DOCSLIB.ORG

Evolutionary Genetic Analysis of the Cytochrome B Gene Variation in the Salmo Trutta Fario with Other Salmons Abolhasan Rezaei A

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Evolutionary Genetic Analysis of the Cytochrome B Gene Variation in the Salmo Trutta Fario with Other Salmons Abolhasan Rezaei A Egypt. Acad. J. biolog. Sci., 3(1):65–71 (2011) C. Physiology & Molecular Biology Email: [email protected] ISSN: 2090-0767 Received: 11/12/2011 www.eajbs.eg.net Evolutionary Genetic Analysis of the cytochrome b gene variation in the Salmo trutta fario with other salmons Abolhasan Rezaei1 and Sheyda Akhshabi2 1-Department of Genetics-School of Basic Science, Islamic Azad University Tonekabon Branch,Iran. 2- Young Researchers Club, Tonekabon Branch, Islamic Azad University, Tonekabon, Iran. [email protected] ABSTRACT PCR amplification and direct sequencing of regions of the cytochrome b mitochondrial genes was carried out on Iranian populations of the salmo trutta fario species. Samples of salmo trutta fario were also examined and used as an out group in the phylogenetic analysis. Results based on 1192 bp indicated differentiation between fario morphs from Iran and other salmonids also Iran and other country had collected. Despite the large phenotypic differences within salmonids, very low genetic variation was found. On the basis of the cytochrome b sequences studied, Salmo carpio and Salmo fibreni, which have been described as good species, there were high homology between salmo trutta fario , salmo trutta and salmo trutta caspius (99%), but regards salmo salar the rate of homology 93%. Regards salmo trutta fario, in hatchery trout has not red colour strips time of hatchery in salmo trutta fario whereas has a bluish grey body colour, However, they are larger than Atlantic salmon, salmo trutta caspius and salmo trutta, more regular in shape, and less intensively pigmented, moreover there are red spots are always observed in populations, however, the shape and size of salmo trutta fario is different with salmo trutta caspius and salmo trutta but the among of homology were high (99%). The salmo trutta fario and salmo trutta caspius are living in the Rivers of North of Iran that connected to Caspian Sea; perhaps these species with themselves has been conjugated, and regards salmo salar is living in the Atlantic Ocean and other Sea and Rivers connected to it, that so far to salmo trutta fario populations in Iran. However we cannot report exactly that how much homology between sequences, because already there are not complete sequence in GeneBank regards salmo trutta caspius and salmo trutta fario. Keywords: Salmo trutta fario, DNA sequencing, cytochrome b. INTRODUCTION methods including RFLP-PCR There are different methods for techniques, SSCP-PCR techniques also identifying and authenticating for fish sequencing of DNA fragments (Carrera and fishery product, specially, DNA et al., 2000; Abercrombie et al., 2005; methods and molecular testing for Lee et al., 2004), approaches have been increasing products. (Gill, et al., 1997; successfully implemented to identify Rasmussen et al., 2008). In related to, partially degraded and otherwise there are wide range of approached of compromised products (Dalvin et al., varying technical sophistication and cost 2010). In general, mitochondrial DNA which exploit diagnostic polymorphism transmitted maternal traits, mtDNA within mitochondrial DNA and nuclear targeted methods have predominated in DNA genomics. Different molecular such studies, because of the general 66 Abolhasan Rezaei and Sheyda Akhshabi robustness and higher cellular copy were approximately 1 kg in size. Species number of mtDNA compared with used in this study salmo trutta fario.DNA nDNA.