Characterization of a PIAS4 Homologue from Zebrafish: Insights into Its Conserved Negative Regulatory Mechanism in the TRIF, MAVS, and IFN Signaling Pathways during This information is current as Vertebrate Evolution of September 29, 2021. Ran Xiong, Li Nie, Li-xin Xiang and Jian-zhong Shao J Immunol 2012; 188:2653-2668; Prepublished online 17 February 2012; doi: 10.4049/jimmunol.1100959 Downloaded from http://www.jimmunol.org/content/188/6/2653

Supplementary http://www.jimmunol.org/content/suppl/2012/02/17/jimmunol.110095 http://www.jimmunol.org/ Material 9.DC1 References This article cites 72 articles, 33 of which you can access for free at: http://www.jimmunol.org/content/188/6/2653.full#ref-list-1

Why The JI? Submit online.

by guest on September 29, 2021 • Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Characterization of a PIAS4 Homologue from Zebrafish: Insights into Its Conserved Negative Regulatory Mechanism in the TRIF, MAVS, and IFN Signaling Pathways during Vertebrate Evolution

Ran Xiong, Li Nie, Li-xin Xiang, and Jian-zhong Shao

Members of the protein inhibitor of activated STAT (PIAS) family are key regulators of various human and mammalian signaling pathways, but data on their occurrence and functions in ancient vertebrates are limited. This study characterizes for the first time to our knowledge a PIAS4 homologue (PIAS4a) from zebrafish. Structurally, this zebrafish PIAS4a (zfPIAS4a) shares a number of conserved functional domains with mammalian PIAS4 proteins, including the scaffold attachment factor A/B/acinus/PIAS box, PINIT, and RING-finger–like zinc-binding domains and a highly acidic domain in the C-terminal region. Subcellular localization analysis Downloaded from shows that zfPIAS4a is a nuclear-localized protein and that the C terminus of the molecule harbors strict nuclear localization signals. Functionally, zfPIAS4a expression can be dramatically induced by the stimulation of polyinosinic-polycytidylic acid and zebrafish IFNw1. It acts as a critical negative regulator of the TIR domain-containing adapter inducing IFN-b, mitochondrial antiviral signaling (MAVS), and IFN signaling pathways, and it is the first PIAS protein that plays a role in the MAVS-mediated pathway to be identified. The structure and functionality of PIAS4 seem highly conserved from zebrafish to mammals, making zebrafish an attractive model for http://www.jimmunol.org/ screens designed to uncover genes involved in IFN- and inflammatory cytokine-induced signaling pathways. This study provides preliminary evidence that the PIAS regulatory mechanism already existed in fish during vertebrate evolution. It presents valuable clues for improving the understanding of not only the negative regulation of cytokine signaling in fish but also the evolutionary history of the PIAS family from fish to mammals as a whole. The Journal of Immunology, 2012, 188: 2653–2668.

