Posted on Authorea 12 Aug 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159724520.02458989 — This a preprint and has not been peer reviewed. Data may be preliminary. fPit ib oul Pssi nesnilclua rcs.O h n ad h ecini rtclfor critical is reaction the hand, one the various On of process. cellular synthesis essential the an for is reactions PPases conversion biosynthetic soluble The by many [6]. Pi acids by fatty to generated and PPi polysaccharides, is acids, of nucleic that proteins, product including Mg biomolecules, metabolic single-domain, important eukaryotes. are a in PPases dimers is whereas I prokaryotes, and PPi Family in prokaryotes found life. in and only of hexamers differ plants are kingdoms as that III in all families exist and membranes three in that II across into families exist divided Na+ from PPases are PPases or I PPases [3-5]. Family H+ Soluble structures and 2]. transport include pyro- sequences [1, PPases to their protists use source types. in parasitic V-PPases energy cell and PPases. archaea, to an all bacteria, as soluble (PPi) in some ATP) present and pyrophosphate of enzymes PPases) of (instead ubiquitous H+-translocating phosphate molecule are (vacuolar one PPases V-PPases (Pi). of membrane-bound phosphates hydrolysis of the molecules catalyze two (PPases) pyrophosphatases Inorganic Introduction 1 phatase Niu Haiying Drug Anti-cancer Potential Target a PPA1 1): Human Pyrophosphatase the (Inorganic of Study Modeling and Crystallographic HRV-3C: and PPA1 human of List: mechanisms double-phosphorylated Abbreviations the accommodate target. into the to insights as new potential PPA1 provides the using study developments has the drug PPA1 from anti-cancer of results structure-based site short, for active basis In hydrolysis. PPases pyrophosphate the JNK1. of for from structures indicate site should available derived active study that with rigid peptides relatively structure modeling comparison and dimeric and the pre-organized a structure largely at from forms PPA1 a PPA1 PPA1 the Results has PPases. PPA1 of human I that Analysis suggest family of the PPases. organisms other lower structure fungal on in from and crystal found study animal those the detailed in to conserved no report similar is be we is PPA1 there of Here fold PPA1, protein PPases. of monomeric 2.4 origin importance anti-cancer of mammalian physiopathological for resolution and of target a biological mechanisms and biomarker the catalytic prognostic knockdown of and PPA1 potential a spite structure tumors. as malignant In emerging human is many development. PPA1 to dephosphorylate drug proliferation. linked directly in decreases been also present and can has is PPA1 PPA1 PPA1 apoptosis hydrolysis, PPA2. of induces in pyrophosphate and expression PPA1 Besides roles PPases, Upregulated two essential enzyme. possess JNK1. housekeeping play Human a phosphorylated PPases as life. largely of phosphates. acting kingdoms all tissues, to in all pyrophosphate found are of and hydrolysis development, and the growth catalyze (PPases) pyrophosphatases Inorganic Abstract 2020 12, August 2 1 otenIlni nvriyCarbondale University Illinois Southern Hospital Central First Tianjin PPA2: ua hnvrs3 Protease 3C Rhinovirus Human 1 in Zhu Jiang , .W locridotmdln tde fPA ncmlxwt N1drvdpopo-etds The phosphor-peptides. derived JNK1 with complex in PPA1 of studies modeling out carried also We A. ˚ nrai yohshts 2 Pyrophosphatase Inorganic 2 uni Qu Quanxin , JNK1: 1 i Zhou Xia , -u -emnlknss1 kinases N-terminal c-Jun 1 2 ioa Huang Xiaolan , PPA1: 2 n hhaDu Zhihua and , 2+ nrai Pyrophos- Inorganic eedn enzymes dependent 2 Posted on Authorea 12 Aug 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159724520.02458989 — This a preprint and has not been peer reviewed. Data may be preliminary. lsoimfliau P-Ps)adTxpam odi(gPae 4] yoatru tuberculosis Mycobacterium [48], (Tg-PPase) parasites human gondii [47], Toxoplasma species, (Pho-PPase) and other horikoshii from (Pf-PPase) PPases Pyrococcus (Y- soluble falciparum had [46], on cerevisiae studies Plasmodium out Saccharomyces (T-PPase) carried biochemical and on thermophilus been [37-39] and also study Thermus (E-PPase) had structural detailed including coli studies Extensive Escherichia no crystallographic X-ray from is PPases enzyme. [40-45]. there PPase) I this PPA1, Family human selective of on of mechanisms reported and importance been catalytic allosteric physiopathological and of and structure discovery biological could the the the activity PPase by of of spite demonstrated [36]. Inhibition In as tuberculosis [35]. Mycobacterium sites, infection from brucei allosteric pyrophos- PPase T. targeting of of soluble by model inhibitors (vacuolar mouse achieved VSP1 a be provided the in (HAT), trypanosomiasis death also resistant of African from drug of inhibitors protection agent against causative molecule 40% the activity a Small brucei, antibiotic Trypanosoma develop- from drug promising anti-cancer protein [34]. small-molecule have 1) as