926 0.1705 0.2467 1.2290 CNAG_03492 hypothetical protein CNAG_03492 0.8326 0.1707 0.2199 0.6424 CNAG_01737 methylsterol monooxygenase 2.1911 0.1713 0.3510 1.0601 CNAG_02942 hypothetical protein CNAG_02942 2.8633 0.1716 0.5307 0.9191 CNAG_04794 spermine transporter 1.7661 0.1729 0.4296 0.7043 CNAG_01742 water channel 3.1172 0.1744 0.2959 1.8221 CNAG_03142 hypothetical protein CNAG_03142 1.3421 0.1745 0.2240 1.0382 CNAG_01803 hypothetical protein CNAG_01803 1.5724 0.1763 0.2230 1.2315 CNAG_06201 hypothetical protein CNAG_06201 1.3280 0.1764 0.2035 1.1419 CNAG_00995 meiotic recombination-related 0.9858 0.1787 0.1307 1.3388 CNAG_03563 aspartate-tRNA(Asn) ligase 1.8624 0.1811 0.2676 1.2512 CNAG_07316 alcohol dehydrogenase 1.6287 0.1831 0.1538 1.9207 CNAG_02335 hypothetical protein CNAG_02335 0.8022 0.1833 0.2035 0.7177 CNAG_01849 hypothetical protein CNAG_01849 1.0895 0.1844 0.2913 0.6833 CNAG_07516 hypothetical protein CNAG_07516 1.0844 0.1845 0.4832 #N/A CNAG_02877 hypothetical protein CNAG_02877 1.2714 0.1854 0.1760 1.3309 CNAG_03002 hypothetical protein CNAG_03002 0.5756 0.1863 0.1573 0.6772 CNAG_00047 pyruvate dehydrogenase kinase 2.0296 0.1893 0.3291 1.1565 CNAG_02230 phosphoketolase 1.9657 0.1897 0.3449 1.0727 CNAG_01341 mannose-6-phosphate isomerase 1.7856 0.1902 0.3398 0.9905 CNAG_02705 hypothetical protein CNAG_02705 1.3159 0.1924 0.2292 1.0963 CNAG_04517 hypothetical protein CNAG_04517 0.3973 0.1937 0.0506 1.5082 CNAG_05356 guanine nucleotide-binding subunit 2.2390 0.1943 1.4962 0.2880 gamma CNAG_04067 haloacid type II 3.0147 0.1961 0.4267 1.3737 CNAG_06220 allergen 1.4286 0.1967 0.1990 1.4018 CNAG_06207 hypothetical protein CNAG_06207 0.4475 0.1969 0.1900 0.4597 CNAG_04275 metalloendopeptidase 1.1320 0.1981 0.2741 0.8114 CNAG_05608 hypothetical protein CNAG_05608 1.8067 0.1982 0.3575 0.9926 CNAG_02751 short-chain dehydrogenase 0.9993 0.2003 0.2938 0.6759 CNAG_02069 hypothetical protein CNAG_02069 0.8617 0.2015 0.2013 0.8561 CNAG_01446 hypothetical protein CNAG_01446 1.5861 0.2029 0.3271 0.9754 CNAG_03794 endoplasmic reticulum 1.6319 0.2033 0.2707 1.2166 CNAG_06843 hypothetical protein CNAG_06843 2.9592 0.2041 0.4990 1.1981 CNAG_06286 hypothetical protein CNAG_06286 2.4469 0.2105 0.5107 1.0000 CNAG_05167 hypothetical protein CNAG_05167 1.1540 0.2121 0.2368 1.0248 CNAG_06577 hypothetical protein CNAG_06577 2.3181 0.2139 0.3572 1.3765 CNAG_05031 3-oxoacid -transferase 0.9592 0.2183 0.6530 0.3179 CNAG_01368 hypothetical protein CNAG_01368 0.3057 0.2186 0.0963 0.6888 CNAG_03564 hypothetical protein CNAG_03564 1.0351 0.2201 0.2131 1.0627 CNAG_03881 hypothetical protein CNAG_03881 1.1866 0.2265 0.2017 1.3230 CNAG_06121 hypothetical protein CNAG_06121 1.4581 0.2265 0.2527 1.2954 CNAG_02768 hypothetical protein CNAG_02768 2.9661 0.2269 0.3152 2.1149 CNAG_01558 chlorophyll synthesis pathway 0.7142 0.2295 0.1888 0.8620 CNAG_03566 hypothetical protein CNAG_03566 1.0800 0.2320 0.1948 1.2770 CNAG_00732 hypothetical protein CNAG_00732 0.7341 0.2320 0.2120 0.7979 CNAG_01042 hypothetical protein CNAG_01042 1.8158 0.2333 0.4477 0.9369 CNAG_00519 lathosterol oxidase 2.1758 0.2356 0.3907 1.3001 CNAG_01585 hypothetical protein CNAG_01585 1.2572 0.2364 0.3828 0.7701 CNAG_07826 hypothetical protein CNAG_07826 2.4687 0.2375 