he protein inhibitor of activated STAT (PIAS) proteins mammalian PIAS family consists of PIAS1, PIAS2 (PIASx), PIAS3, represent one of the most important signal transduction and PIAS4 (PIASy) (1–3). These member proteins were initially T modulator families (1). They regulate transcriptional ac- characterized by their ability to interact with and inhibit STAT fac- tivities in various signaling pathways, either positively or negatively, tors (4, 5). However, the interactions and functions of PIAS proteins by guest on September 29, 2021 but they are mostly associated with repression activity (2). The were subsequently found to be specific not only to STATs but also to many other transcription factors, viral proteins, oncoproteins, tumor suppressors, and cytokine-induced genes or pathways, such as those College of Life Sciences, Zhejiang University, Hangzhou 310058, People’s Republic dependent on NF-kB, IFNs, SMADs, and androgen receptors (6–9). of China; Key Laboratory for Cell and Gene Engineering of Zhejiang Province, They are also involved in various biological activities, in particular Hangzhou 310058, People’s Republic of China; and Key Laboratory of Animal Epidemic Etiology and Immunology Prevention of Ministry of Agriculture, Hang- with immune responses. For example, PIAS3 has also been found to zhou 310058, People’s Republic of China be constitutively activated in diverse human cancer cells and is Received for publication April 4, 2011. Accepted for publication January 12, 2012. crucial for the development of the hematopoietic system (10–12). This work was supported by grants from the National Basic Research Program of Five conserved functional domains have been identified in PIAS China (973) (2012CB114404), the High-Tech Research and Development Program of family members: an N-terminal scaffold attachment factor A/B/ China (863) (2012AA091700), the National Natural Science Foundation of China (30871936, 31072234, and 31172436), and the Program for Key Innovative Research acinus/PIAS (SAP) box, a PINIT domain, a RING-finger–like Team of Zhejiang Province (2010R50026). zinc-binding domain (RLD), a highly acidic domain (AD), and a The sequences presented in this article have been submitted to GenBank (http://www. serine- and threonine-rich region at the C terminus (13–16). The ncbi.nlm.nih.gov/genbank/) under accession number JF759916. PIAS proteins regulate transcription through several mechanisms, Address correspondence and reprint requests to Prof. Jian-zhong Shao and Assoc. including blocking the DNA-binding activity of transcription factors, Prof. Li-xin Xiang, Zhejiang University, YuHangTang Road 866, Hangzhou 310058, promoting protein sumoylation, and recruiting transcriptional core- Zhejiang, People’s Republic of China. E-mail addresses: [email protected] (J.-z.S.) and [email protected] (L.-x.X.) pressors or coactivators (5, 7, 9, 17, 18). Among the PIAS family The online version of this article contains supplemental material. members, PIAS4 has received much attention because it participates Abbreviations used in this article: AD, acidic domain; EGFP, enhanced GFP; EST, in various signaling pathways in different cellular activities, such as expressed sequence tag; hpf, hours postfertilization; hPIAS1, human PIAS1; hPIAS4, hematopoiesis, oncogenesis, and immune regulation. PIAS4 modu- human PIAS4; IRF, IFN regulatory factor; ISG, IFN-stimulated gene; MAVS, mito- lates the transcriptional activity of a set of STAT factors, lymphoid chondrial antiviral signaling; MDA5, melanoma differentiation-associated gene 5; MO, morpholino oligonucleotide; NLS, nuclear localization signal; ORF, open read- enhancer factor 1, and androgen receptors (18, 19). It is particularly ing frame; pI, isoelectric point; PIAS, protein inhibitor of activated STAT; PKZ, important for the negative regulation of TIR domain-containing protein kinase containing Z-DNA binding domains; poly(I:C), polyinosinic-polycy- b k tidylic acid; RFP, red fluorescent protein; RIG-I, retinoic acid–inducible gene I; RLD, adapter-inducing IFN- (TRIF)-induced NF- B activation and IFN RING-finger–like zinc-binding domain; SAP, scaffold attachment factor A/B/acinus/ signaling pathways, which limit the strength and duration of proin- PIAS; TRIF, TIR domain-containing adapter inducing IFN-b; UTR, untranslated flammatory cytokines and the responsiveness of type I IFNs (6, 8). region; zfPIAS4a, zebrafish PIAS4a. In humans and other mammals, proinflammatory cytokines and Copyright Ó 2012 by The American Association of Immunologists, Inc. 0022-1767/12/$16.00 type I IFNs are induced through different signaling pathways in www.jimmunol.org/cgi/doi/10.4049/jimmunol.1100959 2654 CHARACTERIZATION OF A PIAS4 HOMOLOGUE FROM ZEBRAFISH response to pathogen infection or pathogen-associated molecular and fed with commercial pellets at a daily ration of 0.7% of their body pattern stimulation, among which the TLR3- and retinoic acid–in- weight. All fish were held in the laboratory for at least 2 wk before use in the ducible gene I (RIG-I)/melanoma differentiation-associated gene 5 experiments to allow for acclimatization and evaluation of their overall health. Only healthy fish, as determined by their general appearance and level (MDA5)-mediated pathways are the two main pathways for the of activity, were used in the experiments. recognition of dsRNAviral infection and dsRNA-induced type I IFN and proinflammatory cytokine production (20, 21). TRIF is thus far Sequence retrieval the only adapter identified in the TLR3-mediated pathway that di- The PIAS4 homologue of zebrafish was searched using WU-BLAST at the rectly activates IFN regulatory factor (IRF)-3 and NF-kB, leading Computational Biology and Functional Genomics Laboratory (http:// to the induction of type I IFN and proinflammatory cytokines or compbio.dfci.harvard.edu/tgi/cgi-bin/tgi/Blast/index.cgi) using “human PIAS4 amino acid sequence” as the query (NP_056981.2). A homologue chemokines (22, 23). Mitochondrial antiviral signaling (MAVS), expressed sequence tag (EST; accession number TC302013) was found in however, is a later-identified adapter in the RIG-I/MDA5-mediated the zebrafish EST database. It was then used as a reference for designing pathway that directly activates IRF-3/7–dependent type I IFN primers for the molecular cloning of zfPIAS4a cDNA. The PIAS4 responses and NF-kB–dependent inflammatory gene expression sequences of other fish species, including fugu (Takifugu rubripes), me- Oryzias latipes Gasterosteus aculeatus (24–29). Several studies have shown that PIAS4 is a critical negative daka ( ), stickleback ( ), and tetraodon (Tetraodon nigroviridis), were predicted in the Ensembl genome database regulator of the TRIF-induced signaling pathway; in addition, other (http://www.ensembl.org/index.html). regulatory molecules, including TNF-a–induced protein 3, NOD- like receptor family member X1, proteasome (prosome or macro- Cloning of zfPIAS4a pain) subunit a type 7, and poly(rC) binding protein 2, have been The fish were sacrificed after anesthesia and ground in liquid nitrogen. The proved to be involved in the MAVS-activated pathway (30–33). total RNA was isolated from the whole fish using TRIzol reagent (Invi- Downloaded from However, whether PIAS proteins participate in the MAVS-mediated trogen), with additional DNase I digestion to remove traces of genomic pathway is still unknown. A recent study showed that TRIF and DNA. The RNA concentrations were measured using a spectrophotometer, and their integrity was ensured by analysis on 1.5% (w/v) agarose gel. The MAVS are required to produce an immune response to dsRNA and zfPIAS4a cDNA was generated by RT-PCR (the primers are shown in Table that neither sufficiently functions in the absence of the other (34), I). The full 59-RACE and 39-RACE core sets (Takara) were used to obtain indicating possible cross-regulation between the TRIF and MAVS 59 and 39 unknown regions. PCR amplification was performed in 50-ml reaction mixtures containing 4 ml10mM forward and reverse primers, 0.5 pathways, which suggests that the regulatory mechanisms under- http://www.jimmunol.org/ ml cDNA template, 10 ml PCR buffer (Takara), 1 ml dNTP mixture (for a lying these two pathways may be more complex than previously final concentration of 2.5 mM each), and 0.5 ml PrimeSTAR HS DNA known. Therefore, further investigations are still required to clarify Polymerase (2.5 U/ml; Takara); distilled water was added up to 50 ml. The the exact mechanisms in the TRIF- and MAVS-mediated pathways. cycling protocol involved 25 cycles of 98˚C for 10 s, 52˚C for 15 s, and 72˚C A number of genes related to the IFN system have been recently for 90 s. The PCR-amplified fragment was then incubated at 72˚C for 20 Taq 9 identified from different fish species, including the TLRs, the RIG-I– min more with 1 U DNA polymerase (Takara) for the addition of 3 A overhangs. The products were loaded onto 1.2% (w/v) agarose gel and like receptors, the TRIF and MAVS adapters, the IRF members, the visualized by staining in 0.1 mg/ml ethidium bromide. The PCR products JAK/STAT family members, and several IFN-stimulated genes were purified using a gel extraction kit (Qiagen), ligated into a pUCm-T (ISGs), such as protein kinase containing Z-DNA binding domains vector (Takara), and transformed into competent Escherichia coli TOP10 (PKZ) (35, 36), ISG15 (37, 38), CD40 (39), GTPase Mx protein (40), cells (Invitrogen). Plasmid DNA was purified using the Plasmid Miniprep by guest on September 29, 2021 method and sequenced on a MegaBACE 1000 Sequencer (GE Healthcare and viperin (cig1) (41). Overall, these are homologous to genes seen Life Sciences) using a DYEnamic ET Dye Terminator Cycle Sequencing in other vertebrate species. In zebrafish, at least four virus-inducible Kit (Amersham Pharmacia Biotech). IFN genes (IFNw1–IFNw4) and two corresponding receptor com- plexes have been characterized (42, 43). Moreover, TLR3 and TLR22 Characterization of zfPIAS4a have been found to sense dsRNA and induce IFN production through The comparative gene map positions were determined using MapViewer the common adapter TRIF (44). Overexpression of fish TRIF or (http://www.ncbi.nlm.nih.gov/mapview/) and the UCSC Genome Browser MAVS leads to NF-kB activation and induces an antiviral state for (http://genome.ucsc.edu). Gene organizations (intron/exon boundaries) were elucidated by comparing the zfPIAS4 cDNA with genome sequences, IFN production (44, 45). These observations suggest that the IFN- and the illustrations accompanying this article were drawn using Gene- inducing and IFN-signaling networks, including the TRIF- and Maper 2.5 (http://genemaper.googlepages.com). The following species MAVS-mediated pathways, occur in fish and are conserved from fish were selected for comparative analyses: human, Homo sapiens; mouse, to mammals (45–48), rendering fish an attractive model for the study Mus musculus; Xenopus tropicalis; fugu, T. rubripes; medaka, O. latipes; stickleback, G. aculeatus; tetraodon, T. nigroviridis; and zebrafish, D. of these systems. Further identification of the key components in- rerio. The potential functional motifs in zfPIAS4a protein were analyzed volved in fish IFN systems, especially negative regulators, such as using the PROSITE database (http://expasy.org/prosite/). The prediction of PIAS family members, will not only enrich the current knowledge on the tertiary structure of zfPIAS4a was carried out in SWISS-MODEL fish IFN-mediated immunity but also provide a better understanding Workspace (http://swissmodel.expasy.org/). The percentages of amino of the origin and evolution of IFN systems from fish to mammals as acid sequence identity were calculated using the MEGALIGN program from DNASTAR, and a multiple alignment was generated using the a whole. The current study reports the molecular and functional ClustalW program (version 1.83) (49). The phylogenies of the protein characterization of a PIAS4 homologue (PIAS4a) from zebrafish. The sequences were estimated with MEGA5 using parsimony and the zebrafish PIAS4a (zfPIAS4a) plays an important role in the repres- neighbor-joining method (50). sion of TRIF-induced NF-kB activation, TRIF- and MAVS-induced Cloning of zebrafish TRIF cDNA and MxA promoter IFN production, and IFN-induced signaling responses. This is the first report to our knowledge to show the presence of the PIAS regulation The zebrafish TRIF-encoding cDNA and MxA promoter sequence were system in an ancient vertebrate; in addition, it also provides valuable cloned to construct an overexpression plasmid and a luciferase reporter vector according to previously reported sequence data (40, 44). Briefly, for TRIF information on the evolutionary history of the PIAS family. cDNA cloning, RT-PCR amplification was performed using PrimeSTAR HS DNA Polymerase (2.5 U/ml; Takara) followed by the aforementioned Materials and Methods protocols. To clone the MxA promoter (1123 bp in length; GenBank: Experimental fish AF532732.1), zebrafish genome DNAwas isolated from the whole fish using an AxyPrep Multisource Genomic DNA Miniprep Kit (Axygen Biosciences) One-year-old male and female wild-type AB zebrafish (Danio rerio) according to the manufacturer’s protocol. Two pairs of PCR primers, zfMxA weighing ∼0.5–1 g, with body lengths of 1–2 cm, were purchased from pro-outer-F/zfMxA pro-outer-R and zfMxA proinner-F/zfMxA proinner-R, National Zebrafish Resources of China, kept in recirculating water at 28˚C, were designed (Table I). Nested PCR was performed using the genomic DNA The Journal of Immunology 2655 template. Then, 39 A overhangs were added to both PCR-amplified frag- Expression analysis of zfPIAS4 ments, which were then cloned into a pUCm-T vector (Takara) and con- firmed by sequencing analysis on a MegaBACE 1000 Sequencer as described The total RNA from developing embryos and selected tissues, including the earlier. Only the correct sequences of TRIF cDNA and MxA promoter were heart, spleen, liver, intestine, kidney, gill, brain, skin, and muscle, in normal m used for further purposes. or experimental fish stimulated with 10 l polyinosinic-polycytidylic acid [poly(I:C)] (1 mg/ml; Sigma Aldrich), were isolated as described earlier to Plasmid constructions determine the expression patterns of PIAS4a in embryonic and adult zebrafish. Each fish was i.p. injected with 10 ml of the supernatant liquid The open reading frames (ORFs) of zfPIAS4a and TRIF were inserted into from HEK293 cells containing recombinant zfIFNw1 to study whether pcDNA6/myc-HisB (Invitrogen) between the HindIII and XhoI sites to PIAS4a is IFN-stimulated. The supernatant liquid from the HEK293 cells construct the eukaryotic expression vectors pcDNA6-zfPIAS4a and transfected with the empty plasmid (pcDNA6-myc-His B) was used as the pcDNA6-zfTRIF, respectively. The ORFs of TRIF, MAVS, and IFNw1 control. Splenic, liver, intestinal, and kidney tissues from four fish were were inserted into pEGFP-N1 (Clontech) between the XhoI and BamHI collected at 4, 18, 24, 30, 48, and 72 h postinjection. Total RNA was sites to construct the eukaryotic expression vectors pEGFP-N1-TRIF, isolated and reverse-transcribed using an ExScript RT reagent kit (Takara) pEGFP-N1-MAVS, and pEGFP-N1-IFNw1, respectively. The zebrafish according to the manufacturer’s protocol. Four pairs of specific PCR pri- MxA promoter (1123 bp) was cloned into pGL3-Basic (Promega) between mers, b-actin-F/b-actin-R, GAPDH-F/GAPDH-R, zfPIAS4a-F6/zfPIAS4a- the KpnI and XhoI sites to construct the IFN signaling reporter vector R6, and zfPIAS4b-F/zfPIAS4b-R (Table I), were designed to amplify zebra- pGL3-zfMxA-proluc. The NF-kB luciferase construct was purchased from fish b-actin and GAPDH (both as internal controls), as well as zfPIAS4a Clontech (Palo Alto, CA), and the pRL-TK vector was obtained from and zfPIAS4b. Quantitative real-time PCR amplification was carried out on Promega. The zebrafish MAVS expression plasmid was kindly donated by a Mastercycler ep realplex real-time PCR system (Eppendorf) using a Ste´phane Biacchesi (Jouy en Josas, France) (38). The zebrafish IFNw1 SYBR Premix Ex Taq kit (Takara) following the manufacturer’s instruc- expression plasmid was a gift from Victoriano Mulero (Department of Cell tions. Briefly, all real-time PCR reactions were performed in a total re- Biology and Histology, University of Murcia, Murcia, Spain) (45). All m action volume of 10 l. The experiment protocol consisted of 1) 40 cycles Downloaded from primers used for introducing enzyme sites into the plasmid construction of amplification for 30 s at 95˚C and then 20 s at 60˚C; 2); melting curve are shown in Table I. All constructed sequences were confirmed by se- analysis for 5 s at 95˚C, 15 s at 65˚C, and then 15 s at 95˚C; and 3) cooling quencing analysis, and the plasmids for transfection and microinjection at 40˚C for 30 s. Relative gene expression was calculated using the 22DDCT were prepared free of endotoxin using an EZNA Plasmid Mini Kit (Omega method with initial normalization of PIAS4 against b-actin or GAPDH. In Bio-Tek ). all cases, each PCR trial was performed with triplicate samples and re- peated at least three times. Cell culture and transient transfection The HEK293 cells were maintained in DMEM (Biochrom AG, Berlin, Subcellular localization http://www.jimmunol.org/ Germany) supplemented with 10% (v/v) FCS (Biowest, Nuaille, France), m A DsRed2-fused wild-type PIAS4a expression vector (pDsRed2-C1- penicillin (100 U/ml), and streptomycin (100 g/ml) and were cultured zfPIAS4a-WT) and a series of RED-fused mutant vectors with various 3 5 at 37˚C in 5% CO2.Cells(1 10 /ml) were seeded into Multiwell amino acid deletions were constructed to determine the subcellular lo- plates (Corning) to allow growth until 70–90% confluence on the day of calization of the zfPIAS4a molecule and identify which domains or regions transfection and then transiently transfected with DNA in Opti-MEM I in the molecule harbor the subcellular localization signals (see Fig. 5A medium without serum and antibiotics using Lipofectamine 2000 later in text). These mutants include pDsRed2-C1-zfPIAS4a-DSAP (1–46 (Invitrogen Life Technologies) according to the manufacturer’s instruc- aa deletion), pDsRed2-C1-zfPIAS4a-DPINIT (104–264 aa deletion), tions. After 4–6 h, the medium was replaced with complete DMEM plus pDsRed2-C1-zfPIAS4a-DRLD (296–373 aa deletion), pDsRed2-C1- 10% FCS. zfPIAS4a-PINIT (104–264 aa), pDsRed2-C1-zfPIAS4a-DC1 (265–505 D by guest on September 29, 2021 Western blot analysis aa deletion), pDsRed2-C1-zfPIAS4a- N1 (1–264 aa deletion), pDsRed2- C1-zfPIAS4a-DC2 (374–505 aa deletion), and pDsRed2-C1-zfPIAS4a-DN2 Zebrafish embryos or HEK293 cells, which were injected or transfected (1–372 aa deletion). The mutant plasmids were constructed using an overlap with various expression plasmids or mock control plasmid, were dissolved PCR protocol (51). Briefly, the two fragments that require assembly were in 23 SDS sample buffer (∼3 ml/embryo) and scattered by pipette aspi- amplified by PCR using the wild-type PIAS4a gene as template. The reverse ration, followed by incubation at 100˚C for 5 min. The samples underwent primer of the upstream fragment and the forward primer of the downstream centrifugation (10,000 3 g) at 4˚C for 5 min, and the supernatant liquids fragment were designed to have ∼20-bp overlaps. The amplified fragments were collected. The proteins were separated on 10% SDS gels and with correct sizes were extracted from the gel using an AxyPrep DNA Gel semidry-blotted onto PVDF membranes (Immobilon P; Millipore) Extraction Kit (Axygen Biosciences). The two cleaned-up fragments were according to the manufacturer’s instructions. After staining with Ponceau mixed and used as the template for the second PCR reaction, which was run S for 5 min and blocking with 5% BSA in 0.5% Tween 20 in PBS (PBST) for 20 cycles with the two outermost primers. All PCR reactions were for 1 h, the membrane was incubated overnight at 4˚C with mouse anti-His performed using PrimeSTAR HS DNA Polymerase (Takara). After 39 A mAb (Invitrogen) in blocking buffer. The membrane was washed three overhangs were added, the products were ligated into the pUCm-T vector for times with PBST for 45 min, incubated for 1 h with goat anti-mouse IgA– sequencing analysis and then cloned into the pDsRed2-C1 vector (Clon- HRP (Invitrogen) in blocking buffer, and washed three times with PBST tech). For subcellular localization determination, the HEK293 cells were for another 45 min. The membrane was then incubated for 5 min in ECL subcultured and seeded onto cover slips in 6-well plates before transfection. Plus (Amersham Biosciences), and emitted light was detected using a After 24 h of culture, the cells were transfected with the pDsRed2-C1- cooled CCD camera (LAS-1000; Fujifilm). zfPIAS4a-WT plasmid or its derivatives containing a C-terminal RED tag. The cells were washed twice with PBS and fixed for 20 min in 3% (v/v) Production of zebrafish recombinant IFNw1 formaldehyde in PBS at 24 h posttransfection and then stained with DAPI (Sigma) for 10 min. Fluorescence images of cells were obtained using w The zebrafish IFN 1 expression plasmid was transfected into HEK293 a fluorescence microscope (Zeiss Axiovert 40 CFL; Zeiss, Jena, Germany). cells in 6-well plates (1 3 106 cells per well) as described earlier. The cells were maintained in DMEM supplemented with 10% FCS for the first 8 h Morpholino oligonucleotide and capped mRNA posttransfection, after which the medium was changed to serum-free DMEM and the cells were incubated for an additional 24 h. Supernatant Translation-blocking morpholino oligonucleotide (MO) was designed and liquids were collected, centrifuged at 800 3 g for 10 min at 4˚C, and synthesized by Gene Tools and solubilized in water (2 mM). The MO filtered using Medical Millex filter units (33 mm in diameter; Millipore) to sequence used was as follows: 59-ATCTTCGCACAGCAGCCCCGCG- remove the cell pellets. Parts of the filter solutions were concentrated using AGA-39. To test the binding of the MO, the 59-untranslated region (UTR) acetone precipitation. Briefly, 1 volume of the cell supernatant liquids and sequence of the zebrafish PIAS4a gene was amplified using the primers 4 volumes of cold acetone were mixed well, precipitated overnight at 220˚C, zfPIAS4a mo outer F, zfPIAS4a mo inner F, and zfPIAS4a R7 and cloned and centrifuged at 15,000 3 g for 15 min at 4˚C. The supernatant was into the pDsRed2-N1 vector, then injected into one-cell-stage embryo to- carefully discarded, and the precipitate was washed with 1 ml ice-cold gether with the EGFP-N1 vector (50 pg/embryo) with or without PIAS4a acetone and then centrifuged again for 5 min at 15,000 3 g and 4˚C. MO (4 ng/embryo). Red fluorescent protein (RFP) and GFP fluorescence The resulting pellets were retained, and the tube was dried by inversion on was visualized at 24 h post-microinjection using an Olympus MVX10 tissue paper. Finally, the sample was resuspended in a minimal volume of MacroView. Capped zebrafish PIAS4a mRNA was synthesized in vitro 23 SDS sample buffer, and Western blot analysis was performed using 63 using a Message Machine kit (Ambion), according to the supplier’s His Tag mAb (Invitrogen) to determine IFNw1 expression. manual, and solubilized in DEPC water for microinjection. 2656 CHARACTERIZATION OF A PIAS4 HOMOLOGUE FROM ZEBRAFISH