(Mackie et al., 1999).In this paper extracted from muscles samples was used we used PCR and direct sequencing to obtain sequence from the salmo trutta techniques to compare and analyzing fario. segments of cytochrome b DNA Cytochrome b gene. cytochrome b gene sequence variation in the salmo trutta sequences were amplified from salmo fario and observed among trutta fario. DNA was extracted from morphologically distinct salmo trutta tissue muscles according to the method fario, salmo trutt, salmo trutta caspius of Sambrook et al., (1998). The and salmo salar populations. Regards to concentration of DNA samples was cytochrome b, Bernatchez et al., (1992), determined with a DNA studied on the variation of it gene, also, spectrophotometer under wave length of they studied segments of the A260/280 nanometer.The PCR and mitochondrial control region, with this sequencing primers used based on results, we can discussed the congruence consensus sequences of salmonid in phylogenetic relationships among species. PCR amplifications were carried salmo trutta fario populations inferred out in 25 µl volumes containing 1X PCR from the analysis of coding and buffer, 6 ng/pL template DNA, 0.025 noncoding regions of the segments of units/pL Taq polymerase (Bethesda cytochrome b gene. Regarding genetic Research Laboratories), 200 uM each variations salmonids, were studied brown deoxynucleotide-triphosphate (dNTPs), trout that was found substantial genetic and approximately 25 pmol/µl of each differentiation, as revealed by protein amplification primer. Amplifications variation is found between native were carried out primarily in a Perkin Mediterranean and Atlantic populations Elmer 9600 thermal cycler. PCR (Kerieg & Guyomard 1985; Guyomard amplifications were performed with 35 1989; Persa et al.1994). Also, Largiader cycles. Denaturation, annealing and et al., (1996), had reported there are extension times were varied according to common phenotype of the fluviatile the thermal cycler used and the size of ecotype of brown trout, salmo trutta f. the expected amplification product. fario. According to local fisherman, the Primers (cytochrome b Forward and striped trout represent the native form in Reverse), designed to specifically the Doubs, whereas the fario phenotype amplify the cytochrome b gene, originates from introductions of hatchery including: Forward Primer 5' trout. In this research our aims to study GACTTGAAAAACCACCGTTG 3' and among of homology between salmo Reverse Primer 5' trutta fario, salmo trutta caspius salmo CTCCGATCTCCGGATTACAAGAC salar and salmo trutta by cytochrome b 3',were based on conserved sequences gene, also the rate of relationships from the promoter and terminator regions between salmo trutta fario and other identified by the alignment of salmonids for cytochrome b gene. cytochrome b sequence data from several salmonid species. These amplification MATERIALS AND METHODS products were compared to the Sample collections, DNA extraction amplification products from a genomic and gene amplification and sequence DNA template using 1.5 percent agarose analysis: gel electrophoresis. Animals: Salmo trutta fario were Sequencing: obtained from the Rivers of Tonekabon – For doing sequence we designed Iran, in the summer of 2011. All fish one side primer from end of the gene Evolutionary Genetic Analysis of the cytochrome b gene variation in the S. trutta fario 67 including, salmonid fishes (Thomas and GTTTTCCTAAATTTCCAATTGC. By Beckenbach, 1989; McKay et al., 1996). this primer amplified full length of The cytochrome b gene is part of sequence of cytochrome b gene in the mitochondrial DNA. However, salmo trutta fario. approximately, the complete sequence of Polymerase chain reaction (PCR; the cytochrome b gene (1191 nt) was Saiki et al., 1988) amplification was found to be identical between salmo performed on 200-500 ng of genornic trutta fario in Iran. Also observed among DNA template with either Ultratherm of variation between salmonids, (BioiCan Scientific) or Taq (Bethesda including, salmo trutta caspius , salmo Research Laboratories-BRL) DNA trutta and Salmo salar. Polymerase using the reagents and Variation in exon sequences of the instructions provided by the cytochrome b gene: The DNA sequence manufacturer. Typically, the thermal of cytochrome b gene from salmo trutta profile of a PCR consisted of 2-4 min. fario individuals was determined. To incubation at 94" C, followed by 30 avoid confusion about geographic origin, cycles of 30 s at 94°c, 30 s at 55°c, 60 s only wild strains from known sampling at 72°c, followed by a 4 min. incubation locations were analyzed. Comparison of at 72°c. PCR amplification products were variation within species revealed that the prepared for sequencing by purification higher degree