Molecular Basis of Rheb Mediated Apoptosis By

Home , Ran (protein), RHEB

Molecular basis of Rheb mediated apoptosis By

Veena Nambiar Potheraveedu

A thesis submitted in partial fulfillment of the requirements for the degree of

Dr. rer. nat. (PhD)

From the Graduate School of Chemistry and Biochemistry (GSCB)

Ruhr University Bochum

May 2015

This research was conducted at the Department of Molecular Neurobiochemistry,

Faculty of Chemistry and Biochemistry, Ruhr University Bochum under the

supervision of Prof. Dr. Rolf Heumann

The present research work was performed during the period from May 2011 to March 2015 at the Department of Molecular Neurobiochemistry under the supervision of Prof. Dr. Rolf Heumann, Faculty of Chemistry and Biochemistry, Ruhr-University Bochum.

1st Internal Examiner: Prof. Dr. Rolf Heumann 2nd Internal Examiner: Prof. Dr. Raphael Stoll

Date of Submission: 13th May 2015

Date of Examination:

Declaration

I hereby certify that this dissertation was completed and written independently by me and without outside assistance. This dissertation is based on the experimental work carried out at the Department of Molecular Neurobiochemistry, Ruhr University Bochum, Germany. References to the work done by collaborators and theories of others have been cited and acknowledged completely and correctly. This work has never been submitted in this, or a similar form, at this or any other domestic or foreign institution of higher learning as a dissertation. The above mentioned statement was made as a solemn declaration. I conscientiously believe and declare it to be true.

Veena Nambiar Potheraveedu

Bochum 13th May 2015

iii

Truth can be stated in a thousand different ways, yet each one can be true.

Swami Vivekananda

Table of Contents

I. List of figures ix II. List of formulas x III. List of Abbreviations xi IV. Abstract xiii 1. Introduction 1 1.1.Ras Family of GTPases 1 1.2.Subcellular Localization of Ras-GTPases 2 1.3.Rheb GTPases (Ras Homologue Enriched in Brain) 3 1.4.Rheb signaling and their biological role 3 1.5.Amino-acid regulation of Rheb /mTOR 7 1.6.Non-Canonical Rheb signaling 8 1.7.Stress Induced Apoptosis 11 1.8. Rheb localization 14 1.9. Rheb interactions 15 1.10. Rheb Structure 17 1.11. EGFP Expression System 19 1.12. sfYFP and split GFP system 19 1.13. Small molecules binding to Rheb 20 2. Aims 21 3. Materials and Methods 22 3.1.Materials 22 3.1.1. Media 22 3.1.2. Solutions for SDS-PAGE and Immunodetection 23 3.1.3. Antibodies for Immunodetection 25 3.1.4. Solutions for mini-prep plasmid isolation and Agarose- Gel electrophoresis 25 3.1.5. Solutions for immunostaining 27 3.1.6. Antibodies for Immunostaining 27 3.1.7. Buffers for mammalian Cell lysis 27 3.1.8. Buffers for Bacterial cell lysis and Affinity purification 28 3.1.9. Primer pairs 29 3.1.10. Plasmids 32 3.1.11. Lab equipments 32 v

3.1.12. Cell culture solutions and antibiotics 33 3.1.13. Enzymes for molecular biology 33 3.1.14. Kits used 34 3.1.15. Chemicals and consumables 34 3.1.16. Softwares 35 3.1.17. Statistics 35

3.2.Methods 36 3.2.1. Polymerase Chain Reaction 36 3.2.2. Restriction Digestion of DNA 36 3.2.3. De-phosphorylation of plasmid DNA 37 3.2.4. Oligonucleotide Annealing 37 3.2.5. Ligation of DNA 37 3.2.6. Agarose Gel Electrophoresis 38 3.2.7. Isolation of DNA from Agarose Gel 38 3.2.8. Transformation of competent Novablue and BL-21 rosetta cells 38 3.2.9. Plasmid isolation by Mini-prep and Midi-prep 39 3.2.10. Determination of DNA concentration 39 3.2.11. Cultivation and passaging of HeLa cell lines 39 3.2.12. Transient Transfection of Secondary Cell lines 40 3.2.13. Cell count for apoptosis 41 3.2.14. Preparation of cell lysates 41 3.2.15. Fixing transfected cells 41 3.2.16. Immunostaining 42 3.2.17. MTT assay 42 3.2.18. SDS PAGE and Western Blot for Immunodetection 43 3.2.19. Coomassie Staining and Destaining 43 3.2.20. GST protein Purification 44 3.2.21. His-Tag Protein purification 45 3.2.22. GFP- TRAP Immunoprecipitation 45 3.2.23. Myc Immunoprecipitation 46 3.2.24. NMR spectroscopy 46 3.2.25. Mass Spectrometry 46

4. Results 47 4.1. Impact of N-terminal fluorescent protein fusion of Rheb on cellular survival 47 4.1.1. Myc- and - and Flag- tagged Rheb do not induce apoptosis per se however fp-Rheb induce apoptosis in HeLa cells 47 4.2. Investigating the factors that determine the difference in apoptosis inducing property of myc-Rheb and EGFP-Rheb 50 4.2.1. EGFP-Rheb induced apoptosis is independent of its sub-cellular localization 51 4.2.2. There is no difference in the protein expression between EGFP- and myc- Rheb 52 4.2.3. Analysis of different binding properties of myc-Rheb and EGFP-Rheb to putative interaction partners 55 4.2.4. Comparison of the structural difference between wt Rheb and EGFP- Rheb 58 4.2.4a. sfYFP N and C terminal halves have self-reconstituting properties: In cell reconstitution 59 4.2.4b. Application of self-reconstituting sfYFP fragments as a switch to render Rheb apoptotic 61 4.2.4c. Applying split sfYFP system to analyze change in structure of reconstituted sfYFP-Rheb 63 4.3. Applications of split sfYFP system: Applying the split sfYFP system for the monitoring of endomembrane targeting of proteins 67 4.3.1. Endomembrane association of Rheb∆CAAX by split sfYFP system induces cell death on HeLa cells 69 4.4. Overexpression of EGFP-Rheb as well as myc-Rheb enhances apoptosis under UV stress 72

4.4.1. Myc-Rheb also enhances apoptosis in response to UV stress: Enhancement of apoptosis is independent of the caspase-3 cleavage activated pathway 73

4.4.2. EGFP-Rheb also enhances apoptosis induced by UV stress 75

4.5. EGFP-Ras also displays apoptotic property but provides partial protection from UV stress 76

vii

4.6. 4, 4’ Biphenol binds to Rheb and induces cell death 77

5. Discussion 80 5.1. Myc and Flag tagged Rheb do not induce apoptosis but EGFP and sfYFP fusion proteins of Rheb (fp-Rheb) induce apoptosis in HeLa cells 80

5.2. Molecular basis of fp-Rheb induced apoptosis 80 5.2.1. EGFP-Rheb induced apoptosis is independent of its sub-cellular localization 82 5.2.2. Induction of apoptosis by EGFP-Rheb is independent of its protein expression level 82 5.2.3. Change in interaction properties of EGFP-Rheb fusion proteins 84 5.3. Split sfYFP proteins reconstitute fluorescence 88 5.3.1. Development of a split-sfYFP based methodology to study the pro- apoptotic property of fp-Rheb 89 5.3.2. Determining the structural basis of fp-Rheb protein mediated apoptosis: Fusion of split half of sfYFP to the N-terminal of Rheb induces a shift in Rheb’s structure 91

5.4. Monitoring the localization of a protein using split sfYFP system 93

5.5. EGFP-Rheb and myc-Rheb enhances apoptosis under UV stress 94

5.6. EGFP fusion also renders Ras pro-apoptotic 95 5.7. 4, 4’ – Biphenol binds to Rheb and induces cell death 96

6. Conclusion and outlook 99 7. References 102 8. Appendix 114 8.1. Figures 114 8.2. Split sfYFP constructs 116 8.3. Curriculum Vitae 119 8.4. Acknowledgment 123

viii

II. List of Figures Figure 1.1: Overview of a growth factor dependent TSC/Rheb/mTOR pathway 6 Figure 1.2: Autophagy regulation pathway 7 Figure 1.3: Overview of the non-canonical functions of Rheb GTPase 11 Figure 1.4: Overview of the intrinsic and extrinsic apoptosis activation pathway and role of initiator and effector caspases 12 Figure 1.5: Ribbon drawing of a representative member of the ensemble structures of rRheb generated using PyMol 18 Figure 4.1: Induction of apoptosis by fp-Rheb 48 Figure 4.2: Detection of cleaved-caspase-3 for EGFP-Rheb and sfYFP-Rheb but not for flag-Rheb or myc-Rheb transfectants 48 Figure 4.3: Fluorescence microscopic Images showing expression of EGFP, EGFP-Rheb, sfYFP and sfYFP-Rheb 49 Figure 4.4: Detection of the respective fusion proteins of Rheb 49 Figure 4.5: Cell death by EGFP-Rheb overexpression 50 Figure 4.6: Confocal Images showing similar localization of EGFP-Rheb and myc-Rheb in HeLa cells 51 Figure 4.7: Percentage of apoptosis increases with increasing concentrations of Rheb proteins with different tags 53 Figure.4.8: Comparing the expression of EGFP-Rheb with flag-Rheb and myc-Rheb 54 Figure 4.9: Western Blot images showing the pull down of myc-Rheb (+/-UV) and EGFP-Rheb 55 Figure 4.10: List of proteins identified from pull down experiments by mass spectrometry analysis 57 Figure 4.11: 1-D and 2-D spectra of EGFP-Rheb 58 Figure 4.12: Validation of self- reconstitution of sfYFP halves 60 Figure 4.13: Demonstration of self- reconstitution of YN and YC using sepaharose beads 61 Figure 4.14: YN-YC reconstitution fused to Rheb as a switch to induce apoptosis 62 Figure 4.15: Schematic representation of determination of NMR structure of sfYFP-Rheb using the split sfYFP system 63 Figure 4.16: Purification of YC-Rheb proteins using GST-tag and glutathione sepahrose beads 64

Figure 4.17: Analysis of 1-D and 2-D measurements for YC-Rheb and YC-Rheb+YN in comparison with wt Rheb 65 Figure 4.18: Confocal Image showing that YC-YN reconstitution localizes to the endomembranes driven by C-terminal CAAX motif of Rheb 68 Figure 4.19: Confocal Image showing that YC-YN reconstitution allows the specific targeting of a protein taking advantage of the C terminal CAAX motif of Rheb 68 Figure 4.20: Split sfYFP mediated Rheb fusion proteins induce cell death 71 Figure 4.21: Reconstitution of Rheb using the split sfYFP system do not cause any change in S6 ribosomal protein phosphorylation 72 Figure 4.22: Myc-Rheb also enhances apoptosis in response to UV stress 73

Figure 4.23: EGFP-Rheb enhances apoptosis with UV exposure 75

Figure 4.24: EGFP-Ras overexpression also induces apoptosis 76

Figure 4.25: 4, 4’ – Biphenol induces cell death in HeLa cells 78 Figure 4.26: 4, 4’–Biphenol inhibits S6 ribosomal protein phosphorylation in HeLa cells 78 Figure 8.1.1: Cells transfected with Myc-Rheb. Control staining without primary antibody 114 Figure 8.1.2: Effect of increasing concentrations of EGFP-Rheb, flag-Rheb and myc-Rheb after 24 hrs of transfection 114 Figure 8.1.3: No change in level of caspase-3 cleavage upon myc-Rheb overexpression under UV stress 115 Figure 8.1.4: Measurement of fluorescence reconstitution by YC-Rheb and YN 116

III. List of Formulas: Formula 1: Determination of concentration of DNA. 39

Formula 2: Calculation of volume from cell number. 40

Formula 3: Calculation of percentage of transfected apoptotic cells. 41

I. Abbreviations

AMPK 5' AMP-activated protein kinase APS Ammonium Per Sulphate BiFC Bi-molecular Fluorescence Complementation cm Centimeter DMEM Dulbecco's Modified Eagle Medium DMSO Dimethyl sulfoxide DNA Deoxyribonucleic acid dNTPs Deoxynucleotide DTT Dithiothreitol EDTA Ethylenediaminetetraacetic acid EGFP Enhanced Green Fluorescence Protein FLIM Fluorescence Life-time Imaging Microscopy Fp-Rheb Fluorescent protein-Rheb FRET Fluorescence Resonance Energy Transfer GAP GTPase Activating Protein GDP Guanine Nucleotide Diphosphate GEF Guanine Nucleotide Exchange factor GTE Glucose/ Tris/EDTA GTP Guanine Nucleotide Triphosphate Ha-Ras Harvey-Ras HeLa cells Henrietta Lacks cells Hrs Hours IP Immuno precipitation IPTG Isopropyl β-D-1-thiogalactopyranoside JNK c-Jun N-terminal kinases KDa Kilo Daltons K-Ras Kirsten-Ras mM Millimolar µM Micromolar mRNA Messenger Ribonucleic Acid MTT 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide nm Nanometer xi

NFkB nuclear factor kappa-light-chain-enhancer of activated B cells NMR Nuclear magnetic Resonance PAGE Poly Acrylamide Gel Electrophoresis PBS Phosphate Buffered Saline PDE4D5 cAMP-specific 3', 5’-cyclic phosphodiesterase 4D PDK1 3-phosphoinositide dependent protein kinase-1 PIP2 Phosphatidylinositol 4,5-bisphosphate

PIP3 Phosphatidylinositol (3,4,5)-trisphosphate

PM Plasma membrane % Percentage PCR Polymerase Chain Reaction Ras Rat sarcoma Rheb Ras Homologue Enriched in Brain RTK Receptor Tyrosine Kinase

SDS Sodium Dodecyl Sulphate Sec Seconds SEM Standard Error of Mean S6K p70 S6- Kinase Sos Son of Sevenless sfYFP Super folder Yellow Fluorescence Protein TBS Tris-Buffered Saline TCA Trichloroacetic acid TE Tris EDTA TEB Tris/EDTA/ Borate TEMED Tetramethylethylenediamine TNF Tumor necrosis Factor UV Ultra-violet VDAC-1 Voltage Dependent Anion Channel -1 w/v weight per volume wt wild type YFP Yellow Fluorescence Protein

xii

IV. Abstract.

The Ras Homolog Enriched in Brain (Rheb) is an intracellular membrane associated member of the Ras super family of GTP-binding proteins that is involved in insulin/TOR/S6K signaling pathway. Rheb plays a critical role in regulating growth, cell cycle and cellular regeneration. Surprisingly, it was found recently that overexpression of flag-tagged Rheb enhanced the apoptotic effects induced by UV light, TNFα or tunicamycin via the mTOR complex1 (mTORC1) signaling pathway (Karassek et al. 2010). Here we show that in contrast to flag tagged or myc.-tagged Rheb, the EGFP-fusion proteins of Rheb induced apoptosis autonomously. The molecular basis of the fluorescent fusion proteins of Rheb (fp-Rheb) induced apoptosis was further investigated by several independent approaches including differential intracellular fp-Rheb sub-cellular targeting, protein expression levels, investigation of protein interaction partners and protein structural aspects.

The possible role of membrane association in fp-Rheb induced apoptosis was first investigated. Overexpression of fp-Rheb without the C-terminal tail of the Rheb- endomembrane associating farnesylation moiety revealed that apoptosis is still induced (Karassek, PhD thesis 2010). Thus, the mechanism leading to fp-Rheb induced apoptosis is independent of endomembrane anchoring of Rheb. A comparison of the localization of apoptosis inducing EGFP-Rheb and non-apoptotic flag or myc-tagged Rheb revealed that the induction of apoptosis by fp-Rheb is independent of the sub-cellular targeting. This induction of apoptosis by fp-rheb is also independent of mTORC1 signaling pathway.

An analysis of the expression pattern and level of proteins expressed in the cells did not display any striking difference between fp-Rheb and myc or flag tagged Rheb.

Using pull down assay and mass spectrometry, proteins that were differentially interacting with EGFP-Rheb compared to myc-Rheb have been identified. From the eleven proteins identified three or four proteins were known to be associated with the induction of apoptosis. New protein candidates are thought to help unraveling potentially novel mechanisms of cellular degeneration.

In order to further investigate this fp-Rheb mediated mechanism of apoptosis induction, we aimed at developing a method to visualize the triggering of apoptosis in the cell and to use this to establish protein NMR-structural aspects. Here we found that the sfYFP protein can be split into two halves (spilt sfYFP) that are each non fluorescent. However, co-expression of the two halves leads to reconstitution of fluorescence. Individual halves of sfYFP are not triggering apoptosis when fused to Rheb. However, co-expression of complementary half of xiii split sfYFP-Rheb, induced fluorescence and apoptosis at the same time, indicating a functional reconstitution of fluorescence leading to induction of apoptosis. The signaling mechanisms of these proteins have been partially investigated.

Using NMR spectroscopy, an approach to compare the structure between wild-type Rheb and fp-Rheb has been done. Shifts were observed in Rheb and the implications of these shifts in the mechanism of apoptosis have been discussed.

In order to inhibit Rheb mediated pathological conditions such as Tuberous Sclerosis or cellular degeneration it would be desirable to develop membrane permeable small molecules specifically interfering with Rheb signaling. Unfortunately, until now small molecule inhibitors for Rheb are not yet available. In a second part of this PhD project, the effect of a small molecule that specifically binds to Rheb and not to Ras has been analyzed. The effect of binding of this small molecule to Rheb at the cellular and signaling level was investigated. Treatment of HeLa cells with these molecules results in cell death and a corresponding decrease in the level of S6 ribosomal protein phosphorylation. This indicates that binding of this molecule to Rheb may have an effect on the downstream pathway of Rheb (Schöpel. et. al, 2013). Our results may have implications for the establishment of therapy targeted towards treatment of Tuberous Sclerosis as well as neuro-degenerative diseases.

The current thesis is therefore analyzing various approaches to explain the apoptotic mechanism of Rheb fusion proteins which may correlate with cellular degeneration by various pathological proteins and establishment of pharmacological tools targeting pathological conditions mediated by Rheb.

xiv

1. Introduction

1.1. Ras Family of GTPases.

The Ras super family of proteins are small GTP-binding proteins (G proteins) with molecular masses of 20–40 kDa (Takai et al. 2001). The Ha-Ras and Ki-Ras genes were first discovered as the v-Ha-Ras and v-Ki-Ras oncogenes of sarcoma viruses in the 1980s (Sakaguchi et. al. 1984). Their cellular oncogenes were then identified in humans, and their mutations were found in some human carcinomas. The mutated forms were shown to stimulate proliferation and transformation of cultured cells (Pierce & Aaronson 1985) and were also described to induce cell differentiation in neuronal cells (Hagag et al. 1986). The Ras genes in yeast were found to be homologous to the mammalian Ras genes (Powers et al. 1984; Tohru et al. 1985).

The Ras super family of proteins is divided into five major branches on the basis of sequence and functional similarities: Ras, Rho, Rab, Ran and Arf (Takai et al. 2001; Wennerberg et al. 2005). The Ras sarcoma (Ras) oncoproteins are the founding members of the Ras family (36 members) which includes Rap, R-Ras, Ral and Rheb proteins. However the Ras oncoproteins have been the subject of intense research and discussion, largely due to their critical roles in human oncogenesis (Repasky et al. 2004). Three Ras proteins, Ha-Ras, Ki-Ras, and N-Ras, which are activated by various point mutations, are known for their capability to transform mammalian cells (Sakaguchi et al. 1984; Hisamaru et al. 1985).

Ras family members act as molecular switches as they have two interconvertible forms: GDP-bound inactive and GTP-bound active forms (Milburn et al. 1990). An upstream signal stimulates the dissociation of GDP from the GDP-bound form, which is followed by the binding of GTP, eventually leading to the conformational change of the downstream effector-binding region so that this region interacts with the downstream effector(s). The GTP-bound form is converted by the action of the intrinsic GTPase activity to the GDP bound form, which then releases the bound downstream effector(s). In this way, one cycle of activation and inactivation is achieved, and small G proteins serve as molecular switches that transduce an upstream signal to a downstream effector(s) (Milburn et al. 1990).

Ras has two regions referred to as switch 1 (residues 30 – 40) and switch 2 (residues 60 – 76) respectively, that change conformation on phosphate release (Santos and Nebreda 1989; Hall et al. 2002).

These regions are located in close proximity on the surface of the protein and contain conserved residues important for nucleotide and Mg2+ -ion coordination. All the activating mutations in Ras that cause a decrease in the intrinsic GTPase activity are located around amino acids 12 and 61 (Santos & Nebreda 1989; Hall et al. 2002).

Ras proteins serve as signaling nodes activated in response to diverse extracellular stimuli from surface receptors to the interior of the cell (Lowy & Willumsen 1993). Activated Ras interacts with multiple catalytically distinct downstream effectors (Lowy & Willumsen 1993; Avruch et al. 1994), which regulate cytoplasmic signaling networks that control gene expression and regulation of cell proliferation, differentiation, apoptosis (Cox & Der 2003; Ehrkamp et al. 2013) and survival (Borasio et. al. 1989; Downward 1998). Recent researches show that Ha-Ras not only promote survival, proliferation and differentiation, but also has roles in apoptosis, which indeed depends on the cell type and context (Vos et al. 2000; Cox & Der 2003; Ehrkamp et al. 2013).

Moreover studies on Ras, especially Ha-Ras in stress response shows that Ras provides protection under conditions of oxidative stress (Cuda 2002), UV stress and pro-apoptotic cues (Chakrabarty et al. 2007; Karassek et al. 2010).

1.2. Sub cellular Localization of Ras-GTPases

Ras is post-translationally modified at its C-terminus 'CAAX' motif to enable the cellular localization and downstream signaling (Choy et al. 1999). These modifications include farnesylation of the cysteine residue of CAAX before proteolytic removal of the AAX amino acids and methyl esterification of the α-carboxyl group of the newly generated C- terminal prenylcysteine. N-Ras and Ha-Ras are further modified by palmitate at one (N- Ras) or two (Ha-Ras) cysteines adjacent to the processed CAAX motif. Palmitoylation is required for the localization of N-Ras and Ha-Ras at the plasma membrane (PM) (Hancock et al. 1990). In the case of K-Ras, a polylysine motif substitutes for palmitoylation sites as secondary PM targeting signal (Hancock et al. 1990). Farnesylation of the CAAX motif targets Ras proteins to Endoplasmic Reticulum (ER) and Golgi membranes where they encounter the CAAX processing enzymes, Rce1 protease and prenylcysteine-directed carboxyl methyltransferase (Dai et al. 1998). Thus, nascent Ras proteins are present, at least transiently, on the ER and Golgi (Dai et al. 1998; Chiu et al. 2002). Oncogenic Ha- Ras and N-Ras engage different effectors on the endomembranes as well as on PM (Chiu et al. 2002).

1.3. Rheb GTPases (Ras Homologue Enriched in Brain)

A novel inducible member of the Ras family of small GTP-binding proteins termed Rheb or Ras homolog Enriched in brain has been described in the late 20th century (Yamagatas et al. 1994; Gromov et al. 1995). Rheb, whose mRNA is enriched in brain (Yamagatas et al. 1994), was found to be expressed at high basal levels in hippocampus and cerebral cortex. Other tissues that express high levels of Rheb mRNA include lung, thymus, kidney, and intestine. The mammalian Rheb family contains both Rheb1 (henceforth as Rheb) and Rheb2 (Tee et al. 2005; Campbell et al. 2009). Activation of Rheb2 in mammalian cells, might lead to epilepsy, a typical pathology of Tuberous Sclerosis Complex (TSC) patients (Aspuria & Tamanoi 2004; Saito et al. 2005).

The synthesis of Rheb mRNA is up regulated after toxic insults, starvation, exposure to growth factors such as epithelial growth factors or fibroblast growth factors (Yamagatas et al. 1994). Rheb activity is associated with cellular growth, protein biosynthesis, translation and regeneration (Saucedo et al. 2003). This protein is activated by growth factors, insulin and nutrition (Yamagatas et al. 1994; Gromov et al. 1995; Garami et al. 2003). It is ubiquitously expressed in mammalian cells, and highest levels were found in skeletal and cardiac muscle (Gromov et al. 1995). It has been reported that in adult hearts, Rheb is involved in cardiac hypertrophy (Gromov et al. 1995; Tamai et al. 2013). Overexpression of Rheb in isolated adult rat cardiomyocytes activated the mammalian Target of Rapamycin Complex 1 (mTORC1) and protein synthesis and induced enlargement of cell surface area (Tamai et al. 2013).

1.4. Rheb signaling and their biological role

Since its discovery in 1994 (Yamagatas et al. 1994), several studies have been conducted to analyze the signal transduction pathway of Rheb. The significance of Rheb’s role in cell cycle regulation and growth has been identified with the disease Tuberous Sclerosis Complex. The disease is characterized by the development of hamartomas in a variety of tissues including kidney, brain, lung, heart, and skin. The most common clinical manifestations are seizures and mental retardation, kidney failure, and lung problems. These complications are due to tumor growth in respective organs (Curatolo et al. 2008). A lot of studies have shown that mutations in the TSC2 gene are responsible for approximately 50% of familial tuberous sclerosis (TSC) (Bakel et al. 1997).

Further research on the role of TSC1-TSC2 encoding proteins termed hamartin and tuberin respectively on tumor growth identified that TSC2 codes for a GAP protein (Wienecke et al. 1995; Soucek et al. 1997) whereas TSC1 encodes a novel protein containing two coiled-coil domains (Nellist et al. 1999). The TSC1–TSC2 complex was identified to have role in the control of cell cycle progression (Soucek et al. 1997), cell proliferation and growth (Miloloza et al. 2000). It has been known that the loss of TSC1–TSC2 results in increase in cell size (Gao & Pan 2001). Recent studies further suggested that hamartin and tuberin, are involved in antagonizing the amino acid signaling pathway, which normally couples amino acid availability to translation initiation and cell growth (Gao et al. 2002). The complex formed by tuberin and hamartin regulates both growth factor and nutrient- dependent activation of TOR signaling to its downstream targets ribosomal S6 protein kinase-1 (S6K1) and eIF-4E binding protein-1 (4E-BP1) (Gao & Pan 2001; Gao et al. 2002; Inoki et al. 2002; Tee et al. 2002). The mechanism by which this protein complex regulate the mTOR has not been know until the discovery of a novel family member of Ras proteins, Rheb (Yamagatas et al. 1994). The TSC complex was found to act as GTPase activating proteins (GAP) to the Rheb-GTPase (Inoki, Li, et al. 2003; Tee et al. 2003) that activates mTOR to regulate translation and cell growth (Inoki, Li, et al. 2003). Rheb thereby fills the gap between TSC complex and mTOR.

The binding of growth factors activates the receptor tyrosine kinases (RTKs) by their phosphorylation (Goldfine 1987). Phosphoinositide 3-kinases (PI3Ks) are then activated by binding to phosphorylated RTKs, which in turn leads to the conversion of PIP2 to PIP3. The serine/threonine kinases PDK1 and Akt bind to PIP3 at the membrane through their pleckstrin-homology (PH) domains, and PDK1 activates Akt through phosphorylation of its activation loop (Gupta & Dey 2012). Akt then phosphorylates tuberin, and this inhibits the tuberin–hamartin complex (Inoki et al. 2002). The resulting reduced GAP activity of TSC complex allows the accumulation of GTP-bound Rheb (Inoki et al. 2002; Tee et al. 2003; Inoki, Li, et al. 2003; Zhang et al. 2003; Li, Corradetti, et al. 2004; Li, Inoki, et al. 2004;). Therefore TSC1-TSC2 act as a key regulator of PI3K signaling and cell growth by inhibiting the Rheb/mTOR signaling (Gao & Pan 2001; Potter et al. 2001; Tee et al. 2003; Inoki, Li, et al. 2003). GTP bound Rheb activates the Mammalian Target of Rapamycin Complex I (mTORC1), which consists of mTOR, Raptor, PRAS40 and mLST8 binding to the effector protein mTOR ( Hay & Sonenberg 2004; Long, Lin, et al. 2005; Tee et al. 2005; Yang et al. 2006; Adami et al. 2007). Rheb activates mTOR by direct binding (Long, Lin, et al. 2005) or by binding to FKBP38, an inhibitor of mTOR. This binding of Rheb to 4

FKBP38, inhibits the interaction of FKBP38 with mTOR allowing mTOR to be activated (Bai et al. 2007).

The drug, Rapamycin has been found to display anticancer properties by binding to a 12- kDa FK506-binding protein (FKBP12) with high affinity. FKBP12-rapamycin complex then acts on mTOR to inhibit mTORC1 function and thereby inhibit cell growth (Loewith et al. 2002; Crespo et al. 2002;Hay & Sonenberg 2004; Adami et al. 2007).

In mammals mTOR also forms another complex which is rapamycin insensitive and is termed the mammalian TOR complex 2 (mTORC2), which in addition to TOR and Lst8, contains the essential polypeptides Rictor and Sin1 (Sarbassov et al. 2004; Avruch & Long 2009)

Downstream of activated mTORC1, protein translation is promoted by direct phosphorylation of S6K1 (p70S6K) and 4E-BP1 (Burnett et.al.1998; Hay & Sonenberg 2004). mTORC1 controls translation by regulating the formation of the eIF4F complex through 4E-BPs [eIF4E-binding proteins] and through phosphorylation of S6K1 [S6 protein kinase; at Thr389] (Burnett et.al.1998; Hay & Sonenberg 2004;Yang et al. 2006). S6Ks are regulated by the insulin/PI3K pathway and nutrient pathway involving the PI3K/TSC/Rheb/mTOR signaling moieties (Martin et al. 2001; Harrington et al. 2004). This pathway responds to insulin, growth factor stimulation and amino acid levels ( Potter et al. 2001; Gao & Pan 2001; Gao et al. 2002; Saucedo et al. 2003) by promoting cell growth through cell cycle progression (Soucek et al. 1997) and increase in the translation of certain mRNAs for accelerated protein synthesis (Inoki et al. 2005; Long, Lin, et al. 2005). This cell growth and altered cell cycle kinetics are in part due to increased levels of Rheb as found in Drosophila melanogaster. In mitotic tissues of these organisms, overexpression of Rheb accelerates passage through G1–S phase without affecting rates of cell division (Patel et al. 2003).

activation

Inhibition

Interaction

Figure 1.1. Overview of a growth factor dependent TSC/Rheb/mTOR pathway. mTORC1 also regulates protein metabolism by suppression of autophagy via Ulk1/Atg13 complex (Hosokawa et al. 2009; Jung et al. 2009; Ganley et al. 2009; Sciarretta et al. 2012). Autophagy is a catabolic process whereby long-lived proteins and damaged organelles are shuttled to lysosomes for degradation. This process is very important in the maintenance of cellular homeostasis. Under conditions of nutrient starvation the TOR complex is inhibited, that causes dephosphorylation of Atg13 leading to series of signaling finally resulting in stimulation of autophagy (Jung et al. 2009). Once the autophagic processes initiate, autophagosomes engulf cytoplasmic components, including cytosolic proteins and organelles. Concomitantly, a cytosolic form of microtubule-associated protein 1A/1B-light chain 3 or LC3 (LC3-I), is conjugated to phosphatidylethanolamine to form LC3-phosphatidyl-ethanolamine conjugate (LC3-II). LC3-II is then recruited to autophagosomal membranes (Kabeya et al. 2003). Cleavage of LC3 I to LC3 II is considered as a marker for autophagic process (Zhou et al. 2009).