aureus phatase for to inhibitors organisms Staphylococcus shown pathogenic small-molecule of were protein from specific molecules strains PPases by PPA1 small target of achieved the Anti-PPase to development Alternatively, be made the ment. been might for had systems. down-regulation Efforts target have PPA1 CRISPR valuable may drugs. RNA-targeting down-regulation a cancers. PPA1 or represent for certain RNAi might strategies of through that treatment suggest knockdown cancer various the studies mRNA in these for proliferation from decrease potential Results and knock- therapeutic apoptosis PPA1 31]. induce [27], 30, to cells shown [22-24, cancer is cells of silencing) mediated proliferation RNAi and (by invasion down migration, enhances overexpression PPA1 in While increase and p53 in decrease the caused overexpression level. PPA1 that found of was in it overexpression translocation β- PPA1 [30], and EOC that dephosphorylation on found the study previously another phosphorylated promoted we (EOC) mechanism, activities dephosphorylate carcinoma speculated the ovarian directly this regulate epithelial with may can PPA1 consistence PPA1 their In phosphatase, maintain that JNK by p53, apoptosis. to a (including found caused cells as effectors Functioning is alterations cancer downstream [22]. of the it Metabolic kinase) for addition, N-terminal [33]. biomaterials (c-Jun In cells and JNK1 rate. cancer energy understood. extra proliferation fully of not the high hallmark is provide important tumorigenesis may a in overexpression an is overexpression PPA1 PPA1 is protein of PPA1 metabolism involvement that the Dysregulated showed indicate for data tumors mechanism These metastases exact [32]. The (LSCC), cancers. tumors carcinoma certain primary cell for to [29], biomarker squamous compared (ICC) prognostic laryngeal PPA1 cholangiocarcinoma potential In of intrahepatic increase hepatocel- 31]. 28], intense [25], [20-22], 30, cancer[27, cancer an cancer [24, gastric prostate colorectal cancer [26], 24], ovarian Upregulated including cancer [17, role [16-19]. tumors and breast adenocarcinoma essential malignant emerged lung [19], its the human has [23], carcinoma to many to (DLBCL) tumorigenesis lular due all lymphoma to in localized presumably B-cell in linked PPA1 [15], is large found been of gene PPA2 diffuse has enzyme role housekeeping [15]. PPA1 a the ubiquitous of recently, aa) as a expression More largely (305 is acts metabolism. PPA2 PPA1 PPA1 energy homology. and that in ˜70% found aa) share is (289 PPases It been PPA1 tissues. human has PPases, two mouse I and The Family rat mitochondrion. of two neurite by liver regulate possess calcification the to stimulate Human in and potential PPA1 14]. synthesis the cytosolic [13, collagen have of aging I activity to with type and function reported is correlated induce cell expression intestinal been PPase to autophagic Increased and has [11], development for and [12]. PPA1 larval cells osteoblasts arrest gene for enzyme neuroblastoma cycle required ppa PPase mouse cell is in the the to PYP-1 growth mammals, coli, enzyme lead In PPase defects E. the 10]. PPase In elegans, [9, yeast, development. C. fermenting In and In [8]. for [7]. growth death growth pull for cell exergonic. thermodynamic enzymes for highly a essential essential is provides are PPi reaction of PPases hydrolysis the Soluble enzymatic hand, because other reactions the biosynthetic on PPi-generating the homeostasis; PPi cellular maintaining aei xrsinlvl ovrey P1kokonldt h nraeo 5 n eraeof decrease and p53 of increase the to led knockdown PPA1 Conversely, level. expression catenin – β aei,Bl2 n aps-)ta oto elpoieainand proliferation cell control that Caspase-3) and Bcl-2, catenin, 2 β- aei 3] In [31]. catenin β- catenin Posted on Authorea 12 Aug 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159724520.02458989 — This a preprint and has not been peer reviewed. Data may be preliminary. orsod otehmnPA rti ihGnakacsinN.NP No. accession GenBank with protein PPA1 human the to corresponds tutr fteE oiPae(D oe4m)wsue sasac oe.Ti tutr scoe sa as chosen is structure This monomeric The model. search [54]. a package as PHENIX used the was 4um4) in code implemented (PDB is PPase that carried coli in was [53] E. which Scala Phaser the method, and (Argonne replacement program of Mosflm Source molecular structure the the programs Photon using using the Advanced by with achieved by the was scaled out at Phasing and LS-CAT [52]. integrated, of package processed, CCP4 21ID-D the were beamline Data at Laboratory). nitrogen. out National liquid carried in was determination flash-cooled collection were structure Data Crystals and glycerol. processing, (v/v) data 10% collection, and Data KBr, mM 200 7.5), (pH propane used was mixture The PCR processed minutes. The 20 for ends. OD temperature both room at His 5’-overhangs at a NiCo21(DE3) tag, generate incubated DNA of T4 NEB-turbo Halo to and front by transform dTTP the mixed in processed to mM were encodes protease