0.2513 2.3189 CNAG_01736 DASH complex subunit DAD4 2.3721 0.2382 0.4747 1.1789 CNAG_02591 hypothetical protein CNAG_02591 3.5979 0.2383 0.6090 1.3950 CNAG_00057 fructose-1,6-bisphosphatase I 0.7989 0.2396 0.2459 0.7728 CNAG_07391 hypothetical protein CNAG_07391 2.0465 0.2402 0.6044 0.8043 CNAG_06999 hypothetical protein CNAG_06999 1.7421 0.2417 0.2450 1.7038 CNAG_01751 hypothetical protein CNAG_01751 1.3069 0.2429 0.2643 1.1911 CNAG_03113 trehalose synthase 2.1895 0.2474 0.2054 2.6156 CNAG_06302 pathogenesis associated pep2 2.4992 0.2501 0.5042 1.2278 CNAG_00854 C-8 sterol isomerase 2.4636 0.2523 0.5729 1.0753 CNAG_07522 hypothetical protein CNAG_07522 1.1624 0.2525 0.2342 1.2438 CNAG_04160 hypothetical protein CNAG_04160 1.4898 0.2530 0.3566 1.0492 CNAG_02550 hypothetical protein CNAG_02550 0.9561 0.2585 0.2381 1.0300 CNAG_04015 amino acid transporter 1.3494 0.2594 0.3357 1.0341 CNAG_06791 hypothetical protein CNAG_06791 1.5869 0.2595 0.3566 1.1446 CNAG_03937 hypothetical protein CNAG_03937 1.4551 0.2603 0.3607 1.0413 CNAG_03824 solute carrier family 25 1.1861 0.2607 0.3061 1.0013 (mitochondrial phosphate transporter) member 3 CNAG_01584 hydrolase 0.9448 0.2613 0.2588 0.9464 CNAG_05994 multidrug transporter 1.0369 0.2664 0.2797 0.9801 CNAG_06075 hypothetical protein CNAG_06075 0.6434 0.2671 0.1868 0.9129 CNAG_04804 hypothetical protein CNAG_04804 2.4498 0.2676 0.3970 1.6370 CNAG_00813 hypothetical protein CNAG_00813 0.5327 0.2695 0.1147 1.2405 CNAG_06381 membrane Rsn1p 1.2938 0.2718 0.4572 0.7634 CNAG_03738 pantetheine-phosphate 1.3890 0.2775 0.4642 0.8234 adenylyltransferase CNAG_04043 hypothetical protein CNAG_04043 1.0179 0.2778 0.3193 0.8786 CNAG_04926 hypothetical protein CNAG_04926 1.2604 0.2787 0.3330 1.0452 CNAG_00851 hypothetical protein CNAG_00851 1.5914 0.2821 0.3650 1.2196 CNAG_04687 stearoyl- desaturase (delta-9 1.1376 0.2853 0.2980 1.0796 desaturase) CNAG_06957 hypothetical protein CNAG_06953 2.4992 0.2903 0.7395 0.9688 CNAG_04070 exonuclease 1.3928 0.2959 0.3090 1.3249 CNAG_05309 hypothetical protein CNAG_05309 1.0177 0.2963 0.3230 0.9264 CNAG_07629 endopolyphosphatase 1.2638 0.2969 0.4421 0.8421 CNAG_04746 hypothetical protein CNAG_04746 0.9726 0.2979 0.2843 1.0112 CNAG_04351 methylmalonate-semialdehyde 2.1022 0.2983 0.4752 1.3081 dehydrogenase (acylating) NAD binding #N/A 2.0060 0.2986 0.5807 1.0202 dehydrogenas e family protein_2 CNAG_05458 endo-1,3(4)-beta-glucanase 2.0026 0.3006 1.0883 0.5489 CNAG_03572 opsin 1 1.7297 0.3015 0.3820 1.3549 CNAG_03595 hypothetical protein CNAG_03595 0.9263 0.3025 0.3793 0.7329 CNAG_02685 hypothetical protein CNAG_02685 2.5878 0.3041 0.6467 1.2066 CNAG_06238 glutathione S-transferase 4.0132 0.3053 0.8378 1.4507 CNAG_01847 hypothetical protein CNAG_01847 1.8274 0.3056 0.3594 1.5418 CNAG_06064 hypothetical protein CNAG_06064 0.9989 0.3065 0.3184 0.9536 CNAG_04523 glyceraldehyde-3-phosphate type I 3.2360 0.3068 0.5287 1.8591 CNAG_06771 hypothetical protein CNAG_06771 1.4561 0.3078 0.4345 1.0235 CNAG_06375 hypothetical protein CNAG_06375 1.8535 0.3086 0.4318 1.3112 CNAG_02896 hydroxymethylglutaryl- synthase 1.3842 0.3094 0.3574 1.1875 CNAG_00465 hypothetical protein CNAG_00465 1.9908 0.3094 0.4066 1.5017 CNAG_00638 GTPase 1.6436 0.3098 0.4532 1.1152 CNAG_00301 