Figure 1.2: Autophagy regulation pathway. Under conditions of nutrient availability, the mTOR pathway is activated that leads to inhibition of the autophagy process. Whereas, under conditions of stress or starvation, the mTOR pathway is inhibited leading to activation of cellular autophagic machinery.

1.5. Amino acid regulation of Rheb/mTOR mTOR activity is also completely dependent on amino acid status (Long, Ortiz-Vega, et al. 2005). It was found that removal of amino acids from tissue culture medium resulted in the selective inhibition of S6K1 and dephosphorylation of 4E-BP1 (Long, Ortiz-Vega, et al. 2005; Avruch & Long 2009). These targets are even unresponsive to insulin addition. However a readdition of amino acids to basal levels, in the absence of serum or insulin, restored the 4E-BP phosphorylation and S6K1 activity and their responsiveness to insulin (Avruch & Long 2009). Withdrawal of amino acids (or of just leucine or arginine) also diminishes the ability of Rheb to bind to endogenous or co-expressed recombinant mTOR (Avruch & Long 2009). However recent findings show that in addition to the Rheb GTPases, the protein that is important for mTOR responsiveness to amino acid levels, is the Rag-GTPase (Sancak et al. 2008; Groenewoud & Zwartkruis 2013). Whereas, Rheb directly stimulates the kinase activity of mTOR; Rag GTPase regulates the intracellular localization of mTOR (Groenewoud & Zwartkruis 2013). mTOR is found on the endomembrane system of the cell, including the ER, Golgi apparatus, and endosomes. Therefore, amino acids might control the activity of the mTORC1 pathway, through the Rag proteins, by the movement of mTOR to the lysosomes, bringing it into close proximity

7 of Rheb (Sancak et al. 2008; Groenewoud & Zwartkruis 2013). GTP bound Rheb thus binds to mTOR and activates it.

Recently it was shown that PLD1, enzyme responsible for the production of cellular phosphatidic acid, is also required for mTOR signaling and cell size regulation. PLD1 is required for Rheb activation of mTORC1 and PLD1 is regulated by both TSC/Rheb pathway and amino acid sufficiency (Sun et al. 2008).

5' AMP-activated protein kinase (AMPK) is a cellular energy status sensor that inhibits translation and cell growth under conditions of starvation. This is mediated via phosphorylation of TSC2 by AMPK that leads to the activation of TSC2. This ultimately leads to the inhibition of Rheb/mTOR mediated S6K1 activation and hence protein translation and growth (Inoki et al. 2003).

1.6. Non-Canonical Rheb signaling

Even though the well known TSC1-TSC2/Rheb/mTORC1 pathway has been found to play a critical role in the cellular survival and growth, TSC1-TSC2 or Rheb impact cellular pathways other than through mTORC1 signaling (Neuman & Henske 2011). Some of these are described below:

1.6.1. Apoptosis

It was recently found that Rheb interact with FKBP38, a member of the family of FK506- binding proteins that acts as an inhibitor of the mammalian target of rapamycin (mTOR) (Bai et al. 2007; Ma et al. 2008). The binding of Rheb to FKBP38 antagonizes the inhibitory effect on mTOR and lead to their activation (Bai et al. 2007). However, this does not mean that FKBP38 is the main mediator of Rheb’s effects on mTORC1 (Uhlenbrock et al. 2009) but that Rheb can control mTORC1 through different mechanisms like phosphorylation and direct interactions (Inoki, Li, et al. 2003; Long, Lin, et al. 2005; Yadav et al. 2013)

FKBP38 is also involved in binding and recruiting Bcl-2 and Bcl-X (L), two anti-apoptotic proteins to mitochondria. Interestingly, Rheb also controls apoptosis by regulating the interaction of FKBP38 with Bcl-2 and Bcl-X (Ma et al. 2010). This regulation is independent of mTORC1.

1.6.2. Cell fate and differentiation

Rheb also has mTORC1-independent targets like B-Raf (Im et al. 2002; Karbowniczek et al. 2004) to regulate cellular differentiation. Rheb inhibits B-Raf kinase activity and the B- Raf-induced phosphorylation of p42/44 MAPK activity (Karbowniczek et al. 2004). Rheb activation by down regulation of tuberin inhibits B-Raf and p42/44 MAPK and this occurs in an mTOR-independent manner (Karbowniczek et al. 2004). Moreover Rheb and B-Raf interacts and this interaction blocks the interaction of B-Raf with Ras and C-Raf-B-Raf heterodimerization (Karbowniczek et al. 2006). Interestingly, there was a report on the interaction between Rheb and c-Raf. This interaction, in contrast to the B-Raf regulation, induces a synergistic effect in transforming the growth properties of NIH 3T3 fibroblasts (Yee 1997).

The Notch signaling pathway plays a central role in the regulation of neuronal progenitor cell differentiation and is required to maintain stem/progenitor cells in an undifferentiated status (Karbowniczek et al. 2010). Notch is also important in regulating proliferation and migration of cells in tumors. TSC inhibits mTORC1/S6K1 signaling and thus prevents intestinal stem cells (ISC) differentiation by a mechanism independent of Notch signaling (Quan et al. 2013). Contrastingly, mTOR is a positive regulator of Notch signaling in mouse and human cells, acting through induction of the STAT3/p63/Jagged signaling cascade. This indicates that in response to differential cues from mTOR, Notch serves as a molecular switch to shift the balance between cell proliferation and differentiation (Ma et al. 2010).

Interestingly, TSC1/TSC2/Rheb proteins can also regulate the activity of Notch, thereby regulate cell fate and cell proliferation via a pathway independent of mTORC1 activation. Rheb elevates Notch signaling during external sensory organ development in drosophila via a pathway that is parallel to asymmetric targeting of Numb, a protein that is important for the determination of cell fates during development (Karbowniczek et al. 2010).

1.6.3. Endosome regulation

Rheb was also found to be involved in endocytic trafficking pathway independent of the mTOR pathway as they were found to control late-endocytic vesicle formation that may play a critical role in nutrient uptake (Saito et al. 2005). This vacuole formation activated by Rheb is induced by the upstream PI3K/Akt pathway (Saito et al. 2005). However mTOR localization to the endosomes is essential for its interaction with Rheb under conditions of amino-acid stimulation via Rag GTPases (Saito et al. 2005; Buerger et al. 9

2006; Groenewoud & Zwartkruis 2013). Blocking the endosomal conversion prevents this interaction of mTOR with Rheb (Flinn et al. 2010).

1.6.4. Aggresome formation

TSC/Rheb/mTOR pathway has been known to play a central role in protein synthesis and inhibition of autophagy (Sciarretta et al. 2012). Cells, in general, counteract misfolded proteins by three different mechanisms: by inhibiting the synthesis of proteins, by degrading the misfolded proteins by ubiquitin–proteasome and autophagy–lysosome systems and finally by the formation of detergent-insoluble aggresome by transporting the misfolded proteins to the juxtanuclear region in a microtubule-dependent manner. High Rheb activity, by Rheb overexpression or by inhibition of TSC complex, inhibits aggresome formation and sensitizes cell death in response to misfolded proteins. This function of Rheb occurs independent of mTORC1 activation and is mediated by inhibiting dynein-dependent transportation of misfolded proteins (Zhou et al. 2009). The cell death is caused due to the synergistic effect of inhibition of autophagy and aggresome formation thus sensitizing cell to the toxic effect of misfolded proteins (Zhou et al. 2009).

1.6.5. Mitophagy under conditions of high oxidative phosphorylation

Another study has shown that Rheb induces mitophagy independent of mTORC1 (Melser et al. 2013). Nix is a protein that is involved in mitophagy through physical interaction with the autophagosomal protein LC3 (Novak et al. 2010). Rheb forms a complex with Nix and LC3 which then mediates mitochondrial energetic status-induced mitophagy. When the cells are fed with glutamine, mitochondrial energy metabolism is highly active, and the production of cellular ATP occurs via oxidative phosphorylation. Mitophagy is induced under high oxidative phosphorylation activity and Rheb is involved in this mitophagy (Melser et al. 2013). Rheb therefore helps in the constant renewal of mitochondria in order to maintain cellular bioenergetic efficiency, likely by preventing the accumulation of damaged mitochondria.

Figure 1.3: Overview of the non-canonical functions of Rheb GTPase

1.7. Stress Induced Apoptosis

Apoptosis, or programmed cell death as it is known, is a process characterized by morphologic changes such as shrinkage of the cell, condensation of chromatin, and disintegration of the cell into small fragments (so-called “apoptotic bodies”) that can be removed by phagocytosis. The apoptotic cascade can be initiated via two major pathways, involving either the release of cytochrome c from the mitochondria (mitochondria pathway), or activation of death receptors in response to ligand binding (death receptor pathway). By both the pathways, specific families of cysteine proteases called the caspases are activated to execute the cell's fate in a programmed fashion, leading to the typical morphologic changes seen with apoptosis. Caspase-3 is the “effector” caspase associated with the initiation of the “death cascade” and is therefore an important marker of the cell’s entry point into the apoptotic signaling pathway (McIlwain et al. 2013). Recent findings suggest that ‘apoptosis' as a form of cell death, can occur with or without caspase activation (Bröker et al. 2005; Kroemer et al. 2009). Other forms of cell death include necrosis, autophagic cell death, paraptosis, mitotic catastrophe and slow cell death (Bröker et al. 2005).

The apoptotic pathway is activated in response to various intrinsic and extrinsic stresses like UV light, TNF, tunicamycin etc. Intrinsic apoptosis is activated by signals generated by the cell itself (induced by DNA damage, chemotherapeutic agents, pH, Ca2 + -level etc)

11 while the extrinsic apoptosis needs a signal, that activates a receptor-coupled processes (mostly members of the TNF receptor super family (Tumor Necrosis factor). Stress induced apoptosis is more commonly mediated by Caspase-3 dependent pathway (Fulda et al. 2010).

Figure 1.4: Overview of the intrinsic and extrinsic apoptosis activation pathway and role of initiator and effector caspases. Modified from (McIlwain et al. 2013) Cells can respond to stress in various ways. This response includes the activation of survival pathways, to the initiation of cell death to eliminate damaged cells as a means to provide protection to other healthy cells. If a stress cannot be handled by the cell or if the response is way too expensive for the cell, the cell dies by different processes like apoptosis, necrosis, pyroptosis, or autophagy.

Cells respond to unfolded or misfolded proteins, nutrient deprivation and calcium homeostasis perturbation etc by different mechanisms collectively called the unfolded protein response (UPR) or ER stress. These responses protect the cells from unfavorable conditions. However, uncontrolled UPR or failure to activate this response can lead to apoptosis (Fulda et al. 2010). It was found that the TSC/Rheb/mTOR pathway plays an important role in mediating these response either by inhibition of translation and cell growth or by activating autophagy (Kang et al. 2011).

Therefore a suppression of TSC or over activation of Rheb under conditions of ER stress leads to increased cell death by apoptosis (Kang et al. 2011). It was described that ER stress negatively regulates the TSC/Rheb/mTOR pathway leading to cell death by increased autophagy (Qin et al. 2010). Even though autophagy has been found to be protective under several physiological conditions, the level or timing of autophagy may be critical for deciding the fate of the cells. Autophagic cell death has been reported to occur during development and that certain types of cell death could also occur either associated with or dependent on autophagy (Fulda et al. 2010).

Exposure to UV light induces cellular stress and in such cases, damage to DNA is a common initial event. The effector system that is activated in case of DNA-damaging insult includes various stress-inducible molecules like NF-κB, p53, JNK, or MAPK/ERK. These signaling entities modulate cellular events that ultimately leads to cell cycle arrest and to cell death by apoptosis (Fulda et al. 2010).

It was found that overexpression of Rheb sensitizes the cells to apoptosis induced by UV light, by enhancing the apoptosis induced by the stress. And this enhancement of apoptosis is mediated via activation of the downstream mTORC1, as rapamycin could block the apoptosis induced by Rheb overexpression under these conditions (Karassek et al. 2010). How Rheb overexpression leads to apoptosis is a relevant question as the downstream of TSC/Rheb/mTOR is involved in cell cycle progression and growth. This Rheb mediated apoptosis is controlled by ASK-1 (Karassek et al. 2010) and it is not clear if this enhanced effect is also caspase-3 dependent pathway or not. Rheb switches from an inducer of growth to a pro-apoptotic protein depending on the cellular state.

This pro-apoptotic effect is not restricted to UV light, but also includes ER stress, UPR, TNF- induced apoptosis and so on (Zhou et al. 2009; Karassek et al. 2010; dissertation Karassek, 2010; Kang et al. 2011). The TSC/Rheb/mTOR pathway has also been implicated in several stress and disease conditions like oxidative stress, diabetes etc (Patel & Tamanoi 2006; Sciarretta et al. 2012). Rheb overexpression also enhances apoptosis induced by external stress, oxidative stress and inflammation (Patel & Tamanoi 2006; Cao et al. 2013). A recent work has shown that constitutive activation of Rheb in TSC patients may also lead to increased S phase and these abnormally increased S phase cells may undergo apoptosis (Wataya-Kaneda et al. 2001).

There has been report that Rheb overexpression sensitizes cells to apoptosis in response to misfolded proteins stress. However this regulation occurs independent of mTORC1 by inhibition of aggresome formation under misfolded protein stress (Zhou et al. 2009).

1.8. Rheb localization

Similar to Ras, Rheb also has a C-terminus CAAX motif (Takahashi et al. 2005; Hanker et al. 2010), which is the site for post-translational modification by a farnesyl isoprenoid (Takahashi et al. 2005). Posttranslational modifications by farnesyltransferase, Rce1, and Icmt are important for the transport of Rheb to endomembranes (Takahashi et al. 2005). However, Rheb cannot reach the plasma membrane because of the absence of either the palmitoylation sites or the polybasic motif in its hyper-variable region. Thus the lack of cysteines in the hyper-variable region of Rheb underlies its endomembrane localization and not a plasma membrane localization similar to Ha-Ras (Hancock et al. 1990; Choy et al. 1999; Chiu et al. 2002; Takahashi et al. 2005).

Rheb association with the endomembrane and Golgi complex is critical for its activity as it facilitates association with down-stream effectors (Takahashi et al. 2005; Buerger et al. 2006). Several studies have suggested that the (CAAX) CSVM motif and farnesylation are essential for activation of mTOR (Buerger et al. 2006). Because mTOR exists in the Golgi and ER, endomembrane localization of Rheb provides a better access to the target effector (Buerger et al. 2006). The modifications by Rce1 and Icmt were required not only for proper Rheb localization, but also were dispensable for Rheb-mediated activation of mTOR (Hanker et al. 2010).

The interaction between Rheb and mTORC1 has been suggested to occur on late endosomes (Flinn et al. 2010). Amino acids might control the activity of the mTORC1 pathway by regulating, through the Rag proteins, the movement of mTOR to the same intracellular compartment that contains its activator Rheb (Sancak et al. 2008). However it has been suggested that when Rheb is highly overexpressed, some might become mislocalized and inappropriately encounter and activate mTORC1, which could explain why Rheb overexpression makes the mTORC1 pathway insensitive to amino acids (Sancak et al. 2008). Another interesting finding was that overexpression of EGFP-tagged Rheb leads to its co-localization with Rab7, a marker for endosomal and lysosomal structures independent of the availability of amino acids. Whether wild type Rheb localizes to the endosomes and lysosomes is not yet known (Sancak et al. 2008). 14

It was described that EGFP-Rheb shows a cytoplasmic and nuclear localization in HEK293cells. Rheb expression levels were estimated to be ~40% within the cell nucleus and ~60% within the cytoplasm, the Golgi apparatus and ER together (Yadav et al. 2013). However, most of the studies using fluorescent tagged Rheb shows that Rheb is primarily located in the ER and Golgi (Tamanoi et al. 2010; Swer et al. 2014). In a FRET-FLIM approach, low amount of Rheb was also found in the nucleus indicating that EGFP-Rheb may interact with mTOR in the nucleus as well as in the cytosol (Yadav et al. 2013).

Rheb was found to interact with FKBP38 (Ma et al. 2008; Uhlenbrock et al. 2009), a protein that is mainly found on mitochondria. It was reported that both the proteins co- localize and hence Rheb also localize to mitochondria (Ma et al. 2008). A small portion of Rheb and FKBP38 also existed in the vesicular membrane fraction that includes the ER and endosomal membranes.

Another interesting finding was that Rheb (Ras homolog enriched in brain protein) is recruited to the mitochondrial outer membrane during mitochondrial energetic status- induced mitophagy. Under conditions of increased Oxidative Phosphorylation, Rheb promote mitochondrial degradation. Although Rheb was present in mitochondrial fractions in both oxidative (glutamine-grown) and glycolytic (glucose-grown) cells, an enrichment was found in the mitochondrial fractions isolated from cells grown in oxidative conditions. The anchorage of Rheb to the Outer Mitochondrial membrane occurs via the farnesyl group (Melser et al. 2013).

1.9. Rheb interactions

1.9.1. mTOR

GTP bound Rheb stimulates the kinase activity of mTORC1 either via direct interaction or by inducing a conformational change in mTORC1 that results in enhanced substrate turnover. Rheb has been known to interact with mTOR in several cellular compartments leading to mTORC1 activation (Long, Lin, et al. 2005; Yadav et al. 2013). Rheb can interact with the N-terminal part of the mTOR kinase domain in an amino acid-dependent manner, meaning that binding of Rheb to endogenous and recombinant mTOR is reversibly inhibited by withdrawal of all extracellular amino acids or just leucine (Long, Ortiz-Vega, et al. 2005; Long, Lin, et al. 2005). Even though, Rheb binding to mTOR is independent of the nucleotide bound state, only GTP-bound Rheb can activate mTORC1 directly (Long, Lin, et al. 2005). It is also possible that Rheb may bind to and activate 15 mTOR-interacting proteins such as rictor, raptor or mLST8 rather than interacting with and activating mTOR directly (Inoki et al. 2005; Swer et al. 2014).

1.9.2. Raf

Rheb has been found to interact with Raf-1 kinase or c-Raf in a GTP-dependent manner. The affinity of the Rheb–Raf-1 interaction is regulated by growth factors and second messengers. Rheb transduces growth factor stimuli in the presence of cAMP stimulation (Yee 1997). Even though c-Raf and Rheb interact, the affinity is much lower compared to that of the Raf-Ras interaction (Karassek et al. 2010)

A very interesting finding was that Rheb also interact with B-Raf (Karbowniczek et al. 2004) independent of Rheb farnesylation and this interaction is regulated by growth factor signaling pathways. Rheb decreases the activity of B-Raf kinase in mammalian cells, probably by inhibiting the heterodimerization of B- and C-Raf (Im et al. 2002; Karbowniczek et al. 2004; Karbowniczek et al. 2006).

1.9.3. FKBP38

Recombinant Rheb and FKBP38 were found to interact with each other in an in vitro binding assay. The interaction of Rheb with FKBP38 appeared to be dependent on its nucleotide binding states, because Rheb loaded with GTP-γ-S, a nonhydrolyzable GTP analog, guanosine 5′-O-(3′-thiotriphosphate), exhibited much higher binding affinity toward FKBP38 than did GDP-bound or untreated Rheb (Bai et al. 2007; Ma et al. 2008). FKBP38 is an endogenous inhibitor of mTOR. The interaction between FKBP38 and Rheb antagonizes the inhibitory effect on mTOR (Bai et al. 2007).

1.9.4. PDE4D5

PDE4D5, cAMP phosphodiesterase 4D isoform, was identified as a novel interaction partner of Rheb, thereby linking cAMP to the mTORC1 pathway. cAMP was identified as an activator of mTORC1 and this activation requires Rheb. PDE4D interact with Rheb and act as a sensor for cAMP signaling by inhibiting cAMP mediated mTORC1 activation. Elevated levels of cAMP inhibits the interaction between PDE4D5 allowing the release of Rheb for the activation of mTORC1 (Kim et al. 2010).

1.9.5. NR3A

Another important interaction partner identified for Rheb is the NMDAR subunit NR3A. Synaptic plasticity is dependent on the activation of the N-methyl-D -aspartate receptor

(NMDAR) subtype of glutamate receptors (GluRs) and increased dendritic protein synthesis. NMDARs are heteromeric complexes composed of NR1 and NR2 subunits (NR2A–NR2D) and in some cases additional NR3 subunits (NR3A or NR3B). This interaction between Rheb and NR3A was found in mammalian cell lines, HEK293 cells and in crude membranes (CM) and synaptic plasma membranes (SPM) fractions from the developing rat brain, thus confirming the association in the developing postnatal brain too (Sucher et al. 2011).

1.9.6. Bnip3

Bnip3 (Bcl-2/adenovirus E1B 19-kDa interacting protein 3) is a hypoxia-induced pro-death protein that belongs to the Bcl-2 super family. Bnip3 was reported to have proapoptotic function. Bnip3 is strongly induced by hypoxia and plays a role in hypoxic cell death in cancer cells and cardiomyocytes. Bnip3 inhibits the ability of Rheb to activate mTORC1 by decreasing Rheb GTP level, and mediates the inhibitory effect of hypoxia on mTOR signaling. Under hypoxia, Bnip3 binds to Rheb and inhibits its function either by blocking Rheb interaction to downstream effectors or by interfering with Rheb GTP loading (Li et al. 2007).

Study using myc-Rheb showed that Rheb physically interacts with both endogenous Nix or Bnip3L (Sandoval et al. 2008) and LC3 proteins (Kabeya et al. 2003) which play important role in autophagy. Increased oxidative phosphorylation activity promotes mitochondrial degradation via mitophagy. The mitochondrial localization of Rheb promotes mitophagy through a physical interaction with the mitochondrial autophagic receptor Nix and the autophagosomal protein LC3-II. This interaction occurrs mainly in the outer mitochondrial membrane (OMM) (Melser et al. 2013).

1.10. Rheb Structure

Yu et al, 2004 had first co-crystallized the GTPase domain of hRheb in complexes with substrates GDP, GTP and the GTP analogue GppNHp. X-ray diffraction studies were done for preliminary structural analyses of these complexes (Yu et al. 2004; Yu et al. 2005). Rheb consists of 184 amino acids; the N-terminal 169 amino acids make up the GTPase domain (Heard et al. 2014). 15 C-terminal residues of Rheb are hypervariable with a flexible structure and comprise a conserved carboxyl CAAX motif that plays important roles in the farnesylation of Rheb and its association with membrane (Buerger et al. 2006). Rheb shares about 30-40% sequence homology to other members of Ras/Rap subfamily of 17

GTPases (Yamagatas et al. 1994). However, Rheb possesses unique biological properties that differ substantially from those of other members of the Ras/Rap subfamily. The major structural differences between Rheb and the other small GTPases occur mainly in the switch I and switch II regions that are involved in recognition and interaction with GAPs, guanine nucleotide exchange factors, and effectors. Based on sequence alignment, the switch I regions of Rheb are from residues 33–41 that corresponds to residues 30–38 of Ras, and switch II are from residues 63–79 corresponding to residues 60–76 of Ras (Yu et al. 2005).

Mutation of Gly12 to any other residue except Pro impairs the intrinsic GTPase activity of Ras, making the mutant Ras constitutively active and Rheb contains a conserved Arg15 corresponding to this position and wild-type Rheb has very low intrinsic GTPase activity and a high basal GTP level of approx 50%, which is more than 10-fold higher than that of Ras (Yu et al. 2005). GTP hydrolysis mechanism of Rheb utilizes Asn1643 of TSC2-GAP instead of Gln64 of Rheb as the catalytic residue in GTP hydrolysis (Yu et al. 2005).

Figure 1.5: Ribbon drawing of a representative member of the ensemble structures of rRheb generated using PyMol. Figure from (Karassek et al. 2010).

The structure of Rheb has also been characterized using NMR spectroscopy (Karassek et al. 2010). NMR spectra of Rheb were obtained by analyzing residues 1–169 of Rheb expressed in E. coli (Heard et al. 2014). 1H-15N heteronuclear single-quantum coherence (HSQC) spectra of GDP- and GppNHp-bound Rheb were compared. Changes in chemical shift were observed with residues in and around the P-loop (residues 10–20) and switch II region (residues 60–65) (Heard et al. 2014). 1H-15N heteronuclear single-quantum 18 coherence spectrum of Rheb bound to Gpp(NH)p, the resonance signals for the switch I (residues Val-32 to Phe-43) and II (residues Asp-60 to Ile-78) regions were broadened beyond detection presumably due to a chemical exchange at an intermediate rate on the NMR time scale, in marked contrast to Rheb-GDP (Karassek et al. 2010).

1.11. EGFP Expression System

While the GFP-expression approach is excellent for providing evidence of potential localization of proteins in living cells, since it is an overexpression, one cannot exclude the possibility that the labeled proteins may not interact at their lower natural endogenous levels and can cause their mis-localization. Thus there will always be some uncertainty in the approach. Here we are interested in analyzing how EGFP fusion affects the property of Rheb. Even though the GFP approach is widely used and is the best method available for assessing potential interactions of cell components, one must always be aware of its limitations and do not depend on this method alone for overexpression studies (Yadav et al. 2013).

It was found that the characteristic condensation of EGFP-fusion proteins in dying cells provides a novel and powerful specific probe of apoptotic cell death. The pattern of EGFP fusion protein expression, independent of the inducer of apoptosis itself provides an indication of cell death. Cell rounding and shrinkage associated with the loss of adhesion, result in a condensed EGFP-fusion protein signal in apoptotic cells (Harvey et al. 2001).

1.12. sfYFP system and split GFP system

Bimolecular fluorescence complementation (BiFC) assay is based on the discovery that two non-fluorescent fragments of a fluorescent protein can associate to form a fluorescent complex facilitated by the two interacting proteins fused to them (Kerppola 2006).

The ‘super folder YFP’ was introduced by Ottmann et al in order to generate split YFP constructs that can be expressed in E. coli and are stable in standard buffer systems. This has been achieved by introduction of 15 mutations that have been shown to enhance folding and stability in the green fluorescent protein. The resulting ‘super folder YFP’ was used to analyze the applicability of BiFC for in vitro analysis (Ottmann et al. 2009). However, recent researches have shown that even though some YFP proteins have been used for BiFC for interaction studies, this system now faces a major drawback. It was found that some of the fluorescent protein halves are prone to self-assembly, independent 19 of a protein-protein interaction event and is therefore a cautionary note for the setup of BiFC experiments (Horstman et al. 2014). Interestingly, there has been other reports of split GFP system which were designed for purposes other than any protein-protein interaction studies (Cabantous et al. 2005; Cabantous & Waldo 2006; Pinaud & Dahan 2011). The split GFP system developed by Cabantous et al was engineered in order to overcome the drawbacks of protein tagging and detection methods using the split protein tags, as some of these tags can perturb protein solubility or may not work in living cells. The split GFP system was engineered and it works with the principle that the protein of interest (X) is fused to a small GFP fragment (β-strand 11, residues 215–230) via a flexible linker (L). The complementary GFP fragment (β-strands 1–10, residues 1–214) is expressed separately. Neither fragment alone is fluorescent. When mixed, the small and large GFP fragments spontaneously associate, resulting in GFP folding and formation of the fluorophore (Cabantous et al. 2005; Cabantous & Waldo 2006). Another split-GFP system was also used to target, image, and track individual proteins in living cells (Pinaud & Dahan 2011).

The sfYFP though have been designed for protein-protein interaction studies, was found to self-reconstitute. Hence in the current thesis we have elucidated applications of the split sfYFP system taking advantage of their ability to complement each other and improved solubility in vitro.

1.13. Small molecules binding to Rheb. The inhibition of protein-protein interactions using small molcelues have been used since several years in cancer therapy. The therapies have been targeting the most common oncogene K-Ras. Most of these molecules inhibit the (GEF) Sos-mediated nucleotide exchange of Ras (Hall et al. 2013). Rheb activation, could also lead to tumorogenic growth in the body as seen with Tuberous Sclerosis complex. Only one small-molecule inhibitor of Rheb with a rather low affinity (Kd 1500 ± 200 μM) has been reported until today (Schöpel et al. 2013). NMR chemical shift perturbations were observed in the lipophilic binding site that includes the flexible switch II amino acids Tyr67, Ile69, Phe70-Ile78, and Tyr81 as well as the residues Leu103, Met106, Val107, and Lys109 located in α-helix 3. Another molecule, Bisphenol A was also identified to bind to Rheb as well as K-Ras but with a lower affinity to Rheb (Kd 1800 ± 500 μM) (Schöpel et al. 2013). However, it is very interesting to study the mechanism of action of these molecules in cells.

2. AIMS:

I: To investigate the molecular mechanism of fp-Rheb- mediated apoptosis.

Rheb transforms into a pro-apoptotic protein based on the type of the fusion protein. Fusion of Rheb with small tags like flag or myc does not induce cell death in secondary cell lines but fusion of large fluorescence protein like EGFP or sfYFP renders Rheb pro- apoptotic. Investigation of the molecular basis of the fluorescent protein fused Rheb (fp- Rheb) mediated apoptosis by various approaches is the main aim of the current study. These include:

A: Cellular localization

B: Expression levels

C: Mass Spectrometry

D: NMR Spectroscopy

II. Effect of small molecules binding to Rheb.

In the second part of this thesis, the aim is to investigate the cellular effect of small molecule binding to Rheb. This could have implications in developing therapeutic tools targeting pathological conditions involving Rheb.