Examination of PIAS4a in TRIF-induced NF-kB activation alone or with capped PIAS4a mRNA or PIAS4a MO were injected into one-cell-stage embryos, and an empty plasmid was injected as the control. k NF- B activation was examined in zebrafish embryos using a luciferase The developing embryos were observed under a fluorescence stereomi- k assay as previously described (52). In brief, the NF- B luciferase reporter croscope at 24 h postfertilization (hpf), and the embryos with strong and gene and the indicated amounts of pcDNA6-zfTRIF and pcDNA6- homogenous EGFP expression were kept and used for analysis. RT-PCR zfPIAS4a expression plasmids were diluted in microinjection buffer and quantitative real-time PCR were performed as described earlier. (0.5% phenol red, 240 mM KCl, and 40 mM HEPES, pH 7.4) and injected (0.5–1 nl) into one-cell-stage embryos using a microinjector (ASI MPPI- Examination of PIAS4a in IFN signaling pathway 3). The pRL-TK renilla luciferase reporter plasmid was used as the internal control. An empty control plasmid was added to ensure the same amount The IFN pathway activation was examined in zebrafish embryos using of total DNA. After injection, the embryos were rinsed once with E3 a luciferase assay and quantitative real-time PCR as previously described (42, 52). For the luciferase assay, the pGL3-zfMxA-proluc reporter vector medium (5 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl2, and 0.33 mM and indicated amounts of pcDNA3.1-zfIFNw1 and pcDNA6-zfPIAS4a MgSO4) in a 28.5˚C incubator. The firefly and renilla luciferase activities were assayed 24 h post-microinjection with 5–10 replicates (each con- were coinjected into the one-cell-stage embryos. The pRL-TK renilla lu- taining the extracts from 50–100 embryos) according to the manufacturer’s ciferase reporter plasmid was used as the internal control. An empty instructions. Luciferase activity was normalized to pRL-TK activity and control plasmid was added to ensure the same amount of total DNA. expressed as fold stimulation relative to the control. Western blot analysis Luciferase activity was assayed 24 h post-microinjection as described was performed to determine zebrafish TRIF and PIAS4a expression. earlier with 5–10 replicates (each containing the tissue extracts from 50–80 embryos). Luciferase activity was normalized to pRL-TK activity and Examination of PIAS4a in TRIF- and MAVS-activated IFN expressed as the fold stimulation relative to the control. For quantitative induction real-time PCR assay, pcDNA3.1-zfIFNw1 was injected alone or with pcDNA6-zfPIAS4a into one-cell-stage embryos. RT-PCR and quantitative TRIF- and MAVS-activated IFN induction was examined in zebrafish real-time PCR were performed 24 h post-microinjection with 5–10 repli- embryos using quantitative real-time PCR as previously described (42). In cates (each containing the extracts from 15–30 embryos) for the two IFN Downloaded from brief, expression plasmids, including pcDNA6-TRIF and pcDNA6-MAVS reporter genes viperin and PKZ. The results are displayed relative to the alone or with pcDNA6-PIAS4a, were injected into one-cell-stage embryos corresponding GAPDH values to generate the relative copy number. In as described earlier, and an empty plasmid was injected as the control. both experiments, Western blot analysis was performed to determine the RT-PCR and quantitative real-time PCR were performed 24 h post- expression of zebrafish IFNw1 and zfPIAS4a. Furthermore, the effect of microinjection with 5–10 replicates (each containing the extracts from PIAS4a on the IFN pathway was also examined using mRNA- and MO- 15–30 embryos) for the zebrafish IFNw1 gene. The results are displayed mediated overexpression and knockdown experiments. For this, the EGFP- relative to the corresponding GAPDH values to generate the IFNw1 gene fused zfIFNw1-encoding plasmid alone, with capped PIAS4a mRNA, or http://www.jimmunol.org/ relative copy number. Western blot analysis was performed to determine PIAS4a MO was injected into one-cell-stage embryos, with the empty the expression of zebrafish TRIF, MAVS, and PIAS4a. Furthermore, the plasmid as the control. Developing embryos (24 hpf) with strong and effects of PIAS4a on TRIF- and MAVS-activated IFN induction were also homogenous EGFP expression were used for analysis. RT-PCR and determined via mRNA- and MO-mediated overexpression and knockdown quantitative real-time PCR were performed for the four IFN reporter genes experiments. For this, EGFP-fused TRIF- and MAVS-encoding plasmids (ISG15, viperin, PKZ, and CD40) as described earlier. by guest on September 29, 2021

FIGURE 1. Nucleotide sequence of the zfPIAS4a gene and the deduced amino acid sequence. The asterisk represents the stop codon, and cysteines are encircled. In the 39-UTR, five RNA instability motifs (ATTTA) are shown in boldface italic, and three poly(A) signals (AATAAA and ATTAAA) are boldface and underlined. The Journal of Immunology 2657

FIGURE 2. Intron/exon structures of the zfPIAS4 gene compared with those in the human, mouse, X. tropicalis, and teleost fish models. Exons are indicated with black boxes. The length of the coding sequence of each exon is indicated by the number above it. The lines adjacent to exons represent introns, and the numbers below show the base pairs of introns. Downloaded from

Statistical analysis compared with PIAS4a. This suggests a functional divergence of Data from three independent experiments were expressed as mean 6 SD, and PIAS4b, whereas PIAS4a can be expected to retain the ancestral the groups were compared using Student t test for paired samples. The p function of their common ancestor, as often observed with pairs of values *p , 0.05 and **p , 0.01 were considered statistically significant. paralogues in teleosts (Table I).

Characterization of zfPIAS4a protein http://www.jimmunol.org/ Results Characterization of zfPIAS4 gene The mature zfPIAS4a protein consists of 505 aa with a predicted molecular mass of 55.8 kDa. SMART, PROSITE, and multiple se- The cloned full-length zfPIAS4a cDNA consisted of 3698 bp with quence alignment analyses show that zfPIAS4a contains various 9 a 37-bp 5 -UTR, a 1515-bp ORF encoding a predicted 505-aa functional domains and motifs typically seen in the PIAS protein 9 polypeptide, and a 2146-bp 3 -UTR that contained five RNA in- family, including a SAP box (35 aa), a PINIT domain (163 aa), an stability motifs (ATTTA) and three polyadenylation signal RLD (78 aa), an N-terminal LXXLL signature motif in the SAP box, (AATAAA and ATTAAA) nucleotides upstream of the poly(A) tail a “PINIT” motif in the PINIT domain, a C-terminal AD, and a (Fig. 1). Comparative analysis of the zfPIAS4a cDNA sequence and CKXD/E (where C is a hydrophobic residue and X is any amino by guest on September 29, 2021 the corresponding genomic sequence characterized the organiza- acid) consensus sequence (Figs. 4 and 5A). The LXXLL motif was tion of the zfPIAS4a gene (Fig. 2). The zfPIAS4a gene was located found to be conserved from fish to mammals, except for the change within a 12.8-kb genomic fragment on chromosome 22, which from LQMLL to LQTLL in fish. The two important cysteine resi- seems slightly different from the locations of the human PIAS4 (hPIAS4) gene at chromosome 19 and mouse PIAS4 at chromo- some 10. The genes adjacent to the zfPIAS4a locus were retrieved using Genscan and BLAST. With overall conservation among zebrafish and other vertebrate species, most genes adjacent to the zfPIAS4a locus, such as the OAZ1, ATP8b3, ONECUT3, MAP2K2, ZbTB7a, and EEF2, were found to be clustered in zebrafish chro- mosome 22. However, the synteny and organization of these genes were somewhat disordered among different species (even between human and mouse) because transversion of these gene loci usually occurs in different species (Fig. 3). The PIAS4 genes were also predicted in several other fish species, including stickleback (G. aculeatus), medaka (O. latipes), fugu (T. rubripes), and tet- raodon (T. nigroviridis), from the EST/genome databases using the zfPIAS4a sequence as a probe. The genomic structure of the zfPIAS4a gene consisted of 11 exons and 10 introns, and it is similar to that of many other species, including human, mouse, rat, and X. tropicalis models, and especially consistent with the pre- dicted PIAS4 of stickleback, medaka, fugu, and tetraodon (Fig. 2). In addition, the chromosomal synteny of the PIAS4 genes among different fish species, such as zebrafish and tetraodon, was well conserved (Fig. 3). Furthermore, another PIAS4-like gene (named PIAS4b, located on chromosome 2), which encodes two alternative FIGURE 3. Comparative gene location map of PIAS4 in the human, splicing isoforms (GenBank: NP_956637.2 and NP_001229871.1), mouse, zebrafish, and tetraodon models. The numbers on the right side of was detected in zebrafish. PIAS4b also shows a conserved synteny the gene names indicate gene sizes. The contig harboring the zfPIAS4a with mammalian PIAS4 genes, which suggests that this gene might gene shows a conserved linkage of six human chromosome 19 genes, six have arisen from the extra genome duplication in teleosts. However, mouse chromosome 10 genes, and six tetraodon chromosome 1 genes. PIAS4b has lower similarity to PIAS4 sequences from other species Arrows indicate the gene orientation. 2658 CHARACTERIZATION OF A PIAS4 HOMOLOGUE FROM ZEBRAFISH

Table I. Primers used for amplifying cDNAs and gene expression analysis

Primer Name Sequence (59→39)Use zfPIAS4a F1 GGGCTGCTGTGCGAAGAT Gene cloning zfPIAS4a R1 CTCCCTCCCCAATGAGTC Gene cloning zfPIAS4a F2 ATTAAGCTTATGGCGGCCGAACTGGTAG Gene expression zfPIAS4a R2 ATTCTCGAGCGGTATGCGGTGACCAGGTCTTTGT Gene expression zfPIAS4a F3 GGACCTGCCCTGTATGTGAC 39-RACE zfPIAS4a F4 GGACAGCGAGGAAACAGACG 39-RACE zfPIAS4a R3 GAGCAATGAGTTCTGTGGGTG 59-RACE zfPIAS4a R4 CTGGCTGTCGTCTGTTTCC 59-RACE 39-Adapter CTGATCTAGAGGTACCGGATCC 39-RACE zfMxA pro-outer F TTTGATTCGTGCATGTGAG Promoter cloning zfMxA pro-outer R CTGGGTAACGGAACTCCT Promoter cloning zfMxA proinner F ATTGGTACCAGTCATCATACAGTAAGCATCCGC Promoter cloning zfMxA proinner R ATTCTCGAGCTCCTCATATTGCTGACTGAACGT Promoter cloning zfTRIF outer F TGTCTTCCGCATTTCCACT Gene expression zfTRIF outer R CAATCGGATCTCAGCATTAA Gene expression zfTRIF inner F ATTGGATCCGCCACCATGGCAGAAGGTGGAATGAAGC Gene expression zfTRIF inner R ATTCTCGAGCGCGACTCTTCGGCTGAGCTTTTA Gene expression zfTRIF F ATTCTCGAGATGGCAGAAGGTGGAATGAAGC Gene expression zfTRIF R ATTGGATCCCGCGACTCTTCGGCTGAGCTTTTA Gene expression Downloaded from zfPIAS4a F5 ATTAAGCTTCGATGGCGGCCGAACTGGTA Localization zfPIAS4a R5 ATTGGTACCGTATGCGGTGACCAGGTCT Localization zfPIAS4a F6 GACCTGCCCTGTATGTGAC Real-time RT-PCR zfPIAS4a R6 CTGGCTGTCGTCTGTTTCC Real-time RT-PCR zfPIAS4b F AGAACAGCCGGTCGTCTCA Real-time RT-PCR zfPIAS4b R CTGCCACTGAGTAACTCTTGC Real-time RT-PCR zfPIAS4a mo outer F ATTAAGCTTGGATCCGACGAGGCTCTCG Localization http://www.jimmunol.org/ zfPIAS4a mo inner F GGATCCGACGAGGCTCTCGCGGGGCTGCTGTGCGAAGATGGCGGCCGAACTGGTAG Localization zfPIAS4a R7 ATTGGTACCGTGTATGCGGTGACCAGGTC Localization zfPIAS4aDSAP F ATTAAGCTTCGCAGACCGAATACAGTCCAGAGT Mutant construct zfPIAS4aDPINIT up R CTCCAGATGTGTTGAGGTAGTCTGTACCCTGGC Mutant construct zfPIAS4aDPINIT down F CTACCTCAACACATCTGGAGAGCTCTTCAACC Mutant construct zfPIAS4aDRLD up R CTGGTGTCTCATCAAAGCGCAGCTTGTCCTG Mutant construct zfPIAS4aDRLD down F GCGCTTTGATGAGACACCAGAGGATGTAGAGGAG Mutant construct zfPIAS4a-PINIT F ATTAAGCTTCGGGGATCCCCAAACCAGCCCCAC Mutant construct zfPIAS4a-PINIT R ATTGGTACCGAACACTCTCACTAGGTACACTGC Mutant construct zfPIAS4aDC1 R ATTGGTACCTTTTAGAATCTCGGACAGTAAC Mutant construct