hypothetical protein CNAG_00301 1.5869 0.3146 0.7351 0.6732 CNAG_03617 clampless 1 2.6457 0.3160 0.3923 2.1199 CNAG_00485 hypothetical protein CNAG_00485 1.7653 0.3163 0.5492 1.0087 CNAG_06658 rhomboid family membrane 2.3684 0.3165 0.9958 0.7461 CNAG_00850 glycosyl hydrolase family 88 1.1164 0.3170 0.2134 1.6435 CNAG_07338 N-acyl-phosphatidylethanolamine- 1.2868 0.3180 0.3751 1.0820 hydrolyzing phospholipase D CNAG_02943 cytoplasmic variant 1.2381 0.3181 0.3242 1.2061 CNAG_00873 hypothetical protein CNAG_00873 2.9195 0.3195 0.8054 1.1487 CNAG_06065 inositol polyphosphate-5- 1.2710 0.3217 0.3202 1.2669 phosphatase F CNAG_05940 hypothetical protein CNAG_05940 0.8428 0.3220 0.2875 0.9370 CNAG_01924 hypothetical protein CNAG_01924 1.1503 0.3224 0.3021 1.2174 CNAG_04548 hypothetical protein CNAG_04548 1.5975 0.3259 0.4494 1.1492 CNAG_03083 cupin domain-containing 1.6098 0.3262 0.3842 1.3552 CNAG_03007 hypothetical protein CNAG_03007 2.3395 0.3262 0.9566 0.7899 CNAG_07026 hypothetical protein CNAG_07026 3.4343 0.3266 0.5650 1.9644 CNAG_07728 solute carrier family 39 (zinc 1.9733 0.3297 0.5963 1.0811 transporter) member 1 2 3 CNAG_02347 hypothetical protein CNAG_02347 2.0095 0.3307 0.5254 1.2530 CNAG_06256 hypothetical protein CNAG_06256 1.0238 0.3315 0.3168 #N/A CNAG_04789 hypothetical protein CNAG_04789 1.4519 0.3332 0.4013 1.1948 CNAG_03282 hypothetical protein CNAG_03282 1.5479 0.3337 0.4882 1.0483 CNAG_04274 acyl- thioesterase II 2.3821 0.3339 0.5151 1.5288 CNAG_07493 hypothetical protein CNAG_07493 0.5601 0.3342 0.1816 1.0213 CNAG_03679 hypothetical protein CNAG_03679 2.2443 0.3343 0.5666 1.3124 CNAG_06139 hypothetical protein CNAG_06139 1.1882 0.3348 0.2553 1.5447 CNAG_03082 cupin domain-containing 1.9044 0.3354 0.5652 1.1202 CNAG_06590 hypothetical protein CNAG_06590 1.8645 0.3356 0.4650 1.3334 CNAG_00766 hypothetical protein CNAG_00766 2.3093 0.3361 0.4563 1.6866 CNAG_01942 hypothetical protein CNAG_01942 1.3721 0.3370 0.6169 0.7427 CNAG_01007 C2 domain-containing 1.0319 0.3378 0.4067 0.8498 CNAG_04361 hypothetical protein CNAG_04361 1.1243 0.3385 0.2857 1.3224 CNAG_05095 pod-specific dehydrogenase SAC25 1.1501 0.3391 0.3256 1.1883 CNAG_04208 Machado-Joseph disease 1 (Ataxin- 0.9124 0.3402 0.3283 0.9383 3) CNAG_05331 hypothetical protein CNAG_05331 0.5962 0.3419 0.1433 #N/A CNAG_03215 hypothetical protein CNAG_03215 1.6502 0.3422 0.5369 1.0460 CNAG_03807 E3 ubiquitin- ligase CCNP1IP1 1.7916 0.3429 0.5577 1.0919 CNAG_04288 Fe-S assembly co-chaperone 1.7808 0.3433 0.5974 1.0146 CNAG_06576 allergen 2.3866 0.3439 0.4912 1.6585 CNAG_07790 hypothetical protein CNAG_06523 1.1993 0.3440 0.5466 0.7500 CNAG_07317 hypothetical protein CNAG_07317 1.0086 0.3445 0.3232 1.0662 CNAG_05388 formamidopyrimidine-DNA 1.5788 0.3461 0.4107 1.3194 glycosylase CNAG_00079 hypothetical protein CNAG_00079 0.6660 0.3465 0.1963 1.1651 CNAG_00075 hypothetical protein CNAG_00075 1.1182 0.3479 0.3515 1.0969 CNAG_06694 hydroxyisourate hydrolase 1.9869 0.3481 0.4368 1.5685 CNAG_03243 2-nitropropane dioxygenase 2.0730 0.3508 0.5134 1.4024 CNAG_03292 hypothetical protein CNAG_03292 1.8880 0.3513 0.5168 1.2731 CNAG_01874 glutathione S-transferase 0.9963 0.3523 0.3523 0.9871 CNAG_07788 hypothetical protein CNAG_07788 1.8288 0.3526 0.4220 1.5118 CNAG_03875 