subsequently vector 2.5 and vector 3C digestion of and (HRV) cloning SmaI rhinovirus presence insert The by human the The linearized was result. for in etc. vector sequence best polymerase tags, The recognition Fc the sequence. PPA1 and gave amino-acid LIC the NusA, [51] eight specific express HALO, an tag to SUMO, and HALO way TRX, a tag, appropriate GST, MBP, presence an with the the find vector including To in cloning tags, polymerase ends. PCR fusion for- DNA both different The T4 at taining the (LIC). by 5’-overhangs with processed generate cloning in and to ligation-independent plasmid protein dATP electrophoresis for mM the gel 2.5 underlined) agarose from of by nucleotides, purified PCR (21 was by sequence product (GenBank specific amplified PPA1 5’-end was a human 1-289) full-length (residues 5’- ACCACGGGGAACCAACCCTTA PPA1 the primer length encoding ward full fragment the DNA coding a contains that plasmid NC cDNA crystallization of and studies A preparation modeling sample out protein carried cloning, also Molecular residues. We phosphothreonine PPA1. and Methods phosphotyrosine human containing and of peptides Materials structure derived crystal JNK with the complex present in we PPA1 S. paper, and [50], this TbbVSP1) In protein soluble vacuolar published). called not (also (Sj-PPase, brucei japonicum brucei Trypanosoma 49], [36, (Mt-PPase) iaincniin,dffatn rsaso h P1wr banda 9 yhnigdo ao diffusion crystal- vapor the hanging-drop optimizing by K After the 295 in at days. μ obtained used few were were PPA1 a precipitants) the 50 within the of screening against identified crystals as prepared were diffracting PEGs in-house conditions, conditions various of lization crystallization with sets 7.5), Ten Multiple conditions (pH different Tris plates. trials. 96 mM 96-well-format containing 25 using (each containing out solutions buffer carried were a trials in DTT. Crystallization mg/ml mM from resin. ˜10 1 separated NTA to and were with NaCl, concentrated tags process cleaved mM were chromatography) resin. The 200 metal-affinity proteins contains (immobilized affinity artifact. target protein IMAC NTA cloning target purified reverse by the a a The tags, purified as by the N-terminus was protein of removal the target protein After at the fusion GPSSP protease. The 3C sequence HRV artificial by motif. cleaved an then cleavage were for tags fusion recognition The protease 3C HRV the in and a expressed K was 288 protein harvest. to PPA1 lowered before The was overnight temperature grow the to induction, allowed After was culture expression. protein induce to concentration) rti apemxdwt 2 with mixed sample protein l 600 0001)wsprhsdfo NS lsi eoioy h rti rdc fti cDNA this of product protein The Repository. Plasmid DNASU from purchased was 000010.11) f0608 Isopropyl 0.6-0.8. of .coli E. μ elslto sn 6wl omtcytliainpae.Tecytliaindoscnand2 contained drops crystallization The plates. crystallization format 96-well using solution well l .coli E. CAAGGACCGAGCAGCCCCTCA naslbefr,w a etdasre fi-os eeoe I lnn etr con- vectors cloning LIC developed in-house of series a tested had we form, soluble a in el NwEgadBoas.Cl utr a rw nL ei ni trahdan reached it until media LB in grown was culture Cell Biolabs). England (New cells shrci coli Escherichia β- --hoaatprnsd IT)wsaddt h utr a . Mfinal mM 0.4 (at culture the to added was (IPTG) D-1-thiogalactopyranoside μ elslto.Tewl ouincnan 0 E 30 0 MBis-Tris mM 100 3350, PEG 20% contains solution well The solution. well l TGTTCGTAGAC3.Ec fteepiescontains primers these of Each CTAGTTTTTCTGGTGATGGAAC-3’. .coli E. optn el.Tercmiatpamdwstasomdinto transformed was plasmid recombinant The cells. competent safso rti iha -emnlHl a n i a,and tag, His and tag Halo N-terminal an with protein fusion a as 3 tacgtcgac-’adtervrepie 5’- primer reverse the and atgagcggcttcagcaccg-3’ 692 h N en- DNA The 066952. Posted on Authorea 12 Aug 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159724520.02458989 — This a preprint and has not been peer reviewed. Data may be preliminary. mn h oul Psswt nw tutrs ua P1saetehgetsqec oooywith homology sequence highest the share PPA1 human structures, from fold. known PPases protein with the the PPases to soluble polypeptide the the Among of C-terminus the anchor to helps the surround four The the 2A). including (Figure 7) and 6 seventeen of consisting fold structure antiparallel globular sgtructures. the domain core single of a homologous solution adopts highly clear PPA1 four human a share of to E-PPase chain leads and polypeptide readily PPA1 The MR use the prokaryotic for the that that that model indicates search fact known PPA1 The a also human structures. as is of crystal structure It the E-PPase PPA1 gap). in monomeric human states 18% re- a in oligomerization of and (289 44-194 different similarity, E-PPase (residues assume 41% of PPases homologous identity, bias eukaryotic that marginally 27% minimize and than only with to longer are 16-143 much model sequences residues is search two PPA1 