of homozygosity with with DNA Clean-Up kits (Promega). salmonid group. Although no fixed Where necessary, multiple amplification differences were observed between salmo products were separated by trutta fario and salmo salar, because the electrophoresis in low-melting-point degree of variation more than other agarose using standard methods salmonids likes salmo trutta and salmo (Sambrook et al.1989). trutta caspius. However results are Amplification products were shown there were almost variation sequenced directly using either the between salmo salar, salmo trutta caspis Thenosequenase sequencing kits and salmo trutta. The sequence of the (Amersham United States Biochemicals). same region of the cytochrome b gene Sequencing, electrophoresis and was also obtained from salmo trutta autoradiography were performed fario, salmo trutta and salmo trutta according to the manufacturer's caspius similar variation was detected instructions. within this gene: the (T to C, C to A, T to Accessed in the GeneBank: G and A to G), repeat sequences in the The cytochrome b gene was full length of the sequences. There were sequenced and deposited in GeneBank by within sequences. The repeat single Accession number (JN995186.1). nucleotides, (A to G, C to A and etc.). In addition to variation in the number of RESULTS repeat units
Load more

Recommended publications
  • Identification and Modelling of a Representative Vulnerable Fish Species for Pesticide Risk Assessment in Europe
    Identification and Modelling of a Representative Vulnerable Fish Species for Pesticide Risk Assessment in Europe Von der Fakultät für Mathematik, Informatik und Naturwissenschaften der RWTH Aachen University zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften genehmigte Dissertation vorgelegt von Lara Ibrahim, M.Sc. aus Mazeraat Assaf, Libanon Berichter: Universitätsprofessor Dr. Andreas Schäffer Prof. Dr. Christoph Schäfers Tag der mündlichen Prüfung: 30. Juli 2015 Diese Dissertation ist auf den Internetseiten der Universitätsbibliothek online verfügbar Erklärung Ich versichere, dass ich diese Doktorarbeit selbständig und nur unter Verwendung der angegebenen Hilfsmittel angefertigt habe. Weiterhin versichere ich, die aus benutzten Quellen wörtlich oder inhaltlich entnommenen Stellen als solche kenntlich gemacht zu haben. Lara Ibrahim Aachen, am 18 März 2015 Zusammenfassung Die Zulassung von Pflanzenschutzmitteln in der Europäischen Gemeinschaft verlangt unter anderem eine Abschätzung des Risikos für Organismen in der Umwelt, die nicht Ziel der Anwendung sind. Unvertretbare Auswirkungen auf den Naturhalt sollen vermieden werden. Die ökologische Risikoanalyse stellt die dafür benötigten Informationen durch eine Abschätzung der Exposition der Organismen und der sich daraus ergebenden Effekte bereit. Die Effektabschätzung beruht dabei hauptsächlich auf standardisierten ökotoxikologischen Tests im Labor mit wenigen, oft nicht einheimischen Stellvertreterarten. In diesen Tests werden z. B. Effekte auf das Überleben, das Wachstum und/oder die Reproduktion von Fischen bei verschiedenen Konzentrationen der Testsubstanz gemessen und Endpunkte wie die LC50 (Lethal Concentrations for 50%) oder eine NOEC (No Observed Effect Concentration, z. B. für Wachstum oder Reproduktionsparameter) abgeleitet. Für Fische und Wirbeltiere im Allgemeinen beziehen sich die spezifischen Schutzziele auf das Überleben von Individuen und die Abundanz und Biomasse von Populationen.
    [Show full text]
  • ASFIS ISSCAAP Fish List February 2007 Sorted on Scientific Name
    ASFIS ISSCAAP Fish List Sorted on Scientific Name February 2007 Scientific name English Name French name Spanish Name Code Abalistes stellaris (Bloch & Schneider 1801) Starry triggerfish AJS Abbottina rivularis (Basilewsky 1855) Chinese false gudgeon ABB Ablabys binotatus (Peters 1855) Redskinfish ABW Ablennes hians (Valenciennes 1846) Flat needlefish Orphie plate Agujón sable BAF Aborichthys elongatus Hora 1921 ABE Abralia andamanika Goodrich 1898 BLK Abralia veranyi (Rüppell 1844) Verany's enope squid Encornet de Verany Enoploluria de Verany BLJ Abraliopsis pfefferi (Verany 1837) Pfeffer's enope squid Encornet de Pfeffer Enoploluria de Pfeffer BJF Abramis brama (Linnaeus 1758) Freshwater bream Brème d'eau