3. Materials and Methods

3.1. Materials

3.1.1. Media

i) 2-YT medium Peptone 16g Yeast Extract 10g NaCl 5g

Final volume was adjusted to 1L using sterile H2O Autoclave at 1210C for 15 min

ii) Minimal Medium

CaCl2 300µl/L

MgSO4 1ml/L M9 Solution (10X) 100ml Glucose 10g/L Trace Elements (100X) 10ml Biotin (5mg/ml) 200µl/L Thiamine (5mg/ml) 200µl/L

NH4Cl2 5g/L Ampicillin (50mg/ml) 1.5ml/L Chloramphenicol (34mg/ml) 1ml/L

Final volume was adjusted to 1L using sterile H2O

iii) M9 solution (10X)

Na 2HPO4-2H2O 75.2g/L

KH2PO4 30g/L NaCl 5g/L

iv) LB-Ca-Amp/Kan Plates Peptone 10g/L NaCl 10g/L Agar 15g/L Yeast extract 5 g/L 22

pH 7,4 100μg/ml Ampicillin or 34µg/ml Chloramphenicol or 35μg/ml Kanamycin. v) DMEM complete media for Secondary Cell Culture. DMEM high Glucose 450ml 10% Fetal Calf Serum 50ml Penicillin/Streptomycin 5ml 1% L-Glutamine 5ml

3.1.2. Solutions for SDS-PAGE and Immunodetection i) Upper Tris SDS 0. 4 %( w/v) Tris-HCl pH 6,8 500mM ii) Lower Tris SDS 0. 5 %(w/v) Tris-HCl pH 8.8 1.5M iii) SDS PAGE running Buffer 10X TG 100ml/L 10% SDS 10ml/L iv) SDS gel pipetting Scheme. Reagents for 12 %Separating Gel 15 ml Water 5ml Lower Tris (pH8.8) 3,75ml Acrylamide solution 6 ml APS 100 μl TEMED 10 μl

Reagents for 5%Stacking Gel 6 ml Water 3.4ml Upper Tris (pH 6.8) 5ml Acrylamide solution 1ml

APS 60μl TEMED 10μl v) Blot buffer. 10X TG 100ml/L 10% SDS 1ml/L 100% Ethanol 200ml/L vi) TG (10X) Glycine 19.2mM Tris 2.5mM pH 7.4 vi) TBST 10X TBS 100ml/L Tween-20 1ml/L vii) TBS (10X) Tris-base 0.5M NaCl 1.5M pH 7.4 viii) 4X Laemmli buffer Glycerin 40%(w/v) PyroninY 0.04% (w/v) SDS 8%(w/v) Tris HCl pH 7,6 250mM β-Mercaptoethanol 70µM(freshly added) ix) Ponceau staining solution: Ponceau S 2% (w/v) TCA 30%

24 x) Coomassie Staining Solution. Coomassie powder 0.1% (w/v) Methanol 20% (v/v) Acetic Acid 10% (v/v) xi) Destaining Solution Methanol 50% (v/v) Acetic Acid 10% (v/v) xii) Blocking solution: Skim milk powder 5% (w/v) in 1X TBST

3.1.3. Antibodies for Immunodetection

Primary Antibodies Host Dilution Company

Anti-Myc (#2276) Mouse 1:1000 Cell Signaling Technology

Anti-Rheb (#26015) Mouse 1:1000 New East Biosciences

Anti-Tubulin (# T9026) Mouse 1:5000 Sigma

Anti-phospho-S6 (#2211) Rabbit 1:1000 Cell Signaling Technology

Anti-S6 (#2217) Rabbit 1:1000 Cell Signaling Technology

Anti-GFP (#G10362) Rabbit 1:3000 Invitrogen

Anti-cleaved-caspase-3 (#9661) Rabbit 1:1000 Cell Signaling Technology

Secondary Antibodies Host Dilution Company

Anti-Mouse Goat 1:5000 Sigma

Anti-Rabbit Goat 1:5000 Sigma

3.1.4. Solutions for mini-prep plasmid isolation and agarose gel electrophoresis i) 10X TEB EDTA 2 mM Tris-Borat pH 8, 0 89 mM

Boric acid 89 mM EDTA 2 mM

Final volume was adjusted to 1L using sterile H2O ii) DNA-Probing buffer (6x) Bromphenolblue 0, 25 % EDTA 100 mM Glycerin 30 % (w/v) Xylencyanol 0, 25 %

Final volume was adjusted to 10mL using sterile H2O iii) Ethidium Bromide Solution 0.5- 1% (v/v) Ethidiumbromide in 1x TEB iv) GTE-Solution Glucose 50 mM EDTA 10 mM Tris/HCl, pH 8, 0 25 mM v) Lysis-Solution NaOH 0, 2 M SDS 1% (w/v) vi) Kac-Solution Potassiumacetate 3 M Acetic acid 1, 8 M vii) TE-Buffer with RNase Tris/HCl, pH 8,0 10 mM EDTA 1mM RNase 25 μg/ml

3.1.5. Solutions for immunostaining i) Potassium phosphate buffer (PBS)

1M K2HPO4 80.2ml

1M KH2PO4 19.8ml

pH 7.4

The final volume was made up to 1L using H2O ii) 4% Paraformaldehyde (PFA) solution 4g of PFA was added to 90 ml of PBS. The mixture was heated to 400 C until the PFA was dissolved. The pH was adjusted to 7.4 using 1M NaOH and final volume was brought to a volume of 100ml iii) 0,1% Triton-X-100 Triton-X 100 0,1 % (v/v) in 1X PBS

iv) 5% Blocking Buffer Bovine Serum Albumin 5% (w/v) in 1X PBS

3.1.6. Antibodies for Immunostaining

Primary Antibodies Host Dilution Company

Anti-Myc (#2276) Mouse 1:500 Cell Signaling Technology

Secondary Antibodies Host Dilution Company

Anti-Mouse Alexa flour Goat 1:1000 Invitrogen 488 (#A-11001)

3.1.7. Buffers for mammalian cell lysis i) RIPA Buffer (2X) Tris/HCl pH 7.5 100 mM NaCl 300mM NP-40 2% EDTA 2 mM 27

NaDeoxycholate 0.2% Protease Inhibitor Cocktail 1:50 (freshly added) 1M DTT 1mM (freshly added) Phosphatase inhibitor 1:100 (if required; freshly added) ii) Wash Buffer – GFP-TRAP Pull down Tris HCl pH 7.4 10mM NaCl 150mM EDTA 0,5mM iii) Lysis Buffer (1X) Tris HCl pH7.4 50mM NaCl 150mM

MgCl2 1.5mM EDTA 4mM Glycerol 10% Triton-X-100 1% Protease Inhibitor Cocktail 1:50 (freshly added) DTT 1mM (freshly added) Phosphatase inhibitor 1:100 (freshly added)

3.1.8. Buffers for Bacterial cell lysis and affinity purification GST-tag Protein purification i) GST buffer TrisHCl pH 7.4 50mM NaCl 100mM

MgCl2 2mM Protease Inhibitor 1: 250 (freshly added) DTT 2mM (freshly added) ii) Wash Buffer TrisHCl pH 7.4 50mM NaCl 100mM MgCl2 2mM

iii) Elution Buffer TrisHClpH 7.4 50mM Glutathione 20mM pH 8 iv) Buffer for reconstitution assay TrisHCl pH7.4 20mM NaCl 150mM MgCl2 5mM Mercaptoethanol 2mM pH 8.8

His-tag protein purification i) 10x PTB (Phosphate buffer)

Na2HPO4 500mM Tris 50mM pH7,8

ii) Washing buffer NaCl 500 mM Imidazole 10 mM in 1x PTB

iii) Elution buffer NaCl 500mM Imidazole 250mM in 1x PTB

3.1.9. Primer pairs Primers (5`-3` sequences) RhebC8 Forward: AATTCCCGGGAAGTCTTCGTGCTCGGTGATGTGAG Reverse: GATCCTCACATCACCGAGCACGAAGACTTCCCGGG RhebC20 Forward:

AATTCCCTTGGAAGCAGAAAAGATTGACGGAGCGGCTTCACAAGGGAAGTCTTCG TGCTCGGTGATGTGAG Reverse: GATCCTCACATCACCGAGCACGAAGACTTCCCTTGTGAAGCCGCTCCGT CAATCTTTTCTGCTTCCAAGGG RasC20 Forward AATTCCCAAGCTGAACCCTCCTGATGAGAGTGGCCCCGGCTGCATGAGCTGCAAG TGTGTGCTCTCCTGAG Reverse GATCCTCAGGAGAGCACACACTTGCAGCTCATGCAGCCGGGGCCACTCTCATCAG GAGGGTTCAGCTTGGG psfYC-N1 Forward GAT CCA CCG GTC GCC ACC ATGGACA AGCAGAAGAA CGGCATCAAG GC Reverse GTGGCGACGCGGCCGCTCACTTGTACA GCTCGTCCATGCCGAG psfYN-N1 Forward GAT CCACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCA CC Reverse GTGGCGACGCGGCCGCTCAGGCCGTG ATATAGACGT TGTGGC Rheb-deltaCAAX-sfYC/YN: NheI-Forward: CTTAGCTAGCGTCGCCACCATGCCTCAGTCCAAGTCCCGGAAGATCG BamHI-Reverse: GACCGGTGGATCCCGCGAAGACTTCCCTTGTGAAGCCGC Ras-deltaCAAX-sfYC/YN: NheI-Forward: CTTAGCTAGCGTCGCCACCATGACAGAATACAAGCTTGTTGTTGTTGGCGCC BamHI-reverse: GACCGGTGGATCCCGCTTGCAGCTCATGCAGCCGGGGC His6-Rhebdelta CAAX-YN. Forward: GGTCGCAGATCTATGCCTCAGTCCAAGTCCCGG

Reverse : CCAGGTCGACTCAGGCCGTGATATAGACGTTGTGGC GST-YC BamHI –forward: CGTGGATCCCCGGGAGACAAGCAGAAGAACGGCATCAAGGCG ECoRI -reverse : ACGATGAATTCCCGGCTACTTGTACAGCTCGTCCATGCCG Rhebwt-EGFP BglII- Forward : TAGCCTCAGATCTTCGCCACCATGCCTCAGTCCAAGTCCCGG ECoRI- Reverse : CTGCAGAAT TCGCATCACCGAGCACGAAGACTTCC RASV12- EGFP BglII -forward : TAGCCTCAGATCTTCGCCACCATGACAGAATACAAGCTTGTTGTTGTTGGC ECoRI- Reverse : CTGCAGAATTCGGGAGAGCACACACTTGCAGCTCATGCAGC EGFP-Rasv12 ECoRI- Forward : AGGCTCCTTCGAATTCTGACAGAATACAAGCTTGTTGTTGTTGGCG BamHI- Reverse: CGGTGGATCCCG TCAGGAGAGCACACACTTGCAGCTC GST-YC-Rheb BamHI Forward : CCGCGTGGATCCGACAAGCAGAAGAACGGCATCAAGGCG XmaI reverse : GAGACTCCCGGGTCACATCACCGAGCACGAAGACTTCCC

His6- EGFP-Rheb BamHI Forward: CATCACGGATCCATGGTGAGCAA XmaI Reverse: CGACCCGGGTCACATCACCGAGC

3.1.10. Plasmids Plasmid Company pEGFP-C3 BD Bioscience Clonetech pEGFP-N1 BD Bioscience Clonetech pGEX-2T GE Healthcare pQE-30 Qiagen pET-23a Novagen pGEM®-T Easy Promega

The sfYFP and the split halves of sfYFP; YN, the N-terminal half and YC, the C-terminal halves of sfYFP were kindly gifted by Prof. Dr. Ottmann, Max Planck Institute of Molecular Physiology, Dortmund, Germany.

Flag-Rheb, myc-Rheb, pCDNA3.0 (Myc), myc-Ras, H2B-RFP, EGFP-Rheb, sfYFP-Rheb sfYC-C1, sfYN-C1, YC-Rheb, YN-Rheb clones were kindly provided by Dr. Christoph G Goemans from the department.

3.1.11. Lab Equipments

Apparatus Manufacturer Agarose gel electrophoresis system Bio rad Blotapparatus EPS 2000 Bio rad Bacterial Incubator Certomat R

CO2 incubator HERA cell 240i Thermo Scientific Centrifuge 5415 Eppendorf ELISA reader Tecan Sunrise Fluorecsence Microscope Olympus IX51 Hyperfilm Fischer Scientific Gel Blotting paper Schleicher & Schuell Gloves Meditrade Nitrocellulosemembrane GE health care Glass coverslips /Slides Menzel-Gläser Mastercycler personal/gradient Olympus Plasticwares (Pipette tips, tubes, etc) Sarstedt, falcon SDS-Gel electrophoreses system Bio rad Sterile bench Heraeus

Thermomixer 5436 Eppendorf UV-VIS Densitometer UV-1202 Shimadzu UV 1202 Vortex-Genie II Bender&Hobein AG Cell Culture plates (96-, 24- and 6-Well) Sarstedt PD-10 Columns Millipore Microfluidizer Microfluids Corporation Amicon Ultra-15 Centrifugal Filter Units GE Healthcare Ultrospec 2000 UV-Vis-Spectrometer Pharmacia Biotech Needles Braun Syringe Terumo Megafuge 1.0R Heraus UV crosslinker Hoefer -80 Freezer Thermo Scientific Water bath Memmert Confocal Microscope Leica Luminescence Spectrometer Parkin Elmer

3.1.12. Cell Culture Solutions and Antibiotics

Substance Manufacturer. DMEM High/Low-Glucose PAA FCS PAA, Biochrom Penicillin/Streptomycin Gibco BRL, Invitrogen, PAA Trypsin PAA

3.1.13. Enzymes for molecular biology. All restriction enzymes, Calf intestinal Phosphatase (CIP), T4 DNA ligase and Taq polymerase were purchased from New England Biolabs (NEB). Enzymes were stored at - 200C and used with appropriate 10X buffers from the manufacturer.

3.1.14. Kits Used

Kits Manufacturer DC protein Assay Bio Rad Super Signal West Pico Chemiluminescent Thermo Scientific Substrate Protein G IP Kit Sigma Aldrich Midi-prep Kit Macherey Nagel GFP-TRAP Agarose Chromotek

3.1.15. Chemicals and consumables Chemicals Manufacturer

Acrylamide solution Roth Agar Roth APS JT Baker β-Mercaptoethanol Roth BSA Biomol DMSO PAA DNA ladder Thermoscientific- Fermentas DTT JT Baker EDTA Sigma Ethanol Merck Ethidiumbromide Sigma Na Cl Fischer Chemical Milk powder Applichem MTT Sigma Phosphatase-Inhibitor Sigma Ponceau S Biomol Polyfect Qiagen Xfect Transfection reagent Clontech Peptone Fluka Yeast Extract Roth PageRuler Plus Prestained ProteinLadder Thermoscientific- Fermentas Protease inhibitor Roche

SDS Biomol TEMED Fluka Triton-X-100 Fluka Tween 20 Acros Organics Glutathione Sepahrose beads Macherey Nagel Thrombin Serva Reduced Glutathione Serva Ni-NTA beads Macherey Nagel Mowiol Roth All other chemicals were purchased from Fluka, Biomol, JTBaker, Roche, and Acros Organics.

3.1.16. Softwares ImageJ Clone manager CorelDRAW Graphics Suite X7

3.1.17. Statistics

Student’s T-test T-test: Two sample assuming Unequal Variance

3.2. Methods

Molecular Biology

3.2.1. Polymerase Chain Reaction

A PCR reaction was initially set up in order to sub-clone the gene of interest into a particular plasmid. The plasmids used were either for mammalian expression or for bacterial expression of the protein of interest. A PCR mix was prepared in the PCR tubes and then the tubes were transferred to the PCR Cycler for the reaction to occur.

Components Volume Template 10 - 50ng Forward Primer (100µM) 1µl Reverse primer (100µM) 1µl 10X Buffer 5µl dNTPs (1,25µM) 5µl Taq polymerase 1µl

H2O ad 50µl

There are three major steps in a PCR: denaturation at 94°C, annealing at 54°C, and extension at 72°C, which are repeated for 30 or 40 cycles. Step Temperature Duration Purpose 1 98° C 3 min Initial denaturation 2 98° C 1 min denaturation 3 56 ° C 1 min Annealing of primers and polymerase (annealing) 4 72 ° C 1 min elongation 5 72 ° C 10 min Final elongation

3.2.2. Restriction Digestion of DNA

This enzymatic technique can be used for cleaving DNA molecules at specific sites. DNA was restricted with commercial restriction enzymes. The digestion was performed in the recommended buffer. Double digestions were performed in a buffer yielding sufficient cleavage rate for both enzymes. A typical double digestion protocol for PCR eluted DNA is given below. Buffer system recommended by NEB has been followed:

PCR eluted DNA Xµl (volume depends on the concentration of DNA) 10 X NEB Buffer 4 5µl BamHI HF 2µl ECoR I 2µl

H2O ad 50µl

3.2.3. De-phosphorylation of plasmid DNA

One µl of CIP (Calf intestine phosphatase) was used in the restriction digestion mixture to prevent the dephosphorylation and religation of digested plasmid. The reaction mixture was incubated at 37oC for 30 min (minutes).

3.2.4. Oligonucleotide Annealing

Oligonucleotde annealing steps were used to add a short stretch of DNA, such as C- terminal 8 or 20 amino acid sequences to C-terminus of EGFP in the vector pEGFP-C3. Complementary oligos were designed to carry the desired restriction enzyme sites. For the annealing step, the oligos were resuspended in annealing buffer (10mM Tris, pH7.5-8.0, 50mM NaCL, 1mM EDTA) and mixed in equimolar concentration in a microcentrifuge tube. These tubes were placed in a hot block set at 90-950C for 3-5 min. Then the tubes were removed from the block and allowed to cool down to room temperature. The short stretches of DNA carry the sticky ends for a specific enzyme and were then ligated to the vector which has been digested with the same specific enzymes.

3.2.5. Ligation of DNA

Two DNA fragments were ligated using T4 ligase enzymes, provided they have compatible ends. This procedure can be used to insert a PCR product into a linearized vector. The ligation was performed in a15 µl reaction, where the ratio of vector: insert was approximately 1:2. Basic ligation reaction set up is as follows: The mixture was incubated for 2 hrs at room temperature or overnight at 15°C.

Linearized dephosphorylated Vector 2.5µl Insert with compatible ends 2µl 10X ligase buffer 1.5µl

Ligase 1µl

H2O 8µl Total volume 15µl

3.2.6. Agarose Gel Electrophoresis

To separate a mixture of DNA fragments or to detect the size and concentration of a DNA fragment, agarose gel electrophoresis was carried out. Agarose gels were prepared in 1X TEB buffer which was also used as a running buffer. 1, 5% (w/v) or 1 % (w/v) agarose gel was prepared based on the purpose and size of the DNA fragments to be resolved. The sample was mixed with 6X sample buffer and transferred into wells within the gel. An electric potential was applied and the DNA, due to its negative charge, migrates toward the positive pole. The small DNA fragments migrate faster and thus resolve into different bands based on their molecular weight. The gel was stained using ethidium bromide, which intercalates into DNA and fluoresce upon UV illumination allowing visualization of DNA.

3.2.7. Isolation of DNA from Agarose Gel

DNA samples, which were separated by the agarose gel electrophoresis, can be further purified by isolation from the Agarose gels using a kit. For this purpose the gel extraction kit from the company Genome was used. All steps were performed according to the manufacturer's instructions and the eluted DNA stored at-20 °C.

3.2.8. Transformation of competent Novablue and (BL-21 ) Rosetta DE3 cells

100-200µl of the competent bacterial cell suspension was placed on ice. 7.5µl of the ligation mix or 1µg of the plasmid DNA was added to the tube containing the bacterial suspension. The mixture was placed on ice for 20 min. After that the tube was placed on a heating block set at 420C (heat-shock) for 45 sec (seconds) and then placed on ice for 2 min. 600µl of SOC medium was added to the tube and incubated in a shaker at 370C for 1 hr. After that the cell suspension was centrifuged at 5000rpm for 3 min. The supernatant was discarded and the pellet was resuspended in 100µl of SOC medium. Afterwards bacteria were plated on agar plates containing the respective antibiotic. The plates were incubated overnight at 370C.

3.2.9. Plasmid isolation by Mini-prep and Midi-prep

The transformed colonies were picked and inoculated into 2ml 2YT medium containing the respective antibiotics for overnight at 370C. The next day, 1,5ml of the bacterial suspensions were centrifuged at 5000rpm for 5 min and the supernatant was discarded. The bacterial pellets were resuspended in 100µl GTE solution followed by 200µl of lysis buffer. Then the tubes were inverted 5-6 times and left at room temperature for 5 min for the cell lysis to occur. Finally, 150µl of KAc solution was added and again the tubes were inverted 5-6 times. The final suspension was centrifuged (14,000rpm, 10 min at room temperature) and the supernatant was collected in a new tube containing 1ml of absolute ethanol. The mixture was again centrifuged (14,000 rpm, 30 min, 40C) and the pelleted plasmid DNA was washed using 70% ethanol (14,000 rpm, 10 min, room temperature). The pellet was then dried at room temperature and resuspended in 100µl of TE buffer with RNase.

To obtain a highly pure and high yield of plasmid DNA, the commercially available plasmid DNA isolation kit from Macherey Nagel was used. For this, an overnight culture of transformed bacterial cells in 100ml 2YT medium along with the respective antibiotics was prepared. The bacterial suspension was pelleted and the supernatant discarded. Further steps were done as per instructions from the manual.

3.2.10. Determination of DNA concentration

For determining the concentration of the plasmid DNA, first a 1:100 dilution of the DNA was prepared in 1ml H20. The absorbance of this plasmid solution was measured at 260 nm and 280nm. The ratio of the absorbance gives the purity of the sample and the absorbance at 260nm gives the concentration of DNA as per the formula:

C = 50 x 100 x OD260 µg/µl Formula 1. 1000

Cell Culture

3.2.11. Cultivation and passaging of HeLa cell lines

HeLa cells were cultivated in a 75ml culture flask and incubated at 370C with 10%

CO2.The growth media from the HeLa cells of the previous passage was aspirated and 3ml of 10% Trypsin Solution was added to the flask. The flask was then incubated at 370C 39

(max 5 min) to allow the trypsination to occur. After the cells were detached from the surface of the flask, 5ml of warm full DMEM was added to stop the trypsinization. The cells were collected in a falcon tube and pelleted at 1000rpm for 3 min. The supernatant was carefully aspirated and the pellet resuspended in 1ml of full DMEM medium. Approximately 50-100µl of the cell suspension was then seeded on to new flask containing 0 20ml of warm full DMEM media. The cells were incubated at 37 C with 10%CO2until the required confluency has been reached.

In order to seed the cells in 6 well plates or 96 well plates, 20µl of the cell suspension was added to a Neubauer chamber and the number of cells in 0, 1µl volume was counted. From this the number of cells in 1ml was calculated. The volume of cell suspension to be taken for seeding cells in a 6 well plate was calculated from the formula given below:

Volume to be taken (ml) = 150,000 Number of cells in 1ml of suspension Formula 2.

Approximately 1ml of the cell suspension with a cell count of 150,000cells was seeded to 0 each wells of a 6 well plate. The plates were also incubated at 37 C with 10% CO2.

3.2.12. Transient Transfection of Secondary Cell lines

All transfections were carried out using the Xfect transfection Kit (Clontech) with adherent cells in cell culture dishes, after 24 hrs (hours) of seeding in the exponential growth phase of the cells. The cell number and DNA levels were selected as specified by the growth surface of the cell culture dish.

In a microcentrifuge tube, 5 μg of the plasmid DNA were diluted with Xfect Reaction buffer to a final volume of 100 μl and mixed well. In another tube, 1.5 μl of Xfect Polymer was diluted with Xfect Reaction buffer to a final volume of 100 μl and mixed well. The contents of the two tubes were mixed and vortexed for 10 sec. The mixture was incubated for 10 min at room temperature to allow nanoparticle complexes to form. The entire 200 μl of nanoparticle complex solution was added dropwise to the cell culture plate containing 1ml of growth medium and culture dishes were gently rocked. The plates were incubated at 37°C for 4 hr. After 4 hrs, the medium was replaced with 2 ml fresh complete growth medium, and the plates returned to 37°C incubator until time of analysis. The setup for a transfection procedure has been shown in the table below.

Culture Surface Growth DNA Final Dilution Xfect Polymer Vessel Area/ Medium Volume(in Volume

Well Xfect Reaction Buffer) 2 6-well plate 10 cm 1 ml 5μg 200 μl 1,5µl

3.2.13. Cell count for apoptosis

The cells were counted for apoptosis after 24 or 48 hrs of transfection or 4 hrs after UV treatment (300J/cm2). The cell count was done under a fluorescent microscope. Approximately 1000 cells per transfection/treatment were counted. Apoptotic cells were counted by counting the number of fragmented nuclei. Transfection of H2B-RFP allows visualization of nuclei. Alternatively, To-PRO3 or DAPI was also used for detecting nuclei. The percentage of transfected apoptotic cells was determined using the formula:

% of apoptosis = Number of apoptotic transfected cells x 100 Formula 3. Total number of transfected cells

3.2.14. Preparation of cell lysates

After the cell count or transfection for a required amount of time, the cells were scraped from the surface of the cell culture plate and collected in eppendorf tubes along with the medium. The cells were pelleted at 5000rpm for 3 min at room temperature and the supernatant was discarded. The pellet was then washed two-times using 1X PBS (5000 rpm, 3 min room temperature). Subsequently, the cell pellet was resuspended in 50-100µl of 1X lysis buffer and placed on ice for 20 min with vortexing every 10 min. The lysed cell suspension was then centrifuged at 13,000rpm, for 20 min at 40C. The supernatant was collected in a sterile eppendorf tube and stored at -80oC. Alternatively, the total protein concentration could be estimated by using the protein estimation kit from Biorad.

3.2.15. Fixing transfected cells

HeLa cells were seeded on coverslips (10mm) and transfected with the required plasmids. 48 hrs post transfection, the growth medium was removed and the cells were washed with 1X PBS. 1,5ml of Ice-cold 4% PFA was then added to each well and incubated at room temperature for 15 min. After that, the cells were washed 3 times with 1X PBS. Following 41 this the cells were stained with TO-Pro3 (1:2000 dilutions in 1X PBS) for nuclear staining in dark for 20 min. The cells were washed again with 1X PBS and finally with water to remove the excess stain and salts. The cover slip was then mounted onto slides using the Moviol Mounting agent. The slides were then placed in dark until the mounting agent was dried.

3.2.16. Immunostaining

After the cells were fixed, they were permeabilized using 0,1% Triton-X-100 in 1X PBS by incubating on ice for 10 min.The cells were washed 3 times with 1X PBS. After the washing step, non-specific binding sites were blocked with 3% of BSA for 1 hr at room temperature. The cells were then incubated overnight with primary antibody at 40C followed by washing 5 times in 1X PBS. The cells were then incubated with the Alexa- Fluor secondary antibodies for 2 hrs in dark at room temperature and again washed 5 times in 1X PBS. Finally the cells were incubated with TO-Pro3 stain (1:2000 dilutions in 1X PBS) for 20 min in dark and washed 3 times in 1X PBS and 2 times in H2O. The cover slips carrying the cells were then mounted onto slides using the Moviol Mounting agent. The slides were then placed in dark until the mounting agent was dried.

3.2.17. MTT assay

The MTT assay was used to determine the viability of HeLa cells in the presence of 4, 4 ′ - Biphenol. Cells (6× 104) were plated in each 96 well and incubated for 20 h at 37°C with 10% CO2. Cells were then treated with various dilutions of 4,4 ′- Biphenol dissolved in DMSO as well as respective concentrations of DMSO without 4, 4 ′-Biphenol. The background effects of DMSO on cell viability were subtracted. Plates were incubated with

4, 4 ′-Biphenol for 4 h at 37°C with 10% CO2. A 5 mg/mL stock of MTT (3-(4, 5- dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, Sigma) was diluted 1:10 into prewarmed medium. Culture media were then replaced with diluted MTT solution. Plates were then incubated for another 3 hrs at 37 °C with 10% CO2. After incubation, supernatants were removed, and 100 μL of 100% DMSO was added. Plates were then placed on an orbital shaker for 10 min, and the absorbance was recorded at 570 and 620 nm. The percentage of degenerating cells in presence of 4, 4 ′ -Biphenol was expressed as absorbance relative to that of the control.

Biochemistry

3.2.18. SDS PAGE and Western Blot for Immunodetection

Based on the protein concentration, equal amount of proteins were taken for gel run. After the estimation of the protein concentration, the respective amount of lysate was mixed with 4X LSB and heated at 950C for 5 min to prepare the samples for SDS-PAGE. The samples were loaded into a 10-12% gel. A pre-stained marker was also loaded for determining the molecular mass of the protein in the samples. The gel was run initially at 100 volts in the stacking gel and 120 volts in the separating gel.

Following electrophoresis, the proteins were transferred onto a nitrocellulose membrane using a wet transfer system in 1x transfer buffer. The transfer was done for 2 hrs at 100 volts. The success of the transfer was analysed by staining the membrane with Ponceau S which bind to the proteins and can be seen as red bands on the membrane.

Then the membrane was blocked using 5% milk solution in 1X TBST for 1 hr with mild shaking at room temperature, to block the non-specific binding of the antibodies. The membrane was then incubated with the primary antibody solution (Primary antibody diluted in 1% milk-TBST solution) overnight at 40C with mild shaking. After the primary antibody treatment, the membrane was washed 3 times with 1X TBST for 10 min each followed by incubation in secondary antibody solution (Secondary antibody diluted in 1% milk-TBST Solution) for 1 hr at room temperature. The secondary antibody was raised against the host of the primary antibody (anti-rabbit or anti-mouse) and conjugated to Horse-radish-peroxidase. The membrane was then washed three times 10 min each with 1X TBST and incubated for 5 min with the enhanced luminol-based chemiluminescent substrate to detect the horse-radish-peroxidase conjugates on the membrane. The membrane was then exposed to films in the dark room and then developed and fixed using the respective solutions. The positions of the detected bands were marked in alignment with the protein marker.

3.2.19. Coomassie Staining and Destaining

In order to detect the proteins directly from the gel based on the size of protein bands, coomassie stain was used to stain the gel. After the electrophoresis, the gel was incubated with coomassive staining solution for 12 hrs at room temperature. After incubation, the gel was destained using methanol and glacial acetic acid.

3.2.20. GST protein Purification For protein expression using the bacterial expression system, the (BL-21) Rosetta DE3 strain was used. The YC-Rheb, YC or YN were subcloned into pGEX-2T vector with a Thrombin cleavage site allowing separation of the GST from the protein of interest. The plasmids were transformed into the competent cells. A single colony was picked and a starter culture was made in 5ml 2YT medium along with chloramphenicol (1µg/ml) and ampicillin (100µg/ml). From this starter culture, an overnight culture was prepared in 200ml of 2YT medium with appropriate antibiotics.

For GST-YC-Rheb, this overnight culture was inoculated into a 5 liter medium and 0 incubated at 37 C under shaking until the OD595 reaches 1.0. The cells were then pelleted and the pellet resuspended in 1liter of minimal medium for 15N enrichment. After incubation for an hour at 370C, the culture was induced with 1mM IPTG and further incubated for 3 hrs at 370C.