matches The the human residues). as of 176 chosen sequence 2.39 vs was The of sidues E-PPase determination. resolution of structure a PPases structure the at monomeric I on determined A Family was method. PPA1 other (MR) human cement to of similar structure crystal is The PPA1 human of structure overall The hexapeptide A site. Discussion active and the Results at site. Yp active the the at by model Tp 181-MMTpPYpV to the sequence used model JNK1 studies, to was to used modelling 182-MTpPYpV mutated at was for were Tp pentapeptide 181-MMTpPYpV sequence structure a JNK1 A Erk2 and the the to Yp Chimera. in corresponding a peptides sequence model 181-FLTpEYpV prepare indicates to To the p phosphothreonine), respectively. (superscript kinase 184-EYpVA site indicates MAP active used: p were the phosphorylated (superscript tetrapeptides the 181-FLTpE Erk2-derived phosphotyrosine Two and from The phosphotyrosine) derived [60]. site). 2erk) initially active by code the were (PDB site at Erk2 peptides active peptide PPA1 containing bound accommodating the the phosphothreonine of of into and/or minimization capable of modelled energy is series were (including site a Chimera peptides active residues, using containing PPA1 docking threonine for phosphothreonine the phosphorylated structure whether and/or and/or receptor tyrosine explore phosphotyrosine PPA1 To phosphorylated the containing prepare to results. ac- to substrates out the docking used peptide into carried was the docked Chimera was were visualize molecule studies [59]. to pyrophosphate To Vina a and modelling site. AutoDock first, PPA1, At using active human by putative site. site active of the tive the mechanism at at substrate substrates catalytic putative contain various possible not place the does into PPA1 human insights of gain structure substrates crystal putative determined various The with PPA1 of Data Protein the modelling the using Structural in by deposited depicted Clustal been have were by 6C45. data interface out diffraction code homodimerization carried accession and PPA1 surface were with coordinates the Bank structures electrostatic Atomic at known for [58]. settings. interactions with LIGPLOT Figures default program PPases Molecular the soluble figures. with eukaryotic [57]. tool graphic the Omega Coloring UCSF molecular of Surface program the Coulombic alignments The the of Sequence 1. using all Table Chimera in generate by found refinement shown generated was to Structure are were solution used [55]. statistics rendering single Coot was determination A with Structure out [56] tried. carried PHENIX. were Chimera was by family building out P222 model Interactive carried the was of P212121. group groups space space the plausible in All because model search α- eie,adfu 3 four and helices, β- β- arl(tad ,1,1,1 n 5 n -taddantiparallel 5-stranded a and 15) and 14 13, 11, 5, (strands barrel oesrcue aall2-stranded parallel A structure. core .japonicum S. α- eie,fu 3 four helices, 10 hlcs(iue n ) h oeo h lblrfl scmoe fa5-stranded a of composed is fold globular the of core The 2). and 1 (Figures -helices β- arland barrel and .cerevisiae S. 10 hlcs n v short five and -helices, β- he r akdcoeytgte.Ohrprso h molecules, the of parts Other together. closely packed are sheet aot7%smlrt,seFgr ) h tutrso the of structures The 1). Figure see similarity, 70% (about 4 β- he omdb h w hr strands short two the by formed sheet β- tad srns4 ,9 0 2 6 n 17) and 16, 12, 10, 9, 8, 4, (strands strands sn h oeua displa- molecular the using A ˚ β- he srns1 ,3, 2, 1, (strands sheet β 0and 10 β- strands, β 17 Posted on Authorea 12 Aug 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159724520.02458989 — This a preprint and has not been peer reviewed. Data may be preliminary. iue2 hw ueipsto ftemnmrcsrcue fhmnPA n -Ps.Tetwo exist differences The Some Y-PPase. site. and the active 4UM4), PPA1 the code human including (PDB molecules, E-PPase of of the structures of monomeric parts the the most in in of well gave superimposition 2IHP) superimpose code a structures (PDB shows cerevisiae S. 2B the and to 4QLZ) Figure structure 0.98 code PPA1 human (PDB of monomeric japonicum RMSD the S. a of from PPase Superimposition of similar. structure are monomeric species three these from PPases oieiain(iue n ) hs eiusaesatrdi i ieetrgoswti h primary the within regions different ho- six (strand in in Phe85 involved scattered around are regions are Asp165, between His286 three residues Val129, and the These Ser127, His285, with 4). Lys88, Trp283, sequence, and Pro86, Lys282, 3 Phe85, Asp281, (Figures Asn83, Ala185, Trp53, modimerization Tyr182, Arg52, Gly181, including Pro180, interactions. the residues, of electrostatic Lys179, of complementarity and number shape PPases bonds, including large hydrogen three factors A intermolecular the of multiple contacts, by formation of hydrophobic driven that interface, structures is dimerization indicate PPA1 the human artifact. dimerization in of packing of homodimers homodimerization crystal