zfPIAS4aDN1 F ATTAAGCTTCGATGACATCTGGAGAGCTCTTCAACC Mutant construct by guest on September 29, 2021 zfPIAS4aDN2 F ATTAAGCTTCGGAGACACCAGAGGATGTAGAGGAG Mutant construct zfPIAS4aDC2 R ATTGGTACCTTTTAGAATCTCGGACAGTAAC Mutant construct zfIFNw1F1 ATTCTCGAGATGAGAACTCAAATGTGGACC Gene expression zfIFNw1R1 ATTGGATCCCGAGGATTGACCCTTGCGTTGC Gene expression zfIFNw1F2 TGGAGGACCAGGTGAAGTT Real-time RT-PCR zfIFNw1R2 ATTGACCCTTGCGTTGCTT Real-time RT-PCR zfMAVS F ATTCTCGAGATGTCACTGACACGTGAGC Gene expression zfMAVS R ATTGGATCCCGATGATTGAGCTTCCAGGCC Gene expression zfViperin F CTTTCTGATGAACGAAGGGT Real-time RT-PCR zfViperin R TGCCAGGATGTCCAAGTAGTC Real-time RT-PCR zfPKZ F CGGCAAAGTGAAGATTGGA Real-time RT-PCR zfPKZ R CATCCGACCAAACAGACAA Real-time RT-PCR zfCD40 F AGTTGCCGTTAAAGGTTCA Real-time RT-PCR zfCD40 R TTGAACTGCCAGGAGTATCT Real-time RT-PCR zfISG15 F TTGATTTCGGTGCGACTTG Real-time RT-PCR zfISG15 R TGCATCGTCACCGAGTTAT Real-time RT-PCR b-Actin F ACACCTTCTACAATGAGCTG Real-time RT-PCR b-Actin R CTGCTTGCTGATCCACATCT Real-time RT-PCR GAPDH F GCTCCTTTGGCAAAGGTCATCA Real-time RT-PCR GAPDH R ATCTCATCATACTTGGCAGGTT Real-time RT-PCR F, forward primer; R, reverse primer. dues in the RLD (indicated by triangles), crucial for binding to Ubc9 other vertebrates (Table II). With the N-terminal segment (1–65 aa and sumoylation, are also present in zfPIAS4a and are completely containing the complete SAP box) of human PIAS1 (hPIAS1) conserved in different species throughout evolution (53). In addi- protein as a template, the three-dimensional structure of the tion, the lysine residue in the CKXD/E sequence within the SAP zfPIAS4a N-terminal segment (3–66 aa) was modeled. As shown in box, which is considered a major sumoylation site, is also com- the ribbon diagram in Fig. 5B–E, the N terminus of zfPIAS4a pletely conserved (54). However, the Ser–Thr–rich domain, which exhibits an overall tertiary structure similar to the hPIAS1 N ter- is present in other PIAS proteins, was not found in the zfPIAS4a minus (55). They both adopt a unique four-helix bundle with an up– molecule. The isoelectric point (pI) values of the three conserved down–extended loop–down–up topology (a1toa4 from the N domains in zfPIAS4a, namely, the SAP box, PINIT domain, and terminus to the C terminus) wherein much of the a1, a2, and a3 RLD, were predicted to be 11.57, 8.93, and 7.0, respectively, which helix–extended loop–helix represented the SAP box. Functionally, are similar to the values for the PIAS4 proteins of human and some the hPIAS1 N terminus was found to play a crucial role in recog- The Journal of Immunology 2659 Downloaded from http://www.jimmunol.org/ by guest on September 29, 2021

FIGURE 4. Multiple alignment of zfPIAS4a with other homologues. Residues shaded in black are completely conserved across all the species aligned, whereas residues shaded in gray are similar with respect to side chains. The dashes in the amino acid sequences indicate gaps introduced to maximize alignment. The four conserved domains (SAP box, PINIT domain, RLD, and AD) are indicated above the alignment. The LXXLL signature motif, the CKXD/E consensus sequence, and the PINIT motif are boxed. Triangles indicate the two important cysteine residues in the RLD. nizing both tumor suppressor p53 and adenine–thymine–rich DNA. including humans, mouse, rats, cattle, X. tropicalis, zebrafish, and hPIAS4 was also found to interact with p53 and DNA (19, 56), four other teleost fish. The fish PIAS4 shared an overall sequence suggesting that a conserved structural and functional character- identity with other species (Fig. 4). As shown in Table III, ization is present in the N terminus (including the SAP box) among zfPIAS4a had an overall 55.4–85.9% amino acid identity with the hPIAS1, hPIAS4, and zfPIAS4a proteins. Further functional humans and other vertebrates. In general, the homology was much comparative studies are needed to validate this hypothesis. higher between fish species than between fish and mammals. For example, PIAS4 demonstrated 96.5% identity between Tetraodon Multiple sequence alignment and phylogenetic analysis and fugu, 92.4% identity between fugu and stickleback, 92.4% The amino acid sequence multiple alignment of the PIAS4 family identity between Tetraodon and stickleback, and 91% identity was prepared encompassing representatives of various species, between stickleback and medaka. These indicate the existence of 2660 CHARACTERIZATION OF A PIAS4 HOMOLOGUE FROM ZEBRAFISH Downloaded from

FIGURE 5. Characterization of the zfPIAS4a protein. (A) Schematic structures of the zfPIAS4a protein and deletion mutants. (B) Ribbon diagram of the hPIAS1 N-terminal (aa 1–65) tertiary structure obtained by homology modeling. (C) Top view of the ribbon diagram in (B). (D) Ribbon diagram of the zfPIAS4a N-terminal (aa 3–66) tertiary structure. (E) Top view of the ribbon diagram in (D). (F) The structure-based sequence alignments of the N-terminal domains of the hPIAS1, hPIAS4, and zfPIAS4a proteins. The SAP box is underlined. http://www.jimmunol.org/ a closer genetic relationship between fish PIAS4 proteins than in Tissue distribution and expression analysis of zfPIAS4 other classes. In addition, a structure-based sequence alignment The mRNA levels in various embryonic developmental stages and analysis of the functional domains (SAP box, PINIT domain, and in different tissues from poly(I:C)-stimulated, zebrafish IFNw1- RLD) and the four-helix-containing N-terminal segment between stimulated, and the control fish were assayed using RT-PCR and PIAS4 and other PIAS proteins was conducted. The zfPIAS4a SAP quantitative real-time PCR to show the expression pattern of box, PINIT domain, and RLD share high sequence identities with PIAS4 in zebrafish. The zfPIAS4a transcripts were detected dur- those in other PIAS4 proteins (Table IV), which suggest a conserved ing the early development of embryos from 6 to 120 hpf, and structural and functional characterization of these domains between zfPIAS4a expression decreased from the peak level at 6 hpf to the different PIAS4 proteins. Meanwhile, the zfPIAS4a N-terminal four- lowest level at 48 hpf, with persistently low expression from 48 to by guest on September 29, 2021 helix domains also show sequence identity with those in hPIAS1 and 120 hpf, and remained stable thereafter (Fig. 7A). In adult fish, the hPIAS4 proteins (Fig. 5F). Furthermore, the zfPIAS4a SAP box, zfPIAS4a transcripts can be detected in all selectively examined PINIT domain, and RLD also showed sequence identity with those in tissues (namely, heart, spleen, liver, intestine, kidney, gill, brain, other human PIAS proteins. For example, the zfPIAS4a SAP box, skin, and muscle), and they were expressed at relatively higher PINIT domain, and RLD share 52.8%, 44.7%, and 75.9% sequence levels in the spleen, liver, gill, and brain (Fig. 7B). After receiving identity with those in the hPIAS1 molecule and 58.3%, 44.4%, and i.p. injections of poly(I:C) (10 mg/fish) for 12 h, the zfPIAS4a 77.2% sequence identity with those in human PIAS3, respectively. expression was significantly (p , 0.05) induced in most immune- These data demonstrate that the PIAS4 proteins share partially related tissues examined, including the spleen, liver, intestines, conserved structural characterizations between different PIAS pro- kidneys, and gills (Fig. 7B). The zfPIAS4b transcripts can also be teins, suggesting the presence of a close evolutionary relationship detected in all selectively examined tissues (Supplemental Fig. 1). within PIAS family members. A phylogenetic tree was constructed Zebrafish IFNw1 was expressed in HEK293 cells to investigate using the neighbor-joining method, which included the PIAS1, whether zfPIAS4a expression can be induced by IFN. Western PIAS2, PIAS3, and PIAS4 member proteins (Fig. 6). Fish PIAS4s blot analysis shows that the IFNw1 recombinant protein is satis- not only clustered together to form an exclusive group but also factorily expressed and efficiently secreted into the cultural su- merged with mammal PIAS4s into a larger group with high bootstrap pernatant liquid (Fig. 7C). After receiving i.p. injections of this probability. These findings indicate that the evolutionary trend of supernatant liquid (10 ml/fish), the zfPIAS4a transcripts were PIAS4 is in accordance with that of the species. significantly (p , 0.05) upregulated in the spleen, liver, intestine, and kidney, albeit at different time points (Fig. 7D–G), which was Table II. The pI values of the three conserved domains in zfPIAS4 and similar to that of the classical IFN-stimulated gene (viperin) in some other PIAS4 proteins control groups (Supplemental Fig. 2). These observations revealed that zfPIAS4a is an ISG and that it may play an important role in Domains dsRNA- and IFNw1-induced immune responses. Species SAP PINIT RLD Nuclear localization of zfPIAS4a Human 10.9 9.36 6.99 A DsRed2-fused construct (pPIAS4a-WT) with the full-length Mouse 10.9 9.36 6.99 zfPIAS4a molecule was transfected into HEK293 cells to inves- Rat 10.9 9.36 6.99 Cow 10.9 9.43 6.99 tigate the subcellular localization of zfPIAS4a. The overexpressed X. tropicalis 10.9 9.32 6.99 zfPIAS4a fusion protein displayed dot-like signatures in the in- Zebrafish 4a 11.57 8.93 7.00 tracellular region, which completely merged with the DAPI-stained Zebrafish 4b 10.28 6.10 8.06 nucleus, suggesting that zfPIAS4a is exclusively localized in the The Journal of Immunology 2661