However, for unlabelled proteins like GST-YC or GST-YN, the overnight culture were inoculated into 2 liter 2YT medium and incubated at 370C until OD reaches 0, 8. The cells were induced with 1mM IPTG and incubated for further 2 hrs at 370C and then cooled to 280C for overnight to allow the protein production.

After induction, cells were pelleted and resuspended in 50 ml of GST buffer containing 100µM DTT and protease inhibitor. The cells were lysed using the micro fluidizer and centrifuged at 10,000rpm for 45 min at 40C. During this time, 5ml of the 75% solution of glutathione sepharose beads were washed 3 times with GST buffer at 2400rpm for 10 min at room temperature. The lysate was mixed with the beads and rotated for 2 hrs at room temperature. Then the mixture was centrifuged at 2400 rpm for 10 min. An aliquot was taken for SDS-PAGE analysis. This was followed by three steps of washing in GST buffer, each time taking samples for SDS analysis.

Thrombin was then added to the bead-protein mixture allowing thrombin to cleave off the protein of interest from the GST. 80 units of thrombin/liter of the culture were added to the mixture and the reaction was allowed to take place overnight at room temperature. The mixture was then centrifuged at 2400rpm and the supernatant was collected. The pellet was resuspended again in GST buffer to collect all the thrombin cleaved protein. Finally the GST was eluted from the beads using the elution buffer. After elution, Glutathione in the eluate could be removed using the PD10 (gel filtration) columns from GE healthcare. The 44 beads could be regenerated after several washing step using alternatively a high salt and low salt buffer and finally with GST buffer. The pellet was the resuspended in 20% ethanol.

3.2.21. His-Tag Protein purification

For His6 tagged protein purification, the EGFP-Rheb construct was subcloned into pQE-30 vector.The initial procedures for culturing the transformed bacteria, protein induction and cell lysis is the same as for the 15N enriched GST tagged protein preparation. To purify

His6 tagged proteins, Ni-NTA beads from Macherey Nagel were used. The lysates were mixed with 2ml of Ni-NTA beads that was washed with 1X PTB buffer. The mixture was incubated for 4 hrs at 40C with slight agitation for capturing the His tagged proteins on the beads. Following the capture, the samples were washed 3 times with wash buffer and wash samples were collected for SDS analysis. Finally the His6-EGFP-Rheb proteins were eluted from the beads using 1.5ml of elution buffer. This was done one more time to collect all the proteins from the beads. The protein samples were concentrated to a final volume of 1ml and the protein concentration was determined by protein estimation kit from Biorad. The samples were submitted for NMR Spectroscopic measurement at the Department of NMR Spectroscopy at RUB.

3.2.22. GFP- TRAP Immunoprecipitation

For the pull down of EGFP-Rheb, the GFP-TRAP coupled to agarose beads from Chromtek was used. The cell lysates of the EGFP-R +/-UV were prepared using the 1X RIPA buffer. The concentration was measured using protein estimation kit from Biorad. Approx 40µl of plain agarose beads and GFP-TRAP agarose beads were washed 3 times (1000rpm, 40C, 2 min) using ice cold wash buffer and mixed with 300µg of proteins and 200µl ice cold wash buffer. The mixture was incubated at 40C for 3 hrs with constant shaking. Then the suspension was washed using ice cold wash buffer 3 times (1000rpm, 2 min, 40C). Unbound samples were collected for gel run. The pelleted GFP-TRAP were resuspended in 1X- LSB and heated at 950C for 5 min.

3.2.23. Myc Immuno precipitation

The cell lysates were prepared according to 3.2.13 (100-600µl, 300µg) and concentration was determined. The lysates were mixed with 2µl of anti-myc antibody in the 1X IP buffer supplied with the kit into an empty spin column. The columns were incubated for 4 hrs at 40C, mixing the sample by inversion. During the incubation time, 30µl per reaction of the protein G agarose beads were washed with 1ml of ice-cold 1X IP buffer by gentle vortexing and spun down at 10,000rpm for 30 sec. The supernatant was removed and this washing step was repeated twice. Finally 50µl of 1X IP buffer was used to resuspend the beads. The prepared beads were added to the cell lysates in the spin column after the incubation was over. This beads-lysate mixture was incubated overnight at 40C with constant mixing. After the incubation, the tips of the spin column were broken and each column was inserted into a 2ml eppendorf tube. Columns were then centrifuged at 10,000rpm for 30 sec at 40C and the effluent discarded. The beads in the spin column were washed again 3-5 times by resuspending in 700µl of 1X IP buffer and centrifuging at 10,000 rpm for 30 sec at 40C. After the final wash, the spin columns were closed tightly with the tip (which was cut off from the column) and 50µl of 1X- LSB was added to the beads. The closed columns were placed into a new eppendorf tube and heated at 950C for 5 min. The column tip was opened and the columns inserted into the eppendorf tubes. The tubes were centrifuged at 10,000rpm for 30 sec to collect the immuno precipitated samples.

3.2.24. NMR spectroscopy

NMR spectroscopic measurements for the purified Rheb fusion proteins were performed by Miriam Schöpel, Group of Prof. Dr. Raphael Stoll, Biomolecular NMR Spectroscopy, Ruhr University Bochum. Measurements were performed using the Bruker DRX600 Spectrometer at 298K, pH 8.

3.2.25. Mass Spectrometry

Mass Spectrometric measurements and analysis were performed by Dr. Claudia Lindemann, Group of Prof. Dr. Katrin Marcus, Medical Proteome-Center, Ruhr University Bochum. Samples were subjected to Protease digestion using trypsin and then analyzed by LC/MS. The label-free data analysis was done by MaxQuant

4. Results.

PART I

4.1. Impact of N-terminal fluorescent protein fusion of Rheb on cellular survival

It has already been shown that EGFP-Rheb fusion protein (Enhanced Green Fluorescence Protein-Rheb) induces apoptosis when overexpressed in HeLa cells (dissertation Karassek, 2010). This occurs via caspase-3 activation and subsequent condensation of chromatin and nuclear fragmentation. The exact reason for this has not been elucidated so far but is believed to be the result of an altered Rheb structural conformation. Another possibility is that the binding of EGFP to Rheb induces aggregation of fusion proteins or additional interaction with pro-apoptotic proteins. The change in cellular effects caused by EGFP fusion or any other fluorescence proteins (sfYFP ~27 kDa) of Rheb referred to as, fluorescent protein fused Rheb (fp-Rheb), is the subject of the investigation here.

4.1.1. Myc- and flag- tagged Rheb do not induce apoptosis per se however fp-Rheb induce apoptosis in HeLa cells

It has already been shown that fusion of fluorescence protein like EGFP impacts Rheb’s functions as seen with EGFP-Rheb, which induces apoptosis when overexpressed in HeLa cells. However, fusion of small tag like flag does not cause any apoptosis. Here, the molecular basis of this induction of apoptosis caused by fusion of fluorescence proteins on Rheb (fp-Rheb) has been investigated. SfYFP (27KDa), another fluorescence protein, and myc-tag (EQKLISEEDL; 1,2 KDa) have also been included in the current study in order to understand if this is a phenomenon caused by fusion of large fluorescence proteins and compare with Rheb tagged with smaller proteins. HeLa cells were transiently transfected with plasmids carrying EGFP-/sfYFP-Rheb or EGFP/sfYFP, myc/flag-Rheb. Empty vector pCDNA.3 was also transfected as control. H2B-RFP was co-transfected in the ratio 4:1. After 48 hrs of transfection, cells were counted. The co-transfection of H2B-RFP enables the visualization of nuclei and apoptotic cells, which could be detected by the appearance of condensed chromatin or fragmented nuclei. The percentage of apoptosis was calculated from the number of transfected cells with fragmented nuclei and the total number of transfected cells (Figure 4.1).

The expression of EGFP-Rheb and sfYFP-Rheb proteins enables the visualization of transfected cells by the respective fluorescence of the fusion protein (Figure 4.3). To

confirm the expression of different overexpressed Rheb proteins, cells were lysed after counting and Western Blot analysis was conducted (Figure 4.4).

Figure 4.1: Induction of apoptosis by fp-Rheb. HeLa cells were transfected with the respective plasmids and cells were counted 48 hrs post-transfection. Percentage of apoptotic transfected cells was calculated. Results are average of 5 independent experiments. Error bars indicate ± SEM. (***p≤0.005; Students T-test).

Figure 4.2: Detection of cleaved-caspase-3 for EGFP-Rheb and sfYFP-Rheb but not for flag-Rheb or myc- Rheb transfectants. HeLa cells were transfected with the respective plasmids and incubated for 48 hrs. Afterwards, the cells were lysed. Western Blot was done for cleaved-caspase-3 for apoptosis induction and β-tubulin as loading control. Image is representative of 2 independent experiments.

A B

C D

Figure 4.3: Fluorescence microscopic images showing expression of A) EGFP, B) EGFP-Rheb, C) sfYFP and D) sfYFP-Rheb. HeLa cells were transfected with the respective plasmids and incubated for 48 hrs. Pictures were taken using Fluorescence microscope from Olympus; 20X magnification. Images are representatives of 7 independent experiments. Scale bar = 50µm

Figure 4.4: Detection of the respective overexpressed proteins of Rheb. HeLa cells were transfected with the respective plasmids and after 48 hrs; cells were counted for apoptosis and then lysed. After SDS PAGE and Western Blot, myc and flag tagged Rheb as well as Rheb fusion proteins were detected using an anti- Rheb antibody. Image is representative of 3 independent experiments.

The expressions of different fp-Rheb as well as that of myc- or flag-Rheb were confirmed by fluorescence microscopy (Figure 4.3) and by Western Blot (Figure 4.4). It was observed that not only EGFP fusion, but also sfYFP fused to the N-terminus of Rheb renders it pro-

49 apoptotic as shown in the Figure 4.1. The caspase-3 cleavage from the Western Blot result also confirms this (Figure 4.2). However, flag-Rheb or myc-Rheb does not induce apoptosis in HeLa cells as seen by the absence of cleaved-caspase-3 (Figure 4.2). This pro- apoptotic effect of fp-Rheb is hence, as per observed result, due to fusion of large fluorescence proteins. Therefore, fusion of large fluorescence protein converts the pro- growth Rheb to a pro-apoptotic protein in contrast to small tags like myc or flag.

When the EGFP-Rheb or sfYFP-Rheb transfected cells were counted, non nuclear- fragmented dead cells were also observed as seen by condensed green fluorescent signals (Figure 4.5). This observation indicates that the fusion protein induces an overall toxicity resulting in the activation of multiple cell death pathways.

Figure 4.5: Cell death by EGFP-Rheb overexpression. Apoptotic transfected cells displaying fragmented nuclei are indicated by yellow arrow. Green fluorescent condensed cells without nuclear fragmentation indicated by white arrow. Pictures were taken using Fluorescence microscope from Olympus; 20X magnification. Image is representative of 7 independent experiments. Scale bar = 50µm

4.2. Investigating the factors that determine the difference in apoptosis inducing property of myc-Rheb and EGFP-Rheb

Since it was found that, based on the fusion protein, Rheb gains different properties; the next aim was to determine the basis of this difference. It was already tested whether the difference is due to inhibition of the canonical Rheb-mTOR pathway. It was found that EGFP-Rheb indeed activates mTOR leading to S6 ribosomal protein phosphorylation (dissertation, Karassek, 2010). Further more, it was found that EGFP-Rheb mediated apoptosis is independent of mTORC1 activation (dissertation, Karassek, 2010). SfYFP- Rheb also does not inhibit the activation of downstream mTOR pathway (data not shown). The investigations on the molecular basis of fp-Rheb mediated apoptosis were carried out by taking four conditions into consideration; localization or sub-cellular targeting of the fp-

Rheb proteins, level of proteins expressed, differential interaction properties of fp-Rheb proteins and structural alterations.

4.2.1. EGFP-Rheb induced apoptosis is independent of its sub-cellular localization

A comparative study of localization of flag-Rheb and EGFP-Rheb was already performed in our group (dissertation Karassek, 2010). In order to see whether there is any difference between myc-Rheb and EGFP-Rheb intracellular localization, HeLa cells were transfected with EGFP-Rheb or myc-Rheb and fixed after 24 hrs. Myc-Rheb transfectants were stained using an anti-myc-tag antibody and secondary anti-mouse Alexa Fluor 488 antibody and mounted on to slides. The cells transfected with EGFP-Rheb were only fixed and then mounted on to slides. The nuclei were stained using To-PRO3. Figure 4.6 depicts the endomembrane, and cytosolic localization of the two overexpressed proteins, myc-Rheb and EGFP-Rheb using confocal microscopy.

Figure 4.6: Confocal Images showing similar localization of A) EGFP-Rheb and B) myc-Rheb in HeLa cells. A) Cells transfected with EGFP-Rheb were fixed and stained with To-PRO3 for nuclear staining. B) Cells transfected with myc-Rheb were fixed and stained using primary anti-myc tag (mouse) antibody and secondary anti-mouse Alexa Fluor 488 antibody and To-PRO3 for nuclear staining. Pictures were taken using Confocal microscope. Images are representatives of 3 independent sets of staining. Scale bar = 50µm. The control staining without primary antibodies were also done (see appendix 8.1.1).

It was found that both EGFP fused Rheb and myc-tagged Rheb do not display any difference in sub-cellular localization. Both the proteins were observed in the cytosol especially in endomembranes as has been previously published (Buerger et al. 2006; Hanker et al. 2010). In order to confirm the specific localization of the proteins, a co- staining for ER or Golgi marker or mitochondria is needed. A weak presence of EGFP- Rheb and myc-Rheb was also detected in the nucleus. This presence of Rheb in the nucleus could be the effect of overexpression, or for interaction with mTOR as previously described (Yadav et al. 2013). Under overexpression conditions, the intracellular localization of both the proteins, myc-Rheb and EGFP-Rheb were similar. Hence the pro- apoptotic role of EGFP-Rheb fusion protein is independent of its localization.

4.2.2. There is no difference in the protein expression between EGFP- and myc- Rheb.

The level of expression of proteins can have an effect on the survival of the cell. For example, it has been described for albumin and other high molecular weight proteins that when there is way too much protein load that the cell cannot withstand by any mechanism, the cell may die by apoptosis or necrosis (Erkan et al. 2001; Morais et al. 2005; Wu et al. 2010). Hence the next approach was to determine if there might be any difference in the amount of proteins expressed by the two proteins, EGFP-Rheb and myc-Rheb. If a difference is found, it has to be investigated, whether this difference is the factor that determines the pro-apoptotic property of EGFP-Rheb.

The effect of increasing concentrations of myc-Rheb, flag-Rheb and EGFP-Rheb proteins on cellular survival was carried out in order to analyze the influence of high concentrations of fp-Rheb proteins. This was also done to evaluate if it is the amount of proteins expressed that causes induction of apoptosis. A range of plasmid concentrations from 1µg to 10µg were used to transfect each well of a 6 well plate of HeLa cells. H2B-RFP was co- transfected in the ratio 4:1 to enable the visualization of transfected cells and to detect the nuclei. Transfected cells were counted after 24 and 48 hrs of transfection. The expression of the respective proteins after 48 hrs was as well investigated by Western Blot. Expression pattern was consistent for all the three constructs, in terms of an increasing protein expression observed with increasing plasmid concentration as seen in Figure 4.7B. Interestingly, for all proteins, an increase in apoptosis was also observed with increasing concentration of transfected plasmid after 48 hrs (Figure 4.7A) and 24 hrs (see Appendix,

Figure 8.1.2). However, the apoptosis induced by high concentrations of flag-Rheb or myc- Rheb is still lower than the cell death observed with low concentrations of EGFP-Rheb. It was observed that even lower plasmid concentration of EGFP-Rheb induces apoptosis. Hence, this also supports the finding that EGFP-Rheb possesses an enhanced property to induce cell death compared to flag or myc tagged Rheb, and it is not due to the difference in the expression levels of proteins.

Figure 4.7: Percentage of apoptosis increases with increasing concentrations of different Rheb proteins. HeLa cells were transfected with increasing concentrations (1µg, 2µg, 4µg, 5µg, 8µg and 10µg of plasmid concentration per transfection) of EGFP-Rheb, flag-Rheb and myc-Rheb. Cells were counted after 48 hrs of transfection under the fluorescence microscope and thereafter, lysed and the expression of respective proteins was detected by Western Blot. A) Percentage of transfected cells displaying apoptosis as seen by fragmented nuclei. Results are average of 3 independent experiments. Error bars indicate ± SEM, (*p≤0, 5, **p≤ 0, 05, ***p≤0,005; T-test: Two sample assuming Unequal Variance). B) Expression of different concentrations of EGFP-Rheb, myc-Rheb and flag-Rheb by Western Blot for Rheb and β-tubulin as loading control. Images are representatives of 3 independent experiments. It was already observed that at a particular concentration of EGFP-Rheb and flag-Rheb, the expression is similar (dissertation, Karassek, 2010). In the current study a different transfection reagent (X fect instead of Polyfect) and different plasmid concentrations (Figure 4.7) were used, as there tend to be a difference in the transfection efficiency and expression pattern of proteins with different transfection reagents. Additionally, EGFP- Rheb expression was compared with myc-Rheb expression.

To compare the expression of each overexpressed Rheb proteins, HeLa cells were transfected with different Rheb constructs. After 48 hrs of transfection, cells were lysed and expression of each fusion protein at a particular concentration was detected by Western Blot. A representative image showing expression of each protein using 4µg plasmid concentration (X fect reagent) is shown in Figure 4.8.

A B

Figure.4.8: Comparing the expression of EGFP-Rheb with A) flag-Rheb and B) myc-Rheb. HeLa cells were transfected with the respective plasmids and after 48 hrs of transfection, cells were lysed and Western Blot was performed. Specific overexpressed proteins were detected using anti-Rheb antibody (mouse) and anti-tubulin antibody (mouse) as loading control and anti-mouse secondary antibody. Membranes were developed and expression levels were compared. Images are representative of 3 independent experiments with 4µg of plasmids using X fect reagent.

For a particular plasmid concentration (4µg), no difference in the amount of proteins expressed between myc or flag tagged Rheb and EGFP-Rheb proteins were observed. This further indicates that even though the apoptosis rate increases with increasing concentrations of Rheb plasmids, even for the same plasmid concentration, the apoptosis inducing property of EGFP-Rheb is not determined by the amount of protein expressed.

4.2.3. Analysis of different binding properties of myc-Rheb and EGFP-Rheb to putative interaction partners

In order to determine if fusion of fluorescence proteins might change binding properties of Rheb to its interaction partners, it was essential to detect and compare the proteins that bind to both myc-Rheb and EGFP-Rheb. Therefore, myc-Rheb and EGFP-Rheb were overexpressed in HeLa cells and cells were lysed after 48 hrs of incubation. pCDNA3.0 (myc tag control) and pEGFP-C1 (EGFP control) transfections were carried out to exclude the identification of false-positive interaction partners due to unspecific binding to the tag. The samples were then used to pull down any binding partners of the respective proteins.

The pull down samples were separated by SDS PAGE and subsequently, Western Blot and immune detection were performed for the respective overexpressed Rheb proteins. The input samples were also analyzed to check the expression of the proteins under study. Bands were observed corresponding to the overexpressed proteins (myc-Rheb, EGFP, EGFP-Rheb), as seen in Figure 4.9.

Figure 4.9: Western Blot images showing the pull down of myc-Rheb and EGFP-Rheb. A; B) EGFP-Rheb and EGFP transfected samples. Pull down experiments were conducted as mentioned in section 3.2.22 and 30µg of the pull down samples as well as that of input samples were loaded onto SDS- gel and after Western Blot, EGFP and EGFP-Rheb were detected using anti-GFP antibody. Bands are observed corresponding to EGFP and EGFP-Rheb. C) Myc-Rheb transfected samples. Pull down experiments were conducted as mentioned in section 3.2.23 and 30µg of the pull down samples as well as that of input samples were loaded onto SDS-gel and after Western Blot, Myc-Rheb was detected using anti-myc antibody. Bands are observed corresponding to myc-Rheb and the heavy and light chain of anti- Myc antibody. Image is representative of 5 replicates.

The samples were then submitted for Mass Spectrometric analysis by which, the difference in binding properties of the two proteins can be detected. An analysis of the binding proteins can help to determine the basis of the pro-apoptotic property of fp-Rheb proteins.

Sample measurements and analysis were performed at the Medical Proteome Center, Ruhr University Bochum by Dr. Claudia Lindemann. Label-free data analysis by MaxQuant yielded two major observations. i. The proteins upregulated (fold change >2) or downregulated (fold change <0.5) in EGFP-Rheb samples compared to myc-Rheb samples (protein identified in at least 4 biological replicates of EGFP-Rheb or myc-Rheb with at least 3 unique peptides in at least one biological replicate). ii. The proteins in the pull down samples of EGFP-Rheb that displayed interaction with EGFP-Rheb alone and not to myc-Rheb or controls.

The results are documented in Figure 4.10. It was observed that there are differences in the levels of some of the proteins co-immunoprecipitated along with EGFP-Rheb and myc- Rheb. Five proteins were identified that are upregulated and three proteins downregulated upon EGFP-Rheb overexpression compared to that of myc-Rheb. However these proteins are also bound to EGFP (control) and did not display any fold difference.

It was found that the proteins that were differentially regulated by EGFP-Rheb or EGFP are those involved in apoptotic pathways. Most prominent is the CK-18 or KRT-18, an important protein involved in apoptosis pathway (Caulin 1997).

Interesting observation is that about 11 proteins were bound to EGFP-Rheb alone and not to myc-Rheb or controls, whereas, 4 proteins were identified that bind to myc-Rheb alone, but did not bind to EGFP-Rheb. These observations thus provide evidence that EGFP- Rheb assumes a conformation that modifies its binding properties

The proteins that co-immunoprecipitated with EGFP-Rheb alone are mainly involved in the apoptotic pathway or have pro-apoptotic roles in the cell. Of these, VDAC1 has been recognized as a key protein in mitochondria-mediated apoptosis through its involvement in the release of apoptotic proteins located in the inter-membranal space. It is an important target of pro- and anti-apoptotic members of the Bcl2-family (Shimizu et al. 1999; Shimizu et al. 2000). Other proteins are listed in the Figure 4.10.

Figure 4.10: List of proteins identified from pull down experiments by mass spectrometry analysis. A) Proteins that were up- or downregulated upon EGFP-Rheb overexpression compared to myc-Rheb. B) List of proteins that were interacting with EGFP-Rheb alone. C) List of proteins that were interacting with myc- Rheb alone.

A comparison of the proteins associated with both EGFP-Rheb and EGFP shows that, except for the expression level of Rheb, there is no change in level of proteins co-

57 immunoprecipitated. Same was observed comparing myc and myc-Rheb, as only Rheb was found to be overexpressed in the samples containing myc-Rheb.

4.2.4. Comparison of the structural difference between wt Rheb and EGFP-Rheb.

The next approach was to investigate, if the structure of Rheb is altered due to the fusion of 15 EGFP at the N-terminus of Rheb. For this, N enriched, His6 tagged EGFP-Rheb was purified for NMR measurements. 1-D and 2-D spectra were recorded for the isolated protein. The measurements were performed in collaboration with the group of Prof. Dr. Raphael Stoll, Department of Biomolecular NMR Spectroscopy, Ruhr University Bochum. Results are shown in Figure 4.11. 1-D measurements indicate that the protein is folded. However, for the 2-D measurements, the high molecular mass (~50KDa) of the fusion protein caused a slow down of the relaxation time and led to the disappearance of the peaks due to line broadening (Figure 4.11). Because of this no 2-D spectra were observed for EGFP-Rheb.

1 1 15 Figure 4.11: H (A) and H- N (B) NMR spectra of His6-EGFP-Rheb measured using Bruker DRX600 spectrometer at 298K and pH 8.

4.2.4a. sfYFP N and C terminal halves have self-reconstituting properties: In cell reconstitution.

In order to further investigate the fp-Rheb mediated apoptosis induction, a method was developed to visualize the triggering of apoptosis in the cell and to use this system to determine NMR-structural basis of fp-Rheb mediated apoptosis. The split sfYFP system was utilized for acheiving this purpose.

SfYFP could be split into two halves, N-terminal half (YN) and C-terminal half (YC). This split halves have been used to detect protein-protein interaction using the BiFC principle (Ottmann et al. 2009). The sfYFP and the split halves of sfYFP; YN and YC were subcloned into mammalian expression vectors pEGFP-C1. The constructs used are listed in the appendix: Figure 8.2.

Equimolar concentrations of the YC and YN were co-transfected into HeLa cells. Separate transfections using individual halves (YN or YC constructs) along with H2B-RFP (4:1 ratio) as a control for transfection were also performed (Figure 4.12). In contrast to single- transfected constructs, it was observed that the YN and YC co-transfected cells display fluorescence due to reconstitution to sfYFP (Figure 4.12).

Figure 4.12: Validation of self-reconstitution of sfYFP halves. A).Transfection of YN B) or YC alone did not show any fluorescence C) HeLa cells were transfected with equimolar concentration of plasmids carrying YC and YN halves of sfYFP and observed under fluorescence microscope after 48 hrs of transfection at 20X magnification. Green fluorescence was reconstituted upon co-transfection of both the halves (green fluorescence detected in cells shown by arrow mark). Images are representatives of 3 independent experiments. Scale bar =50µm.

Another approach to show that the YN and YC halves reconstitute fluorescence was to express YN and YC using bacterial expression system with GST tag in the pGEX-2T vector. Proteins were purified using glutathione sepahrose beads by the methods described in 3.2.20. The purified GST-YC remains attached to separose beads and free YN was added to 96 well plates containing GST-YC carrying beads. GST-YN was purified using sepharose beads but separated from GST using thrombin that cleaves at a specific sequence between GST and YN, leaving YN free and GST still attached to beads. The YN containing fraction was collected by centrifugation. YN and YC reconstitute fluorescence around the beads, as GST-YC is still attached to beads. The sfYFP formed by this reconstitution between YN and YC was observed under a fluorescence microscope. The 60

same was observed with free YC and GST-YN attached to beads. Whereas, individual proteins attached to beads did not yield any fluorescence (Figure 4.13).

Figure 4.13: Demonstration of self-reconstitution of YN and YC using sepaharose beads. A) Addition of YC to GST-YN attached beads allows reconstitution as seen with green fluorescence. B) Beads carrying GST- YN alone is non fluorescent. Scale bar = 50µm

These observations indicate that the non-fluorescent halves of sfYFP can reconstitute fluorescence within as well as outside the cells even in the absence of an interacting pairs of proteins attached to them. Hence, split sfYFP displays self-reconstituting property and is therefore not a suitable candidate for BiFC assays.

4.2.4b. Applications of self-reconstituting sfYFP fragments as a switch to render Rheb apoptotic

Even though the split sfYFP is not suitable for BiFC assays, new applications of this self- reconstituting pairs of proteins were elucidated. The most important is to use this system as a tool for ‘switching on’ as well as to visualize the apoptosis induction by fp-Rheb and for developing an NMR based strategy to determine the structural basis of fp-Rheb mediated apoptosis.

As a first approach, YC was fused to N-terminal of Rheb and analyzed whether this construct displays any apoptosis. Taking advantage of the reconstituting ability of YN and YC (shown in Figure 4.12), YC-Rheb was co-transfected with YN allowing the formation of sfYFP-Rheb (Figure 4.14A). The formation of sfYFP-Rheb was indicated by the appearance of fluorescence as seen in Figure 4.14A. YC-Rheb is non-fluorescent and less apoptotic. As expected, the reconstitution of YN and YC-Rheb to give rise to fluorescent sfYFP-Rheb, strongly induced the apoptosis similar to that observed with fp-Rheb (Figure 4.14B). Similar results were observed with YN-Rheb alone (non-fluorescent, less apoptotic) and YN-Rheb with YC co-transfected cells (fluorescent, strongly apoptotic). The reconstitution of sfYFP at the N-terminus of Rheb, acts as a ‘‘switch’’ in converting the ‘‘non-toxic’’ Rheb protein to a ‘‘toxic, pro-apoptotic’’fusion protein (Figure 4.14).

Figure 4.14: YN-YC reconstitution fused to Rheb as a switch to induce apoptosis. HeLa cells were transfected with plasmids carrying YN or YC at the N-terminus of Rheb and another set with YC-Rheb or YN-Rheb co-transfected with YN or YC respectively. Cells were observed under fluorescence microscope

62 for reconstitution of YC and YN at the N-terminus of Rheb. A) YC-Rheb co-transfected with YN resulted in formation of sfYFP-Rheb and reconstituted fluorescence. Pictures were taken using Confocal microscope. Image is representative of 3 independent experiments. Scale bar= 50µm. B) Graph showing apoptosis induction by reconstituted sfYFP-Rheb from YC-Rheb+YN or YN-Rheb+YC. Results are average of 5 independent experiments. Error bars indicate ± SEM. (***p≤0.005; Students-T-test).

4.2.4c. Applying split sfYFP system to analyze change in structure of reconstituted sfYFP-Rheb

The split sfYFP system and its role in the induction of apoptosis by fp-Rheb was adopted to determine the structure of reconstituted sfYFP-Rheb by NMR spectroscopy (Prof. Dr. Raphael Stoll and Miriam Schöpel, Biomolecular NMR Spectroscopy, Ruhr University Bochum) and compare it with the already determined structure of wt Rheb (Berghaus et al. 2007; Karassek et al. 2010). Since addition of YN to YC-Rheb results in formation of sfYFP-Rheb that is strongly apoptotic, these proteins could be used to determine the changes that occur in Rheb during the formation of apoptotic fp-Rheb structure. The strategy has been depicted below (Figure 4.15) and with this approach, the structural basis of the fp-Rheb mediated apoptosis can be determined.

A B

Figure 4.15: Schematic representation of determination of NMR structure of sfYFP-Rheb using the split sfYFP system. A) Initially, the structure of YC-Rheb is determined. B) Then the change in the structure after the addition of YN, due to the reconstitution of YC-Rheb and YN to sfYFP-Rheb is determined. This structure can then be compared to that of wt Rheb structure (Karassek et al, 2010; Berghaus et al. 2007).

For this purpose, YC-Rheb and YN were sub-cloned into a pGEX-2T vector with GST tag to enable their purification using the glutathione sepharose beads. YC-Rheb proteins were 15N enriched and YN was unlabelled. With this approach the size limitations of NMR measurements could be overcome, as 15N enriched YC-Rheb is only 30KDa in size. The purification of YC-Rheb was performed using the glutathione sepahrose beads using the strategy described in Figure 4.16A and proteins purified were analyzed using SDS gel by coomassie staining and Western Blot (Figure 4.16B and C).