galactose-1-phosphate 1.0790 0.3529 0.4691 0.8051 uridylyltransferase CNAG_02053 hypothetical protein CNAG_02053 1.8502 0.3533 0.4548 1.4225 CNAG_05739 hypothetical protein CNAG_05739 2.4824 0.3544 0.4319 2.0181 CNAG_00921 glutathione transferase 1.4248 0.3545 0.3270 1.5318 CNAG_03141 hypothetical protein CNAG_03141 1.3701 0.3555 0.2948 1.6318 CNAG_04833 hypothetical protein CNAG_04833 1.1823 0.3565 0.3183 1.3135 CNAG_04443 hypothetical protein CNAG_04443 1.4983 0.3567 0.4318 1.2278 CNAG_06955 hypothetical protein CNAG_06955 1.6377 0.3584 0.5946 #N/A CNAG_06245 hypothetical protein CNAG_06245 2.0339 0.3593 0.2767 2.6166 CNAG_05644 2-nitropropane dioxygenase 2.0216 0.3602 0.5893 1.2245 NAD #N/A 0.5838 0.3618 0.2573 0.8149 dependent epimerase/deh ydratase family protein_1 CNAG_05682 hypothetical protein CNAG_05682 1.1826 0.3621 0.4431 0.9583 CNAG_07492 hypothetical protein CNAG_07492 0.6737 0.3627 0.1987 1.2212 CNAG_00686 hypothetical protein CNAG_00686 0.9061 0.3632 0.3371 0.9688 CNAG_05022 endoribonuclease l-psp 2.2762 0.3633 0.5326 1.5371 CNAG_07164 hypothetical protein CNAG_07164 1.1481 0.3633 0.3949 1.0474 CNAG_03454 pria precursor 0.8549 0.3645 0.2726 1.1348 CNAG_05767 regulation of carbohydrate 1.8626 0.3658 0.6117 1.1044 metabolism-related CNAG_02255 BNR Asp-box repeat family 1.1863 0.3673 0.3090 1.3972 CNAG_00524 acetyl- acyltransferase 2 1.7125 0.3677 0.4083 1.5282 CNAG_00074 integral to plasma membrane 1.0334 0.3686 0.4693 0.8051 CNAG_02667 hypothetical protein CNAG_02667 1.9272 0.3704 0.6906 1.0245 CNAG_04090 bZip transcription factor 0.8448 0.3704 0.3459 0.8975 CNAG_07745 mannitol-1-phosphate 0.7489 0.3712 0.2317 1.1899 dehydrogenase CNAG_06761 siderophore-iron transporter Str1 2.2918 0.3742 0.8881 0.9575 CNAG_05871 hypothetical protein CNAG_05871 1.2060 0.3776 0.3855 1.1708 CNAG_04322 hypothetical protein CNAG_04322 1.1495 0.3778 0.4673 0.9224 CNAG_03759 conidiation-specific 6 2.6551 0.3779 0.5920 1.6816 CNAG_00961 hypothetical protein CNAG_00961 1.7736 0.3780 0.6311 1.0539 CNAG_06453 benzodiazapine receptor 1.3674 0.3788 0.4469 1.1504 CNAG_06884 hypothetical protein CNAG_06884 1.0107 0.3791 0.3170 1.1993 CNAG_04781 hypothetical protein, variant 2 3.3370 0.3815 1.0394 1.2118 CNAG_01369 hypothetical protein CNAG_01369 1.5449 0.3846 0.4604 1.2788 CNAG_06050 UDP-glucose 4-epimerase 2.5283 0.3847 0.9339 1.0314 CNAG_06413 hypothetical protein CNAG_06413 1.0482 0.3864 0.4326 0.9273 CNAG_03213 UV damage endonuclease 1.4552 0.3884 0.4538 1.2352 CNAG_05686 hypothetical protein CNAG_05686 1.4507 0.3887 0.4550 1.2274 CNAG_06074 cytoplasmic variant 2.2658 0.3898 0.5324 1.6445 CNAG_03398 solute carrier family 39 (zinc 1.7668 0.3902 0.7000 0.9751 transporter) member 1 2 3 CNAG_02864 hypothetical protein CNAG_02864 1.8733 0.3906 1.2239 0.5930 CNAG_03268 hypothetical protein CNAG_03268 1.4509 0.3909 0.4245 1.3252 CNAG_06431 acyl- oxidase 1.7186 0.3923 0.4055 1.6484 CNAG_04737 hypothetical protein CNAG_04737 1.5443 0.3936 0.5181 1.1643 CNAG_07955 hypothetical protein CNAG_07955 1.2231 0.3937 0.4182 1.1408 CNAG_00729 hypothetical protein CNAG_00729 1.9702 0.3946 #N/A #N/A CNAG_02182 D-lactaldehyde dehydrogenase 2.4198 0.3949 0.7848 1.2067 CNAG_03828 aromatic amino acid 1.4008 0.3953 0.3383 1.6215 aminotransferase