Table III. Percentages of amino acid sequence identity for zfPIAS4 genes

Species Human Mouse Rat Cattle X. tropicalis Fugu Medaka Stickleback Tetraodon Zebrafish 4a Zebrafish 4b1 Zebrafish 4b2 Human 90.3 89.8 95.9 79.4 57.5 57.3 58.4 58 59.4 39 43.8 Mouse 98.8 90.1 76 58.6 58.2 59.4 58.9 60.1 38.9 43.6 Rat 89.8 75.8 59.1 58.7 59.8 59.1 60.7 39 43.8 Cattle 78.8 57.3 56.8 58.2 57.8 59.6 38.3 43.1 X. tropicalis 54.9 53.6 55.4 55.7 55.4 38.3 43.1 Fugu 90.1 92.4 96.5 85.5 40.3 45.1 Medaka 91 90.1 85 42.6 47.3 Stickleback 92.4 85.9 41.9 46.6 Tetraodon 85.9 41.7 46.5 Zebrafish 4a 41.9 46.6 Zebrafish 4b1 92.9 Zebrafish 4b2 The accession numbers are provided in the legend to Fig. 5. nucleus (Fig. 8B), whereas the overexpressed pDsRed2-C1 empty zfPIAS4a plays a negative role in TRIF-induced NF-kB control plasmid showed a smear-like distribution in the cell without activation any nuclear dot-like localization signals (Fig. 8A). A series of the In mammals, TRIF is the common adapter in the TLR3 and TLR4 Downloaded from D D DsRed2-fused constructs (pPIAS4a- SAP, pPIAS4a- PINIT, and signaling pathways. Overexpression of this adapter leads to the D pPIAS4a- RLD) encoding mutants with deletions of conserved activation of NF-kB signaling, and PIAS4 represses this process domains, including the SAP box, PINIT domain, RLD, as well as N- (8). The zebrafish pcDNA6-TRIF was constructed and coinjected and C-terminal domains, was transfected into HEK293 cells to with the NF-kB reporter gene into zebrafish embryos to investi- analyze which domain in the molecule harbors the nuclear locali- gate whether zfPIAS4a plays a similar role in TRIF-induced NF- zation signals (NLSs). The overexpressed fusion mutants altered http://www.jimmunol.org/ kB activation. Luciferase activity was normalized to pRL-TK with the SAP box, PINIT domain, or RLD were still localized to the activity and expressed as the fold stimulation relative to the nucleus (Fig. 8C–E). These observations indicate that these three negative control (pcDNA6/myc-HisB empty plasmid adminis- conserved domains might not be essential for the nuclear localiza- trated group). Western blot analysis demonstrated that both the tion of zfPIAS4a; a DsRed2-fused construct with the PINIT domain overexpressed TRIF and the zfPIAS4a proteins can be detected alone was selectively constructed to verify this. As anticipated, the 24 h postinjection (Fig. 10A, lower panel). Overexpression of the location of the PINIT domain-containing protein segment was no TRIF protein significantly (p , 0.05) activates the NF-kB reporter longer restricted to the nucleus (Fig. 8F). Similarly, two N-terminal k D D gene, and the TRIF-induced NF- B activation is dramatically deletion mutants (pPIAS4a- N1 and pPIAS4a- N2) encoding ,

inhibited (p 0.05) by zfPIAS4a administration in a dose- by guest on September 29, 2021 different lengths of C-terminal segments (265–505 and 374–505 aa) dependent manner (Fig. 10A, upper panel). zfPIAS4a thus func- still nuclear-localized as the wild-type proteins (Fig. 8H, 8I). In tions as a negative regulator in TRIF-induced NF-kB activation. contrast, the C-terminal deletion mutant pPIAS4a-DC1 encoding N- terminal segments (1–103 aa) appeared as considerable dot-like zfPIAS4a plays a negative role in TRIF-mediated IFNw1 signals outside but near the nucleus (Fig. 8G), and the DsRed2 induction that fused the entire PIAS4a-DC2 sequence (1–373 aa) was no k longer restricted to the nucleus (Fig. 8J), suggesting that the C ter- The observation that zfPIAS4a suppresses TRIF-induced NF- B minus of zfPIAS4a (374–505 aa) harbors NLSs, which are re- activation strongly suggests that this molecule plays an important sponsible for strict nuclear localization. role in the regulation of proinflammatory cytokine expression. The role zfPIAS4a plays in TRIF-induced IFN production was inves- Effect of morpholino oligonucleotide tigated to clarify this implication. For this purpose, the pcDNA6- To test the efficacy of the MO against PIAS4a, an RFP-encoding TRIF was injected alone or with the pcDNA6-zfPIAS4a into one- construct containing the MO target sequence upstream of RFP was cell-stage embryos. An empty control plasmid was added to en- generated. This RFP-MO target sequence fusion construct and the sure that the same amount of total DNA was received. Quantitative EGFP encoding plasmid (pEGFP-N1, used as the control) were real-time PCR was conducted to evaluate IFNw1 expression at the injected into one-cell-stage embryos with or without the corre- mRNA level (as determined by IFNw1/GAPDH). After pcDNA6- sponding MO. The results show that injection with pEGFP-N1 or TRIF was administered alone for 24 h, the IFNw1 expression level the fusion plasmid without the corresponding MO produced strong was dramatically upregulated compared with that of the mock green or red fluorescence in the injected embryos, respectively, plasmid-injected control, suggesting that the zebrafish TRIF whereas the red fluorescence was effectively inhibited by the induces IFNw1 expression . In parallel, after pcDNA6-TRIF and corresponding MO. This suggests that the MO against PIAS4a pcDNA6-zfPIAS4a were coadministered for 24 h, the IFNw1 ex- efficiently blocks translation (Fig. 9). pression level was dramatically repressed compared with that of

Table IV. Pairwise identity of the three conserved domains in zfPIAS4a with other PIAS4 proteins

Species

Domains Human Mouse Rat Cow X. tropicalis Fugu Medaka Stickleback Tetraodon Zebrafish 4b Zebrafish PIAS4a SAP 74.3 74.3 74.3 74.3 74.3 100.0 100.0 100.0 100.0 48.6 Zebrafish PIAS4a PINIT 67.7 66.5 66.5 67.7 66.5 85.1 82.5 88.1 85.7 51.6 Zebrafish PIAS4a RLD 83.3 82.1 82.1 83.3 83.3 100.0 98.7 98.7 100.0 69.2 2662 CHARACTERIZATION OF A PIAS4 HOMOLOGUE FROM ZEBRAFISH Downloaded from http://www.jimmunol.org/ by guest on September 29, 2021

FIGURE 6. Phylogenetic tree showing the relationship of the zfPIAS4a gene with four predicted teleost PIAS4s and a known PIAS gene in some other species. This unrooted phylogenetic tree was constructed using the neighbor-joining method based on the amino acid alignment (ClustalW) of full-length protein sequences. The accession numbers of the sequences used in the phylogenetic analysis are as follows (unless indicated otherwise, numbers in parentheses are to be accessed from http://www.ncbi.nlm.nih.gov/protein/): human PIAS1, NP_057250.1 (http://www.ncbi.nlm.nih.gov/ protein/NP_057250.1); cow PIAS1, NP_001068864.1 (http://www.ncbi.nlm.nih.gov/protein/NP_001068864.1); mouse PIAS1, NP_062637.2 (http:// www.ncbi.nlm.nih.gov/protein/NP_062637.2); rat PIAS1, NP_001100299.2 (http://www.ncbi.nlm.nih.gov/protein/NP_001100299.2); chicken PIAS1, NP_001026627.1 (http://www.ncbi.nlm.nih.gov/protein/NP_001026627.1); human PIAS2 isoform a, NP_775298.1 (http://www.ncbi.nlm.nih.gov/ protein/NP_775298.1); human PIAS2 isoform b, NP_004662.2 (http://www.ncbi.nlm.nih.gov/protein/NP_004662.2); mouse PIAS2 isoform 1, NP_032628.3 (http://www.ncbi.nlm.nih.gov/protein/NP_032628.3); mouse PIAS2 isoform 2, NP_445789.1 (http://www.ncbi.nlm.nih.gov/protein/ NP_445789.1); mouse PIAS2 isoform 3, NP_001157640.1 (http://www.ncbi.nlm.nih.gov/protein/NP_001157640.1); mouse PIAS2 isoform 4, NP_001157641.1 (http://www.ncbi.nlm.nih.gov/protein/NP_001157641.1); mouse PIAS2 isoform 5, NP_001157642.1 (http://www.ncbi.nlm.nih.gov/ protein/NP_001157642.1); rat PIAS2, NP_445789.1 (http://www.ncbi.nlm.nih.gov/protein/NP_445789.1); chicken PIAS2, NP_001025797.1 (http:// www.ncbi.nlm.nih.gov/protein/NP_001025797.1); X. tropicalis PIAS2, NP_001072455.1 (http://www.ncbi.nlm.nih.gov/protein/NP_001072455.1); zebrafish PIAS2-like, XP_685704.3 (http://www.ncbi.nlm.nih.gov/protein/XP_685704.3); human PIAS3, NP_006090.2 (http://www.ncbi.nlm.nih.gov/ protein/NP_006090.2); mouse PIAS3 isoform 1, NP_001159421.1 (http://www.ncbi.nlm.nih.gov/protein/NP_001159421.1); mouse PIAS3 isoform 2, NP_061282.2 (http://www.ncbi.nlm.nih.gov/protein/NP_061282.2); mouse PIAS3 isoform 3, NP_666247.1 (http://www.ncbi.nlm.nih.gov/protein/ NP_666247.1); rat PIAS3, NP_113972.2 (http://www.ncbi.nlm.nih.gov/protein/NP_113972.2); cow PIAS3, NP_001095655.1 (http://www.ncbi.nlm. nih.gov/protein/NP_001095655.1); X. tropicalis PIAS3, NP_001116890.1 (http://www.ncbi.nlm.nih.gov/protein/NP_001116890.1); human PIAS4, NP_056981.2 (http://www.ncbi.nlm.nih.gov/protein/NP_056981.2); mouse PIAS4, NP_067476.2 (http://www.ncbi.nlm.nih.gov/protein/NP_067476.2); rat PIAS4, NP_001094227.1 (http://www.ncbi.nlm.nih.gov/protein/NP_001094227.1); cow PIAS4, NP_001076951.1 (http://www.ncbi.nlm.nih.gov/ protein/NP_001076951.1); X. tropicalis PIAS4, NP_001011455.1 (http://www.ncbi.nlm.nih.gov/protein/NP_001011455.1); zebrafish PIAS4a, JF759916; fugu PIAS4, ENSTRUT00000045978 (http://asia.ensembl.org/Takifugu_rubripes/Transcript/Sequence_Protein? (Figure legend continues) The Journal of Immunology 2663 Downloaded from

FIGURE 7. Quantitative PCR analysis of zfPIAS4a transcripts in embryos at different developmental stages and various adult zebrafish tissues. (A) Quantification of zfPIAS4a transcripts at the embryonic stages of 6, 12, 24, 36, 48, 72, 96, and 120 hpf against GAPDH. Values are mean 6 SD. The relative expression value was averaged from three duplicates (each containing 10–30 embryos). (B) Relative gene expression of PIAS4a in various adult tissues (heart, spleen, liver, intestine, kidney, gill, brain, skin, and muscle) that were stimulated with poly(I:C); healthy fish were used as the control. The 6 C relative expression value was averaged from three duplicates, each of which contains four fish. Values are mean SD. ( ) HEK293 cells were transfected http://www.jimmunol.org/ with the pcDNA6-zfIFNw1 expression construct or an empty control plasmid. Approximately 32 h after transfection, the supernatant liquids were collected, part of which was used for Western blot analysis using the His mAb; the rest was used for zebrafish i.p. injection (10 ml/fish), and the zfPIAS4a transcript levels were determined using real-time PCR in the (D) spleen, (E)liver,(F) intestines, and (G) kidneys. The gene expression is normalized against b-actin and presented as mean 6 SD of four fish. *p , 0.05, **p , 0.01 (t test). The groups without asterisks did not show statistically significant differences with control supernatant-injected fish. the TRIF-injected control (Fig. 10B, upper panel). Western blot expression. After the pcDNA6-MAVS plasmid was administered analysis revealed that the expression of both TRIF and PIAS4a can alone for 24 h, the IFNw1 expression level was significantly up-