douce Brema común FBM Abramis spp Freshwater breams nei Brèmes d'eau douce nca Bremas nep FBR Abramites eques (Steindachner 1878) ABQ Abudefduf luridus (Cuvier 1830) Canary damsel AUU Abudefduf saxatilis (Linnaeus 1758) Sergeant-major ABU Abyssobrotula galatheae Nielsen 1977 OAG Abyssocottus elochini Taliev 1955 AEZ Abythites lepidogenys (Smith & Radcliffe 1913) AHD Acanella spp Branched bamboo coral KQL Acanthacaris caeca (A. Milne Edwards 1881) Atlantic deep-sea lobster Langoustine arganelle Cigala de fondo NTK Acanthacaris tenuimana Bate 1888 Prickly deep-sea lobster Langoustine spinuleuse Cigala raspa NHI Acanthalburnus microlepis (De Filippi 1861) Blackbrow bleak AHL Acanthaphritis barbata (Okamura & Kishida 1963) NHT Acantharchus pomotis (Baird 1855) Mud sunfish AKP Acanthaxius caespitosa (Squires 1979) Deepwater mud lobster Langouste
    [Show full text]
  • TROTA FARIO Salmo (Trutta) Trutta R.T.I
    ASSESSORATO ALL’AGRICOLTURA, CACCIA E PESCA Direzione Agroambiente, Programmazione e Gestione Ittica e Faunistico-Venatoria CARTA ITTICA REGIONALE AI SENSI DELLA DDR N. 188 DEL 23 ottobre 2018 PRESENTAZIONE SULLO STATO DEI POPOLAMENTI SALMONICOLI DEL VENETO Marzo 2020 AQUAPROGRAM srl BIOPROGRAMM soc. Coop. Dr. THOMAS BUSATTO Vicenza Padova - Treviso Venezia www.aquaprogram.it www.bioprogramm.it mandante mandante capogruppo mandataria I SALMONIDI IN ITALIA FAMIGLIA NOMENCLATURA AIIAD (V. CORRENTE) NOME COMUNE ORIGINE Salmonidae Coregonus lavaretus (Linnaeus, 1758) Coregone o Lavarello Alloctona Salmonidae Coregonus oxyrinchus (Linnaeus, 1758) Bondella Alloctona Salmonidae Oncorhynchus kisatch (Walbaum, 1792) Salmone argentato Alloctona Salmonidae Oncorhynchus mykiss (Walbaum, 1792) Trota iridea Alloctona raramente acclimatata Salmonidae Oncorhynchus tshawytscha (Walbaum in Artedi, 1792) Chinook Alloctona non acclimatata Salmonidae Salmo carpio (Linnaeus, 1758) Carpione del Garda Autoctona lago di Garda (endemica) Salmonidae Salmo cettii (Rafinesque, 1810) Trota mediterranea Autoctona Sicilia sud-orientale Salmonidae Salmo fibreni (Zerunian & Gandolfi, 1990) Carpione del Fibreno Autoctona lago Posta Fibreno (endemica) Salmonidae Salmo ghigii (Pomini, 1940) Trota mediterranea Autoctona Appennino e Alpi occidentali Salmonidae Salmo marmoratus (Cuvier, 1829) Trota marmorata Autoctona distretto P.V. (endemica) Salmonidae Salmo trutta (Linnaeus, 1758) Trota fario Alloctona Salmonidae Salmo salar (Linnaeus, 1758) Salmone atlantico Alloctona non
    [Show full text]
  • Trout and Char of Central and Southern Europe and Northern Africa
    12 Trout and Char of Central and Southern Europe and Northern Africa Javier Lobón-Cerviá, Manu Esteve, Patrick Berrebi, Antonino Duchi, Massimo Lorenzoni, Kyle A. Young Introduction !e area of central and southern Europe, the Mediterranean, and North Africa spans a wide range of climates from dry deserts to wet forests and temperate maritime to high alpine. !e geologic diversity, glacial history, and long human history of the region have interacted with broad climatic gradients to shape the historical and cur- rent phylogeography of the region’s native trout and char. !e current distributions and abundances of native species are determined in large part by their fundamental niches (i.e., clean, cold water with high dissolved oxygen). Brown Trout Salmo trutta are relatively common and widespread in the northern and mountainous areas of the region but occur in isolated headwater populations in the warmer southern areas of the region. !ese southern areas provided glacial refugia for salmonids and today har- bor much of the region’s phylogenetic diversity. Despite relatively narrow ecologi- cal requirements in terms of water quality, native and invasive trout and char occur throughout the region’s rivers, lakes, estuaries, and coastal waters. Despite having only a single widely recognized native trout species, the region’s range of environments has produced a remarkable diversity of life histories ranging from dwarf, stunted, short and long-lived, small- and large-sized, stream-resident, lake-resident, fluvial potamo- dromous, adfluvial potamodromous, and anadromous (see Chapter 7). Only one trout and one char are native to the region, Brown Trout and Alpine Char Salvelinus umbla.