I CNAG_00521 hypothetical protein CNAG_00521 1.4571 0.3974 0.3591 1.5988 CNAG_03685 hypothetical protein CNAG_03685 1.2557 0.3976 0.5756 0.8602 CNAG_04587 hypothetical protein CNAG_04587 0.5939 0.3980 0.2192 1.0704 CNAG_07851 isocitrate NAD-dependent 1.1259 0.3989 0.5567 0.7994 CNAG_02006 N-terminal asparagine 1.4262 0.3999 0.4999 1.1310 amidohydrolase CNAG_06602 cysteine-type peptidase 2.3697 0.4001 0.6334 1.4849 CNAG_07557 ATP-binding cassette transporter 0.6189 0.4008 0.3563 0.6904 CNAG_02926 hypothetical protein CNAG_02926 1.2763 0.4008 0.7035 0.7207 CNAG_01787 hypothetical protein CNAG_01787 2.2937 0.4008 0.7806 1.1661 CNAG_02584 serine threonine- phosphatase 2A 1.7228 0.4020 0.6740 1.0186 activator 1 CNAG_00866 transketolase 1.4688 0.4021 0.6775 0.8645 CNAG_01386 phosphatidylinositol class P 1.6121 0.4038 0.5814 1.1096 CNAG_02348 hypothetical protein CNAG_02348 1.0497 0.4039 0.6670 0.6300 CNAG_04970 hypothetical protein CNAG_04970 1.1318 0.4049 0.3977 1.1425 CNAG_03705 hypothetical protein CNAG_03705 1.1651 0.4057 0.3858 1.2154 CNAG_02655 hypothetical protein CNAG_02655 1.0313 0.4059 0.3478 1.1938 CNAG_01155 glycerol kinase 0.5776 0.4066 0.2723 0.8559 CNAG_05732 hypothetical protein CNAG_05732 1.4863 0.4097 0.5588 1.0807 CNAG_03239 hypothetical protein CNAG_03239 1.3035 0.4108 0.6309 0.8410 CNAG_02753 endoplasmic reticulum 1.1912 0.4125 0.4263 1.1432 CNAG_01750 heat shock 0.3171 0.4129 0.1526 0.8518 CNAG_02297 hypothetical protein CNAG_02297 3.9608 0.4132 1.0661 1.5214 CNAG_03178 hypothetical protein CNAG_03178 1.0918 0.4134 0.4541 0.9858 CNAG_03905 cell growth-related 0.7933 0.4135 0.3942 0.8236 CNAG_00776 immunoreactive manno MP88 1.3821 0.4144 0.8155 0.6957 CNAG_06448 cystathionine gamma-lyase 2.3107 0.4149 0.7282 1.3075 CNAG_01946 allantoate permease 1.0797 0.4157 0.5954 0.7467 CNAG_07303 hypothetical protein CNAG_07303 1.1638 0.4159 0.5982 0.8027 CNAG_06922 lipid metabolism-related 1.3270 0.4160 0.6498 0.8426 CNAG_04112 oxidoreductase 1.1093 0.4163 0.3195 1.4329 CNAG_02427 hypothetical protein CNAG_02427 2.4850 0.4171 0.8781 1.1695 CNAG_04886 hypothetical protein CNAG_04886 1.3816 0.4192 0.5122 1.1215 CNAG_01043 hypothetical protein CNAG_01043 1.2465 0.4195 0.5222 0.9927 CNAG_07591 mitochondrial metalloendopeptidase 0.9989 0.4223 0.4764 0.8777 OMA1 CNAG_07639 lipase 2 1.4697 0.4231 0.6114 1.0084 CNAG_02211 hypothetical protein CNAG_02211 1.5256 0.4235 0.5055 1.2674 CNAG_04098 xenobiotic-transporting ATPase 1.5303 0.4235 0.4431 1.4498 CNAG_06616 hypothetical protein CNAG_06616 1.2280 0.4239 0.4042 1.2774 CNAG_05652 cytoplasmic protein 1.2213 0.4247 0.6479 0.7936 CNAG_00036 Sec14 cytosolic factor 1.0487 0.4255 0.4385 1.0095 CNAG_06993 hypothetical protein CNAG_06993 1.3473 0.4259 0.9859 0.5772 CNAG_00130 serine threonine- kinase 1.2146 0.4261 0.5059 1.0154 CNAG_04152 phosphatase methylesterase 1 1.0238 0.4263 0.3729 1.1600 CNAG_03509 pyruvate dehydrogenase x 0.8614 0.4268 0.4559 0.7991 mitochondrial precursor CNAG_07642 gag-pol poly 1.2670 0.4277 0.6306 0.8513 CNAG_04934 hypothetical protein CNAG_04934 1.4379 0.4294 0.6418 0.9536 CNAG_07940 hypothetical protein CNAG_07940 1.2142 0.4296 0.4895 1.0565 CNAG_00121 glycerol-3-phosphate 1.1738 0.4304 0.4561 1.0981 dehydrogenase (NAD(+)) CNAG_00480 