A B C

Figure 4.16: Purification of YC-Rheb proteins using GST-tag and glutathione sepahrose beads. A) Schematic representation of the steps for purifying GST-YC-Rheb and cleavage of YC-Rheb from GST protein carrying beads using thrombin. B) Coomassie stained gel showing bands of i) GST-YC-Rheb captured on sepahrose beads; ii, iii) YC-Rheb after thrombin cleavage; iv) pellet carrying GST attached to sepharose beads after separation of YC-Rheb; v) YC-Rheb after concentration to 0.1mM using Amicon ultra filter tubes C) Western Blot and detection of uncleaved GST-YC-Rheb and YC-Rheb using anti-Rheb antibody.

1-D and 2-D NMR spectroscopic measurements were done for YC-Rheb alone and YC- Rheb pre-incubated with YN for overnight (16 hrs). The spectra were compared with wt Rheb. The results are documented in Figure 4.17.

A .

Figure 4.17: Analysis of (1-D) 1H-NMR and (2-D) 1H-15N HSQC measurements for YC-Rheb and YC-Rheb+YN in comparison with wt Rheb. A) 1-D spectra of wt Rheb, YC-Rheb and YC- Rheb+YN B) Comparitive 2-D measurements for YC-Rheb (blue), YC-Rheb+YN (green) and wt Rheb (black). C) Shifts in amino acids of Rheb with YC-Rheb and YC-Rheb+YN. Analysis was done using CCPNMR software. D) Further comparison of the shifts in the amino acids E53 and Y54 of YC- Rheb (blue) or YC-Rheb+YN (green) with wt Rheb (Black). Measurments were performed using Bruker DRX600 Spectrometer at 298K, pH 8 by Miriam Schöpel, Biomolecular NMR Spectroscopy, Ruhr University Bochum

The 1H NMR measurements indicate that in YC-Rheb, YC part itself is not folded and hence the addition of YN counterpart did not induce any reconstitution.

Interestingly, in the 2-D measurements, shifts were observed in three amino acids at the N- terminus of Rheb when fused with YC. A comparison with the wt Rheb shows that these shifts were observed in Ser6, Glu-53 and Tyr-54 (see Figure 4.17 C and D). Of these, Glu- 53 and Tyr-54 are important for the activation of downstream signaling by Rheb (Tee et al. 2005). No additional changes could be detected with the addition of YN. This is because the YC in YC-Rheb is in an unfolded state and addition of YN did not induce any reconstitution (no fluorescence reconstitution even after addititon of YN).

Overall, the fusion of YC (9KDa) that induced shifts in Rheb, could cause steric hinderance and inhibit downstream activation. However, it has to be verified whether the fusion of YC induce an inhibition of downstream pathway of Rheb and whether the shifts observed are the factors determining the pro-apoptotic property of fp-Rheb.

4.3. Applications of split sfYFP system: Applying the split sfYFP system for the monitoring of endomembrane targeting of proteins.

The C-terminal CAAX motif is essential for Rheb sub-cellular targeting to the ER and Golgi (Hanker et al. 2010). As previously described, (Hanker et al. 2010) EGFP was fused to C-terminal 8 amino acids of Rheb carrying the CSVM (Cystein, Serine, Valine,

Methionine) (EGFP-CAAX8) and it was found that they (fluorescence) are targeted to the endomembranes. The ability of the YN and YC to self-reconstitute has been further applied

here by fusing YC to CAAX8 and co-transfection with YN. This caused a reconstitution of sfYFP and fluorescence at the endomembranes due to farnesylation at the CAAX sequence as seen in Figure 4.18.

Figure 4.18: Confocal Image showing that YC-YN reconstitution localizes to the endomembranes driven by C-terminal CAAX motif of Rheb. YC half of sfYFP was fused to CAAX8 of Rheb and co- transfected with YN alone leads to reconstitution and localization of fluorescence to regions led by the CAAX8. HeLa cells were transfected with YC-CAAX8 and YN and H2B-RFP (ratio 2:2:1) and incubated for 48 hrs. Pictures were taken using Confocal microscope. Image is representative of 3 independent experiments. Scale bar =50µm

The truncation of the CAAX sequence of Rheb results in Rheb∆CAAX, which remains in the nucleus and the cytoplasm (dissertation, Karassek, 2010). YN was fused C terminally to truncated Rheb (Rheb∆CAAX-YN) and co-transfected with YC. Even though a reconstitution of fluorescence is observed, it remains in the whole cell due to lack of CAAX motif (Figure 4.19A) similar to that of EGFP-Rheb∆CAAX as described previously (dissertation, Karassek, 2010).

Figure 4.19: Confocal Image showing that YC-YN reconstitution allows the specific targeting of a protein taking advantage of the C terminal CAAX motif of Rheb. A) Rheb lacking the C-terminal CAAX motif fused to YN at the C-terminus was co-transfected with YC half of sfYFP. YN-YC reconstitution at C- terminus of Rheb∆CAAX remains in the cytosol and nuclei as seen by green fluorescence. B) A co-transfection of Rheb∆CAAX-YN with the YC-CAAX8 allows reconstitution as well as targeting of Rheb∆CAAX-YN to endomembranes led by the CAAX8. HeLa cells were transfected with YC or YC-CAAX8 and Rheb∆CAAX-YN and H2B-RFP (ratio 2:2:1) and incubated for 48 hrs. Cells were fixed and nuclei stained using To-PRO3. Pictures were taken using the confocal microscope. Images are representative of 3 independent experiments. Scale bar =50µm.

The co-transfection of YC-CAAX8 with Rheb∆CAAX-YN allowed the Rheb∆CAAX-YN

reconstitution with YC and was targeted to regions driven by the CAAX8 (Figure 4.19B).

A clear difference in the localization of fluorescence with and without the CAAX8 is observed from the Figure 4.19.

Hence the split sfYFP system could be used to bring together two proteins (in this case,

Rheb∆CAAX and CAAX8) in a cell by taking advantage of the ability of YN and YC to reconstitute. Moreover, it is possible to track or monitor this reconstitution by the location of the green fluorescence.

4.3.1. Endomembrane association of truncated Rheb by split sfYFP system induces cell death in HeLa cells

Using the split sfYFP system, it was possible to target Rheb∆CAAX to the endomembranes and this localization was tracked by the appearance of fluorescence. The

effect of reconstitution of YN and YC or YC-CAAX8 at C terminal of Rheb∆CAAX on cellular survival was determined. For this, the following constructs were transfected into HeLa cells and cells counted after 48 hrs of incubation.

1. RhebΔCAAX-YN

2. RhebΔCAAX-YN+ YC

3. RhebΔCAAX-YN + YC-CAAX8

4. EGFP-Rheb∆CAAX

5. Myc-Rheb∆CAAX

The percentage of apoptosis induced by these proteins is represented in the graph in Figure 4.20.

Figure 4.20: Split sfYFP mediated Rheb fusion proteins induce cell death. HeLa cells were transfected with several constructs and cells counted after 48 hrs. The percentage of apoptosis was calculated from the cell counts. Results are average of 3 independent experiments. Error bars indicate ± SEM. (***p≤0.005, **p≤0,05; T-test: Two sample assuming Unequal Variance)

It was observed that EGFP fused to truncated Rheb (EGFP-Rheb∆CAAX) also induces apoptosis (dissertation, Karassek, 2010). However myc tagged Rheb∆CAAX does not induce any apoptosis. Interestingly, Rheb∆CAAX-YN is also non-apoptotic. Rheb∆CAAX-YN co-transfected with YC results in the reconstitution of fluorescence, leading to the formation of Rheb∆CAAX-sfYFP. This cytosolic protein, however, induces apoptosis. The split sfYFP system, although an efficient method to target and monitor the trafficking of Rheb∆CAAX-YN to endomembranes using YC-CAAX8, strongly induces high rate of apoptosis as seen in Figure 4.20.

Cytosolic EGFP-Rheb∆CAAX and Rheb∆CAAX-YN-YC induces apoptosis. Apoptosis was also induced by the split sfYFP mediated endomembrane targeted Rheb∆CAAX-YN-

YC-CAAX8. Both these observations support the finding that apoptosis induction by fusion proteins of Rheb (N- or C-terminal fusion) occurs independent of its localization.

Additionally, the functionality of the split sfYFP mediated endomembrane targeted Rheb was tested. Rheb lacking the C-terminal CAAX motif cannot be localized to endomembranes and this localization is essential for its activity (Buerger et al. 2006).

Whether the reconstituted Rheb using the YN and YC-CAAX8, is able to activate the downstream canonical Rheb pathway (mTORC1 and S6 Kinase), was determined by probing for the the level of phosphorylated S6 ribosomal proteins. The following

71 constructs were transfected into HeLa cells. To analyze the activation of mTOR by Rheb overexpression, after total of 48 hrs of transfection, cells were lysed and Western Blot was done for phospho-S6 and total-S6.

1. Untransfected cells 2. EGFP-Rheb∆CAAX 3. Rheb∆CAAX-YN 4. Rheb∆CAAX-YN+YC

5. Rheb∆CAAX-YN+YC-CAAX8

Figure 4.21: Reconstitution of Rheb using the split sfYFP system do not cause any change in S6 ribosomal protein phosphorylation. HeLa cells were transfected with respective plasmids. After 48 hrs of transfection, cells were lysed and Western Blot was performed to detect the level of phospho-S6 and total- S6 in the respective samples. Image is representative of 3 independent experiments.

When compared to the untransfected samples, EGFP-Rheb∆CAAX was unable to increase the activation of downstream S6 Kinase due to the absence of C-terminal CAAX motif. It was then analyzed whether Rheb∆CAAX-YN co-expressed with YC-CAAX8 could activate phosphorylation of S6 ribosomal protein, since the proteins were able to localize to the endomembranes similar to EGFP-Rheb. As seen in Figure 4.21, neither Rheb∆CAAX-

YN+YC nor Rheb∆CAAX-YN+YC-CAAX8 could cause an increase in S6 ribosomal protein phosphorylation compared to untransfected or EGFP-Rheb∆CAAX. Only a basal level of phospho-S6 was observed in all the samples. This also supports that apoptosis induction by these proteins is not dependent on mTOR activation.

4.4. Overexpression of EGFP-Rheb as well as myc-Rheb enhances apoptosis under UV stress It has already been shown that overexpression of flag-Rheb enhances apoptosis in primary and secondary cell lines under UV stress. However, whether this property of Rheb to enhance apoptosis under UV stress also changes with the tag type has to be determined. For this purpose, the effect of myc-Rheb and EGFP-Rheb after UV stress on cellular survival was determined. 72

4.4.1. Myc-Rheb also enhances apoptosis in response to UV stress: Enhancement of apoptosis is independent of the caspase-3 cleavage activated pathway It was investigated whether myc-Rheb mimics flag-Rheb in enhancing the apoptosis induced by UV light at different time points. HeLa cells were transfected with myc-Rheb or pCDNA3.0 along with H2B-RFP (4:1 ratio) and H2B-RFP alone and incubated for 24 and 48 hrs. Cells were exposed to UV light (300J/cm2) and incubated for further 4 hrs. UV treated and untreated cell were observed under the fluorescence microscope and the number of transfected nuclei which were intact, or fragmented, were counted. The percentage of apoptosis is represented in terms of percentage of transfected cells with fragmented nuclei. The expression of the transfected myc-Rheb was determined by Western Blot using an anti-myc-tag antibody. Bands corresponding to 22.2 KDa were detected in the samples transfected with myc-Rheb. Figure 4.22 A and B shows that myc- Rheb also enhances apoptosis in response to UV stress, similar to flag-Rheb after both 24 and 48 hrs of transfection.

Figure 4.22: Myc-Rheb also enhances apoptosis in response to UV stress. HeLa cells were transfected with H2B-RFP alone, pCDNA3.0+H2B-RFP and Myc-Rheb+H2B-RFP and incubated for 24 or 48 hrs. Cells were exposed to UV light (300J/cm2) and incubated for further 4 hrs. Cells were counted under fluorescence microscope. Graph shows the effect after A) 24 hrs and B) 48 hrs. Results are average of 5 independent experiments. Error bars indicate ± SEM.( ***p≤0.005, **p≤0,05; Students T-test). C, D) Cells were lysed after each time points and proteins were separated via SDS PAGE, followed by Western Blot and immune detection for cleaved caspase-3, myc-Rheb as well as β-tubulin. Image is representative of 3 independent experiments.

The induction of apoptosis was determined by the detection of caspase-3 cleavage by Western Blot. UV-induced nuclear fragmentation and apoptosis are mediated via caspase-3 cleavage pathway (Kimura et al. 1998). Whether the Rheb enhanced apoptosis is also via the same pathway, is not yet known. For this, the cleavage of caspase-3 was analyzed by Western Blot for these samples. Even though an increase in the number of fragmented nuclei were observed in myc-Rheb overexpressed cells exposed to UV (Figure 4.22 A; B), no increase in level of cleaved-caspase-3 in comparison with UV treated samples were observed (Figure 4.22 C; D). A quantification of the level of caspase-3 cleavage for UV treated compared to that of UV treated with myc-Rheb overexpression did not show any difference (see appendix, Figure 8.1.3). Thus these findings provide evidence that the enhancement of apoptosis under UV stress may not be via caspase-3 cleavage pathway and that caspase-3 independent pathway may be involved.

4.4.2. EGFP-Rheb also enhances apoptosis induced by UV stress

EGFP-Rheb induces apoptosis autonomously when compared to that of flag and myc- Rheb, which are non-apoptotic (dissertation, Karassek, 2010). Here, it was investigated whether EGFP fusion affects Rheb’s response to UV stress. For this, EGFP-Rheb was transfected into HeLa cells and after 48 hrs of incubation, the cells were exposed to UV light (300J/cm2) and incubated for further 4 hrs. UV-induced and basal state EGFP-Rheb transfected cells were counted and percentage of apoptosis was calculated. The data was compared to UV treated cells. The results are as shown in the Figure 4.23.

Figure 4.23: EGFP-Rheb enhances apoptosis with UV exposure. HeLa cells were transfected with EGFP- Rheb and H2B-RFP as a control for transfection. Cells were incubated for 48 hrs post transfection and after 75

UV (300J/cm2) exposure; cells were further incubated for 4 hrs. Cells were observed under fluorescence microscope and the percentage of transfected apoptotic cells were determined. Results are average of 4 independent experiments. Error bars indicate ± SEM.( **p≤0.05, *p≤0,5; T-test: Two sample assuming Unequal Variance).

It was observed that UV exposed cells undergo apoptosis as seen by fragmented nuclei. EGFP-Rheb also induces apoptosis under basal state. Interestingly, an enhanced apoptosis was observed in cells transfected with EGFP-Rheb after UV stimulation, when compared to UV treated samples. Even though this enhancement is less significant, the pro-apoptotic function of Rheb in response to UV stress is consistent, irrespective of the tag type.

4.5. EGFP-Ras also displays apoptotic property but provides partial protection from UV stress

Since our findings show that fusion of fluorescence proteins like EGFP or sfYFP to Rheb is toxic to cells, it is necessary to determine whether EGFP fusion is toxic to other members of the Ras family, especially Ha-Ras. This is because Rheb belongs to the same family as Ha-Ras, and displays structural and functional similarities (Yamagatas et al. 1994; Im et al. 2002). Therefore, EGFP was fused to the constitutively active G12V-Ha- Ras and transfected into HeLa cells. After 48 hrs of transfection, cells were exposed to UV light (300J/cm2) and incubated for another 4 hrs. Following this, cells were counted and results are documented in Figure 4.24.

Figure 4.24: EGFP-Ras overexpression also induces apoptosis. EGFP was fused N-terminally to G12V-Ras and transfected into HeLa cells. The effect of EGFP-Ras upon cellular survival with and without UV exposure was compared to that of myc-Ras. All constructs were co-transfected with

H2B-RFP in the ratio 4:1 as a control for transfection. After 48 hrs of transfection, cells were exposed to UV light and further incubated for 4 hrs. Cells were observed under fluorescence microscope and the percentage of transfected apoptotic cells were determined. Results are average of 4 independent experiments. Error bars indicate ± SEM (**p≤0.05, *p≤0,5; T-test: Two sample assuming Unequal Variance).

The cells were observed under the fluorescence microscope for transfection of EGFP-Ras, as seen by the presence of green fluorescence and myc-Ras by co-transfection of H2B-RFP that displays a red fluorescence in the nuclei. It was observed that after UV exposure, apoptosis occurs as seen by fragmented nuclei. Myc-Ras, as previously determined, exerts protection from UV stress (Karassek et al. 2010). However, similar to EGFP-Rheb, the fusion of EGFP to Ras also renders it pro- apoptotic. Interestingly, only a partial protection was observed for cells transfected with EGFP-Ras that was exposed to UV (Figure 4.24). This indicates that even EGFP fusion on Ras induces a toxic effect and this effect dominates leading to only a partial protection from UV stress.

PART II 4.6. 4, 4’ Biphenol binds to Rheb and induces cell death

In order to inhibit Rheb mediated pathological conditions such as tuberous sclerosis or cellular degeneration, several attempts were made to develop small molecules specifically interfering with Rheb signaling. Two small molecules that bind to Rheb were identified by multidimensional NMR spectroscopy (Schöpel et al. 2013). These molecules were additionally checked for their binding to K-Ras, as both the proteins belong to the same superfamily of GTPases (Yamagatas et al. 1994; Aspuria & Tamanoi 2004; Wennerberg et al. 2005).

One molecule 4,4’ Biphenol was identified to bind specifically to Rheb and not to K-Ras whereas another molecule Bisphenol A was found to bind both K-Ras and Rheb but with higher affinity to K-Ras (Schöpel et al. 2013). 4, 4’- Biphenol binds to Rheb with a Kd value of 1540±230 μM. The effects of these molecules on the overall survival of cells were tested. For this, MTT assay was performed using different concentrations of the molecule. The results are documented in Figure 4.25.

Figure 4.25: 4, 4’ – Biphenol induces cell death in HeLa cells. HeLa cells were treated with increasing concentrations of 4, 4’– Biphenol and incubated for further 4 hrs. After 4 hrs, MTT assay was performed to determine the cellular viability of untreated and 4,4’– Biphenol treated cells. Results are average of 7 independent experiments. Error bars indicate ±SEM (**p≤0, 05; Students T-test).

An increase in cell death was observed with increasing concentration of 4,4’-Biphenol, the maximum being at 100µM, after which, the cell death decreases and increases again at 500µM.

The effect of these molecules on Rheb downstream signaling was analyzed, in order to determine whether the cell death observed is because of their binding to Rheb, or if this is the effect of general toxicity of the molecule. Therefore, HeLa cells were treated with different concentrations of 4, 4’-Biphenol and incubated for 4 hrs. The level of S6 ribosomal protein phosphorylation upon 4, 4’-Biphenol treatment was determined by Western Blot (Figure 4.26).

Figure 4.26: 4, 4’–Biphenol inhibits S6 ribosomal protein phosphorylation in HeLa cells. HeLa cells were treated with increasing concentrations of 4, 4’-Biphenol and incubated for 4 hrs. After 4 hrs, cells were lysed and the level of phospho-S6 was detected by Western Blot. A) Quantification of the band intensity was done using ImageJ. Results are average from 3 independent experiments. Error bars indicate ±SEM. (Note: No significance between different concentrations was calculated as there are variations between quantification values within each concentration tested. More number of experiments is needed for calculation of significance under this condition). B) Western Blot for P-S6 and total-S6. Image is representative of 3 independent experiments.

It was observed that at concentrations of 4, 4’–Biphenol that caused increased cell death, a decrease in the level of phospho-S6 was observed. However, at lower concentration of the small molecule, an increase in the level of phospho-S6 was observed. Moreover, at 100µM concentrations, the level of phospho-S6 is close to that of control even though an increased cell death was observed at this concentration. Hence, the cell death observed could only be in part, due to inhibition of Rheb signaling and not completely dependent on the pathway. These observations point out that even though the molecule induces cell death in secondary cell lines, the effect is not always due to Rheb binding and its downstream pathway inhibition but involves other non-specific targets as well.

5. Discussion 5.1. Myc and Flag tagged Rheb do not induce apoptosis but EGFP and sfYFP fusion proteins of Rheb (fp-Rheb) induce apoptosis in HeLa cells Rheb overexpression promotes cell growth and proliferation due to the activation of the downstream mTOR pathway (Saucedo et al. 2003; Inoki, Li, et al. 2003; Li, Corradetti, et al. 2004). It was found that fusion of Rheb with large fluorescent proteins like EGFP or sfYFP induced caspase-3 dependent apoptosis as shown by caspase-3 staining (Karassek 2010) and fragmented nuclei. However, small tags of sizes 1KDa like flag or myc did not induce apoptosis per se. Apoptotic cells were detected by the co-transfection of H2B-RFP that displays the nuclei and transfected cells with fragmented nuclei were counted as apoptotic cells. Some of the EGFP-/sfYFP-Rheb transfected cells display condensed green fluorescence signal. As described previously, these are also the characteristics of apoptotic or dead cells expressing green fluorescence protein (Harvey et al. 2001). The condensed signals are due to the cell rounding and shrinkage associated with the loss of adhesion (Harvey et al. 2001). Since some of these condensed signals did not display any fragmented nuclei (Figure 4.5), it is not clear, whether these cells actually underwent apoptosis or any additional cell death mechanisms were activated. EGFP and sfYFP fused Rheb induced apoptosis (Figure 4.1), whereas EGFP or sfYFP alone, or myc or flag tagged Rheb did not induce cell death which was also confirmed by Western Bot against cleaved-caspase-3 (Figure 4.2). For myc-Rheb and flag-Rheb overexpressing cells, no cleaved-caspase-3 could be detected (Figure 4.2). These observations along with the detection of dead cells displaying fragmented as well as non-fragmented nuclei indicate that the fluorescent-protein-Rheb fusion proteins (fp-Rheb) induces an overall toxicity to the cells thus causing the activation of multiple cell death pathways.

5.2. Molecular basis of fp-Rheb induced apoptosis Overexpression of EGFP or sfYFP fused to N-terminus of Rheb (fp-Rheb) induces apoptosis in HeLa cells and other cell lines (dissertation Karassek, 2010). These characteristics are displayed by large fluorescent protein fused to Rheb and not of any other small tagged Rheb proteins or wild type Rheb. Hence, it was important that we determine the cause of such a change in the characteristic of the protein, in order to eliminate making mistakes on understanding the exact role of Rheb overexpression in the future. The fluorescent proteins used here have been employed since several years to

80 characterize various proteins (Kaether & Gerdes 1995; Marshall et al. 1995). The results obtained here raise a question, whether the results of such studies are also influenced by the fluorescent protein fusions.

Interestingly, common challenges encountered in working with fluorescent proteins are protein aggregation, incorrect localization, non-functional fusions etc (Rizzo et al. 2009). In many cases, the primary cause is interference with the host protein's normal biological function, but aggregation as well as excessively high expression levels can also produce the same result (Lisenbee et al. 2003). In the current study, a few of these challenges have been considered and addressed as the possible cause of Rheb fusion protein induced apoptosis. Several approaches have been made here to determine the exact cause of this change in property of the proteins.

A previous study (dissertation, Karassek, 2010) as well as the current study (data not shown), had shown that there is no difference in the activation of downstream mTORC1 pathway by either of the Rheb fusion proteins (dissertation, Karassek, 2010). Since it was already stated that the apoptosis inducing property of EGFP-Rheb is independent of the mTOR pathway, as rapamycin could not provide protection from EGFP-Rheb induced apoptosis (dissertation, Karassek, 2010), the induction of apoptosis by fp-Rheb may be mediated by a pathway independent of mTORC1.

Moreover, it has been previously described that EGFP fused to Rheb lacking the C- terminal CAAX motif (EGFP-Rheb∆CAAX) also induces apoptosis (dissertation, Karassek, 2010). Without the C-terminal CAAX motif, the protein remains in the cytosol and nucleus. Since the C-terminal CAAX mediated localization of Rheb is essential for its function (Buerger et al. 2006), the Rheb∆CAAX protein cannot activate mTOR and downstream S6 Kinase. Hence the fusion of EGFP to Rheb or to Rheb∆CAAX induces apoptosis via a mechanism independent of mTOR or sub-cellular localization.

Several studies in the past have shown that Rheb has mTORC1 independent targets and non-canonically regulates many other cellular events (Neuman & Henske 2011; Zhou et al. 2009; Karbowniczek et al. 2006; Melser et al. 2013). Hence, it could be possible that EGFP-Rheb induces apoptosis by a pathway independent of mTORC1 by a gain of function, which is the pro-apoptotic property. Therefore, detailed investigations have to be conducted to identify whether EGFP-Rheb mediates apoptosis by either of these non- canonical pathways or a novel pathway is involved.

5.2.1. EGFP-Rheb induced apoptosis is independent of its sub-cellular localization

In the localization studies conducted, it was found that both EGFP-Rheb and myc-Rheb overexpression displayed a similar localization pattern. An endomembrane localization was observed as previously described for Rheb (Hanker et al. 2010; Takahashi et al. 2005). The exact localization, whether in the ER, Golgi, mitochondria or any other endomembranes, has to be confirmed by co-staining with specific markers for these organelles (Hanker et al. 2010; Yadav et al. 2013). Rheb’s presence in the nucleus (Yadav et al. 2013) has been described using similar EGFP-Rheb protein as that has been used in the current study. Since very low percentage of EGFP-Rheb and myc-Rheb was also detected in the nucleus (Figure 4.6), it cannot be confirmed whether this localization can be owed to the overexpression or mislocalization due to the impact of the fusion protein. This presence of EGFP-Rheb and myc-Rheb in the nucleus could also be due to mislocation by very high amount of protein compared to that of endogenous level in the cell. Between myc-Rheb and EGFP-Rheb, no difference in the localization was observed with the same initial plasmid concentration under overexpression condition (Figure 4.6). Whether this presence of overexpressed Rheb in the nucleus is also true for wild type Rheb, is yet to be confirmed.

The current observation that myc-Rheb and EGFP-Rheb do not display any difference in localization, indicate that the pro-apoptotic role of EGFP-Rheb is independent of its localization. This observation was supported by a previous study using EGFP- Rheb∆CAAX which is not endomembrane associated due to lack of C-terminal CAAX motif, but induced apoptosis. Hence it can be concluded that Rheb fusion protein induced apoptosis is independent of its localization and mTOR activation (dissertation, Karassek, 2010).

5.2.2. Induction of apoptosis by EGFP-Rheb is independent of its protein expression level

The next approach was to determine whether the pro-apoptotic role of EGFP-Rheb is attributed to the higher amount of the protein expressed compared to myc-Rheb or flag- Rheb. For this, various concentrations of each of the plasmids were transfected into HeLa cells. The induction of apoptosis as well as the expression of proteins with increased plasmid concentrations was compared between EGFP, flag or myc tagged Rheb and results were analyzed.

With increasing plasmid concentration, an increase in apoptosis of transfected cells was observed for each of the three proteins (Figure 4.7). The expression pattern was also analyzed and increasing amount of protein expression was found with increasing concentration of plasmids for each of the overexpressed proteins (Figure 4.7).

Interestingly, a higher concentration of myc or flag tagged Rheb still did not induce apoptosis as compared to the apoptosis induced by a lower concentration of EGFP-Rheb. Or in other words, even a low concentration of EGFP-Rheb induced apoptosis in HeLa cells.

Alternatively, the expression levels of the same initial concentration of each plasmid were compared to determine whether the expression level of the proteins makes any difference. For this, proteins isolated from the 4µg of plasmid transfected cells were subjected to SDS- PAGE and Western Blot to detect the level of each tagged Rheb proteins. It was observed that compared to EGFP-Rheb expression, both flag- as well as myc-tagged Rheb expressed relatively same amount of proteins (Figure 4.8). Between myc-Rheb and EGFP-Rheb as well as between flag-Rheb and EGFP-Rheb there was no difference in the expression of proteins. This further indicates that the difference in apoptotic properties between these proteins is not due to any difference in the amount of protein expressed.

It was previously described that high amount of protein in the cells may cause cell death by apoptosis or necrosis (Erkan et al. 2001; Morais et al. 2005; Wu et al. 2010) due to ER stress. Whether EGFP-Rheb induced apoptosis is due to their high expression that leads to a protein amount which is not tolerable by the cells, has to be analyzed. To this end, increasing concentrations of proteins were overexpressed in the cells. Of course, an increased apoptosis was observed with increasing concentration of all the three proteins. Even though the expression levels of myc- or flag-Rheb and EGFP-Rheb were similar, high levels of myc or flag-Rheb did not induce apoptosis as compared to that of EGFP- Rheb. This gives rise to two possibilities for the statement that the amount of protein expression is not the reason for EGFP-Rheb induced apoptosis: first, the overexpression of any of these proteins is still tolerable by the cell as the higher concentrations of flag or myc-Rheb still did not induce apoptosis compared to that of the apoptosis induced by a lower concentration of EGFP-Rheb. Second, even low concentration of EGFP-Rheb that has the lowest expression (Figure 4.7), induced apoptosis. Nevertheless, from the observed results, EGFP tagged Rheb has some other undefined ability to induce apoptosis that is independent of their protein amounts expressed.

5.2.3. Change in interaction properties of EGFP-Rheb fusion proteins

The next approach was to determine if possible changes in the interaction properties of myc-Rheb and EGFP-Rheb could be the basis of the pro-apoptotic role of EGFP-Rheb. The physiological relevance of the apoptosis induced by overexpression of EGFP-Rheb can be analyzed based on the interacting proteins identified as well as the proteins that were regulated upon EGFP-Rheb expression. This inturn will help, in general, to identify the mechanism by which the binding properties of fp-Rheb proteins are altered. For this purpose, pull down experiments using the two conditions; EGFP-Rheb and myc-Rheb were performed and mass spectrometry was used to identify the co-immunoprecipitated proteins.

Rheb GTPase interact with proteins like mTOR, Raf kinase, FKBP38, PDE4D5, NR3A, Bnip3 due to their role in several cellular events like proliferation, growth, differentiation, apoptosis (Li et al. 2007; Sucher et al. 2011; Kim et al. 2010; Ma et al. 2008). The effect of EGFP fusion on the binding properties of Rheb was detected by comparing the proteins that were differentially interacting with myc tagged Rheb and EGFP fused Rheb.

It was observed after mass spectrometric analysis of the samples that, many proteins co- immunoprecipitated with both myc and EGFP-Rheb. Interestingly, few of these proteins were differentially regulated (either higher level of proteins: upregulation or lower level of proteins: downregulation). This means that, five proteins were found to be upregulated and three downregulated upon EGFP-Rheb overexpression compared to that of myc-Rheb overexpression (Figure 4.10). Contrastingly, all of these proteins that were differentially regulated between myc and EGFP-Rheb did not show any fold difference between EGFP and EGFP-Rheb.