    [Show full text]
  • Investigating the Genetic Structure of Trout from the Garden of Ninfa (Central Italy): Suggestions for Conservation and Management
    DOI: 10.1111/fme.12259 ORIGINAL ARTICLE Investigating the genetic structure of trout from the Garden of Ninfa (central Italy): Suggestions for conservation and management A. Fabiani1 | P. Gratton1,2 | I. A. Zappes1 | M. Seminara3 | A. D’Orsi3 | V. Sbordoni1 | G. Allegrucci1 1Dipartimento di Biologia, Università degli Studi di Roma Tor Vergata, Roma, Italy Abstract 2Department of Primatology, Max Planck Mediterranean populations of brown trout (Salmo trutta L. complex) have lost a large Institute for Evolutionary Anthropology, part of their genetic distinctiveness, mostly due to massive restocking, and the waters Leipzig, Germany of the Gardens of Ninfa (province of Latina, central Italy, Site of Community Importance 3Dipartimento di Biologia Ambientale, Sapienza Università di Roma, Roma, Italy since 2013) are regarded as one of a few potential reservoirs of autochthonous trout lineages in the Tyrrhenian drainage of the Italian peninsula. In this study, nuclear and Correspondence Anna Fabiani, Dipartimento di Biologia, mitochondrial markers were used on brown trout samples from Ninfa to estimate non- Università degli Studi di Roma Tor Vergata, Mediterranean influence in the population gene pool, potential changes of genetic Roma, Italy. Email: [email protected] structure over time and genetic relationships with other sites known (or suspected) to host native trout gene pools. Striking changes in both microsatellite and mtDNA allele Funding information Provincia di Latina, through the Fondazione frequencies over a 9- year time span were found and provided evidence of unrecorded Goffredo Caetani stocking from the nearby Lake Fibreno. Results are analysed in the light of potential ecological consequences of such events on a longer time scale and provide a scientific background for fisheries management and conservation programmes in the area.
    [Show full text]
  • S-236503 COMPLETO.Pdf
    TECNICOS CIENTIFICOS S£ivrv4 LITERARIOS AGENCIA'EXPOENTE 1 SPAULO - R.SILV.MARTINS.53 TFL.33-2744 E 32-9797-CX.P03T.5S14 Instituto Oceanografico BIBLIOTECA CATALOGUE OF THE FISHES IN THE BRITISH MUSEUM. BY ALBERT GUNTHER, M.A., M.D., PH.D., F.Z.S., ETC., ETC. VOLUME SIXTH. LONDON: PRINTED BY ORDER OF THE TRUSTEES. 1866. CATALOGUE OF THF, PHYSOSTOMI, CONTAINING THE FAMILIES SALMONID^E, PERCOPSID^E, GALAXID.E. MORMYRID^-E, GYMNARCHID^E, ESOCID^E, UMBRID^E, SCOMBRESOCIDyE, CYPRINODONTID^E, IN THE COLLECTION OF THE BRITISH MUSEUM. BY DR. ALBERT GUNTHER. Instituto Oceanogr&fico REG N. .-3.2JE S. PATTT.O %o.S- S3. LONDON: PRINTED BY ORDER OF THE TRUSTEES. 1866. PBEFACE. DK. GUNTHEB observes,—" This volume contains the continuation of the families of Physostomi. At the commencement of my account of this order it was my intention to adopt it with the limits assigned to it by Muller, and to distinguish the Scombresoces as a distinct order, viz. Malacopterygii pliaryngognathi; however, during the progress of a detailed examination of these fishes so many points of affinity with the Cyprinodontes became apparent, that I was reluctantly obliged to deviate still more from Muller's ordinal division. " The Salmonidae and the vast literature on this family offer so many and so great difficulties to the Ichthyologist, that as much patience and time are required for the investigation of a single species as in other fishes for that of a whole family. The ordinary method followed by naturalists in distinguishing and determining species, is here utterly inadequate; and I do not hesitate to assert that no one, however experienced in the study of other families of fishes, will be able to find his way through this labyrinth of varia­ tions without long preliminary study, and without a good collection for constant comparison.