SASA The similar to buried of due large unlikely presence the is The and homodimer 1). groups the 21 space different P1 in and crystallized P32, 21, 21 (P21 1860 buries (1830 homodimer homodimers PPA1 Y-PPase human from and the of PPases Formation 2C of 2IHP). (Figures relative and structures directions a 4QLZ A the ˚ opposite assume codes in facing PDB homodimer observed arm, Y-PPase, the and in are in (Sj-PPase arm homodimers protomers standing two Similar twin identical The 2D). an and homodimer. to Family a analogous of as is that exists subset orientation PPA1 human a crystal, in the conserved In is that structure PPases dimeric I a [48]. forms Pf-PPase PPA1 of assumes homodimerization Human Pf-PPase the in in extension is involved C-terminal and not The 2B), is (Figure below). that Y-PPase (see C-terminal structure and PPases different Sj-PPase, a the PPA1, a of have human homodimerization in Pf-PPase) the structure in and similar involved Y-PPase, a PPases. assumes (Sj-PPase, I sequence Family PPases extension soluble eukaryotic the of three (after structures other known extension all and in PPA1 common Human are (RMSD=2.60 structure structure the E-PPase of the in portions counterparts These their have PPA1 human of ne hsooia odtos[73,4,4,4] l u n nwekroi Psssrcue form structures PPases eukaryotic know one but All hexamers 49]. form PPases 47, Prokaryotic 46, states. oligomeric [37-39, different in conditions exist physiological to (Figure known under Y-PPase are and PPases molecules and Asp165-Lys282 I Sj-PPase, water Family PPA1, the Soluble structured human of by in sidechains conserved mediated the is are between pair bonds observed, 1). Asp281-Arg52 hydrogen are The interactions other pairs. oxygen electrostatic all Asp281-Arg52 backbone Two the Arg52, between of one 3). the sidechain (Figure Except (human and interface. PPases dimerization eukaryotic Asp281 the three of at bonds the hydrogen among several are conserved 1). There are Figure mediated which see contacts 4), Y-PPase, the include Hydrophobic and (Figure examples Trp283 Sj-PPase, 4). Some PPA1, Figure and in 3). and Pro86, areas (Figure residues surface extensive Phe85, hydrophobic red are the by orange interface of to dimerization sidechains (white the the residues in by other contacts defined of but sidechains is interactions the surface of interfacial molecular parts interface the aliphatic the in of portion participating large directly A only extension not C-terminal by the the within dimerization holding residues in Importantly, also role 1). important (Figure residues an the play of most having loop) following 2 fsletacsil ufc ra(AA rmtetopooes oprbet hs nteSj-PPase the in those to comparable protomers, two the from (SASA) area surface accessible solvent of α 4-helix, α 1- α eie n -emnsof n-terminus and helices 2 β β bsdo 02cmo tm)ad0.97 and atoms) common 3032 on (based A ˚ 8, 0rgo nposition. in region 10 β 9, α -ei)sqec oprdt te aiyIPae Fgr ) hsC-terminal This 1). (Figure PPases I Family other to compared sequence 3-helix) β 10, β 7rgos swl ssm onciglos ncmaio ihtestructure the with comparison In loops. connecting some as well as regions, 17 A ˚ 2 β- n 2030 and barrel, α -ei) n rudTp8 (3 Trp283 around and 2-helix), β 6, A ˚ 2 β epciey.Tetrecytl aedffrn pc groups space different have crystals three The respectively). 7, α 1-helix, 5 β 0adtefloiglo) rudPo8 (linker Pro180 around loop), following the and 10 α bsdo 91cmo tm)respectively. atoms) common 2981 on (based A ˚ -ei,adteNtria oto of portion N-terminal the and 2-helix, 10 .japonicum S. helix vr60cmo atoms). common 640 over A ˚ η ,strand 4, and β .cerevisiae S. 7 n the and 17, α 3-helix Posted on Authorea 12 Aug 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159724520.02458989 — This a preprint and has not been peer reviewed. Data may be preliminary. lse noesd fteatv ie ls oteP hshrsao.Tescn ru nldsalof all includes group residues second These The atom. Gly95. phosphorus and P2 residues the charged to negatively close the site, pyrophosphate active of the the all to of relationship of side spatial consists relative one group on on 3 based first cluster the groups The from two transition residues into the divided these substrate. make can of Lys194 residues Most and numbers). side Tyr193 active residue PPA1 PPases. Glu49, human I Family (Y- shown are soluble The Lys194 the Y-PPase) Tyr193, than substrate. the in Lys155, less pyrophosphate in residues Asp153, one Asp148, locate site modeled are Asp121, active a numbers Asp118, established with residue Asp116, the PPA1 PPase Gly95, site. (matching Tyr94, human active Arg79, residues of Glu59, the site structure Lys57, at active pyrophosphate site PPA1 a active human with sidechain the 14 PPA1 and shows of backbone structure 5A in the Figure merged difference generate were slight to pyrophosphate very the coordinates of only PPA1 (PDB coordinates 0.98 show the superimposed of site with structure The RMSD active S1). Y-PPase small the Figure a fluoride-inhibited (Supplementary define with conformations that well substrate-bound, structures superimposed a structure structures of PPA1 overall portions with human Y-PPase) The the structure with into [45]. into modeled 1RE6A) alignment insights the was code sequence gain substrate of To structure-based the superimposition site. substrate, from pyrophosphate active by (inferred the putative to residues the relative at current site in substrate orient the active the in speculative contain PPA1 the not Y-PPase human how does of of structure site mechanisms PPA1 active human catalytic the The and analyzing structures for site critical active are the knowledges structure. on previous out These carried [40-45]. been site had active studies pre-organized Extensive largely a has PPA1 non-conserved a reaction Human in hydrolysis bind the inhibitors [36]. block Mt-PPase, which manner of identified, allosteric the case were and From the structure interface uncompetitive the In studies. hexameric dimerization an at the further site. the in cleft of target deserves target, allosteric monomers and a large useful between known as a interface a PPA1 not as of human 4-turn is serve suing a PPA1 presence may development human accommodate cleft the drug easily of structure-based is can site of cleft structure functional perspective the a dimeric of represents PPA1 size cleft human The required this the 2D). not (Figure other is of interface to dimerization feature relevant dimerization if dimerization Residues be outstanding even still structure, very may course, other. currently. monomeric A it Of known each condition, the not physiological site. to in is under active PPA1 independent that site the human function(s) active be on of PPA1 any, function the should (Figures phosphatase if from sites other the effect, away for each active allosteric far from two have isolated also only the and are should away at of dimerization far reactions case dimer, in Catalytic the the involved In from 2D). of (one known. sites surface and active not molecular two 2C are functional the opposite any, places the on if dimerization state, Y-PPase), function, protomer) multimeric and PPase of each a Sj-PPase on in homologous structure diversity exist the crystal (and PPases structural PPA1 The I its human Family and soluble [50]. multimerization proposal. that dimerization of this believed roles of generally support now mode to is Family evidence similar it soluble of Although a that piece share conservation) strong might sequence a fungi on provides The eukaryotic (based PPA1 and in human [50]. proposed animal exist Y-PPase was from dimerization and it of PPases Previously, Sj-PPase, modes I PPA1, diverse PPases. human that I show among Family PPases mode soluble eukaryotic conserved of the structures crystal from available different Tb Tb and Tg-PPase, and other, in The (Tg-PPase modes each either Y-PPase. dimerization PPases extension and eukaryotic The Sj-PPase Other C-terminal (Pf-PPase). the configurations a dimerization. in in have involved conserved critically not is are that do PPases mode these dimerization in extensions a C-terminal Tb reveals PPA1 is human exception of The structure 48]. [40-45, dimers β- arladteadjacent the and barrel β b -tad hc r elcnevdaddfie nalsrcue of structures all in defined and conserved well are which 6-strand, S1 hc om ermr(ie fdmr 5] h crystal The [50]. dimer) of (dimer tetramer a forms which VSP1, 6 b S1 rhsaCtria xeso ndifferent in extension C-terminal a has or VSP1) b S1 n fPaeaedffrn from different are Pf-PPase and VSP1, 10 -helix η othe to 2 Fgr B.The 2B). (Figure A ˚ α- ei.Whether helix. α -ei.The 2-helix. Posted on Authorea 12 Aug 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159724520.02458989 — This a preprint and has not been peer reviewed. Data may be preliminary. ciest sidctdb h lc ro.Tecvt sidctdb h ht vl.Teotrprinof portion outer The oval). white the the by of indicated location The is 5B. cavity (Figure The cavity arrow. a black of apo- the portion the by deep with indicated and structures is inner PPA1 portion site the at active bound outer located phosphor-peptide the 0.2 is the very on than substrate of only pyrophosphate less residues values showed Superimpositions for between RMSD phosphor-peptide Chimera) crash give pocket. bound structure steric in site a without minimization active pocket, with the energy site structures of (during active the PPA1 changes the The at conformational in Tp PPA1. minor accommodated the and be and phosphor-peptide can the Yp phosphor-peptides A the the Two 6A). of 6B). model (Figure (Figure A All to S2). site site Figure active used active Erk2. (Supplementary the were kinase the at respectively 181-FLTpE, Tp MAP site at the and active the Yp model 184-EYpVA or the to pyrophosphate tetrapeptides, JNK1 used residue model a was Erk2-derived either of to phosphorthreonine 181-MMTpPYpV match atom hexapeptide used or phosphorus derived phosphor-peptides was P2 JNK1- phosphortyrosine four the 182-MTpPYpV the the