The proteins upregulated in EGFP-Rheb include cytoskeleton associated proteins like tubulin alpha and beta chain, actin and EEF1A1P5, an elongation factor. A major fold difference (11.8 fold) was observed for CK-18 (cytokeratin-18 or KRT18). The CK-18 is an important protein in the apoptosis pathway as cleavage of this protein by caspases contributes to cellular collapse and apoptosis (Caulin 1997). CK-18 is a well known apoptotic by-product and has been reported to be an important marker of apoptosis in many diseases (Tamimi et al. 2012). It was found that caspase generated CK-18 fragments are significantly elevated in nonalcoholic steatohepatitis (NASH) patients, acute pancreatitis (Koruk et al. 2012), HELLP patients (John et al. 2013), a disease that is characterized by

84 apoptosis. The elevated level of CK-18 in EGFP-Rheb overexpressed samples indicates that there is an elevated induction of apoptosis in EGFP-Rheb samples.

However, few proteins like SLC25A5, HSPA5 and HSPA9 were found to be downregulated. Of these SLC25A5 or ANT2 (mitochondrial ADP/ATP carrier - Adenine Nucleotide Carrier or Ancp) is one of the most abundant mitochondrial protein of the inner membrane of bovine heart mitochondria. It is particularly involved in maintaining the mitochondrial membrane potential and preventing apoptosis. Any deficiency or dysfunction of this membrane protein leads to serious consequences on cell metabolism and can cause various diseases such as muscular dystrophy. It participates in many models of mitochondrial apoptosis by forming the mitochondrial permeability transition pore (Clémençon et al. 2013). Therefore the association of downregulation of SLC25A5 with EGFP-Rheb overexpression and induction of apoptosis supports the pro-apoptotic nature of EGFP-Rheb in the cells.

Other protein that was downregulated includes the 78-kDa glucose-regulated protein (GRP78), an ER chaperone that regulates protein folding in the ER and has been suggested to contribute to cell survival. A downregulation of these proteins have been associated with induction of apoptosis due to ER stress (Suyama et al. 2011; Li et al. 2014). Another protein is HSPA9 whose downregulation also induces apoptosis and altered cell cycle (Chen et al. 2011; Peng et al. 2013).

Therefore EGFP-Rheb may mediate apoptosis by altering the levels and expression of various proteins that have roles in proliferation, survival or apoptosis, when compared to that of myc-Rheb. However, these proteins were also present in EGFP expressing samples and did not display any fold difference. Since, EGFP expressing cells were not as apoptotic as EGFP-Rheb expressing cells, it indicates that EGFP-Rheb induced apoptosis may not be due to the differential regulation of these proteins alone but due to differential binding properties of EGFP-Rheb.

Supporting the above statement is the finding that few proteins were present only in samples expressing EGFP-Rheb (Figure 4.10). Interestingly, these proteins have roles in apoptosis (pro or anti-apoptotic). Some of the proteins identified were: i. HSPD1- Heat Shock Protein 60, a chaperone protein of molecular weight of 60 kDa, is involved in carcinogenesis and apoptosis (Hwang et al. 2009)

85 ii. HSP90B1- Heat Shock Protein 90B1, an anti-apoptotic chaperone protein present in many human tumor cells. By inhibiting apoptosis and promoting the proliferation of cancer cells, HSP90 facilitates the survival and growth of cancer cells (Li et al. 2012). iii. Filamin A, a candidate for the mediation of a caspase-independent non-nuclear pathway to apoptosis in response to grB, a pro-apoptotic protease produced by cytotoxic T lymphocytes. Filamin is directly cleaved by granzyme B when target cells are exposed to granzyme B and the lytic protein perforin, but it is also cleaved in a caspase dependent manner following the ligation of Fas receptors (Browne et al. 2000). iv. Succinate dehydrogenase (SDH)–ubiquinone complex II, a multi-subunit component of the Krebs cycle and mitochondrial respiratory chain. It is involved in complex II of the mitochondrial electron transport chain and is responsible for transferring electrons from succinate to ubiquinone (coenzyme Q). This protein act as a tumor suppressor and mutations in this proteins are associated with an increased risk for many malignancies Mutations in these genes predispose to hereditary paraganglioma (PGL) and pheochromocytoma (PHEO), and are associated with an increased risk for other malignancies (Renella et al. 2014). v. Prohibitin (PHB) is a protien that has roles in impacting cellular senescence and development, as well as suppression of tumor cell proliferation. Akt may promote cell proliferation by phosphorylating prohibitin (Jiang et al. 2015).

vi. HADHA encodes for the α-subunit of the mitochondrial trifunctional protein that catalyzes the mitochondrial β-oxidation of long chain fatty acids (Naiki et al. 2014). vii. CHCHD3, a protein essential for maintaining crista integrity and mitochondrial function. In the mitochondria, ChChd3 is a peripheral protein of the inner mitochondrial membrane facing the inter membrane space. ChChd3 was found to be significantly down regulated in mitochondrial proteomic analysis of a cell line model of familial amyotrophic lateral sclerosis (Darshi et al. 2011). viii. Fatty acid synthase, the key enzyme for production of palmitic acid, which is the precursor of all lipids. FASN was reported to be overexpressed in the ovarian system when cells reveal high growth rates, irrespective of their state of malignancy /differentiation / senescence. FASN represents a metabolic marker of ovarian cell proliferation rather than cancer. Quiescent normal cells usually lack it (Veigel et al. 2015).

86 ix. Protein Disulfide Isomerase (PDI). The members of this family are classified as enzymatic chaperones for reconstructing misfolded proteins. Loss of PDI activity has been associated with the pathogenesis of numerous disease states. Inhibition of PDI enzymatic activity sensitizes cells to apoptosis. Even though up-regulation of PDI family members protect from misfolded proteins and restores normal cellular homeostasis at the early stage of ER stress, apoptotic cell death pathways are initiated when the PDI accumulates at threshold levels in response to misfolded proteins (Zhao et al. 2015). ix. Peroxiredoxin. They are recently considered as the most important enzymes regulating the concentration of hydroperoxides inside the cells. It might be essential for eliminating

H2O2 generated by a variety of cellular stresses and proinflammatory cytokines. It may also have a protective role against ASK1-induced apoptosis mediated by oxidative stresses (Kim et al. 2008). Since Rheb enhanced apoptosis is mediated via ASK-1 (Karassek et al. 2010), it will be interesting to know if EGFP-Rheb mediated apoptosis involves peroxiredoxin and its regulation of ASK-1. x. VDAC1, a protein that has key role in mitochondria-mediated apoptosis through its involvement in the release of apoptotic proteins located in the inter-membranal space. The mitochondrial voltage-dependent anion channel (VDAC) family proteins, VDAC1, VDAC2, and VDAC3, all are located on the mitochondrial outer membrane (OMM). During apoptosis signaling cascade, the pro-apoptotic proteins like Bax and Bak, stimulates the opening of VDAC1, allowing the release of Cytochrome C, whereas, anti- apoptotic proteins like Bcl2 or BclXL closes VDAC1 (Shimizu et al. 1999; Shimizu et al. 2000).

Previous studies were conducted on the synRas mouse model, which was established by Heumann et al using the constitutively activated Ras under the control of the synapsin I promoter, allowing expression in postmitotic neurons in the cortex and hippocampus. These studies showed that pl-VDAC-1 expression is decreased in the synRas-Mouse. This was also confirmed at the mRNA level in primary cortical cultures. In the mouse, the exon 1 of the VDAC-1 mRNA is alternatively spliced, so that the VDAC-1 is expressed in the plasma membrane (pl-VDAC-1) and in the outer mitochondrial membrane (mt-VDAC-1). Syn-Ras model displayed neuroprotection against several toxic stimulation like 6-OHDA (Chakrabarty et al. 2007) and excitatory glutamate induced cell death (Neumann 2010) in primary cortical neurons. The specific pl-VDAC-1 decreased expression in the synRas- mouse at the mRNA level in primary cortical cultures as well as in cortex and

87 hippocampus of adult mice synRas reveals the relationship between VDAC-1 and synRas- mediated neuroprotection. For the mt-VDAC-1 it is well documented that its expression level has an effect on the cell survival. An overexpression results in an increased rate of apoptosis, conversely, a decreased expression makes the cells less sensitive to toxic stimuli. It was therefore suggested that constitutively activated Ras induces a reduced pl- VDAC-1 expression and thus contributes to neuroprotection (Neumann 2010).

Therefore, based on the findings that EGFP-Rheb induces apoptosis by itself and interacts with VDAC1, it is assumed that VDAC1 may play a key role in the apoptosis induction by EGFP-Rheb. The interaction of EGFP-Rheb with VDAC1 needs to be first confirmed by pull down assay and Western Blot using specific antibodies. It was already tested whether EGFP-Rheb induced apoptosis can be suppressed by VDAC1 knock out. But it did not give rise to any change in the apoptosis. Neverthless, considering the role of VDAC1 in apoptosis (Death et al. 2009) and the localization of EGFP-Rheb in mitochondria (Ma et al. 2008; Melser et al. 2013), the significance of this interaction needs to be further analyzed.

The proteins that were present only in myc-Rheb expressing samples include: RNA binding proteins, Kelch Like protein 22 and TOX4. The physiological significance of these proteins and their interactions with Rheb has to be analyzed.

5.3. Split sfYFP proteins reconstitute fluorescence

BiFC have been in use since several years to determine protein-protein interactions in cellular systems (Hu et al. 2002; Kerppola 2006). A ‘superfolder’ YFP- sfYFP was used to analyze the applicability of BiFC for in vitro analysis for protein-protein interactions (Ottmann et al. 2009).To obtain split sfYFP constructs that can be expressed in E. coli, 15 different mutations were introduced. The resultant protein was shown to display enhanced folding and stability in standard buffer systems.

The split halves and the whole sfYFP protein were sub-cloned for their expression in secondary cell lines like HeLa cell lines. It was found that the expression of split halves, YN (N-terminal half) and YC (C-terminal half) alone do not display any fluorescence in the cells. Interestingly, the co-expression of the two halves resulted in reconstitution of fluorescence even in the absence of any interacting pairs of proteins (Figure 4.12). The split sfYFP halves, therefore, have the ability to self-reconstitute. This self-reconstitution of sfYFP split halves has been verified using tranfection and expression of the proteins in secondary cell lines. 88

Apart from the cellular experiments, the proteins were expressed with GST tags (GST-YN and GST-YC) using bacterial expression system and purified using glutathione sepharose beads. The purified YN and YC proteins, as well as the mixture of the two proteins (titration using different concentrations) were subjected to fluorescence measurement using fluorescence spectrometer at the Department of physical Chemistry I, Ruhr University Bochum. The excitation and emission spectra of the reconstituted and individual proteins were measured. A time drive measurement of titrations of different increasing concentration of YN with a fixed concentration of YC indicated a very low affinity (data not shown as the measurements did not yield any steady state level).

Using the GST-YC attached separose beads and adding free YN to the beads, the reconstitution of YN and YC was demonstrated, which could be observed under fluorescence microscope (Figure 4.13). Whereas, individual proteins attached to beads did not yield any fluorescence. Since here the observations were made under the microscope, without any quantification, it is not possible to determine the affinity or binding kinetics of the reconstitution processes. However, this is a perfect example which supports the finding that YN and YC self-reconstitute fluorescence.

There has been another report providing caution on the use of split YFP proteins to study protein-protein interactions (Horstman et al. 2014), stating that two halves of the protein tend to reconstitute by themselves even in the absence of interacting pairs of proteins. This along with the current findings claim that not all fluorescent proteins could be used for the BiFC assays and hence would like to provide a cautionary note on the usage of split fluorescence proteins for BiFC assays.

Since the two halves of sfYFP reconstitute fluorescence, this system could no longer be used for BiFC assays to determine protein-protein interaction. However, new applications of this system were deciphered.

5.3.1. Development of a split-sfYFP based methodology to study the pro-apoptotic property of fp-Rheb

Even though the split sfYFP system could not be used for protein-protein interaction studies, in the current study, an attempt to elucidate new applications of this system was made.

There has been previous reports on the development of split GFP system that displays better solubilty, self-association and was used to tag and detect either soluble or insoluble proteins in living cells or cell lysates. The split GFP system is simple and does not change fusion protein solubility. A protein of interest (X) was fused to a small GFP fragment (residues 215–230) via a flexible linker (L). The complementary GFP fragment (1–214) is expressed separately. Neither fragment alone is fluorescent. When mixed, the small and large GFP fragments spontaneously associate, resulting in GFP folding and formation of the fluorophore (Cabantous et al. 2005).

Here the reconstitution of split sfYFP halves could be used to visualize fluorescence induction and pro-apoptotic property of Rheb fusion proteins. The fusion of any one half of sfYFP to Rheb leads to a protein which is non-fluorescence and less-apoptotic (Figure 4.14). However, addition of the complementary half leads to the reconstitution of fluorescence and strong induction of apoptosis as seen in Figure 4.14. Therefore the reconstitution of split sfYFP is an essential tool to ''switch on'' the fluorescence and pro- apoptotic property of Rheb fusion proteins. The reconstituted protein allows the visualization of the Rheb location and apoptosis induction.

The fusion protein of Rheb with YC (9KDa) or YN (17KDa) alone is weakly pro-apoptotic (12-13%) (Figure 4.14) when compared to that induced by myc tag (1.2KDa) or flag tag (1KDa) fusion (3.5-5%) (Figure 4.1). A co-expression of YN with YC-Rheb or vice versa strongly enhanced the pro-apoptotic activity due to YC and YN reconstitution to fluorescent sfYFP-Rheb.

The reconstitution of purified YC-Rheb and YN proteins was also investigated using fluorescence spectrometer (see appendix 8.1.4). A pre-incubated sample mixture of YC- Rheb and YN was excited at 485nm and emission was recorded between 510 and 550nm. Peak emission was observed at 523nm. Individual proteins did not yield this fluorescence, thus confirming that YC-Rheb and YN also reconstitute fluorescence in solution when mixed together in solution.

5.3.2. Determining the structural basis of fp-Rheb protein mediated apoptosis: Fusion of split half of sfYFP to the N-terminal of Rheb induces a shift in Rheb’s structure

The ability of sfYFP split halves to self-reconstitute was also taken advantage of in order to determine the change in structure of Rheb when fused with fluorescence proteins.

In order to determine if the fusion of EGFP induces a change in the folding or structure of Rheb, NMR spectroscopic measurements were carried out in collaboration with Miriam Schöpel and Prof. Dr. Raphael Stoll, Biomolecular NMR spectroscopy, at the Ruhr

University Bochum. His6 tagged, EGFP-Rheb protein was expressed using the bacterial system and purified. The proteins were enriched with 15N and subsequently, 1-D and 2-D NMR spectroscopic measurements were performed.

From the 1H measurements, it was found that the proteins are in their folded state (Figure 4.11). The 1H-15N HSQC measurments showed that the signals were broadened beyond detection due to the huge size of the complex protein, as the relaxation time was slowed. The EGFP is fused N terminally to Rheb with a linker size of 27 amino acids and the fusion protein behaves as a huge complex causing a slow-down of the relaxation time. This in turn leads to the disappearance of the peaks and hence no signals were detected for the proteins (Figure 4.11).

The current observations lead to the hypothesis that linker length of 27 amino acids between EGFP and Rheb allows the EGFP protein to be attached to Rheb, hence causing a steric hindrance on Rheb. There have been previous researches using EGFP-Rheb overexpression that did not report on any apoptosis induction by these proteins (Buerger et al. 2006; Yadav et al. 2013; Swer et al. 2014). The linker length for a few of these was less than the one used in current study (example, 17 amino acids linker size (Yadav et al. 2013)). Since no apoptosis induction was described by these researches, it is not yet clear if the length of the linker indeed made a difference in the property of Rheb or if the apoptotic property went unnoticed. Hence it would be interesting to test the hypothesis that length of the linker can have an effect. This could be done by determining the effect by both cellular and structural analysis, using a shorter as well as a longer linker between EGFP and Rheb.

Since the size of EGFP-Rheb is too big to be able to detect the shifts of the whole protein, the split sfYFP system and their role in switching on and mimicking the apoptosis inducing property of fp-Rheb were exploited.

Based on the finding that YC-Rheb does not induce apoptosis as compared to that of YC- Rheb co-expressed with YN, the NMR spectroscopy was used to determine the structure of YC-Rheb and compare it with the Rhebwt and reconstituted sfYFP-Rheb from the purified YN and YC-Rheb (Figure 4.15).

YC-Rheb (30KDa) was 15N labeled and YN unlabeled. This allows visualization of the shifts in YC-Rheb, with and without addition of YN and overcome the size limits of NMR measurements.

The 1H NMR spectra of YC-Rheb showed that Rheb is indeed correctly folded but the YC part of the protein remains unfolded. The addition of YN did not allow the re-folding of the YN-YC to sfYFP (Figure 4.17). Since it is known that the rates of the different steps in fluorophore formation vary for different fluorescent proteins (Robida & Kerppola 2010), the YC-Rheb and YN were pre-incubated for up to 16 hrs at room temperature to allow the complex formation. However, a pre-incubation of YC-Rheb and YN at a concentration of 4 fold excess than YC-Rheb, did not allow the reconstitution to occur during NMR measurements. This could be because the affinity is very low in solution and hence a higher concentration of YN may be needed. A measurement using fluorescence spectrometer, with high concentrations of YC-Rheb and YN, reconstituted fluorescence (see appendix Figure 8.1.4) indicating that high amount of both proteins may be required to allow reconstitution in solution.

However, a promising result from the 1H-15N HSQC specta of YC-Rheb was obtained (Figure 4.17). Two major shifts were observed corresponding to Glu-53 and Tyr-54 of Rheb. It was previously described in an alanine screening that the point mutation E53A and Y54A reduced the phosphorylation of 4E-BP1 and S6K1. This was assumed to be the regions important for proper Rheb farnesylation and downstream signaling activation. Additionally, it was also found that Y54A and L56A mutants were deficient in guanine nucleotide binding indicating that these mutations interfere with mTOR activation due to their impaired nucleotide binding (Tee et al. 2005).

A weak pro-apoptotic activity was observed with YC-Rheb overexpression (12% as seen in Figure 4.14), which is enhanced upon co-expression with YN. Based on the shifts observed in YC-Rheb, it is necessary to investigate whether YC-Rheb and the reconstituted sfYFP- Rheb interferes with mTOR activation. This could be investigated by a Western Blot using anti-phospho-S6 or anti-phospho 4E-BP1 for samples overexpressing YC-Rheb or reconstituted sfYFP-Rheb. 92

No inhibition of mTOR activity was observed by fp-Rheb overexpression in the current study as well as previous study (dissertation, Karassek, 2010). Neverthless, the apoptosis induction by these fusion proteins is independent of the mTOR activation. Hence, it is important to determine whether the shifts observed in the YC-Rheb cause an induction of apoptosis via inhibition of mTOR pathway.

Since a reconstitution of YC and YN was not possible during the NMR measurements, it is very difficult to predict the outcome of fusion of the whole reconstituted sfYFP on Rheb protein structure. Alternatively, using various other methodologies like x-ray crystallography or a high resolution NMR Spectrometry, the change in fp-Rheb compared to wt Rheb could be determined.

5.4. Monitoring the targeting of a protein using split sfYFP system

One way by which the self-reconstitution of split sfYFP system could be taken advantage of, is to use it as a tool by which a cytosolic protein could be targeted to endomembranes additionally using the CAAX motif of Rheb. The fluorescence reconstitution allows the monitoring of the sub-cellular targeted protein.

As a proof of principle, YC was fused to C-terminal CAAX of Rheb (YC-CAAX8). Modifications at this region alone is required to target Rheb to the endomembranes

(Hanker et al. 2010). YC-CAAX8 was co-transfected with YN allowing the reconstitution of YN and YC to occur (Figure 4.18). This results in the localization of fluorescence to endomembranes similar to that observed with EGFP fused to CAAX8 (Hanker et al. 2010).

Rheb without the C-terminal CAAX motif (RhebΔCAAX) remains in the cytosol and nucleus and cannot activate downstream signaling (Buerger et al. 2006). This protein was fused with YN at its C-terminus (RhebΔCAAX-YN). The co-expression of YC allows fluorescence reconstitution and the protein remains in both cytosol and nucleus due to the absence of CAAX motif (Figure 4.19). Interestingly, a co-expression of YC fused to

CAAX8 allows the reconstitution to occur and the protein to be targeted to the endomembranes (Figure 4.19). This localization was observed from the appearence of fluorescence due to the ability of YN and YC halves to self-reconstitute.

Since the proper localization of Rheb is essential for its function, it is not yet clear if the targeting of Rheb∆CAAX via split sfYFP system and CAAX motif to the endomembranes yield a proper functioning Rheb.

Under normal conditions, Rheb activates mTOR which then activates downstream S6 Kinase that phosphorylates S6 ribosomal proteins and 4E-BP1 (Saucedo et al. 2003; Tee et al. 2005; Inoki et al. 2005). These proteins play important role in regulating translation and growth (Inoki et al. 2005). Whether Rheb∆CAAX localized to endomembranes via the split sfYFP system and CAAX8 is capable of activating downstream mTOR pathway, has been tested by probing for the level of phospho-S6. We did not observe any change in the phospho-S6 level compared with the untransfected or samples expressing Rheb∆CAAX alone (Figure 4.21). However there is a gain of apoptotic function as seen in Figure 4.20 and this function of the protein is independent of S6 Kinase activation (Figure 4.21). This is consistent with the observation that EGFP fused to Rheb∆CAAX, which is non endomembrane associated and do not activate downstream mTOR, but also induces apoptosis. This indicates the general property of fp-Rheb proteins that induces apoptosis independent of cellular localization and canonical Rheb pathway.

If not for functional Rheb reconstitution, this split sfYFP system could also be used for targeting a therapeutic protein that is fused to one half of sfYFP and co-expression of other half fused to localization signals, to a specific location in the cell. This specific targeting could be monitored by the reconstitution of fluorescence.

However, further application of the split sfYFP system requires that the affinity between the two halves is really high. The current system works well in the cell, but applications in solution requires optimization of the buffer conditions as well as several mutations to increase the affinity between the two halves.

Alternatively for NMR deteremination of the structure of reconstituted fp-Rheb, the split superfolder GFP system that was previously described (Cabantous & Waldo 2006) could be used as they display rapid reconstitution due to higher affinity and has minimum effect on protein solubility and folding.

5.5. EGFP-Rheb and myc-Rheb enhances apoptosis under UV stress It was already shown that flag-Rheb enhances apoptosis in response to UV stress (Karassek et al. 2010). When this phenomenon was investigated using myc-Rheb by cell count for fragmented nuclei, it was found that this protein is also able to enhance the apoptosis induced by UV stress.

Caspase-3 was found to be a critical executioner of apoptosis, as it induces the proteolytic cleavage of many key proteins such as the nuclear enzyme poly (ADPribose) polymerase 94

(PARP). Activation of caspase-3 requires proteolytic processing of its inactive zymogen into activated p17 and p12 fragments. (Fernandes-alnemri et al. 1994). UV-induced nuclear fragmentation and apoptosis are mediated via caspase-3 cleavage pathway (Kimura et al. 1998). Caspase-3 cleavage was detected by Western Blot for both of the UV induced samples. However, it was observed that, even though an enhancement of apoptosis was observed, there is no change in cleaved-caspase-3 level in myc-Rheb overexpressed samples treated with UV light (Figure 4.22). Hence the enhancement of apoptosis under UV stress by myc-Rheb is independent of caspase-3 cleavage. This is interesting as fragmented nuclei were observed in the cells transfected with myc-Rheb after exposure to UV light. There has been a report of cleaved-caspase-3 independent pathways that induce apoptosis (Bröker et al. 2005) where nuclear fragmentation occurs. These, along with our findings suggest that under cellular stress, myc-Rheb induces apoptosis via a pathway independent of caspase-3 activation. Since it was already described by Karassek et al, 2010 that Rheb enhanced apoptosis is dependent on Apoptosis Signaling regulated Kinase-1 (ASK-1), it would be interesting to investigate if this enhancement of apoptosis via ASK-1 is mediated by caspase-3 independent apoptotic pathway. ASK-1 is an essential component in the cellular death signaling induced by various stresses like ER stress, UV, Reactive Oxygen Species, (Tobiume et al. 2001; Nishitoh et al. 2002; Van Laethem et al. 2006). There has been a publication where, ASK-1 activation induces nuclear fragmentation and cell death but independent of caspase-3 cleavage (Boronkai et al. 2009). Whether myc- Rheb enhanced apoptosis is mediated by ASK-1 via a caspase-3 independent mechanism is yet to be investigated.

EGFP-Rheb overexpressed cells could also enhance cell death induced by UV stress (Figure 4.23). Even though not as significant compared to that mediated by wt Rheb, these finding confirms that there is a synergistic cell death induced by EGFP fusion as well as UV stress.

5.6. EGFP fusion also renders Ras pro-apoptotic

It was also investigated if, fusion of EGFP to the N-terminus of Ras also has any effect on cellular survival because both Ras and Rheb belong to the same subfamily and play pivotal roles in cellular growth and proliferation. The constitutively active Ras mutant (G12V), was found to protect cells from UV-induced apoptosis (Karassek et al. 2010). EGFP was fused N-terminally to constitutively active Ras and the effect of EGFP-Ras on cellular

95 survival under basal and UV stressed conditions were determined. It was observed that even the overexpression of EGFP-Ras induced apoptosis of HeLa cells (Figure 4.24). Interestingly, EGFP-Ras displayed only partial protection from UV induced cell death. The protection is not significant compared to the protection by myc-tagged Ras. This is probably because the toxicity of EGFP-Ras is more dominant when compared to the protective role of the Ras proteins. Here, it was observed that EGFP fusion induces an additive toxicity to the protein too, while the basic property of the protein remains unaffected.

From the above mentioned findings, it remains clear the need to investigate the mechanism by which the fusion of fluorescence proteins affects the property of the protein. In molecular biology, a lot of research has been conducted using fluorescence tags in order to study the interactions, localizations and trafficking mechanisms. From our observations, it is clear that such fusion proteins can change the characteristics of the protein. Hence it is important to investigate the changes that occur and the mechanism of induction of such changes.

If one has to use fluorescent proteins for the study, it has to follow certain precautions and guidelines in order to eliminate false results. These have been stated in several publications and interests have grown towards optimizing the over expression strategies for using fluorescent tags (reviewed in Snapp 2005).

5.7. 4, 4’ – Biphenol binds to Rheb and induces cell death

Increasing evidence suggests that Rheb and mTOR are aberrantly activated in a variety of human cancers. Hyper activation of Rheb proteins plays an important role in tuberous sclerosis, which causes the formation of benign hamartomatous tumors in the brain, kidneys, heart, lungs, skin, or eyes (Cargnello et al. 2015; Aspuria & Tamanoi 2004). A commonly applied chemical that inhibits the mTOR is Rapamycin (Choi et al. 1996). It was discovered to have potent immunosuppressive and anti-proliferative properties and has been used in the treatment of certain cancers (Crespo et al. 2002; Acevedo-Gadea et al. 2015). However their adverse side-effects restricted its usage.

K-Ras is a common oncogene which has been mutated in several cancers and has been the subject of study since many years (Hisamaru et al. 1985; Slebos et al. 2000). A wide variety of small molecule inhibitors were discovered for K-Ras that sterically interfere with the Sos-mediated nucleotide exchange in H- and K-Ras (Hall et al. 2013). However, a 96 small molecule inhibitor for Rheb has not been discovered so far. This is because a bona fide GEF has not been identified for Rheb.

Several molecules of small fragment library that bind to Rheb were screened using NMR Spectroscopy (Schöpel et al. 2013). This has been done at the Biomolecular NMR Spectroscopy, Ruhr University Bochum.

Two compounds; bisphenol A and 4, 4’ – Biphenol were identified to bind to Rheb. According to the Breast Cancer Fund, bisphenol A (BPA) is one of the chemicals humans are commonly exposed to as it is a building block of polycarbonate plastics. BPA is hence present in many household products, such as plastic food containers and eating utensils (Rubin 2011). It has been suggested that bisphenol A might (partly) cause cardiovascular diseases, breast and prostate cancers, and neuronal disorders (Wetherill et al. 2007). However, the complex impact of bisphenol A on living cells is not fully understood.

The affinity of bisphenol A and 4, 4’ – Biphenol to Rheb were identified to be 1800 ± 500 μM and 1540±230 μM respectively. Bisphenol A was found to bind to K-Ras with a higher affinity (Kd value 600 ± 200 μM) (Schöpel et al. 2013).

In order to check the effect of binding of 4, 4’- Biphenol to Rheb, HeLa cells were treated with different concentrations of these molecules and the percentage of cell death was determined. Interestingly, an increase in cell death was observed with increasing concentrations in the beginning but slightly decreases and then increases again (Figure 4. 25). In order to determine whether cell death is caused by binding of 4, 4’-Biphenol to Rheb and whether this binding has any effect on the downstream pathway activated by Rheb, cells treated with these molecules were subjected to Western Blot for S6 Kinase activity.

Rheb activates mTOR which then promotes translation by inducing phosphorylation of S6- ribosomal proteins and 4E-BP1 (Saucedo et al. 2003; Garami et al. 2003; Inoki et al. 2005; Long, Lin, et al. 2005). In the current study, the level of phospho-S6 was determined in comparison with the total S6 level. It was observed that there is a sudden increase in the phospho-S6 level at 25µM of 4, 4’- Biphenol and then decreasing until 100µM, followed by an increase at 200µM and again decreasing at 500µM (Figure 4.26). When compared with the cell death pattern, at a concentration of 4, 4’- Biphenol that induces cell death, a decrease in the level of phospho-S6 was observed (does not account for all concentrations of 4, 4’ - Biphenol). However, for concentrations such as 100µM, the level of phospho-S6 is almost same as that of control but still induces a maximum cell death. 97

This indicates that 4, 4’- Biphenol may have other targets in the cell whereby it induces cell death and not by inhibition of Rheb pathway alone. Even though we have tested the binding ability of this molecule for K-Ras, we haven’t tested it for the broad spectrum of proteins in the cell. Hence, for the molecule to be used to target specific pathways, it must be further screened for its specificity or further modified for specific binding to Rheb. Moreover, the affinity of the binding is low compared to other small molecules targeted against Ras. Therefore, measures like structural modifications of the molecules may be carried out to improve the affinity for selective binding to Rheb. This could help to establish these molecules in the treatment of various cancers and neuronal disorders.

Nevertheless, the current research provides a basic foundation for identification of small molecules that bind to Rheb, for which a small molecule inhibitor has not been discovered so far. Such molecules could be used to develop targeted therapy in the treatment of disease like Tuberos Sclerosis or neuro-degenerative diseases.

6. Conclusion and Outlook

In the current study, the molecular basis of fp-Rheb (fluorescent protein fused to Rheb) mediated apoptosis has been investigated. Analyses were conducted using various fluorescence proteins like EGFP, sfYFP and smaller tags like flag or myc. It was found that fusion of Rheb with large fluorescence proteins converts it from a pro-growth to a pro- apoptotic protein. The molecular basis of this pro-apoptotic role of fp-Rheb was investigated based upon the sub-cellular targeting and localization of the proteins, the amount of proteins expressed, differential interaction properties of fp-Rheb and structural modifications using NMR spectroscopy.