    [Show full text]
  • Bulletin of the United States Fish Commission Seattlenwf
    INDEX. .- A. Page4 Page Anchovy ................................ 65. 410 Abadejo .................................. e flshing ......................... 888 Aberdeen ................................ 18 Anderson. Capt. James L ................ 404. 438 Abbott. Leon ............................. 18 Andrewe. E. A .......................... 87 Acanthocybium solandri ................. 1 Anemometer ............................. 149 Acanthlirus chirurgus ................... I Angelfischorei ........................... 284 omruleus ................... 7 Angel flsh ............................... 178. 380 tractus ..................... 7 An.cermanu Rivnr ........... -:.......... 327 Acerinn .................................. 4 Angling. cited ........................... 272 Acclimntizntion of flsh in Australia ...... 3 Anguilla ................................. 111 Aclnnclla mornoni ........................ 23 nucklandii ..................... 55 Acroperus loucocephalus ................. 44 australia ....................... 65 Actinoplirys ............................. 43 cuhana ......................... 111 Acushnet River .......................... 31 rostrata ........................ 111 Addison Contor, sohoouer ................ 24! Anguillidm .............................. 208 A. F. Gifford, schooner ................... 171 Annin, jr.s James ........................ 85 Agnssiz. Prof. A .......................... 31 Anolophus . v . grreoum .................. 178 Prof. L .......................... 293.20, Anthins riohardsoni ....................
    [Show full text]
  • Present and Future Salmonid Cytogenetics
    G C A T T A C G G C A T genes Article Present and Future Salmonid Cytogenetics Muhammet Gaffaroglu 1 , Zuzana Majtánová 2 , Radka Symonová 3,* ,Šárka Pelikánová 2, Sevgi Unal 4 , ZdenˇekLajbner 5 and Petr Ráb 2 1 Department of Molecular Biology and Genetics, Faculty of Science, University of Ahi Evran, Kirsehir 40200, Turkey; mgaff[email protected] 2 Laboratory of Fish Genetics, Institute of Animal Physiology and Genetics, Czech Academy of Sciences, 27721 Libˇechov, Czech Republic; [email protected] (Z.M.); [email protected] (Š.P.); [email protected] (P.R.) 3 Department of Bioinformatics, Wissenschaftszentrum Weihenstephan, Technische Universität München, 85354 Freising, Germany 4 Department of Molecular Biology and Genetics, Faculty of Science, Bartin University, Bartin 74000, Turkey; [email protected] 5 Physics and Biology Unit, Okinawa Institute of Science and Technology, Graduate University, Onna, Okinawa 904 0495, Japan; [email protected] * Correspondence: [email protected] or [email protected] Received: 6 November 2020; Accepted: 2 December 2020; Published: 6 December 2020 Abstract: Salmonids are extremely important economically and scientifically; therefore, dynamic developments in their research have occurred and will continue occurring in the future. At the same time, their complex phylogeny and taxonomy are challenging for traditional approaches in research. Here, we first provide discoveries regarding the hitherto completely unknown cytogenetic characteristics of the Anatolian endemic flathead trout, Salmo platycephalus, and summarize the presently known, albeit highly complicated, situation in the genus Salmo. Secondly, by outlining future directions of salmonid cytogenomics, we have produced a prototypical virtual karyotype of Salmo trutta, the closest relative of S.