hypothetical protein CNAG_00480 1.7041 0.4314 0.5932 1.2291 CNAG_01821 hypothetical protein CNAG_01821 1.2664 0.4317 0.6257 0.8662 CNAG_07954 hypothetical protein CNAG_07954 1.6751 0.4325 0.9205 0.7795 CNAG_05658 L-arabinitol 4-dehydrogenase 0.5006 0.4325 0.1792 1.1969 CNAG_01129 lanosterol synthase 1.6644 0.4326 0.5393 1.3235 CNAG_07586 hypothetical protein CNAG_07586 2.0193 0.4331 0.9790 0.8847 CNAG_02953 tuberin 1.3137 0.4339 0.5108 1.1068 CNAG_07004 dihydrolipoyl dehydrogenase 0.8103 0.4339 0.4116 0.8464 CNAG_02883 rho family 1.4979 0.4345 0.6206 1.0395 CNAG_04849 vacuolar protein 1.1027 0.4352 0.6052 0.7860 CNAG_06104 hypothetical protein CNAG_06104 0.8083 0.4353 0.5376 0.6484 CNAG_05333 hypothetical protein CNAG_05333 2.3980 0.4365 0.7771 1.3373 CNAG_07923 hypothetical protein CNAG_07923 4.5877 0.4367 #N/A #N/A CNAG_04879 glycogen debranching enzyme 1.6546 0.4371 0.5221 1.3745 lipase/esterase #N/A 2.8505 0.4377 0.5629 2.1968 family protein CNAG_05599 hypothetical protein CNAG_05599 1.4307 0.4379 0.4777 1.2980 CNAG_07641 monosaccharide transporter 1.1216 0.4388 0.9165 0.5321 CNAG_04091 hypothetical protein CNAG_04091 1.3145 0.4389 0.5871 0.9736 CNAG_05638 hypothetical protein CNAG_05638 0.6042 0.4393 0.2903 0.9061 CNAG_05864 hypothetical protein CNAG_05864 1.7331 0.4405 0.6386 1.1864 CNAG_06290 high-affinity glucose transporter 1.2274 0.4410 0.5287 1.0149 SNF3 CNAG_03565 plasma-membrane proton-efflux P- 1.7016 0.4414 0.8534 0.8736 type ATPase CNAG_02974 voltage-dependent anion channel 2 0.6347 0.4422 0.3062 0.9081 CNAG_06962 DNA ligase 3 -phosphoesterase 2.0199 0.4423 0.6570 1.3475 domain-containing CNAG_01492 hypothetical protein CNAG_01492 1.1507 0.4424 0.4464 1.1305 CNAG_05971 hypothetical protein CNAG_05971 2.1084 0.4430 0.7618 1.2154 CNAG_04084 hypothetical protein CNAG_04084 2.0620 0.4432 0.9203 0.9828 CNAG_04807 hypothetical protein CNAG_04807 1.2937 0.4448 0.5104 1.1181 CNAG_01299 hypothetical protein CNAG_01299 1.7079 0.4456 0.8159 0.9246 CNAG_02005 hypothetical protein CNAG_02005 0.7100 0.4470 0.2528 1.2442 CNAG_02814 glycerol-3-phosphate 0.7322 0.4472 0.3012 1.0786 dehydrogenase CNAG_07975 hypothetical protein CNAG_07975 1.9537 0.4474 0.8037 1.0774 CNAG_07574 hypothetical protein CNAG_07574 2.0347 0.4480 0.7213 1.2526 CNAG_06232 transcription factor C subunit 7 1.4748 0.4487 0.5275 1.2439 CNAG_04946 hypothetical protein CNAG_04946 1.3279 0.4497 0.4835 1.2241 CNAG_00424 choline-phosphate 0.7990 0.4509 0.3587 0.9962 cytidylyltransferase CNAG_01753 hypothetical protein CNAG_01753 1.2759 0.4509 0.4566 1.2495 CNAG_01933 hypothetical protein CNAG_01933 3.1290 0.4513 #N/A #N/A CNAG_03609 hypothetical protein CNAG_03609 1.1537 0.4519 0.3988 1.2962 CNAG_06396 hypothetical protein CNAG_06396 3.5147 0.4532 1.0400 1.5187 CNAG_03187 protoporphyrinogen oxidase 0.9159 0.4537 0.4516 0.9121 CNAG_05443 hypothetical protein CNAG_05443 1.0015 0.4545 0.5994 0.7529 CNAG_03883 hypothetical protein CNAG_03883 1.2492 0.4553 0.6214 0.9066 CNAG_07406 pheromone alpha 1.0603 0.4554 0.6136 0.7792 CNAG_06781 hypothetical protein CNAG_06781 1.1557 0.4554 0.5104 1.0216 CNAG_05677 phospholipase 1.4464 0.4571 0.8575 0.7637 CNAG_02830 delta24(24(1))-sterol reductase 1.8153 0.4589 0.9389 0.8795 CNAG_02041 hypothetical protein CNAG_02041 