It was found that the pro-apoptotic role of EGFP-Rheb is independent of its localization as no differences were evident in the localization between apoptotic EGFP-Rheb and non- apoptotic myc- or flag-tagged Rheb. Moreover supporting evidences that apoptosis induced by fusion proteins of Rheb are independent of localization were provided by previous work (dissertation, Karassek, 2010). It was described that EGFP fused to Rheb lacking the CAAX motif which are important sites of farnesylation leading to endomembrane localization, also induces apoptosis.

Fp-Rheb does not inhibit the downstream canonical pathway activation and the pro- apoptotic function of fp-Rheb is independent of the mTOR activation (dissertation, Karassek, 2010). Therefore the fp-Rheb mediates apoptosis by an additional gain of function.

A comparison of the protein expressed by EGFP-Rheb and myc or flag tagged Rheb suggest that there is no difference in the protein amount expressed. Hence the induction of apoptosis is not due to a differential expression level of each protein.

Mass spectrometric analysis for the identification of putative interacting partners of the EGFP-Rheb in comparison with the myc tagged Rheb revealed that EGFP fusion changes the binding properties of Rheb. Out of 11 proteins that were differentially binding to EGFP-Rheb, 3 were found to play roles in apoptosis. Further studies should aim to resolve the question if the identified proteins that associate differentially to EGFP-Rheb bind directly or indirectly via additional proteins such as chaperones.

A knock down of these proteins under EGFP-Rheb overexpression condition and its effect on apoptosis will aid in identifying the mechanism by which EGFP-Rheb regulates these proteins. This in turn will help in explaining the basis of apoptosis induction by fp-Rheb.

Further investigations were carried out to determine whether, there arises an alteration in Rheb’s structure with EGFP fusion and whether this altered conformation of Rheb converts it into a pro-apoptotic protein. The 1H-15N HSQC NMR measurements for EGFP-Rheb did not yield any signals due to slow down of the relaxation time leading to line broadening and disappearance of peaks. Hence the size of the EGFP-Rheb fusion protein was exceeding the limits given by the NMR spectroscopic methods and alternative methods such as x-ray crystallography would have to be applied to determine the structure of fp- Rheb.

In another approach, it was found that split sfYFP halves, YN and YC, could reconstitute fluorescence even in the absence of previously described interacting pairs of proteins fused to them (Ottmann et al. 2009). To our initial surprise, these halves were found to be able to ‘‘switch on’’ the pro-apoptotic function of Rheb. For example, the weak pro-apoptotic activity of YC-Rheb was induced to strong pro-apoptotic activity of sfYFP-Rheb by YN and YC-Rheb co-expression. It was found that upon co-expression, YC-Rheb and YN reconstitute to fluorescent sfYFP-Rheb thereby initiating the fp-Rheb induced apoptosis. Unfortunately, in vitro reconstitution between YN and YC-Rheb could not be achieved so that we had to focus on YC-Rheb for the NMR structure determination. Comparison with the structure of wild type Rheb revealed two major shifts in amino acids Gln-53 and Tyr- 54 which were previously described to be essential for mTOR activation. Previous research showed that mutations in these amino acids completely inhibited mTOR activation. Since fp-Rheb mediated apoptosis is independent of the downstream mTORC1 mediated pathway, the relevance of these shifts has to be further critically analyzed. Yet, the implications of these shifts need to be investigated by determining if YC-Rheb activates mTOR by probing for S6 Kinase 1 or 4E-BP1 phosphorylation by Western Blot.

The split sfYFP system was used to target Rheb∆CAAX protein, to the endomembranes taking advantage of the CAAX sequence of Rheb fused to the YC and co-expressed with the YN fused to the C-terminal end of tuncated Rheb. The C-terminal CAAX sequence of Rheb turned out to be essential for the endomembrane association as well as proper functioning of Rheb. Even though this endomembrane targeting did not yield any change in S6 ribosomal protein phosphorylation compared to untransfected cells, the above 100 described method may turn out to become an important tool for specific targeting as well as monitoring the protein targeted to specific locations in the cell.

An improvement of the affinity between the two halves via mutations in the genes encoding for the two halves will enable their reconstitution in solution, allowing the NMR structure determination of reconstituted sfYFP-Rheb and also their applications in various protein targeting processes. Similar split GFP system have been described before (Cabantous et al. 2005, Pinaud and Dahan, 2011) which have been proved to rapidly complement. The improved affinity of the two fragments of split GFP could also be take advantage of, to determine the structure of fp-Rheb by using the two fragments of split GFP as fusion partners of Rheb.

Even though the split fluorophore systems are not novel, we were able to elucidate new application of this system which includes visualizing the fluorescence complementation leading to gain of apoptotic function of fp-Rheb.

A small molecule, 4,4’-Biphenol was identified to be able to bind to Rheb and not to K- Ras, thereby inducing cell death It was found that binding of 4,4’-Biphenol to Rheb effects the activation of the downstream growth promoting mTOR pathway as seen by decreased S6 Kinase 1 activity. However, it cannot be concluded that the cell death induced by 4, 4’-Biphenol is due to inhibition of Rheb pathway alone. Other targets or non-specific toxic mechanisms may be involved as well. Until now small molecule inhibitors have not been identified for Rheb. Hence, the identification of a small molecule that binds to Rheb is a starting point for developing therapeutic molecules targeting Tuberous Sclerosis or neurodegenerative diseases.

101

7. References

Acevedo-Gadea, C., Hatzis, C., Chung, G., Fishbach, N., Lezon-Geyda, K., Zelterman, D., DiGiovanna, M. P., Harris, L., and Abu-Khalaf, M. M. 2015.Sirolimus and trastuzumab combination therapy for HER2-positive metastatic breast cancer after progression on prior trastuzumab therapy. Breast Cancer Res. Treat., 157–167. Adami, A., García-Alvarez, B., Arias-Palomo, E., Barford, D., and Llorca, O. 2007.Structure of TOR and its complex with KOG1. Mol. Cell 27, 509–16. Aspuria, P.-J. & Tamanoi, F., 2004. The Rheb family of GTP-binding proteins. Cellular signalling, 16(10), pp.1105–12. Avruch, J. & Long, X., 2009. Amino acid regulation of TOR complex 1. Am J Physiol Endocrinol Metab, 1(98), pp.592–602. Avruch, J., Zhang, X. & Kyriakis, J.M., 1994. Raf meets Ras : completing the framework of a signal transduction pathway. Trends Biochem Sci., (July), pp.279–283. Bai., X, D., Ma, A., Liu, X., Shen, QJ., Wang, Y., Liu, Y., Jiang., 2007. Rheb activates mTOR by antagonizing its endogenous inhibitor, FKBP38. Science., 318(November), pp.977–981. Bakel, I. Van, Sepp, T., Ward, S., Yates, J. R. W., and Green, A. J. 1997. Mutations in the TSC2 gene : analysis of the complete coding sequence using the protein truncation test ( PTT ). Hum Mol Genet 6, 1409–1414 Berghaus, C., Schwarten, M., Heumann, R., and Stoll, R., 2007. Sequence-specific 1H, 13C, and 15N backbone assignment of the GTPase rRheb in its GDP-bound form. Biomolecular NMR Assignments, 1(1), pp.45–47. Borasio GD, John J, Wittinghofer A, Barde YA, Sendtner M, H.R., 1989. RAS p21 Protein Promotes Survival Outgrowth of Cultured Embryonic and Fiber Neurons. Neuron, 2(1), pp.1087–1096. Boronkai, A., Bellyei, S., Szigeti, A., Pozsgai, E., Bognar, Z., Sumegi, B., and Gallyas, F. 2009. Potentiation of paclitaxel-induced apoptosis by galectin-13 overexpression via activation of Ask-1-p38-MAP kinase and JNK/SAPK pathways and suppression of Akt and ERK1/2 activation in U-937 human macrophage cells. European Journal of Cell Biology, 88(12), pp.753–763. Bröker, L.E., Kruyt, F.A.E., Giaccone, G., 2005. Cell death Independent of Caspases:A Review. Clinical Cancer Research, 11(22), pp.3155–62. Browne, K. a., Johnstone, R. W., Jans, D. a., and Trapani, J. 2000. Filamin (280-kDa actin- binding protein) is a caspase substrate and is also cleaved directly by the cytotoxic T lymphocyte protease granzyme B during apoptosis. Journal of Biological Chemistry, 275(50), pp.39262–39266. Buerger, C., DeVries, B. & Stambolic, V., 2006. Localization of Rheb to the endomembrane is critical for its signaling function. Biochemical and biophysical research communications, 344(3), pp.869–80. Cabantous, S., Terwilliger, T.C. & Waldo, G.S., 2005. Protein tagging and detection with engineered self-assembling fragments of green fluorescent protein. Nature biotechnology, 23(1), pp.102–107. Cabantous, S. & Waldo, G.S., 2006. In vivo and in vitro protein solubility assays using split GFP. Nature methods, 3(10), pp.845–854. 102

Campbell, T. B., Basu, S., Hangoc, G., Tao, W., and Broxmeyer, H. E. 2009. Overexpression of Rheb2 enhances mouse hematopoietic progenitor cell growth while impairing stem cell repopulation. Blood, 114(16), pp.3392–401. Cao, M., Tan, X., Jin, W., Zheng, H., Xu, W., Rui, Y., Li, L., Cao, J., Wu, X., Cui, G., Ke, K., and Gao, Y. 2013. Upregulation of Ras homolog enriched in the brain (Rheb) in lipopolysaccharide-induced neuroinflammation. Neurochemistry international, 62(4), pp.406–17. Cargnello, M., Tcherkezian, J. & Roux, P.P., 2015. The expanding role of mTOR in cancer cell growth and proliferation. Mutagenesis, 30(2), pp.169–176. Caulin, C., 1997. Caspase Cleavage of Keratin 18and Reorganization of Intermediate Filaments during Epithelial Cell Apoptosis. The Journal of Cell Biology, 138(6), pp.1379–1394. Chakrabarty, K., Serchov, T., Mann, S. a., Dietzel, I. D., and Heumann, R. 2007. Enhancement of dopaminergic properties and protection mediated by neuronal activation of Ras in mouse ventral mesencephalic neurones. European Journal of Neuroscience, 25(December 2006), pp.1971–1981. Chen, T. H. P., Kambal, A., Krysiak, K., Walshauser, M. a., Raju, G., Tibbitts, J. F., and Walter, M. J. 2011. Knockdown of Hspa9, a del(5q31.2) gene, results in a decrease in hematopoietic progenitors in mice. Blood, 117(5), pp.1530–1539. Chiu, V. K., Bivona, T., Hach, A., Sajous, J. B., Silletti, J., Wiener, H., Johnson, R. L., Cox, A. D., and Philips, M. R. 2002. Ras signalling on the endoplasmic reticulum and the Golgi. Nature cell biology, 4(5), pp.343–50. Choi, J., Chen, J., Schreiber, S. L., and Clardy, J. 1996. Structure of the FKBP12- rapamycin complex interacting with the binding domain of human FRAP. Science (New York, N.Y.), 273(5272), pp.239–242. Choy, E., Chiu, V. K., Silletti, J., Feoktistov, M., Morimoto, T., Michaelson, D., Ivanov, I. E., and Philips, M. R. 1999. Endomembrane Trafficking of Ras : The CAAX Motif Targets Proteins to the ER and Golgi. Cell, 98, pp.69–80. Clémençon, B., Babot, M. & Trézéguet, V., 2013. The mitochondrial ADP/ATP carrier (SLC25 family): Pathological implications of its dysfunction. Molecular Aspects of Medicine, 34(2-3), pp.485–493. Cox, A.D. & Der, C.J., 2003. The dark side of Ras: regulation of apoptosis. Oncogene, 22, pp.8999–9006. Crespo, J.L., Hall, M.N. & Crespo, L., 2002. Elucidating TOR Signaling and Rapamycin Action : Lessons from Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev., 66(4), pp.579–591. Cuda, G., 2002. Protection of Human Endothelial Cells From Oxidative Stress: Role of Ras-ERK1/2 Signaling. Circulation, 105(8), pp.968–974. Curatolo, P., Bombardieri, R. & Jozwiak, S., 2008. Tuberous sclerosis. Lancet, 372(9639), pp.657–68. Dai, Q., Choy, E., Chiu, V., Romano, J., Slivka, S. R., Steitz, S. a., Michaelis, S., and Philips, M. R. 1998. Mammalian Prenylcysteine Carboxyl Methyltransferase Is in the Endoplasmic Reticulum. Journal of Biological Chemistry, 273(24), pp.15030–15034.

103

Darshi, M., Mendiola, V. L., Mackey, M. R., Murphy, A. N., Koller, A., Perkins, G. a., Ellisman, M. H., and Taylor, S. S. 2011. ChChd3, an inner mitochondrial membrane protein, is essential for maintaining Crista integrity and mitochondrial function. Journal of Biological Chemistry, 286(4), pp.2918–2932. Death, M. C., Baines, C. P., Kaiser, R. a, Sheiko, T., Craigen, W. J., and Molkentin, D. 2009. Voltage-Dependent Anion Channels are Dispensable for Mitochondrial- Dependent Cell Death. Nat Cell Biol., 9(5), pp.550–555. Downward, J., 1998. Ras signalling and apoptosis. Curr Opin Genet Dev., pp.49–54. Ehrkamp, A., Herrmann, C., Stoll, R., and Heumann, R. 2013. Ras and Rheb Signaling in Survival and Cell Death. Cancers, 5(2), pp.639–661. Erkan, E., De Leon, M. & Devarajan, P., 2001. Albumin overload induces apoptosis in LLC-PK(1) cells. American journal of physiology. Renal physiology, 280, pp.F1107– F1114. Eugenio Santos & Angel R. Nebreda, 1989. Structural and functional properties of ras proteins. FASEB J., (3(10)), pp.2151–2163. Fernandes-alnemri, T., Litwacks, G. & Alnemris, E.S., 1994. CPP32, a novel human apoptotic protein with homology to Caenorhabditis elegans cell death protein Ced-3 and mammalian interleukin-1 beta-converting enzyme. J Biol Chem, 269(49), pp.30761–30764. Flinn, R. J., Yan, Y., Goswami, S., Parker, P. J., and Backer, J. M. 2010. The late endosome is essential for mTORC1 signaling. Molecular biology of the cell, 21(5), pp.833–41. Fulda, S., Gorman, A. M., Hori, O., and Samali, A. 2010. Cellular stress responses: Cell survival and cell death. International Journal of Cell Biology, 2010. Ganley, I. G., Lam, D. H., Wang, J., Ding, X., Chen, S., and Jiang, X. 2009. ULK1.ATG13.FIP200 complex mediates mTOR signaling and is essential for autophagy. The Journal of biological chemistry, 284(18), pp.12297–305. Gao, X., Zhang, Y., Arrazola, P., Hino, O., Kobayashi, T., Yeung, R. S., Ru, B., and Pan, D. 2002. Tsc tumour suppressor proteins antagonize amino-acid-TOR signalling. Nature cell biology, 4(9), pp.699–704. Gao, X. & Pan, D., 2001. TSC1 and TSC2 tumor suppressors antagonize insulin signaling in cell growth. , pp.1383–1392. Garami, A., Zwartkruis, F. J. T., Nobukuni, T., Joaquin, M., Roccio, M., Stocker, H., Kozma, S. C., Hafen, E., Bos, J. L., and Thomas, G. 2003. Insulin Activation of Rheb , a Mediator of mTOR / S6K / 4E-BP Signaling , Is Inhibited by TSC1 and 2. , 11, pp.1457–1466. Goldfine, I., 1987. The insulin receptor: molecular biology and transmembrane signaling. Endocr Rev, 8(3). Groenewoud, M.J. & Zwartkruis, F.J.T., 2013. Rheb and Rags come together at the lysosome to activate mTORC1. Biochem Soc Trans, (41(4)), pp.951–955. Gromov, P. S., Madsen, P., Tomerup, N., and Celis, J. E. 1995. A novel approach for expression cloning of small GTPases: identification, tissue distribution and chromosome mapping of the human homolog of rheb. FEBS letters, 377(2), pp.221–6.

104

Gupta, A. & Dey, C.S., 2012. PTEN, a widely known negative regulator of insulin/PI3K signaling, positively regulates neuronal insulin resistance. Molecular biology of the cell, 23(19), pp.3882–98. Hagag N, Halegoua S, V.M., 1986. Inhibition of growth factor-induced differentiation of PC12 cells by microinjection of antibody to ras p21. Nature. Hall, B.E., Bar-Sagi, D. & Nassar, N., 2002. The structural basis for the transition from Ras-GTP to Ras-GDP. Proceedings of the National Academy of Sciences of the United States of America, 99(19), pp.12138–42. Hall, L., Phan, J., Burns, M. C., and Lee, T. 2013. Discovery of small molecules that bind to K-Ras and inhibit Sos-mediated activation. Angew Chem Int Ed Engl., 51(25), pp.6140–6143. Hancock, J.P., Paterson, H. & Marshalit, J., 1990. A Polybasic Domain or Palmitoylation Is Required in Addition to the CAAX Motif to Localize ~ 21 ” s to the Plasma Membrane. Cell, 63, pp.133–139. Hanker AB, N, Mitin, RS, Wilder, EP, Henske, , F, Tamanoi, AD, Cox, CJ., Der 2010. Differential requirement of CAAX-mediated posttranslational processing for Rheb localization and signaling. Oncogene, 29(3), pp.380–391. Harrington, L. S., Findlay, G. M., Gray, A., Tolkacheva, T., Wigfield, S., Rebholz, H., Barnett, J., Leslie, N. R., Cheng, S., Shepherd, P. R., Gout, I., Downes, C. P., and Lamb, R. F. 2004. The TSC1-2 tumor suppressor controls insulin-PI3K signaling via regulation of IRS proteins. The Journal of cell biology, 166(2), pp.213–23. Harvey, K.J., Lukovic, D. & Ucker, D.S., 2001. Membrane-Targeted Green Fluorescent Protein Reliably and Uniquely Marks Cells Through Apoptotic Death. Cytometry, 43, pp.273–278. Hay, N. & Sonenberg, N., 2004. Upstream and downstream of mTOR. Genes & development, 18(16), pp.1926–45. Heard, J. J., Fong, V., Bathaie, S. Z., and Tamanoi, F. 2014. Recent progress in the study of the Rheb family GTPases. Cellular Signalling, 26(9), pp.1950–1957. Hisamaru,H., Tetsuro, O., Yumi, A., Michio, F., Akio, U and Fumimaro,T. 1985. Activation of the c-K-ras oncogene in a human pancreas carcinoma. , 127(1), pp.168– 174. Horstman, A., Tonaco, I. A. N., Boutilier, K., and Immink, R. G. H. 2014. A cautionary note on the use of split-YFP/BiFC in plant protein-protein interaction studies. International journal of molecular sciences, 15(6), pp.9628–43. Hosokawa, N., Hara, T., Kaizuka, T., Kishi, C., Takamura, A., Miura, Y., Iemura, S., Natsume, T., Takehana, K., Yamada, N., Guan, J., Oshiro, N., and Mizushima, N. 2009. Nutrient-dependent mTORC1 Association with the ULK1 – Atg13 – FIP200 Complex Required for Autophagy. Mol Biol Cell., 20(m), pp.1981–1991. Hu, C.-D., Chinenov, Y. & Kerppola, T.K., 2002. Visualization of interactions among bZIP and Rel family proteins in living cells using Bimoelcular Fluorescence Complementation. Molec. Cell, 9, pp.789–798. Hwang, Y. J., Lee, S. P., Kim, S. Y., Choi, Y. H., Kim, M. J., Lee, C. H., Lee, J. Y., and Kim, D. Y. 2009. Expression of heat shock protein 60 kDa is upregulated in cervical cancer. Yonsei Medical Journal, 50(3), pp.399–406.

105

Im, E., von Lintig, F. C., Chen, J., Zhuang, S., Qui, W., Chowdhury, S., Worley, P. F., Boss, G. R., and Pilz, R. B. 2002. Rheb is in a high activation state and inhibits B-Raf kinase in mammalian cells. Oncogene, 21(41), pp.6356–65. Inoki, K., Li, Y., Xu, T., and Guan, K. 2003. Rheb GTPase is a direct target of TSC2 GAP activity and regulates mTOR signaling. Genes Dev., 17(15), pp.1829–1834. Inoki, K., Ouyang, H., Li, Y., and Guan, K.-L. 2005. Signaling by target of rapamycin proteins in cell growth control. Microbiology and molecular biology reviews : MMBR, 69(1), pp.79–100. Inoki, K., Li, Y., Zhu, T., Wu, J., and Guan, K.-L. 2002. TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling. Nature cell biology, 4(9), pp.648– 57. Inoki, K., Zhu, T. & Guan, K.-L., 2003. TSC2 mediates cellular energy response to control cell growth and survival. Cell, 115, pp.577–590. Jiang, L., Dong, P., Zhang, Z., Li, C., Li, Y., Liao, Y., Li, X., Wu, Z., Guo, S., Mai, S., Xie, D., Liu, Z., and Zhou, F. 2015. Akt phosphorylates Prohibitin 1 to mediate its mitochondrial localization and promote proliferation of bladder cancer cells. Cell Death and Disease, 6(2), p.e1660. John, K., Wielgosz, S., Schulze-Osthoff, K., Bantel, H., and Hass, R. 2013. Increased plasma levels of CK-18 as potential cell death biomarker in patients with HELLP syndrome. Cell death & disease, 4(10), p.e886. Jung, C. H., Jun, C. B., Ro, S., Kim, Y., Otto, N. M., Cao, J., Kundu, M., and Kim, D. 2009. ULK-Atg13-FIP200 Complexes Mediate mTOR Signaling to the Autophagy Machinery. , 20, pp.1992–2003. Kabeya, Y., Mizushima, N., Ueno, T., Yamamoto, A., Kirisako, T., Noda, T., Kominami, E., Ohsumi, Y., and Yoshimori, T. 2003. LC3, a mammalian homolog of yeast Apg8p, is localized in autophagosome membranes after processing (EMBO Journal (2000) 19 (5720-5728)). EMBO Journal, 22(17), p.4577. Kaether, C. & Gerdes, H.H., 1995. Visualization of protein transport along the secretory pathway using green fluorescent protein. FEBS Letters, 369(2-3), pp.267–271. Kang, Y.J., Lu, M.-K. & Guan, K.-L., 2011. The TSC1 and TSC2 tumor suppressors are required for proper ER stress response and protect cells from ER stress-induced apoptosis. Cell death and differentiation, 18, pp.133–144. Karassek, S., Berghaus, C., Schwarten, M., Goemans, C. G., Ohse, N., Kock, G., Jockers, K., Neumann, S., Gottfried, S., Herrmann, C., Heumann, R., and Stoll, R.2010. Ras homolog enriched in brain (Rheb) enhances apoptotic signaling. The Journal of biological chemistry, 285(44), pp.33979–91. Karassek, S., 2010. Ras homologue enriched in brain ( Rheb ) auf die stressinduzierte Apoptose. Naturwissenschaften, Erlangung,. Karbowniczek, M., Cash, T., Cheung, M., Robertson, G. P., Astrinidis, A., and Henske, E. P. 2004. Regulation of B-Raf kinase activity by tuberin and Rheb is mammalian target of rapamycin (mTOR)-independent. The Journal of biological chemistry, 279(29), pp.29930–7. Karbowniczek, M., Zitserman, D., Khabibullin, D., Hartman, T., Yu, J., Morrison, T., Nicolas, E., Squillace, R., Roegiers, F., and Henske, E. P. 2010. The evolutionarily

106

conserved TSC / Rheb pathway activates Notch in tuberous sclerosis complex and Drosophila external sensory organ development. J Clin Invest, 120(1), pp.93–102. Karbowniczek, M., Robertson, G.P. & Henske, E.P., 2006. Rheb inhibits C-raf activity and B-raf/C-raf heterodimerization. The Journal of biological chemistry, 281(35), pp.25447–56. Kerppola, T.K., 2006. Design and implementation of bimolecular fluorescence complementation (BiFC) assays for the visualization of protein interactions in living cells. Nature protocols, 1(3), pp.1278–1286. Kim, H. W., Ha, S. H., Lee, M. N., Huston, E., Kim, D.-H., Jang, S. K., Suh, P.-G., Houslay, M. D., and Ryu, S. H. 2010. Cyclic AMP controls mTOR through regulation of the dynamic interaction between Rheb and phosphodiesterase 4D. Molecular and cellular biology, 30(22), pp.5406–5420. Kim, S.Y., Kim, T.J. & Lee, K.Y., 2008. A novel function of peroxiredoxin 1 (Prx-1) in apoptosis signal-regulating kinase 1 (ASK1)-mediated signaling pathway. FEBS Letters, 582(13), pp.1913–1918. Kimura, C., Zhao, Q. L., Kondo, T., Amatsu, M., and Fujiwara, Y. 1998. Mechanism of UV-induced apoptosis in human leukemia cells: roles of Ca2+/Mg(2+)-dependent endonuclease, caspase-3, and stress-activated protein kinases. Experimental cell research, 239(239), pp.411–422. Koruk, I., Özdemir, H., Aydinli, M., Tarakcioglu, M., and Koruk, M. 2012. The relation between serum cytokeratin 18 and acute pancreatitis: Can it be a serological predictive marker? Turkish Journal of Gastroenterology, 23(6), pp.759–763. Kroemer, G., Galluzzi, L., Vandenabeele, P., Abrams, J., Alnemri, E. S., Baehrecke, E. H., Blagosklonny, M. V, El-Deiry, W. S., Golstein, P., Green, D. R., Hengartner, M., Knight, R. a, Kumar, S., Lipton, S. a, Malorni, W., Nuñez, G., Peter, M. E., Tschopp, J., Yuan, J., Piacentini, M., Zhivotovsky, B., and Melino, G. 2009. Classification of cell death: recommendations of the Nomenclature Committee on Cell Death 2009. Cell death and differentiation, 16, pp.3–11. Van Laethem, A., Nys, K., Van Kelst, S., Claerhout, S., Ichijo, H., Vandenheede, J. R., Garmyn, M., and Agostinis, P. 2006. Apoptosis signal regulating kinase-1 connects reactive oxygen species to p38 MAPK-induced mitochondrial apoptosis in UVB- irradiated human keratinocytes. Free Radical Biology and Medicine, 41(9), pp.1361– 1371. Li, G., Cai, M., Fu, D., Chen, K., Sun, M., Cai, Z., and Cheng, B. 2012. Heat shock protein 90B1 plays an oncogenic role and is a target of microRNA-223 in human osteosarcoma. Cellular Physiology and Biochemistry, 30(6), pp.1481–1490. Li, H., Zhu, X., Fang, F., Jiang, D., and Tang, L. 2014. Down-regulation of GRP78 enhances apoptosis via CHOP pathway in retinal ischemia-reperfusion injury. Neuroscience Letters, 575, pp.68–73. Li, Y., Wang, Y., Kim, E., Beemiller, P., Wang, C. Y., Swanson, J., You, M., and Guan, K. L. 2007. Bnip3 mediates the hypoxia-induced inhibition on mammalian target of rapamycin by interacting with Rheb. Journal of Biological Chemistry, 282(49), pp.35803–35813. Li, Y., Corradetti, M. N., Inoki, K., and Guan, K.-L. 2004. TSC2: filling the GAP in the mTOR signaling pathway. Trends in biochemical sciences, 29(1), pp.32–8.

107

Li, Y., Inoki, K. & Guan, K., 2004. Biochemical and Functional Characterizations of Small GTPase Rheb and TSC2 GAP Activity. Mol Cell Biol., 24(18), pp.7965–75. Lisenbee, C.S., Karnik, S.K. & Trelease, R.N., 2003. Overexpression and mislocalization of a tail-anchored GFP redefines the identity of peroxisomal ER. Traffic (Copenhagen, Denmark), 4(7), pp.491–501. Loewith, R., Jacinto, E., Wullschleger, S., Lorberg, A., Crespo, J. L., Bonenfant, D., Oppliger, W., Jenoe, P., and Hall, M. N. 2002. Two TOR complexes, only one of which is rapamycin sensitive, have distinct roles in cell growth control. Molecular cell, 10(3), pp.457–68. Long, X., Ortiz-Vega, S., Lin, Y., and Avruch, J. 2005. Rheb binding to mammalian target of rapamycin (mTOR) is regulated by amino acid sufficiency. Journal of Biological Chemistry, 280, pp.23433–23436. Long, X., Lin, Y., Ortiz-Vega, S., Yonezawa, K., and Avruch, J. 2005. Rheb binds and regulates the mTOR kinase. Current biology : CB, 15(8), pp.702–13. Lowy, D.R. & Willumsen, B.M., 1993. Function and regulation of ras. Annu Rev Biochem. Ma, D., Bai, X., Zou, H., Lai, Y., and Jiang, Y. 2010. Rheb GTPase controls apoptosis by regulating interaction of FKBP38 with Bcl-2 and Bcl-XL. The Journal of biological chemistry, 285(12), pp.8621–7. Ma, D., Bai, X., Guo, S., and Jiang, Y. 2008. The switch I region of Rheb is critical for its interaction with FKBP38. The Journal of biological chemistry, 283(38), pp.25963–70. Ma, J., Meng, Y., Kwiatkowski, D. J., Chen, X., Peng, H., Sun, Q., Zha, X., Wang, F., Wang, Y., Jing, Y., Zhang, S., Chen, R., Wang, L., Wu, E., Cai, G., Malinowska- kolodziej, I., and Liao, Q. 2010. Mammalian target of rapamycin regulates murine and human cell differentiation through STAT3 / p63 / Jagged / Notch cascade. J Clin Invest., 120(1), pp.103–14. Marshall, J., Molloy, R., Moss, G. W., Howe, J. R., and Hughes, T. E. 1995. The jellyfish green fluorescent protein: a new tool for studying ion channel expression and function. Neuron, 14(2), pp.211–215. Martin, K. a, Schalm, S. S., Richardson, C., Romanelli, a, Keon, K. L., and Blenis, J. 2001. Regulation of ribosomal S6 kinase 2 by effectors of the phosphoinositide 3-kinase pathway. The Journal of biological chemistry, 276(11), pp.7884–91. McIlwain, D.R., Berger, T. & Mak, T.W., 2013. Caspase functions in cell death and disease. Cold Spring Harbor Perspectives in Biology, 5, pp.1–28. Melser, S., Chatelain, E. H., Lavie, J., Mahfouf, W., Jose, C., Obre, E., Goorden, S., Priault, M., Elgersma, Y., Rezvani, H. R., Rossignol, R., and Bénard, G. 2013. Rheb regulates mitophagy induced by mitochondrial energetic status. Cell Metabolism, 17(5), pp.719–730. Milburn, M. V, Tong, L., Devos, A. M., Brunger, A., Yamaizumi, Z., Nishimura, S., and Kim, S. 1990. Molecular switch for signal transduction: structural differences between active and inactive forms of protooncogenic ras proteins. Science., 247(4945), pp.939–45. Miloloza, A., Rosner, M., Nellist, M., Halley, D., Bernaschek, G., and Hengstschläger, M. 2000. The TSC1 gene product , hamartin , negatively regulates cell proliferation. Hum Mol Genet, 9(12), pp.1721–1727.