    [Show full text]
  • Il Carpione Del Garda: Tutela Di Una Specie a Rischio Di Estinzione
    www.regione.lombardia.it IL CARPIONE DEL GARDA: TUTELA DI UNA SPECIE A RISCHIO DI ESTINZIONE IL CARPIONE DEL GARDA: TUTELA DI UNA SPECIE A RISCHIO ESTINZIONE Quaderni della Ricerca n. 149 - febbraio 2013 Agricoltura Sperimentazione condotta nell’ambito del progetto di ricerca n. 1220 “Sviluppo di metodi e strumenti per la tutela di una specie a rischio di estinzione: il carpione del Garda (Salmo trutta carpio) – SALVACARPIO” ¿QDQ]LDWRFRQLO3URJUDPPD5HJLRQDOHGLULFHUFDLQFDPSRDJULFRORGL5HJLRQH/RPEDUGLD Testi a cura di: .DWLD3DUDWL*DHWDQR*HQWLOL*LRYDQQL/RULV$OERUDOL0DULDSLD9LJOLRQH Foto a cura di: .DWLD3DUDWLH*DHWDQR*HQWLOL Hanno realizzato le attività sperimentali: 3URYLQFLDGL%UHVFLD$VVHVVRUDWR&DFFLDH3HVFD8I¿FLR3HVFD 3529%6 9LD0LODQR%UHVFLD %6 7HO)D[ 3URSRQHQWH'RWW0DULD3LD9LJOLRQH(PDLOPYLJOLRQH#SURYLQFLDEUHVFLDLW ,VWLWXWR6SHULPHQWDOH,WDOLDQR/6SDOODQ]DQL ,6,/6 /RF/D4XHUFLD5LYROWDG¶$GGD &5 7HO)D[ 5HIHUHQWH'RWW.DWLD3DUDWL(PDLONDWLDSDUDWL#LVWLWXWRVSDOODQ]DQLLW ,VWLWXWR=RRSUR¿ODWWLFR6SHULPHQWDOHGHOOD/RPEDUGLDHGHOO¶(PLOLD5RPDJQD ,=6%6 9LD%LDQFKL%UHVFLD %6 7HO)D[ 5HIHUHQWH'RWW/RULV$OERUDOL(PDLOODOERUDOL#EVL]VLW *5$,$6UO 9LD5HSXEEOLFD9DUDQR%RUJKL 9$ 7HO)D[ 5HIHUHQWH'RWW*DHWDQR*HQWLOL(PDLOJDHWDQRJHQWLOL#JUDLDHX 5HVSRQVDELOHVFLHQWL¿FR.DWLD3DUDWL Per informazioni: 5HJLRQH/RPEDUGLD'LUH]LRQH*HQHUDOH$JULFROWXUD 82,QQRYD]LRQHFRRSHUD]LRQHHYDORUL]]D]LRQHGHOOHSURGX]LRQL 6WUXWWXUD5LFHUFDLQQRYD]LRQHWHFQRORJLFDHVHUYL]LDOOHLPSUHVH 3DOD]]R/RPEDUGLDSLD]]D&LWWjGHOOD/RPEDUGLD0LODQR 7HO)D[(PDLODJULBULFHUFD#UHJLRQHORPEDUGLDLW 5HIHUHQWL*LDQSDROR%HUWRQFLQL*LRYDQQD3UDGHULR
    [Show full text]
  • FOS Approved Customers & Suppliers & Retailers
    FOS Approved Customers & Suppliers & Retailers : Country Account Name Production Chain FOS certified species .Albania (1) Coral shpk Fishery - Processor;Fishery - Ship Owner European anchvy-engraulis Encrasicolus .Australia (22) EYRE PENINSULA SEAFOODS PTY LTD Aquaculture - Processor;Aquaculture - Mediterranean Mussel-Mytilus Aquaculture site galloprovincialis . Health World Limited Omega3 - Distributor Anchoveta-Engraulis ringens . Spring Bay Seafoods Pty Ltd Aquaculture - Aquaculture site Blue Mussel-Mytilus galloprovincialis . Clean Seas Aquaculture - Aquaculture site Yellowtail Amberjack-Seriola lalandi . A Raptis and Son Pty Ltd Fishery - Ship Owner;Fishery - End Banana Prawn-Fenneropenaeus Processing;Fishery - Exporter merguiensis . Direct Wellbeing Pty Ltd Omega3 - Distributor Japanese Flying Squid-Todarodes pacificus, Argentine Shortfin Squid-Illex argentinus, Jumbo Flying Squid-Dosidicus gigas . Angel Oysters Australia Pty Ltd Aquaculture - Aquaculture site Giant Cupped Oyster-Crassostrea gigas . Tasman Pacific Holding Pty Ltd Omega3 - Producer Anchoveta-Engraulis ringens, Atlantic Chub Mackerel-Scomber colias . Ferngrove Pharmaceuticals Australia Pty Ltd Krill Oil - Distributor Antarctic Krill-Euphausia superba . Australian Southern Bluefin Tuna Industry Aquaculture - Distributor;Aquaculture - Southern Bluefin Tuna-Thunnus maccoyii Association Ltd Exporter;Fishery - Ship Owner;Aquaculture - Aquaculture site . Myti Blue Aquaculture - Processor Blue Mussel-Mytilus galloprovincialis . Australian Fishing Enterprises Pty Ltd (Sarin
    [Show full text]
  • GENUS Brachymystax Gunther, 1866