as pentapeptide of position of JNK1-derived same sequences atom the The at phosphorus pyrophos- located known substrate. The is the at phosphor-peptide bound the site. phosphor-peptide within active short to a binding studies with modeling each phate out constructed, carried were phosphor-peptides. we models accommodate phosphatase, also structural JNK Four could a a site active as within PPA1 binding pyrophosphate pyrophosphate Tyr185 of known inorganic role the and concerned emerging whether only the investigate Thr183 PPases Given I Family [62]. of substrate. soluble enzyme and the on phosphorylation the as studies p53, mechanistic inactivates dual (MAP) and c-Jun, phosphatases structural a protein protein far, including by So by neuronal mitogen-activated molecules, activated JNK in the downstream of is role Dephosphorylation numerous of JNK a motif. of to member play 180-FMMTPYVV activity led phosphorylation. a may was the overexpression by PPA1 is level regulates or Bcl2, phosphorylation JNK JNK knockdown mutant. JNK PPA1 PPA1 family. of that dephosphorylation. inactive differentiation kinase shown alteration neuronal catalytically JNK Evidence was no on a via activity. studies It while with JNK differentiation in level, treatment of 61]. obtained phosphorylation regulation after also [11, JNK to detected was embryo related decreased phosphatase chick partially or pJNK and least increased a at rat, as is down- mouse, PPA1 cancer significantly in of PPA1-silencing colon indicating function inhibitor, in JNK the PPA1 [22]. PPA1 by human impaired for detected of is that was role effect found antiproliferation the p-p38 This was studies that or It proliferation. recent cell pERK 61]. cancer several levels, towards colon 22, phosphor-protein pyrophosphate, activity regulated and [11, catalytic of phosphor-peptide phosphatase both no hydrolysis protein in while a the JNK1 phosphorylated as catalyze dephosphorylate function directly PPases from also could that may peptides PPA1 established double-phosphorylated that well accommodate reveal is to it potential While the which has pre-organized, PPA1 largely human is PPA1 of JNK1 human site catalysis. of during active (Figure site reorganization residues Low The active conformational these the of for S1). flexibility that need Figure lower the indicates relatively (Supplementary minimize analysis suggest Lys194 would also and and and site data substrate- some lysine active Arg79, These with their the the of Lys57, 5B). well at and structure, sidechains residues superimpose of PPA1 the for residues sidechains human longer values site of of the B-factor the active core apo-structure in the (especially during rigid the differences that and sidechains shows of the conformation binding structure Comparison the in Y-PPase substrate of located fluoride-inhibited changed. upon bound, conformations be are changes could residues little course, residues) have site Of arginine should active atoms) the reaction. backbone of the the most of that active (locations the fact the positions group as leaving the that molecule and of to water reveal state side a Y-PPase Due transition activating other on the and stabilize the Studies ions sidechains on 5A). metal charged (Figure 4 locate positively [40-45]. with the atom largely while coordinating phosphorus residues nucleophile, for P1 These reaction responsible the are tyrosines. to carboxylates two close site the site, and active residues the charged positively the .Te(uaie ciest fhmnPA htwudbn the bind would that PPA1 human of site active (putative) The A. ˚ 7 Posted on Authorea 12 Aug 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159724520.02458989 — This a preprint and has not been peer reviewed. Data may be preliminary. ii n r-raie.Teotrprino h aiyi endb eiusfo eihrlstructures, peripheral from residues by defined is cavity the inner of the portion from strands outer the residues The including by defined pre-organized. mostly shallower. and is getting rigid site while leftward binding and pyrophosphate downward The expanding larger, much becomes cavity the and h oki upre ygatfo h ini is eta optlo hn (yuanCM201810). China of Hospital Central First Tianjin The from References grant paper. by this supported of is publication work the The regarding interest of conflict Statement no Funding study is this there that of declare(s) findings author(s) the 6C45. The code support accession to with Interest used Bank of structures Data Conflicts the Protein the for in data deposited diffraction been and have coordinates atomic The lab. our provides Availability in also Data out structure carried The being using functions. knowledge is by PPA1 previous discovery which of and drug mechanism libraries, studies structure-based the modeling for into in from presented insights basis is results new the structure with sheds a conjunction Such structures, development, human in PPase drug PPA1. of human anti-cancer structure, on of role for The structure target emerging study. resolution