108

Morais, C., Westhuyzen, J., Metharom, P., and Healy, H. 2005. High molecular weight plasma proteins induce apoptosis and Fas/FasL expression in human proximal tubular cells. Nephrology Dialysis Transplantation, 20(1), pp.50–58. Naiki, M., Ochi, N., Kato, Y. S., Purevsuren, J., Yamada, K., Kimura, R., Fukushi, D., Hara, S., Yamada, Y., Kumagai, T., Yamaguchi, S., and Wakamatsu, N. 2014. Mutations in HADHB , which encodes the β-subunit of mitochondrial trifunctional protein, cause infantile onset hypoparathyroidism and peripheral polyneuropathy. American Journal of Medical Genetics Part A, 164(5), pp.1180–1187. Nellist, M., Slegtenhorst, M. A. Van, Goedbloed, M., Ouweland, A. M. W. Van Den, Halley, D. J. J., and Sluijs, P. Van Der .1999. Characterization of the cytosolic tuberin- hamartin complex. Tuberin is a cytosolic chaperone for hamartin. J Biol Chem., 274(50), pp.35647–35652. Neuman, N. a & Henske, E.P., 2011. Non-canonical functions of the tuberous sclerosis complex-Rheb signalling axis. EMBO molecular medicine, 3(4), pp.189–200. Neumann, S., 2010. Zelluläre Protektion bei Transfektion mit Calciumphosphat/DNA- Nanopartikeln und durch Regulation des voltage-dependent anion channel-1 (VDAC- 1). Dissertation, 1. Nishitoh, H., Matsuzawa, A., Tobiume, K., Saegusa, K., Takeda, K., Inoue, K., Hori, S., Kakizuka, A., and Ichijo, H. 2002. ASK1 is essential for endoplasmic reticulum stress- induced neuronal cell death triggered by expanded polyglutamine repeats. Genes and Development, 16(11), pp.1345–1355. Novak, I., Kirkin, V., McEwan, D. G., Zhang, J., Wild, P., Rozenknop, A., Rogov, V., Löhr, F., Popovic, D., Occhipinti, A., Reichert, A. S., Terzic, J., Dötsch, V., Ney, P. a, and Dikic, I. 2010. Nix is a selective autophagy receptor for mitochondrial clearance. EMBO reports, 11(1), pp.45–51. Ottmann, C., Weyand, M., Wolf, A., Kuhlmann, J., and Ottmann, C. 2009. Applicability of superfolder YFP bimolecular fluorescence complementation in vitro. Biological chemistry, 390(1), pp.81–90. Patel, P. H., Thapar, N., Guo, L., Martinez, M., Maris, J., Gau, C.-L., Lengyel, J. a, and Tamanoi, F. 2003. Drosophila Rheb GTPase is required for cell cycle progression and cell growth. Journal of cell science, 116(Pt 17), pp.3601–10. Patel, P.H. & Tamanoi, F., 2006. Increased Rheb-TOR signaling enhances sensitivity of the whole organism to oxidative stress. Journal of cell science, 119, pp.4285–4292. Patrick E. Burnett, Roxanne K. Barrow, Noam A. Cohen, S.H.S. & Sabatini, A.D.M., 1998. RAFT1 phosphorylation of the translational regulators p70 S6 kinase and 4E- BP1. Proc Natl Acad Sci U S A, 95(February), pp.1432–1437. Peng, C., Yang, P., Cui, Y., He, M., Liang, L., and Di, Y. 2013. HSPA9 overexpression inhibits apoptin-induced apoptosis in the HepG2 cell line. Oncology Reports, 29(6), pp.2431–2437. Pierce, J.H. & Aaronson, S.A., 1985. Myeloid Cell Transformation by ras-Containing Murine Sarcoma Viruses. Mol Cell Biol, 5(4), pp.667–674. Pinaud, F. & Dahan, M., 2011. Targeting and imaging single biomolecules in living cells by complementation-activated light microscopy with split-fluorescent proteins. Proceedings of the National Academy of Sciences of the United States of America, 108(24), pp.E201–E210.

109

Potter, C.J., Huang, H. & Xu, T., 2001. Drosophila Tsc1 functions with Tsc2 to antagonize insulin signaling in regulating cell growth, cell proliferation, and organ size. Cell, 105(3), pp.357–68. Powers, S., Kataoka, T. & Goldfarb, M., 1984. Genes in S. cerevisiae encoding proteins with domains homologous to the mammalian ras proteins. Cell, 36(March), pp.607– 612. Qin, L., Wang, Z., Tao, L., and Wang, Y. 2010. ER stress negatively regulates AKT/TSC/mTOR pathway to enhance autophagy. Autophagy, 6(February), pp.239– 247. Quan, Z., Sun, P., Lin, G., and Xi, R. 2013. TSC1/2 regulates intestinal stem cell maintenance and lineage differentiation through Rheb-TORC1-S6K but independently of nutritional status or Notch regulation. Journal of cell science, 126, pp.3884–92. Renella, R., Carnevale, J., Schneider, K.A., Hornick, J. L., Rana, H. Q., and Janeway, K. A. 2014. Exploring the association of succinate dehydrogenase complex mutations with lymphoid malignancies. Familial Cancer, 13(3), pp.507–511. Repasky, G. A, Chenette, E.J. & Der, C.J., 2004. Renewing the conspiracy theory debate: does Raf function alone to mediate Ras oncogenesis? Trends in cell biology, 14(11), pp.639–47. Rizzo, M. A., Davidson, M.W. & Piston, D.W., 2009. Fluorescent protein tracking and detection: Fluorescent protein structure and color variants. Cold Spring Harbor Protocols, 4(12), pp.1–22. Robida, A.M. & Kerppola, T.K., 2010. Bimolecular fluorescence complementation analysis of inducible protein interactions: effects of factors affecting protein folding on fluorescent protein fragment association. J Mol Biol, 394(3), pp.391–409. Rubin, B.S., 2011. Bisphenol A: An endocrine disruptor with widespread exposure and multiple effects. Journal of Steroid Biochemistry and Molecular Biology, 127(1-2), pp.27–34. Saito, K., Araki, Y., Kontani, K., Nishina, H., and Katada, T. 2005. Novel role of the small GTPase Rheb: its implication in endocytic pathway independent of the activation of mammalian target of rapamycin. J Biochem, 430(3), pp.423–430. Sakaguchi, Y., Alan, Lalley, P. A., Zabel, B. U., Ellis, R. W., Scolnicko, E. M., and Naylor, and S. L. 1984. Chromosome assignments of four mouse cellular homologs of sarcoma and leukemia virus oncogenes. Proc Natl Acad Sci U S A., 81(January), pp.525–529. Sancak, Y., Peterson, T. R., Shaul, Y. D., Lindquist, R. A, Thoreen, C. C., Bar-Peled, L., and Sabatini, D. M. 2008. The Rag GTPases bind raptor and mediate amino acid signaling to mTORC1. Science (New York, N.Y.), 320(5882), pp.1496–501. Sandoval, H., Thiagarajan, P., Dasgupta, S. K., Schumacher, A., Prchal, T., Chen, M., and Wang, J. 2008. Essential role for Nix in autophagic maturation of erythroid cells. Nature., 454(7201), pp.232–235. Sarbassov, D. D., Ali, S. M., Kim, D., Guertin, D. A., Latek, R. R., Erdjument-bromage, H., Tempst, P., and Sabatini, D. M. 2004. Rictor , a Novel Binding Partner of mTOR , Defines a Rapamycin-Insensitive and Raptor-Independent Pathway that Regulates the Cytoskeleton. Curr Biol., 14, pp.1296–1302.

110

Saucedo, L. J., Gao, X., Chiarelli, D. A., Li, L., Pan, D., and Edgar, B. A. 2003. Rheb promotes cell growth as a component of the insulin / TOR signalling network. Nat Cell Biol., 5(6), pp.566–71. Schöpel, M., Jockers, K. F. G., Düppe, P. M., Autzen, J., Potheraveedu, V. N., Ince, S., Yip, K. T., Heumann, R., Herrmann, C., Scherkenbeck, J., and Stoll, R. 2013. Bisphenol a binds to Ras proteins and competes with guanine nucleotide exchange: Implications for GTPase-selective antagonists. Journal of Medicinal Chemistry, 56(23), pp.9664–9672. Sciarretta, S., Zhai, P., Shao, D., Maejima, Y., Robbins, J., Volpe, M., Condorelli, G., and Sadoshima, J. 2012. Rheb is a critical regulator of autophagy during myocardial ischemia: pathophysiological implications in obesity and metabolic syndrome. Circulation, 125(9), pp.1134–46. Shimizu, S., Konishi, A, Kodama, T., and Tsujimoto, Y. 2000. BH4 domain of antiapoptotic Bcl-2 family members closes voltage-dependent anion channel and inhibits apoptotic mitochondrial changes and cell death. Proceedings of the National Academy of Sciences of the United States of America, 97(7), pp.3100–3105. Shimizu, S., Narita, M. & Tsujimoto, Y., 1999. Bcl-2 family proteins regulate the release of apoptogenic cytochrome c by the mitochondrial channel VDAC. Nature, 399(6735), pp.483–487. Slebos, R. J., Hoppin, J. a, Tolbert, P. E., Holly, E. a, Brock, J. W., Zhang, R. H., Bracci, P. M., Foley, J., Stockton, P., McGregor, L. M., Flake, G. P., and Taylor, J. A. 2000. K-ras and p53 in pancreatic cancer: association with medical history, histopathology, and environmental exposures in a population-based study. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology, 9(11), pp.1223–1232. Snapp, E., 2005. Design and use of fluorescent fusion proteins in cell biology. Current Protocols in Cell Biology, p.chapter 21:Unit 21.4. Soucek, T., Pusch, O., Wienecke, R., Declue, J. E., and Hengstschla, M. 1997. Role of the Tuberous Sclerosis Gene-2 Product in Cell Cycle Control. , 272(46), pp.29301–29308. Sucher, N. J., Yu, E., Chan, S. F., Miri, M., Lee, B. J., Xiao, B., Worley, P. F., and Jensen, F. E. 2011. Association of the small GTPase Rheb with the NMDA receptor subunit NR3A. NeuroSignals, 18, pp.203–209. Sun, Y., Fang, Y., Yoon, M.-S., Zhang, C., Roccio, M., Zwartkruis, F. J., Armstrong, M., Brown, H. a, and Chen, J. 2008. Phospholipase D1 is an effector of Rheb in the mTOR pathway. Proceedings of the National Academy of Sciences of the United States of America, 105, pp.8286–8291. Suyama, K., Watanabe, M., Sakabe, K., Okada, Y., Matsuyama, D., Kuroiwa, M., and Mochida, J. 2011. Overexpression of GRP78 protects glial cells from endoplasmic reticulum stress. Neuroscience Letters, 504(3), pp.271–276. Swer, P.B., Bhadoriya, P. & Saran, S., 2014. Analysis of Rheb in the cellular slime mold Dictyostelium discoideum: Cellular localization, spatial expression and overexpression. Journal of Biosciences, 39(1), pp.75–84. Takahashi, K., Nakagawa, M., Young, S. G., and Yamanaka, S.2005. Differential membrane localization of ERas and Rheb, two Ras-related proteins involved in the

111

phosphatidylinositol 3-kinase/mTOR pathway. The Journal of biological chemistry, 280(38), pp.32768–74. Takai, Y., Sasaki, T. & Matozaki, T., 2001. Small GTP-Binding Proteins. Physiol Rev, 81(1), pp.153–208. Tamai, T., Yamaguchi, O., Hikoso, S., Takeda, T., Taneike, M., Oka, T., Oyabu, J., Murakawa, T., Nakayama, H., Uno, Y., Horie, K., Nishida, K., Sonenberg, N., Shah, A. M., Takeda, J., Komuro, I., and Otsu, K. 2013. Rheb (Ras homologue enriched in brain)-dependent mammalian target of rapamycin complex 1 (mTORC1) activation becomes indispensable for cardiac hypertrophic growth after early postnatal period. The Journal of biological chemistry, 288(14), pp.10176–87. Tamimi TI, Elgouhari HM, Alkhouri N, Yerian LM, Berk MP, Lopez R, Schauer PR, Zein NN, F.A., 2012. An Apoptosis Panel for Nonalcoholic Steatohepatitis Diagnosis. Changes, 29(6), pp.997–1003. Tee, A. R., Manning, B. D., Roux, P. P., Cantley, L. C., and Blenis, J. 2003. Tuberous Sclerosis Complex Gene Products , Tuberin and Hamartin , Control mTOR Signaling by Acting as a GTPase-Activating Protein Complex toward Rheb. Current Biology, 13(15), pp.1259–1268. Tee, A. R., Fingar, D. C., Manning, B. D., Kwiatkowski, D. J., Cantley, L. C., and Blenis, J. 2002. Tuberous sclerosis complex-1 and -2 gene products function together to inhibit mammalian target of rapamycin ( mTOR ) -mediated downstream signaling. Proc Natl Acad Sci U S A, 99(21), pp.13571–13576. Tee, A.R., Blenis, J. & Proud, C.G., 2005. Analysis of mTOR signaling by the small G- proteins, Rheb and RhebL1. FEBS letters, 579(21), pp.4763–8. Tobiume, K., Matsuzawa, A., Takahashi, T., Nishitoh, H., Morita, K. I., Takeda, K., Minowa, O., Miyazono, K., Noda, T., and Ichijo, H. 2001. ASK1 is required for sustained activations of JNK/p38 MAP kinases and apoptosis. EMBO Reports, 2(3), pp.222–228. Tohru, K., Powers, S. & Scott, C., 1985. Functional homology of mammalian and yeast RAS genes. Cell, 40(January), pp.19–26. Uhlenbrock, K., Weiwad, M., Wetzker, R., Fischer, G., Wittinghofer, A., and Rubio, I. 2009. Reassessment of the role of FKBP38 in the Rheb/mTORC1 pathway. FEBS Letters, 583(6), pp.965–970. Veigel, D., Wagner, R., Stübiger, G., Wuczkowski, M., Filipits, M., Horvat, R., Benhamú, B., López-Rodríguez, M. L., Leisser, A., Valent, P., Grusch, M., Hegardt, F. G., García, J., Serra, D., Auersperg, N., Colomer, R., and Grunt, T. W. 2015. Fatty acid synthase is a metabolic marker of cell proliferation rather than malignancy in ovarian cancer and its precursor cells. International Journal of Cancer, 136(9), pp.2078–2090. Vos, M. D., Ellis, C. a., Bell, a., Birrer, M. J., and Clark, G. J. 2000. Ras uses the novel tumor suppressor RASSF1 as an effector to mediate apoptosis. Journal of Biological Chemistry, 275, pp.35669–35672. Wataya-Kaneda, M., Kaneda, Y., Hino, O., Adachi, H., Hirayama, Y., Seyama, K., Satou, T., and Yoshikawa, K. 2001. Cells derived from tuberous sclerosis show a prolonged S phase of the cell cycle and increased apoptosis. Archives of dermatological research, 293(9), pp.460–9.

112

Wennerberg, K., Rossman, K.L. & Der, C.J., 2005. The Ras superfamily at a glance. Journal of cell science, 118(Pt 5), pp.843–6. Wetherill, Y. B., Akingbemi, B. T., Kanno, J., McLachlan, J. a., Nadal, A., Sonnenschein, C., Watson, C. S., Zoeller, R. T., and Belcher, S. M. 2007. In vitro molecular mechanisms of bisphenol A action. Reproductive Toxicology, 24(2), pp.178–198. Wienecke R, König A, D.J., 1995. Identification of tuberin, the tuberous sclerosis-2 product. Tuberin possesses specific Rap1GAP activity. J Biol Chem. Wu, X., He, Y., Jing, Y., Li, K., and Zhang, J. 2010. Albumin overload induces apoptosis in renal tubular epithelial cells through a CHOP-dependent pathway. Omics : a journal of integrative biology, 14(1), pp.61–73. Yadav, R. B., Burgos, P., Parker, A. W., Iadevaia, V., Proud, C. G., Allen, R. a, O’Connell, J. P., Jeshtadi, A., Stubbs, C. D., and Botchway, S. W. 2013. mTOR direct interactions with Rheb-GTPase and raptor: sub-cellular localization using fluorescence lifetime imaging. BMC cell biology, 14(1), p.3. Yamagatas, K., Sanders, L. K., Kaufmannnll, W. E., Yees, W., Barnes, C. A., Nathan, D., and Paul, F. 1994. rheb, a growth factor- and synaptic activity-regulated gene, encodes a novel Ras-related protein. Journal of Biological Chemistry, 269(23), pp.16333–16339. Yang, Q., Inoki, K., Kim, E., and Guan, K.-L. 2006. TSC1/TSC2 and Rheb have different effects on TORC1 and TORC2 activity. Proceedings of the National Academy of Sciences of the United States of America, 103(18), pp.6811–6. Yee, W.M., 1997. Rheb Interacts with Raf-1 Kinase and May Function To Integrate Growth Factor- and Protein Kinase A- Dependent Signals. Mol Cell Biol., 17(2), pp.921–933. Yu, Y., Li, S., Huang, Q., and Ding, J. 2004. Expression, purification, crystallization and preliminary structural characterization of the GTPase domain of human Rheb. Acta Crystallogr D Biol Crystallogr, 13, pp.1883–1887. Yu, Y., Li, S., Xu, X., Li, Y., Guan, K., Arnold, E., and Ding, J. 2005. Structural basis for the unique biological function of small GTPase RHEB. J Biol Chem, 280(17), pp.17093–17100. Zhang, Y., Gao, X., Saucedo, L. J., Ru, B., Edgar, B. a, and Pan, D. 2003. Rheb is a direct target of the tuberous sclerosis tumour suppressor proteins. Nature cell biology, 5(6), pp.578–81. Zhao, G., Lu, H. & Li, C., 2015. Proapoptotic Activities of Protein Disulfide Isomerase (PDI) and PDIA3 Protein, a Role of the Bcl-2 Protein Bak. Journal of Biological Chemistry, 290(14), pp.8949–8963. Zhou, X., Ikenoue, T., Chen, X., Li, L., Inoki, K., and Guan, K.-L. 2009. Rheb controls misfolded protein metabolism by inhibiting aggresome formation and autophagy. Proceedings of the National Academy of Sciences of the United States of America, 106(22), pp.8923–8928.

113

8. Appendix

8.1. Figures

8.1.1 Cells transfected with Myc-Rheb. Control staining without primary antibody

Figure 8.1.1: Cells transfected with Myc-Rheb with no primary antibody (negative control), but only Alexa Fluor 488 secondary antibody, and nuclei stained with To-PRO3. Images are representatives of 3 independent sets of staining. Scale bar = 50µm

8.1.2. Effect of increasing concentrations of EGFP-Rheb, flag-Rheb and myc-Rheb after 24 hrs of transfection

Figure 8.1.2: Percentage of apoptosis induced by increasing concentrations of respective plasmids. HeLa cells were transfected with increasing concentrations (1µg, 2µg, 4µg, 5µg, 8µg and 10µg of plasmid concentration per transfection) of EGFP-Rheb, flag-Rheb and myc-Rheb. Cells were counted after 24 hrs of transfection under the fluorescence microscope. Error bars indicate ± SEM. Results are average of 3 independent experiments.

114

8.1.3. No change in cleaved-caspase-3 level upon myc-Rheb overexpression under UV Stress

Figure 8.1.3: No change in level of cleaved-caspase-3 upon myc-Rheb overexpression under UV stress. HeLa cells were transfected with myc-Rheb along with H2B-RFP and H2B-RFP alone. After 24 or 48 hrs of transfection, both the sets of transfected cells were exposed to UV light and incubated for further 4 hrs. Cells were lysed and Western Blotting was done to detect the levels of cleaved caspase-3 and β-tubulin as loading control. Quantification of the bands for caspase-3 cleavage and β- tubulin was done using ImageJ and results documented in a graph. Results are average of 3 independent experiments. Error bars indicate ±SEM.

8.1.4. Reconstitution of fluorescence upon mixing YN and YC-Rheb in solution.

The pre-incubation of YC-Rheb with YN yielded a signal which could be measured using the fluorescence spectrometer (Figure 8.1.4). 2µM of YC-Rheb was pre-incubated with a higher concentration of YN (150µM) and the fluorescence intensity was measured. Upon excitation of the mixture at 485nm, an increase in the relative intensity compared to individual proteins was observed. The emission was measured at a wavelength range of 510 nm and 550 nm with peak emission obtained at 523nm. This is an example showing that fluorescence reconstitution in solution may take place upon pre-incubation.

115

Figure 8.1.4: Measurement of fluorescence reconstitution by YC-Rheb and YN. The samples were excited at 485nm and emission probed between 510 and 550nm. The peak excitation was observed at 523nm. YN (150µM) and YC-Rheb (2µM) did not yield any peak values or fluorescence other than intrinsic fluorescence of YN due to high concentration used; however a mixture of YC- Rheb (2µM) and YN (150µM) reconstituted fluorescence.

8.2. Split sfYFP constructs

Following constructs were used for analysis of Rheb fusion protein mediated apoptosis and for analysis of split sfYFP applications. For the expression of proteins in HeLa cells, mammalian expression vectors pEGFP-C3, pEGFP-N1 were used.

No: Name Overview

1 sfYN

2 sfYC

116

3 YC-Rheb/ YN-Rheb

4. RhebΔCAAX-YN

5. YC-CAAX8

6. sfYFP-Rheb

7. EGFP-Ras

Constructs for in vitro experiments were generated using bacterial expression systems with GST or His6 tag for easy purification. The proteins generated will be used for complementation in vitro and for future NMR studies. For bacterial expression of His6 tagged protein, pQE-30 and for bacterial expression of GST tagged proteins, pGEX-2T vectors were used.

117

No: Name Overview

1 GST-YN

2. GST-YC

3. His6- EGFP-Rheb

4 GST- YC-Rheb

118

8.3. Curriculum Vitae

PERSONAL DETAILS

Name: Pothera Veedu Veena Nambiar

Address: Prinz-Regent-Str 92 A

44795 Bochum Germany E-mail: [email protected] Tel No: 004917641646860 Date of Birth: 20.01.1986 Sex: Female Nationality: Indian Marital Status: Married

LINGUISTIC ABILITIES Malayalam: native speaker English: fluent (speaking, reading, writing) Hindi: fluent (speaking, reading, writing) German: limited working proficiency

EDUCATION  PhD Student: Department of Molecular Neurobiochemistry, (Graduate School of Chemistry and Biochemistry), Ruhr University Bochum, Germany (2011-present).

 MSc. Biotechnology: Amrita School of Biotechnology, Kollam, India (2006-2008) with CGPA - 8.82.

 BSc. Biotechnology: Sir Syed College (Kannur University), Kannur, India (2003-2006) with 88.5% marks.

 AISSCE (10+2 Schooling): Chinmaya Vidyalaya, Kannur (CBSE syllabus), Kannur, India (2001-2003) with 87.6% marks.

 AISSE (1-10th grade Schooling): Chinmaya Vidyalaya, Taliparamba (CBSE syllabus), Kannur (1991-2001) with 86% marks.

119

ACADEMIC ACHIEVEMENTS

 Fourth Rank in MSc. Biotechnology examination, 2008, from Amrita Viswa Vidhyapeetham, Coimbatore  Second rank with gold medal in B.Sc Biotechnology examination, 2006, Kannur University.  Certificate of Merit in Biology, 2003, as the top ten successful candidate of AISSC Examination.

WORK HISTORY AND EXPERIENCE

 05/2011 to present: PhD student and Research Assistant at the Department of Molecular Neurobiochemistry, Ruhr University Bochum, Germany.

 08/2011 to present: Supervisor of Practical courses for Bachelor students of Biochemistry at the Department of Molecular Neurobiochemistry, Ruhr University Bochum, Germany.

 09/2010 to 02/2011: Research Trainee under the guidance of Prof. Dr. Lutz.Pott, Cellular Physiology, Ruhr University Bochum, Germany.

 06/2010 to 08/2010: Research Trainee under the guidance of Prof. Dr. J.T. Epplen, Humangenetik, Ruhr University, Bochum, Germany.

 09/2009 to 11/2009: Research Trainee involved in the diagnosis of Cannabis and Barbiturates in Urine samples of Patients at the De-addiction center of National Institute of Mental Health and Neurosciences, Bangalore, India.

 08/2008 to 08/2009: Assistant Bio-Modeling Scientist at Cellworks Research India Ltd, Bangalore. Experienced in modeling of biological pathways and in-silico drug application based on literature scoping.

 01/2008 to 06/2008: Master thesis (Biotechnology Department) at Ranbaxy Research Laboratories, Pvt Ltd, Gurgaon. Submiitted the Project on “Cloning, Expression and Activity Analysis of Gene of Cytochrome P450 family utilizing Baculovirus Expression System”.

120

SEMINARS AND PRESENTATIONS

 Poster presentation at the GBM Meeting at Ruhr University Bochum, Germany, in September, 2014.

 Poster presentation at the Mosbacher Kolloqium "Cellular Protein Quality Control in Health, Aging and Disease" at Mosbach, Germany, in March, 2014.

 Oral presentation at the 3rd SFB642 Summer School, held at Muenster, Germany, in September, 2013.

 Poster presentation at the Cold Spring harbor Asia Conferences- Small GTPases at Different Scales: Proteins, Membranes, Cells conference at Suzhou, China, in September, 2012.

 Poster presentation at the GBM study group meeting at Ruhr University Bochum, August, 2012.

 Poster presentation at the 35th Annual Meeting of the German Society for Cell Biology (DGZ), at Dresden, Germany, in March 2012.

 Poster presentation at the 2nd Summer School, held at Wenden, Germany, in September, 2011.

 Participated in seminar on “Molecular Medicine” by the Society of Biotechnologists, India, at Amrita Institute of Medical Sciences, Kochi, 2008.

MEMBERSHIP

2012-2015: Student member of the Deutschen Gesellschaft für Zellbiologie (DGZ).

WORKSHOPS

 12/2011: Workshop on ‘‘Fluorescence Microscopy as a Tool to Investigate the Membrane-binding Behavior of Lipidated Ras Proteins’’, organized by SFB642 at Technical University of Dortmund.  12/2013: Characterization of the thermodynamic parameters of protein interactions by ITC (isothermal titration calorimetry), organized by SFB642 at Department of Physical Chemistry, Ruhr University Bochum.

121

PUBLICATIONS

 Schöpel M, Jockers KF, Düppe PM, Autzen J, Potheraveedu VN, Ince S, Yip KT, Heumann R, Herrmann C, Scherkenbeck J, Stoll R. Bisphenol A binds to Ras proteins and competes with guanine nucleotide exchange - implications for GTPase selective antagonists. J Med Chem. 2013 Dec 12; 56(23):9664-72.

SELECTED POSTER ABSTRACTS AND TALKS

 Veena N. Potheraveedu, Christoph G. Goemans, Katharina F.G. Jockers, Sascha Karassek, Miriam Schöpel, Klaus Kock, Semra Imce, Jürgen Scherkenbeck, Christian Hermann, Raphael Stoll and Rolf Heumann. (2013). Molecular and structural basis of Rheb mediated apoptosis and interference by small molecules. Conference talk, SFB 642 summer school 2013, at Münster.

 Veena N Pothera Veedu, Christoph G Goemans, Sascha karassek, Katharina Jockers, Raphael Stoll, Rolf Heumann. (2012). Ras Homolog Enriched in Brain (Rheb) Induces Apoptosis: A Cellular and Structural Approach. Poster abstract, CSH meeting 2012, at Shanghai, China.

 Veena N Pothera Veedu, Christoph G Goemans, Sascha Karassek, Katharina Jockers, Raphael Stoll, Rolf Heumann. (2012). Rheb induced apoptosis- molecular and structural basis. Poster abstract, 35th Annual Meeting of the German Society for Cell Biology (DGZ), 2012, at Dresden.

REFERENCE

Prof. Dr. Rolf Heumann Faculty for Chemistry and Biochemistry Seniorprofessor Molecular Neurobiochemistry Ruhr-University Bochum, NC 7 / 174 Universitaetsstraße 150 D-44780 Bochum Germany Email: [email protected] Tel. +49(0)234-32-28230

122

8.4. Acknowledgement

This thesis represents not only my work on the keyboard; it is a milestone achieved after several years of hard work at the Department of Molecular Neurobiochemistry, Ruhr University Bochum. This thesis is also the result of immense support from dozens of remarkable individuals who I wish to acknowledge.

First and foremost, I would like to express my gratitude to Prof. Dr. Rolf Heumann who believed in me and gave an opportunity to work on this project. I would like to thank him for keeping my spirit up and critically reviewing my research at each step. Without his guidance and persistent support, this PhD thesis would not have been possible.

I would also like to thank Prof. Dr. Raphael Stoll, who is my second supervisor for the project, for his thoughtful support and active discussions which kept me motivated. I extend my thanks to Miriam Schöpel for performing the NMR experiments and suggestions on protein purification protocols.

I am highly thankful to Prof. Dr. Christian Herrmann, Department of physical chemistry, for permitting me to utilize his laboratory equipments for my work. I thank Dr. Klaus Kock for helping me with the fluorescence measurements.

My sincere thanks to Prof. Dr. Katrin Markus and Dr. Claudia Lindemann, who expressed their interest in my project and agreed to perform the mass spectrometric measurements of the samples.

I convey my sincere thanks to Dr. Christoph Goemans, my mentor at the beginning of the project, who helped me learn various techniques and guided me through the project.

I am very grateful to Dr. Daniela Damen, Anja Ehrkamp, for their thoughtful support during the difficult times and for critically reviewing my thesis.

I extend my thanks to Dr. Sivaraj and Denis Paliga for being supportive officemates. Finally, I would like to thank Panagiotis Athanasopoulos, Dr. Sebastian Neumann, Christina Rolfes and all the technicians for their continuous help and support in the group.

A very special and warm thanks to my husband who is my inspiration, always stood by me, advised me and motivated me whenever I need help, without whose constant support all this would have been impossible. And finally to my parents, grandparents and parents-in- laws who understood my dreams and supported me throughout.

123