1.0495 0.4593 0.3913 1.2215 CNAG_03041 hypothetical protein CNAG_03041 1.7422 0.4607 0.6946 1.1450 CNAG_00863 flavin-containing monooxygenase 1.7406 0.4613 0.5458 1.4578 CNAG_03047 hypothetical protein CNAG_03047 1.3676 0.4614 0.8265 0.7558 CNAG_00941 hypothetical protein CNAG_00941 1.2738 0.4615 0.6310 0.9236 CNAG_03991 integral membrane 1.1866 0.4624 0.4094 1.3303 CNAG_04750 hypothetical protein CNAG_04750 1.1288 0.4646 0.4338 1.1982 CNAG_03946 galactokinase 1.2491 0.4647 0.5592 1.0296 CNAG_01588 plasma membrane proteolipid 3 1.3549 0.4652 0.7282 0.8577 CNAG_07043 hypothetical protein CNAG_07043 2.0967 0.4655 0.7481 1.2927 CNAG_05684 hypothetical protein CNAG_05684 1.0254 0.4674 0.5439 0.8745 CNAG_07363 isocitrate NAD-dependent 0.8461 0.4681 0.5007 0.7840 CNAG_05238 hypothetical protein CNAG_05238 1.3913 0.4691 0.5166 1.2526 CNAG_02857 response to drug-related 0.7405 0.4701 0.4681 0.7376 CNAG_07347 heat shock 0.1451 0.4716 0.1276 0.5323 CNAG_01984 transaldolase 0.9675 0.4728 0.4404 1.0298 CNAG_05168 hypothetical protein CNAG_05168 1.3815 0.4730 0.7656 0.8463 CNAG_00488 hypothetical protein CNAG_00488 2.3057 0.4732 0.9138 1.1827 CNAG_07927 hypothetical protein, variant 1.2731 0.4733 0.7234 0.8253 CNAG_07032 peroxiredoxin atypical 2-Cys 1.6166 0.4734 0.5815 1.3042 peroxiredoxin dihydrodipicoli #N/A 0.6658 0.4742 0.5253 0.5955 nate synthetase family protein_2 CNAG_07482 SCF-associated factor 1 1.7556 0.4752 0.5499 1.5040 CNAG_06497 microsomal epoxide hydrolase 1.8941 0.4753 0.5888 1.5170 CNAG_06764 short-chain dehydrogenase 1.7030 0.4771 0.6144 1.3108 CNAG_03631 hypothetical protein CNAG_03631 0.9618 0.4772 0.4495 1.0126 CNAG_05444 NADPH dehydrogenase 1.1945 0.4776 0.8838 0.6394 CNAG_05785 hypothetical protein CNAG_05785 2.0850 0.4783 0.8061 1.2243 CNAG_01745 glycerol-3-phosphate 0.7586 0.4790 0.3941 0.9151 dehydrogenase (NAD+) CNAG_04387 thioredoxin 4A 0.8817 0.4813 0.3359 1.2519 CNAG_01481 hypothetical protein CNAG_01481 2.3324 0.4821 0.6863 1.6244 CNAG_00164 hypothetical protein CNAG_00164 1.6773 0.4840 0.5840 1.3773 CNAG_04659 pyruvate decarboxylase 0.4479 0.4842 0.2333 0.9222 CNAG_06493 hypothetical protein CNAG_06493 2.1383 0.4844 0.7140 1.4381 CNAG_00125 hypothetical protein CNAG_00125 0.6982 0.4847 0.3401 0.9849 CNAG_01417 hypothetical protein CNAG_01417 1.6569 0.4858 0.4801 1.6621 CNAG_06244 hypothetical protein CNAG_06244 1.1903 0.4861 0.5299 1.0819 CNAG_06432 acetate kinase 1.2132 0.4884 0.5077 1.1574 CNAG_05396 LRP16 family 1.8476 0.4895 0.5416 1.6544 CNAG_00516 peroxisome targeting signal 1.2458 0.4899 0.4577 1.3209 receptor CNAG_07786 hypothetical protein CNAG_07786 1.1286 0.4907 0.3883 #N/A CNAG_05104 CAMK kinase 1.9801 0.4915 0.8214 1.1734 CNAG_05201 DNA mismatch repair MSH4 2.8643 0.4918 0.8658 1.6116 CNAG_02392 hypothetical protein CNAG_02392 1.6872 0.4920 0.6525 1.2607 CNAG_06594 oxysterol binding 1.0040 0.4929 0.5289 0.9276 CNAG_04958 ubiquitin fusion degradation 1 1.0635 0.4930 0.5071 1.0252 CNAG_03517 64 kDa mitochondrial NADH 1.8891 0.4931 0.6370 1.4507 dehydrogenase CNAG_01769 mitochondrial inner membrane 0.7747 0.4935 0.4727 0.8015 CNAG_02282 carboxypeptidase A4 1.1977 0.4940 0.5199 1.1284 CNAG_01691 hypothetical protein, variant 1.0308 0.4946 0.5045 1.0022 CNAG_03769 hexokinase 0.7405 