be detected at this time point (Fig. 10B, lower panel). This result regulated compared with that of the mock plasmid-injected con- by guest on September 29, 2021 initially indicates that zfPIAS4a plays a negative role in TRIF- trol, suggesting that the zebrafish MAVS protein induces IFNw1 mediated IFNw1 induction. To verify this conclusion, several fur- expression similar to the TRIF protein. In parallel, after pcDNA6- ther improved protocols were used, including mRNA- and MO- MAVS and pcDNA6-zfPIAS4a were coadministered for 24 h, the mediated overexpression and knockdown of zfPIAS4a, and the IFNw1 expression level in the embryos was dramatically repressed EGFP-fused TRIF expression, allowing the screening of embryos compared with that of the MAVS-stimulated control embryos (Fig. with homogenous TRIF protein expression, thereby ensuring the 11A, upper panel). Western blot was simultaneously performed experiments become more stable. The results show that the EGFP- using the His mAb, and both MAVS and zfPIAS4a expression was fused TRIF also significantly induced IFNw1 expression, which detected (Fig. 11A, lower panel). To verify this observation fur- could be dramatically repressed by PIAS4a mRNA administration. ther, mRNA- and MO-mediated overexpression and zfPIAS4a In contrast, PIAS4a knockdown in embryos by MO significantly knockdown in embryos with EGFP-fused MAVS expression were upregulates IFNw1 expression (Fig. 10C). Taken together, these also performed. The results show that MAVS also significantly results clearly demonstrate that zfPIAS4a plays a negative role in induces IFNw1 expression, which is dramatically inhibited by TRIF-mediated IFNw1 induction. In these experiments, no ap- zfPIAS4a mRNA administration. Furthermore, zfPISA4a knock- parent developmental defects were observed (data not shown). down by MO significantly upregulates IFNw1 expression (Fig. 11B). These results demonstrate that zfPIAS4a represses MAVS- zfPIAS4a plays a negative role in MAVS-mediated IFNw1 mediated IFNw1 induction. In these experiments, no apparent induction developmental defects were observed (data not shown). MAVS is an important adapter protein in the RIG-I/MDA5- mediated pathway; it directly activates the IRF-3/7–dependent zfPIAS4a downregulates IFN signaling IFN responses. pcDNA6-MAVS was injected alone or with The zebrafish MxA promoter sequence was cloned, and a zebrafish pcDNA6-zfPIAS4a into one-cell-stage embryos to investigate MxA reporter gene was constructed to investigate the role of whether zfPIAS4a participates in MAVS-induced IFN induction. zfPIAS4a in the IFN signaling pathway. The MxA reporter gene Quantitative real-time PCR was performed to evaluate IFNw1 and indicated amounts of IFNw1 and zfPIAS4a expression plasmid

g=ENSTRUG00000017867;r=scaffold_25:615006-619863;t=ENSTRUT00000045978); tetraodon PIAS4, ENSTNIP00000005826 (http://asia.ensembl.org/ Tetraodon_nigroviridis/Transcript/Sequence_Protein?g=ENSTNIG00000003243;r=1:13911793-13916321;t=ENSTNIT00000005974); stickleback PIAS4, ENSGACP00000016761 (http://asia.ensembl.org/Gasterosteus_aculeatus/Transcript/Sequence_Protein?g=ENSGACG00000012681;r=groupVIII:16131213- 16138405;t=ENSGACT00000016795); medaka PIAS4, ENSORLP00000006265 (http://asia.ensembl.org/Oryzias_latipes/Transcript/Sequence_Protein? g=ENSORLG00000004970;r=4:8416423-8428170;t=ENSORLT00000006266). 2664 CHARACTERIZATION OF A PIAS4 HOMOLOGUE FROM ZEBRAFISH

FIGURE 8. Localizations of the wild- type and truncated forms of zfPIAS4a in HEK293 cells. In total, 2 3 10 5 HEK293 cells were seeded onto coverslips in 24- well plates 1 d before transfection. Cells were transfected with the red-fused wild type, the nine truncated forms of zfPIAS4a, or the empty control plasmids. After 24 h, fixed cells on the coverslips were stained with DAPI. The images were obtained by fluorescent microscopy. Original magnification 3400. (A)–(J) are the images we obtained after transfecting the cells with the plasmids indicated on the left side of the images, respectively. Downloaded from http://www.jimmunol.org/ were coinjected into the embryos. After 24 h, the embryos were IFNw1-treated embryos compared with those in the control em- harvested and lysed for the luciferase assay. Alternatively, the bryos. After IFNw1 and zfPIAS4a were coadministered, however, embryos injected with indicated amounts of pcDNA3.1-IFNw1 the expression of viperin and PKZ genes in the embryos were and pcDNA6-zfPIAS4a were collected for RT-PCR and quanti- dramatically downregulated compared with those in the IFNw1- tative real-time PCR analyses. The luciferase assay demonstrated stimulated control embryos [Fig. 12B (upper panel), 12C]. West- that the MxA reporter gene is significantly stimulated (p , 0.05) ern blot analysis was simultaneously performed to determine the in IFNw1-treated embryos compared with the empty plasmid- expression of IFNw1 and PIAS4a in the embryos (Fig. 12B, lower injected embryos, and after IFNw1 and zfPIAS4a were coad- panel). These suggest that zebrafish IFNw1 shares a signaling by guest on September 29, 2021 ministered, the stimulation of the MxA reporter gene in the em- pathway similar to that of the human IFN system. Accordingly, the bryos was dramatically downregulated compared with that in the mRNA- and MO-mediated overexpression and zfPIAS4a knock- IFNw1-stimulated control embryos. Furthermore, the inhibitory down were also conducted, and four ISGs (ISG15, viperin, PKZ, effect of zfPIAS4a on the MxA reporter activation was found to be and CD40) were analyzed in these experiments. As expected, with dose dependent (Fig. 12A, upper panel). Western blot analysis IFNw1 and zfPIAS4a mRNA administration to the embryos, the demonstrated that both the overexpressed IFNw1andthe four ISGs became significantly downregulated. In contrast, zfPIAS4a proteins were detectable 24 h postinjection (Fig. 12A, zfPIAS4a knockdown dramatically upregulated the expression of lower panel). Similarly, the expression of the two IFN-inducible the ISGs (Fig. 12D–G). Therefore, zfPIAS4a also plays a negative genes viperin and PKZ were significantly stimulated in the role in the IFNw1 signaling pathway. Similarly, no any apparent developmental defects were observed in the experiments (data not shown).

Discussion Cytokines use complex signaling cascades to elicit their biological effects. Rapid and efficient attenuation of cytokine signals is crucial in maintaining the homeostasis of immunity and preventing toxic side effects. The PIAS proteins were originally identified as inhibitors of cytokine signaling mediated by STAT family mem- bers, and they have since been found to regulate the functions of different proteins, many of which are transcription factors that function in various signaling pathways. Based on this, we hy- pothesized that a PIAS family member may exist in fish according to its crucial role in immune regulation. In the current study, a PIAS4 homologue (zfPIAS4a) from the zebrafish model that shares many conserved structural hallmarks with the human and FIGURE 9. Control experiments to verify the morpholino-mediated knockdown. Bright field, RFP, and GFP fluorescence micrographs of mammal PIAS4 proteins was successfully identified. These include embryos at 24 hpf. The zebrafish embryos were injected with EGFP-N1 similarities in their chromosomal synteny and location, exon/intron vector, PIAS4a 59-UTR-RFP plasmid alone (upper panels), or together organization, sequence identities, and conserved functional do- with a morpholino specific for the zfPIAS4a translation start site (lower mains and motifs, such as the SAP box, the PINIT domain, the panels). Original magnification 320. RLD, and the AD in the C-terminal region. These observations The Journal of Immunology 2665

FIGURE 10. PIAS4a negatively regulates the TRIF-dependent pathway. (A) One-cell-stage zebrafish embryos were injected with NF-kB luciferase reporter plasmids, TRIF vectors, and indicated amounts of PIAS4a expression plasmids. The pRL-TK renilla luciferase reporter plasmids were used as the internal control. Empty control plasmids were added to ensure the same amounts of total DNA. The firefly and renilla luciferase activities were assayed 24 h post-microinjection according to the manufacturer’s instructions with 5–10 replicates (each containing the extracts from 50–80 embryos). Luciferase Downloaded from activity was normalized to pRL-TK activity and expressed as the fold stimulation relative to control. Values represent mean 6 SD (upper panel). Western blot analysis was performed to determine the expression of zebrafish TRIF and PIAS4a (lower panel). (B) One-cell-stage embryos were injected with pcDNA6-TRIF (40 pg/embryo) alone or with the pcDNA6-zfPIAS4a (40 pg/embryo) into their cytoplasm, and empty plasmids (pcDNA6-myciHis B) were injected as the control. The figure shows the levels of the zfIFNw1 mRNA relative to GAPDH expression, measured using quantitative RT-PCR from whole embryos 24 h after injection with 5–10 replicates (each containing 15–30 embryos) (upper panel). Values represent mean 6 SD. Western blot analysis was performed to determine the expression of zebrafish TRIF and PIAS4a (lower panel). (C) One-cell-stage embryos were injected with EGFP-TRIF expression plasmid alone (50 pg/embryo) or with capped PIAS4a RNA (200 pg/embryo) or MO against PIAS4a (4 ng/embryo), and empty plasmids (pEGFP-N1) were http://www.jimmunol.org/ injected as the control. The figure shows the zfIFNw1 mRNA levels relative to GAPDH expression, measured using quantitative RT-PCR from whole embryos 24 h after injection with 5–10 replicates (each containing 15–30 embryos). Values represent mean 6 SD. *p , 0.05, **p , 0.01. prove that zfPIAS4a is homologous to the PIAS4 proteins of other it can be induced with recombinant zebrafish IFNw1 in selected vertebrates and suggest that it has been conserved from fish to tissues. These suggest that zfPIAS4a is an ISG and provide initial mammals during vertebrate evolution. insights that this molecule might be involved in the feedback Functionally, the expression of zfPIAS4a can be dramatically regulation of IFN-mediated immunity or inflammatory responses. induced in most immune-relevant tissues through stimulation with In humans and mammals, the primary sense dsRNA is mediated poly(I:C), an analogue of dsRNA polymers commonly used for the by innate pattern recognition receptors, which include TLR3 and by guest on September 29, 2021 induction of type I IFN and proinflammatory cytokines. In addition, RIG-I/MDA5-like receptors at the very least (21). In response to dsRNA stimulation, the TLR3 recruits the adapter protein TRIF, activates NF-kB signaling, and induces IRF-3 activation, followed by IFN-b induction. Meanwhile, RIG-I/MDA5 also triggers IRF-3 activation, followed by type I IFN induction through the adapter protein MAVS. Therefore, the TRIF- and MAVS-mediated path- ways are critical for the induction and signaling of IFN and other proinflammatory cytokines (57, 58). The TRIF-mediated pathway has been found to be controlled by various negative regulators, such as sterile a and TIR-motif-containing 1 (59), SH2-containing protein tyrosine phosphatase 2 (60), PI3K (61), and PIAS4. However, the regulation of the MAVS-mediated pathway remains poorly understood. In addition, the TLR3 and RIG-I/MDA5 receptor-linked TRIF and MAVS cascades were also identified to play crucial roles in dsRNA sensors, as well as IFN-dependent and NF-kB–dependent signaling pathways in teleost fish, similar to those seen in humans and mammals (47, 62, 63). Nevertheless, FIGURE 11. Effects of zfPIAS4a on MAVS upregulated zfIFNw1. (A) the regulatory mechanisms underlying these pathways in fish pcDNA6-MAVS (40 pg/embryo) alone or with pcDNA6-zfPIAS4a (40 pg/ species are still unclear. The current study provides preliminary embryo) was injected into one-cell-stage embryos, and empty plasmids evidence that zfPIAS4a is an important negative regulator in both (pcDNA6-myciHis B) were injected as the control. Quantitative RT-PCR TRIF- and MAVS-mediated pathways in fish and that it plays was performed 24 h later with 5–10 replicates (each containing 15–30 a negative role in the IFN signaling pathway. These results dem- w 6 embryos) for zfIFN 1 mRNA (upper panel). Values represent mean SD. onstrate that zfPIAS4a is a multifunctional regulator involved in Western blot analysis was performed to determine the expression of various pathways and is particularly important for IFN-inducing zebrafish TRIF and PIAS4a (lower panel). (B) EGFP-MAVS vector (80 pg/ and IFN signaling networks. Notably, zfPIAS4a participates in the embryo) alone or with capped PIAS4a RNA (200 pg/embryo) or MO against PIAS4a (4 ng/embryo) was injected into one-cell-stage embryos, MAVS-mediated pathway. This is the first report to show that and empty plasmids (pEGFP-N1) were injected as the control. Quantitative a PIAS family member acts as a negative regulator in the MAVS RT-PCR was performed 24 h later with 5–10 replicates (each containing signaling pathway, which is beneficial to understanding the reg- 15–30 embryos) for zfIFNw1 mRNA. Values represent mean 6 SD. *p , ulatory mechanism underlying the MAVS pathway not only in 0.05, **p , 0.01. fish but also in mammals. Moreover, hPIAS4 has been shown to 2666 CHARACTERIZATION OF A PIAS4 HOMOLOGUE FROM ZEBRAFISH Downloaded from http://www.jimmunol.org/