    FAMILY Salmonidae Jarocki (or Schinz), 1822 - salmonids SUBFAMILY Salmoninae Jarocki (or Schinz), 1822 - salmonids [=Dermopteres, Salmonidi, Salmones, Tutriformes (Truttiformes), Salvelini, Brachymystini, Oncorhynchus, Huchoninae, Salmothymini, Salvelinini, Parahuchoninae] GENUS Brachymystax Gunther, 1866 - lenoks, Asiatic trout, Manchurian trout Species Brachymystax lenok (Pallas, 1773) - sharp-snouted lenok [=coregonoides, swetowidowi] Species Brachymystax savinovi Mitrofanov, 1959 - Russian lenok Species Brachymystax tsinlingensis Li, 1966 - Yangtze lenok Species Brachymystax tumensis Mori, 1930 - blunt-snouted lenok [=czerskii] GENUS Hucho Gunther, 1866 - salmonids [=Epitomynis] Species Hucho bleekeri Kimura, 1934 - Bleeker's hucho Species Hucho hucho (Linnaeus, 1758) - huchen, huchen trout, Danube salmon [=germanorum] Species Hucho ishikawae Mori, 1928 - Korean hucho Species Hucho taimen (Pallas, 1773) - taimen [=fluviatilis, lossos] GENUS Oncorhynchus Suckley, 1861 - salmonids [=Hypsifario, Paraoncorhynchus, Parasalmo] Species Oncorhynchus aguabonita (Jordan, 1892) - golden trout, California golden trout [=roosevelti, whitei] Species Oncorhynchus apache (Miller, 1972) - apache trout, Arizona trout Species Oncorhynchus chrysogaster (Needham & Gard, 1964) - Mexican golden trout Species Oncorhynchus clarkii (Richardson, 1837) - cutthroat trout [=alpestris, alvordensis, bathoecetor, behnkei, bouvieri, brevicauda, carinatus, carmichaeli, crescentis, declivifrons, eremogenes, evermanni, henshawi, humboldtensis, jordani, lewisi, macdonaldi,
    [Show full text]
  • Genetic Identification of Native Populations of Mediterranean Brown Trout Salmo Trutta L. Complex (Osteichthyes: Salmonidae) in Central Italy
    The European Zoological Journal ISSN: (Print) 2475-0263 (Online) Journal homepage: https://www.tandfonline.com/loi/tizo21 Genetic identification of native populations of Mediterranean brown trout Salmo trutta L. complex (Osteichthyes: Salmonidae) in central Italy A. R. Rossi, G. Petrosino, V. Milana, M. Martinoli, A. Rakaj & L. Tancioni To cite this article: A. R. Rossi, G. Petrosino, V. Milana, M. Martinoli, A. Rakaj & L. Tancioni (2019) Genetic identification of native populations of Mediterranean brown trout Salmotrutta L. complex (Osteichthyes: Salmonidae) in central Italy, The European Zoological Journal, 86:1, 424-431, DOI: 10.1080/24750263.2019.1686077 To link to this article: https://doi.org/10.1080/24750263.2019.1686077 © 2019 The Author(s). Published by Informa View supplementary material UK Limited, trading as Taylor & Francis Group. Published online: 12 Nov 2019. Submit your article to this journal Article views: 92 View related articles View Crossmark data Full Terms & Conditions of access and use can be found at https://www.tandfonline.com/action/journalInformation?journalCode=tizo21 The European Zoological Journal, 2019, 424–431 Vol. 86, No. 1, https://doi.org/10.1080/24750263.2019.1686077 Genetic identification of native populations of Mediterranean brown trout Salmo trutta L. complex (Osteichthyes: Salmonidae) in central Italy A. R. ROSSI1, G. PETROSINO1, V. MILANA1, M. MARTINOLI2, A. RAKAJ2,& L. TANCIONI2* 1Department of Biology and Biotechnology C. Darwin, University of Rome “La Sapienza”, Rome, Italy, and 2Experimental Ecology and Aquaculture Laboratory, Department of Biology, University of Rome “Tor Vergata”, Rome, Italy (Received 30 July 2019; accepted 23 October 2019) Abstract Italian native populations of Mediterranean brown trout belong to the Salmo trutta complex.
    [Show full text]