0.4946 0.3894 0.9324 CNAG_04515 hypothetical protein CNAG_04515 1.2252 0.4950 0.5535 1.0859 CNAG_02552 variant 1 1.9671 0.4960 0.6116 1.5805 CNAG_06868 enolase 1 1.6315 0.4964 0.7707 1.0426 CNAG_01506 hypothetical protein CNAG_01506 2.9320 0.4974 1.8947 0.7625 CNAG_00050 hypothetical protein CNAG_00050 1.0642 0.4974 0.5220 1.0050 CNAG_06863 hypothetical protein CNAG_06863 2.1028 0.4983 0.5501 1.8850 CNAG_04248 ubiquitin thioesterase OTUB1 1.1832 0.4984 0.4206 1.3901 CNAG_03997 hypothetical protein CNAG_03997 1.5346 0.4988 0.9849 0.7700 CNAG_00919 carboxypeptidase D 0.9861 0.4989 0.5925 0.8227 CNAG_01014 hypothetical protein CNAG_01014 0.9009 0.4992 0.4841 0.9205 CNAG_06704 hypothetical protein CNAG_06704 0.8229 0.4992 0.4496 0.9053 Table S4. Primers used for strain generation Strains Primer name Sequence (5'-3') grx4 mutant 1-GRX4 GCGAGATGGGCACATCCTTTATGTGACC 2-GRX4 TGCTCCAGTGCATCCCATCGTGCAGGCC 3-GRX4 GGTTCGGCTCTGGCTAATGAACAGGAAACAGCTATGACCATG 4-GRX4 CATGGTCATAGCTGTTTCCTGTTCATTAGCCAGAGCCGAACC 5-GRX4 CACTGGCCGTCGTTTTACAACCGGGTCAGGTCGAAGATTACC 6-GRX4 GGTAATCTTCGACCTGACCCGGTTGTAAAACGACGGCCAGTG 7-GRX4 AGGACGTCACTCTCCGAGCTTAACAACC 8-GRX4 GAAGCGTGCGGGGGAGAGGTGAAAGACC 9-GRX4 TCACAATCACCACCACGCGCC 10-GRX4 TAGCGTGCGTTTTTCAGCGTC grx4 complementation SS-A GTTTCTACATCTCTTCCGTGTTAATACAGAGACCTGACCCGATGACGCTGAAAAACGCACG SS-B CCGCGACGTGGTTCGGCTCTGGCTAATGAATGGGCGCGTGGTGGTGATTGTGATGGGGAT SS-7 AGGACGTCACTCTCCGAGCTTAACAACC SS-C ATGGAATGCGTGAGATCG SS-1 GCGAGATGGGCACATCCTTTATGTGACC SS-D CTGCGAGGATGTGAGCTG SS-E CAGCTCACATCCTCGCAG Grx4-mCherry Grx3mCherry-P1F CGCCGACGCTTCCCTCCTTCACTCTCTC Grx3mCherry-P1R TGTTATCCTCCTCGCCCTTGCTCACCACCTCCGTCTTGCCCTCCTCGATAG Grx3mCherry-P2F CTATCGAGGAGGGCAAGACGGAGGTGGTGAGCAAGGGCGAGGAGGATAACA Grx3mCherry-P2R ACTCCTTTCCCGCTCCAAGGCGCTCGCCCAAGCTTGGTACCGAGCTCGGATC Grx3mCherry-P3F GATCCGAGCTCGGTACCAAGCTTGGGCGAGCGCCTTGGAGCGGGAAAGGAGT Grx3mCherry-P3R CTCAGTTACTCGCCAACCCCATCCA Cir1-GFP Cir1-GFP-P1F CCAATGTCCTTTCTCCTCCACGAC Cir1-GFP-P1R GTGAACAGCTCCTCGCCCTTGCTCACACTCCTAACGTCAAAACTCCACA Cir1-GFP-P2F TGTGGAGTTTTGACGTTAGGAGTGTGAGCAAGGGCGAGGAGCTGTTCAC Cir1-GFP-P3R AGTCTGTACCAACTTCCAACTCCACACGACGTTGTAAAACGACGGCCAG Cir1-GFP-P5F CTGGCCGTCGTTTTACAACGTCGTGTGGAGTTGGAAGTTGGTACAGACT Cir1-GFP-P5R TGATTGTCCGATTTTCGAACACTTCC
Table S5. Primers used for qPCR
Primers Sequence Fre3_F TCGGTGTCTGCGGTCCAT Fre3_R CCTCCCTGACACCCTTTCG LAC1_F CCCCGAGTCTTGGACGAAT LAC1_R GCGGGTCCAAATGCATTG Cir1_F GATCGCGAGCATCGTCCTT Cir1_R AACCGTTACCCATGCTGTTCTC TEF2_F CCTTCCTTGCCCTCTTCTCAT TEF2_R AGCGACGACAGGGACAATG Fig. S1
A
B Fig. S2
30oC 37oC DOPA
WT
Cir1-GFP
Grx4-mCherry Cir11-GFP Grx4-mCherry Fig. S3 A 1 2 3 2 kDa 1 B 245 135 100
63
48
35
20
1: protein ladder protein 1: 2: Grx4-mCherry Grx4-mCherry 2: 3: WT (H99)3: C Fig. S4
DIC Cir1-GFP DAPI Merge
WT LIM
LIM+ 10µMFeCl 3
LIM+ 100µMFeCl 3
LIM+ 10µMHeme
LIM+ 10µMHeme Fig. S5
Cellular respiration/electron Cellular transport/metal binding transport/metal (mitochondria functions) (mitochondria
oxidative phosphorylation oxidative
Homologus recombination Homologus Fig. S6
A B YNB Chloroquine Fig. S7 YPD - Fe + Fe - Fe + Fe+ Fe - Fe+ Fe - WT grx4-JL grx4-JK grx4 + GRX4 Phleomycin CoCl 2 - Fe + Fe - Fe + Fe+ Fe - Fe+ Fe -
SHAM Paraquat
- Fe + Fe - Fe + Fe+ Fe - Fe+ Fe -
MMS UV
- Fe + Fe - Fe + Fe+ Fe - Fe+ Fe -