FIGURE 12. PIAS4a negatively regulates the IFN-w1–dependent pathway. (A) One-cell-stage zebrafish embryos were injected with zfMxA-proluc vectors and indicated amounts of pcDNA3.1-zfIFNw1 and pcDNA6-PIAS4a expression plasmids; the pRL-TK renilla luciferase reporter plasmids were used as the internal control. Empty control plasmids were added to ensure the same amounts of total DNA. The firefly and renilla luciferase activities were

assayed 24 h post-microinjection according to the manufacturer’s instructions with 5–10 replicates (each containing the extracts from 50–80 embryos). by guest on September 29, 2021 Luciferase activity was normalized to pRL-TK activity and expressed as the fold stimulation relative to control. Values represent mean 6 SD (upper panel). Western blot analysis was performed to determine the expression of zebrafish IFNw1 and zfPIAS4a (lower panel). (B and C) Effects of zfPIAS4a on zfIFNw1 upregulated ISGs: (B) viperin and (C) PKZ. pcDNA3.1-zfIFNw1 (40 pg/embryo) was injected alone or with pcDNA6-PIAS4a (40 pg/embryo) into the cytoplasm of one-cell-stage embryos, empty plasmids (pcDNA6-myciHis B) were injected as the controls, and quantitative RT-PCR was performed 24 h later with 5–10 replicates (each containing 15–30 embryos). The levels of viperin and PKZ mRNA relative to GAPDH expression are shown. Values represent mean 6 SD (upper panel). Western blot analysis was performed to determine the expression of zebrafish IFNw1 and zfPIAS4a using the His mAb (lower panel). (D–G) Further verification of the effects of zfPIAS4a on zfIFNw1-upregulated ISGs: (D) ISG15, (E) viperin, (F) PKZ, and (G) CD40. EGFP- IFNw1 vector (50 pg/embryo) was injected alone or with capped PIAS4a RNA (200 pg/embryo) or MO against PIAS4a (4 ng/embryo) into one-cell-stage embryos, empty plasmids (pEGFP-N1) were injected as the controls, and quantitative RT-PCR was performed 24 h later with 5–10 replicates (each containing 15–30 embryos). The levels of ISG15, viperin, PKZ, and CD40 mRNA relative to GAPDH expression are shown. Values represent mean 6 SD. *p , 0.05, **p , 0.01. function as a SUMO ligase, and the SAP box, PINIT domain, and isoform of PIAS3) and PIAS4 proteins have been reported (67, RLD are found to be essential to its molecular functionality in 68), with controversial findings. For example, the three conserved sequence- and structure-specific DNA binding, nuclear retention, functional domains (SAP box, PINIT domain, and RLD) in the and SUMO E3 ligase activity, respectively (14, 19, 64). Further mouse PIAS3L molecule were found to be essential to nuclear studies are needed to clarify whether these domains in the localization (14), whereas those in the hPIAS4 molecule were zfPIAS4a molecule have similar functions and to advance the demonstrated to be unrelated to nuclear retention, and the C- current understanding of the molecular and functional evolution terminal region contains the NLSs, which guide the nuclear lo- of the PIAS family. calization (69). These observations suggest that the localization Specific intracellular localization is essential for proper protein signals of the PIAS proteins differ in different family members, functions in signaling pathways. Although there are examples of and further studies are hence needed to clarify this concern. For cytoplasmic regulation in which PIAS proteins are involved, most this purpose, the localization signals of zfPIAS4a were carefully of the PIAS protein interactions reported to date occur with analyzed in this study. In total, eight zfPIAS4a mutants with transcription factors or other proteins linked to nuclear regulation in various deletions in their functional domains and N- or C-terminal mammals (65, 66). Therefore, PIAS proteins are generally be- regions were constructed. Comparative analyses between these lieved to be nuclear-localized proteins because of their functional mutants clearly demonstrate that mutations in the SAP box, PINIT features. However, the structural basis and details of the nuclear domain, or RLD do not alter the nuclear localization of the pro- localization of PIAS proteins, such as the distribution of the NLSs teins, suggesting that these domains are not involved in the nuclear in their domains, are still poorly understood. Only a few retention of zfPIAS4a. In contrast, the C terminus (374–505 aa) of localization-related studies on human and mouse PIAS3L (an zfPIAS4a was found to harbor the NLSs responsible for strict The Journal of Immunology 2667 nuclear localization. This result is generally consistent with that 12. Yagil, Z., G. Kay, H. Nechushtan, and E. Razin. 2009. A specific epitope of protein inhibitor of activated STAT3 is responsible for the induction of apoptosis obtained for the hPIAS4 protein, suggesting that PIAS4 family in rat transformed mast cells. J. Immunol. 182: 2168–2175. members share a conserved subcellular localization mechanism 13. Aravind, L., and E. V. Koonin. 2000. SAP - a putative DNA-binding motif in- from fish to mammals. Further studies are nevertheless needed to volved in chromosomal organization. Trends Biochem. Sci. 25: 112–114. 14. Duval, D., G. Duval, C. Kedinger, O. Poch, and H. Boeuf. 2003. The ‘PINIT’ determine the exact amino acids that compose the NLSs of this motif, of a newly identified conserved domain of the PIAS protein family, is 374–505 aa C-terminal segment. essential for nuclear retention of PIAS3L. FEBS Lett. 554: 111–118. IFNs are important members of the innate immune system that 15. Hochstrasser, M. 2001. SP-RING for SUMO: new functions bloom for a ubiq- uitin-like protein. Cell 107: 5–8. play critical roles in both innate and acquired immunity. Teleost 16. Minty, A., X. Dumont, M. Kaghad, and D. Caput. 2000. Covalent modification of IFNs were recently discovered in zebrafish, and they have since p73alpha by SUMO-1. Two-hybrid screening with p73 identifies novel SUMO- 1-interacting proteins and a SUMO-1 interaction motif. J. Biol. Chem. 275: been found in many fish species (70–72). The predicted protein 36316–36323. sequences of fish IFNs show low (,20%) similarity to mamma- 17. Jackson, P. K. 2001. A new RING for SUMO: wrestling transcriptional responses lian and avian type I IFNs. Significant differences between fish into nuclear bodies with PIAS family E3 SUMO ligases. Genes Dev. 15: 3053– 3058. and higher vertebrate IFNs, such as structural features, gene 18. Gross, M., R. Yang, I. Top, C. Gasper, and K. Shuai. 2004. PIASy-mediated organizations, and type of receptors, were also observed. How- repression of the androgen receptor is independent of sumoylation. Oncogene ever, the fish IFNs share functional characterizations similar to 23: 3059–3066. 19. Sachdev, S., L. Bruhn, H. Sieber, A. Pichler, F. Melchior, and R. Grosschedl. those of mammals. For example, they upregulate the activity of 2001. PIASy, a nuclear matrix-associated SUMO E3 ligase, represses LEF1 MxA, PKZ, viperin, stat1, and IL-1b (45). Fish and mammals have activity by sequestration into nuclear bodies. Genes Dev. 15: 3088–3103. 20. Meylan, E., and J. Tschopp. 2006. Toll-like receptors and RNA helicases: two gene orthologs among JAK/STAT family members and a number parallel ways to trigger antiviral responses. Mol. Cell 22: 561–569. of IFN-induced proteins. Previous data and the current results 21. Kawai, T., and S. Akira. 2008. Toll-like receptor and RIG-I-like receptor sig- Downloaded from suggest that the IFN-activated signaling pathways and the key naling. Ann. N. Y. Acad. Sci. 1143: 1–20. 22. Alexopoulou, L., A. C. Holt, R. Medzhitov, and R. A. Flavell. 2001. Recognition regulators in the IFN signaling network originated from fish, and of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3. they were conserved from teleosts to mammals during vertebrate Nature 413: 732–738. evolution. In addition, the fact that PIAS4 is present in fish sug- 23. Yamamoto, M., S. Sato, H. Hemmi, K. Hoshino, T. Kaisho, H. Sanjo, O. Takeuchi, M. Sugiyama, M. Okabe, K. Takeda, and S. Akira. 2003. Role of gests that this molecule is a primitive member of the PIAS family. adaptor TRIF in the MyD88-independent toll-like receptor signaling pathway.

However, further investigations are still needed to clarify the Science 301: 640–643. http://www.jimmunol.org/ 24. Kawai, T., K. Takahashi, S. Sato, C. Coban, H. Kumar, H. Kato, K. J. Ishii, exact evolutionary relationship among the family members. O. Takeuchi, and S. Akira. 2005. IPS-1, an adaptor triggering RIG-I- and Mda5- In summary, this study has pioneered the identification of a PIAS mediated type I interferon induction. Nat. Immunol. 6: 981–988. family member from teleost fish. Functional characterization dem- 25. Meylan, E., J. Curran, K. Hofmann, D. Moradpour, M. Binder, R. Bartenschlager, and J. Tschopp. 2005. Cardif is an adaptor protein in the RIG- onstrated that zfPIAS4a acts as a critical negative regulator in the I antiviral pathway and is targeted by hepatitis C virus. Nature 437: 1167–1172. TRIF- and MAVS-mediated signaling cascades and the IFN sig- 26. Seth, R. B., L. Sun, C. K. Ea, and Z. J. Chen. 2005. Identification and charac- naling pathway. The data significantly contribute to the current terization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3. Cell 122: 669–682. knowledge on the negative regulation of cytokine signaling in fish, 27. Xu, L. G., Y. Y. Wang, K. J. Han, L. Y. Li, Z. Zhai, and H. B. Shu. 2005. VISA is as well as to the evolutionary history of the PIAS family, and they an adapter protein required for virus-triggered IFN-beta signaling. Mol. Cell 19:

727–740. by guest on September 29, 2021 help to understand better the regulation of TLR-, RLR-, and IFN- 28. Kumar, H., T. Kawai, H. Kato, S. Sato, K. Takahashi, C. Coban, M. Yamamoto, triggered innate inflammatory responses. S. Uematsu, K. J. Ishii, O. Takeuchi, and S. Akira. 2006. Essential role of IPS-1 in innate immune responses against RNA viruses. J. Exp. Med. 203: 1795–1803. 29. Sun, Q., L. Sun, H. H. Liu, X. Chen, R. B. Seth, J. Forman, and Z. J. Chen. 2006. Disclosures The specific and essential role of MAVS in antiviral innate immune responses. The authors have no financial conflicts of interest. Immunity 24: 633–642. 30. Lin, R., L. Yang, P. Nakhaei, Q. Sun, E. Sharif-Askari, I. Julkunen, and J. Hiscott. 2006. Negative regulation of the retinoic acid-inducible gene I- induced antiviral state by the ubiquitin-editing protein A20. J. Biol. Chem. References 281: 2095–2103. 1. Shuai, K., and B. Liu. 2005. Regulation of gene-activation pathways by PIAS 31. Moore, C. B., D. T. Bergstralh, J. A. Duncan, Y. Lei, T. E. Morrison, proteins in the immune system. Nat. Rev. Immunol. 5: 593–605. A. G. Zimmermann, M. A. Accavitti-Loper, V. J. Madden, L. Sun, Z. Ye, et al. 2. Shuai, K. 2006. Regulation of cytokine signaling pathways by PIAS proteins. 2008. NLRX1 is a regulator of mitochondrial antiviral immunity. Nature 451: Cell Res. 16: 196–202. 573–577. 3. Rytinki, M. M., S. Kaikkonen, P. Pehkonen, T. Ja¨a¨skela¨inen, and J. J. Palvimo. 32. Jia, Y., T. Song, C. Wei, C. Ni, Z. Zheng, Q. Xu, H. Ma, L. Li, Y. Zhang, X. He, 2009. PIAS proteins: pleiotropic interactors associated with SUMO. Cell. Mol. et al. 2009. Negative regulation of MAVS-mediated innate immune response by Life Sci. 66: 3029–3041. PSMA7. J. Immunol. 183: 4241–4248. 4. Chung, C. D., J. Liao, B. Liu, X. Rao, P. Jay, P. Berta, and K. Shuai. 1997. 33. You, F., H. Sun, X. Zhou, W. Sun, S. Liang, Z. Zhai, and Z. Jiang. 2009. PCBP2 Specific inhibition of Stat3 signal transduction by PIAS3. Science 278: 1803– mediates degradation of the adaptor MAVS via the HECT ubiquitin ligase AIP4. 1805. Nat. Immunol. 10: 1300–1308. 5. Liu, B., J. Liao, X. Rao, S. A. Kushner, C. D. Chung, D. D. Chang, and K. Shuai. 34. Kumar, H., S. Koyama, K. J. Ishii, T. Kawai, and S. Akira. 2008. Cutting edge: 1998. Inhibition of Stat1-mediated gene activation by PIAS1. Proc. Natl. Acad. cooperation of IPS-1- and TRIF-dependent pathways in poly IC-enhanced an- Sci. USA 95: 10626–10631. tibody production and cytotoxic T cell responses. J. Immunol. 180: 683–687. 6. Liu, B., M. Gross, J. ten Hoeve, and K. Shuai. 2001. A transcriptional core- 35. Rothenburg, S., N. Deigendesch, K. Dittmar, F. Koch-Nolte, F. Haag, pressor of Stat1 with an essential LXXLL signature motif. Proc. Natl. Acad. Sci. K. Lowenhaupt, and A. Rich. 2005. A PKR-like eukaryotic initiation factor USA 98: 3203–3207. 2alpha kinase from zebrafish contains Z-DNA binding domains instead of 7. Long, J., I. Matsuura, D. He, G. Wang, K. Shuai, and F. Liu. 2003. Repression of dsRNA binding domains. Proc. Natl. Acad. Sci. USA 102: 1602–1607. Smad transcriptional activity by PIASy, an inhibitor of activated STAT. Proc. 36. Bergan, V., R. Jagus, S. Lauksund, Ø. Kileng, and B. Robertsen. 2008. The Natl. Acad. Sci. USA 100: 9791–9796. Atlantic salmon Z-DNA binding protein kinase phosphorylates translation ini- 8. Zhang, J., L. G. Xu, K. J. Han, X. Wei, and H. B. Shu. 2004. PIASy represses tiation factor 2 alpha and constitutes a unique orthologue to the mammalian TRIF-induced ISRE and NF-kappaB activation but not apoptosis. FEBS Lett. dsRNA-activated protein kinase R. FEBS J. 275: 184–197. 570: 97–101. 37. Liu, M., R. Reimschuessel, and B. A. Hassel. 2002. Molecular cloning of the fish 9. Liu, B., R. Yang, K. A. Wong, C. Getman, N. Stein, M. A. Teitell, G. Cheng, interferon stimulated gene, 15 kDa (ISG15) orthologue: a ubiquitin-like gene H. Wu, and K. Shuai. 2005. Negative regulation of NF-kappaB signaling by induced by nephrotoxic damage. Gene 298: 129–139. PIAS1. Mol. Cell. Biol. 25: 1113–1123. 38. Røkenes, T. P., R. Larsen, and B. Robertsen. 2007. Atlantic salmon ISG15: 10. Yagil, Z., H. Nechushtan, G. Kay, C. M. Yang, D. M. Kemeny, and E. Razin. Expression and conjugation to cellular proteins in response to interferon, double- 2010. The enigma of the role of protein inhibitor of activated STAT3 (PIAS3) in stranded RNA and virus infections. Mol. Immunol. 44: 950–959. the immune response. Trends Immunol. 31: 199–204. 39. Gong, Y. F., L. X. Xiang, and J. Z. Shao. 2009. CD154-CD40 interactions are 11. Levy, C., H. Nechushtan, and E. Razin. 2002. A new role for the STAT3 in- essential for thymus-dependent antibody production in zebrafish: insights into hibitor, PIAS3: a repressor of microphthalmia transcription factor. J. Biol. Chem. the origin of costimulatory pathway in helper T cell-regulated adaptive immunity 277: 1962–1966. in early vertebrates. J. Immunol. 182: 7749–7762. 2668 CHARACTERIZATION OF A PIAS4 HOMOLOGUE FROM ZEBRAFISH

40. Staeheli, P., Y. X. Yu, R. Grob, and O. Haller. 1989. A double-stranded RNA- N-terminal domain of SUMO ligase PIAS1 and its interaction with tumor sup- inducible fish gene homologous to the murine influenza virus resistance gene pressor p53 and A/T-rich DNA oligomers. J. Biol. Chem. 279: 31455–31461. Mx. Mol. Cell. Biol. 9: 3117–3121. 56. Nelson, V., G. E. Davis, and S. A. Maxwell. 2001. A putative protein inhibitor of 41. Boudinot, P., P. Massin, M. Blanco, S. Riffault, and A. Benmansour. 1999. vig-1, activated STAT (PIASy) interacts with p53 and inhibits p53-mediated trans- a new fish gene induced by the rhabdovirus glycoprotein, has a virus-induced activation but not apoptosis. Apoptosis 6: 221–234. homologue in humans and shares conserved motifs with the MoaA family. J. 57. Matsumiya, T., and D. M. Stafforini. 2010. Function and regulation of retinoic Virol. 73: 1846–1852. acid-inducible gene-I. Crit. Rev. Immunol. 30: 489–513. 42. Aggad, D., M. Mazel, P. Boudinot, K. E. Mogensen, O. J. Hamming, 58. Vercammen, E., J. Staal, and R. Beyaert. 2008. Sensing of viral infection and R. Hartmann, S. Kotenko, P. Herbomel, G. Lutfalla, and J. P. Levraud. 2009. The activation of innate immunity by toll-like receptor 3. Clin. Microbiol. Rev. 21: two groups of zebrafish virus-induced interferons signal via distinct receptors 13–25. with specific and shared chains. J. Immunol. 183: 3924–3931. 59. Carty, M., R. Goodbody, M. Schro¨der, J. Stack, P. N. Moynagh, and A. G. Bowie. 43. Stein, C., M. Caccamo, G. Laird, and M. Leptin. 2007. Conservation and di- 2006. The human adaptor SARM negatively regulates adaptor protein TRIF- vergence of gene families encoding components of innate immune response dependent Toll-like receptor signaling. Nat. Immunol. 7: 1074–1081. systems in zebrafish. Genome Biol. 8: R251. 60. An, H., W. Zhao, J. Hou, Y. Zhang, Y. Xie, Y. Zheng, H. Xu, C. Qian, J. Zhou, 44. Matsuo, A., H. Oshiumi, T. Tsujita, H. Mitani, H. Kasai, M. Yoshimizu, Y. Yu, et al. 2006. SHP-2 phosphatase negatively regulates the TRIF adaptor M. Matsumoto, and T. Seya. 2008. Teleost TLR22 recognizes RNA duplex to protein-dependent type I interferon and proinflammatory cytokine production. induce IFN and protect cells from birnaviruses. J. Immunol. 181: 3474–3485. Immunity 25: 919–928. 45. Biacchesi, S., M. LeBerre, A. Lamoureux, Y. Louise, E. Lauret, P. Boudinot, and 61. Aksoy, E., W. Vanden Berghe, S. Detienne, Z. Amraoui, K. A. Fitzgerald, M. Bre´mont. 2009. Mitochondrial antiviral signaling protein plays a major role G. Haegeman, M. Goldman, and F. Willems. 2005. Inhibition of phosphoinositide in induction of the fish innate immune response against RNA and DNA viruses. 3-kinase enhances TRIF-dependent NF-kappa B activation and IFN-beta syn- J. Virol. 83: 7815–7827. thesis downstream of Toll-like receptor 3 and 4. Eur. J. Immunol. 35: 2200–2209. 46. Sullivan, C., J. H. Postlethwait, C. R. Lage, P. J. Millard, and C. H. Kim. 2007. 62. Lauksund, S., T. Svingerud, V. Bergan, and B. Robertsen. 2009. Atlantic salmon Evidence for evolving Toll-IL-1 receptor-containing adaptor molecule function IPS-1 mediates induction of IFNa1 and activation of NF-kappaB and localizes to in vertebrates. J. Immunol. 178: 4517–4527. mitochondria. Dev. Comp. Immunol. 33: 1196–1204. 47. Fan, S., S. Chen, Y. Liu, Y. Lin, H. Liu, L. Guo, B. Lin, S. Huang, and A. Xu. 63. Rebl, A., T. Goldammer, and H. M. Seyfert. 2010. Toll-like receptor signaling in 2008. Zebrafish TRIF, a Golgi-localized protein, participates in IFN induction bony fish. Vet. Immunol. Immunopathol. 134: 139–150. Downloaded from and NF-kappaB activation. J. Immunol. 180: 5373–5383. 64. Kotaja, N., U. Karvonen, O. A. Ja¨nne, and J. J. Palvimo. 2002. PIAS proteins 48. Simora, R. M., M. Ohtani, J. Hikima, H. Kondo, I. Hirono, T. S. Jung, and modulate transcription factors by functioning as SUMO-1 ligases. Mol. Cell. T. Aoki. 2010. Molecular cloning and antiviral activity of IFN-b promoter Biol. 22: 5222–5234. stimulator-1 (IPS-1) gene in Japanese flounder, Paralichthys olivaceus. Fish 65. Martin, S., A. Nishimune, J. R. Mellor, and J. M. Henley. 2007. SUMOylation Shellfish Immunol. 29: 979–986. regulates kainate-receptor-mediated synaptic transmission. Nature 447: 321– 49. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: im- 325. proving the sensitivity of progressive multiple sequence alignment through se- 66. Takahashi, Y., A. Toh-e, and Y. Kikuchi. 2001. A novel factor required for the

quence weighting, position-specific gap penalties and weight matrix choice. SUMO1/Smt3 conjugation of yeast septins. Gene 275: 223–231. http://www.jimmunol.org/ Nucleic Acids Res. 22: 4673–4680. 67. Albor, A., S. El-Hizawi, E. J. Horn, M. Laederich, P. Frosk, K. Wrogemann, and 50. Kumar, S., M. Nei, J. Dudley, and K. Tamura. 2008. MEGA: a biologist-centric M. Kulesz-Martin. 2006. The interaction of Piasy with Trim32, an E3-ubiquitin software for evolutionary analysis of DNA and protein sequences. Brief. Bio- ligase mutated in limb-girdle muscular dystrophy type 2H, promotes Piasy inform. 9: 299–306. degradation and regulates UVB-induced keratinocyte apoptosis through 51. Xiong, A. S., Q. H. Yao, R. H. Peng, X. Li, H. Q. Fan, Z. M. Cheng, and Y. Li. NFkappaB. J. Biol. Chem. 281: 25850–25866. 2004. A simple, rapid, high-fidelity and cost-effective PCR-based two-step DNA 68. Tussie-Luna, M. I., B. Michel, S. Hakre, and A. L. Roy. 2002. The SUMO synthesis method for long gene sequences. Nucleic Acids Res. 32: e98. ubiquitin-protein isopeptide ligase family member Miz1/PIASxbeta /Siz2 is 52. Sepulcre, M. P., F. Alcaraz-Pe´rez, A. Lo´pez-Mun˜oz, F. J. Roca, J. Meseguer, a transcriptional cofactor for TFII-I. J. Biol. Chem. 277: 43185–43193. M. L. Cayuela, and V. Mulero. 2009. Evolution of lipopolysaccharide (LPS) 69. Chun, T. H., H. Itoh, L. Subramanian, J. A. In˜iguez-Lluhı´, and K. Nakao. 2003. recognition and signaling: fish TLR4 does not recognize LPS and negatively Modification of GATA-2 transcriptional activity in endothelial cells by the regulates NF-kappaB activation. J. Immunol. 182: 1836–1845. SUMO E3 ligase PIASy. Circ. Res. 92: 1201–1208.

53. Ihara, M., H. Yamamoto, and A. Kikuchi. 2005. SUMO-1 modification of PIASy, 70. Robertsen, B. 2006. The interferon system of teleost fish. Fish Shellfish Immunol. by guest on September 29, 2021 an E3 ligase, is necessary for PIASy-dependent activation of Tcf-4. Mol. Cell. 20: 172–191. Biol. 25: 3506–3518. 71. Alvarez-Pellitero, P. 2008. Fish immunity and parasite infections: from innate 54. Sampson, D. A., M. Wang, and M. J. Matunis. 2001. The small ubiquitin-like immunity to immunoprophylactic prospects. Vet. Immunol. Immunopathol. 126: modifier-1 (SUMO-1) consensus sequence mediates Ubc9 binding and is es- 171–198. sential for SUMO-1 modification. J. Biol. Chem. 276: 21664–21669. 72. Workenhe, S. T., M. L. Rise, M. J. Kibenge, and F. S. Kibenge. 2010. The fight 55. Okubo, S., F. Hara, Y. Tsuchida, S. Shimotakahara, S. Suzuki, H. Hatanaka, between the teleost fish immune response and aquatic viruses. Mol. Immunol. 47: S. Yokoyama, H. Tanaka, H. Yasuda, and H. Shindo. 2004. NMR structure of the 2525–2536.