a the current atomic as Given an the PPA1 obtain human reported. to of essential been value becomes But has potential it available. the organisms are and higher organisms tumorigenesis lower from from in PPases PPases PPA1 I on Family study soluble of structural structures no crystal many study, or our to peptide Prior of development the for basis helpful Conclusion molecular very the be reveal also to needed will are structures PPA1. complexes human The PPA1-pJNK1 of the inhibitors dephosphorylate phosphor-protein specificity. cannot peptide-like of or substrate but Structures phosphor-peptide pJNK1 this dephosphorylate with [22]. directly of complex and only can p-p38 Glu149 PPA1 in can human or PPA1 right, PPA1 human that top pERK of by known at structures recognition is substrate Lys199 substrate It resolution peptide left, peptide substrates. in high top of implications by have details at may revealed structural Lys75 residues exact be and charged the the of Lys74 in course, distribution left, areas Of peculiar different bottom The in specificity. in at placed left). play note, are 63 the Of into Lys199 on Lys and Glu151 phosphor-peptides. hydrogen come 5B, Glu151, certain Figure Glu149, as interactions the for Lys75, (in (such of specificity these Lys74, pocket interactions substrate Lys63, geometry When have residues inter-molecular good charged might the six keeping pocket etc). the optimize site while active interaction, to crash PPA1 made steric electrostatic the reality, was minimized phosphorylation. contacts, effort only double-site hydrophobic No models or catalysis bonds, the single- and protein. that binding with and out pyrophosphate phosphor-peptides peptides pointed for various known be accommodate pocket should site of to It active portion potential the flexible the that more has indicate and phosphor- results shallower, various outer, modeling portion the These accommodate deeper) by (and can inner accommodated cavity the are into cavity the residues reaching cavity. the flanking is how the of phosphor-residue the areas explain cavity, the different While cavity the in of studies. the atoms The modeling of of the flexibilities. in flexibilities large properties peptides have different These to the expected reflect 5B). are also (Figure Lys199) may and rendering Glu151, surface Glu149, B-factor Lys75, Lys74, Lys63, in sidechains β 3(iue5) ic ayo hs eiusaesraeepsd hi iehis(seilytelonger the (especially sidechains their exposed, surface are residues these of many Since 5A). (Figure 13 β and 8 β ,te3 the 9, 10 helix η h opconnecting loop the , 2 8 nsilico in ita cenn fsalmlcl compound molecule small of screening virtual β and 6 β ,adtelo connecting loop the and 7, β- oeadteeoerelatively therefore and core β 12 Posted on Authorea 12 Aug 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159724520.02458989 — This a preprint and has not been peer reviewed. Data may be preliminary. 5 arhl A aeua .Coigadepeso rfieo ua nrai yohshts.Biochim 10542310. pyrophosphatase. inorganic PMID: human PubMed of profile 1999;1447(2-3):133-6. expression Acta. and Cloning Biophys Biogeron- G. restriction. Patejunas TA, 24271717. dietary Fairchild long-term PMID: 15. and PubMed short- with 10.1007/s10522-013-9481-0. enhancement pyrophosphatase doi: further inorganic its of 2014;15(1):81-6. and activity mice tology. and male expression of increased liver Age-dependent the of R. in Sharma activity WJ, 10.1007/s10522- and Kharbhih expression doi: 14. differential 2007;8(5):517-25. Age-dependent 17415680. Biogerontology. PC. PMID: gene. Supakar PubMed pyrophosphatase PR, 007-9094-6. inorganic Debata PMID: cytosolic RS, induces PubMed liver Pandey pyrophosphatase rat 10.1016/j.bone.2009.08.055. H, Inorganic Panda doi: R. Terkeltaub 13. 2010;46(1):81-90. JL, PMC2818162. Bone. by PMCID: Millan Central growth M, osteoblasts. PubMed Foster neurite 19733704; in KA, of collagen Johnson Regulation I MD, type A. 10.1371/jour- Polewski Sanbe PMC3633968. doi: PMCID: H, 2013;8(4):e61649. Central 12. Nishigori PubMed One. J, 23626709; PLoS Yamauchi PMID: dephosphorylation. PubMed Y, JNK Tada nal.pone.0061649. via M, 1 Okada pyrophosphatase inorganic development Y, 10.1016/j.febslet.2007.10.047. larval Tezuka for doi: required 11. 2007;581(28):5445-53. is pyrophosphatase, Lett. inorganic FEBS PYP-1, 17981157. elegans. J. PMID: C. PubMed Ahnn in JR, function Yu an doi: intestinal W, plays and Lee 2005;73(4):1995-2004. suum KM, immunity. PMC1087427. Ascaris Ko and PMCID: roundworm 10. Central Infection the PubMed of development. 15784540; Pyrophosphatase and PMID: N. molting PubMed Tsuji worm’s 10.1128/IAI.73.4.1995-2004.2005. the M, in Yamada in depletion T, role Miyoshi NAD+ essential 10.1074/jbc.M112.439349. MK, through doi: Islam Inorganic death PMCPMC3642350. 2013/03/13. 9. A. cell PMCID: Epub Central Serrano autophagic PubMed P, 2013;288(18):13082-92. and 23479727; Navas Chem. PMID: arrest JR, Biol PubMed cycle Perez-Castineira J 2170325; cell G, yeast. PMID: to Lopez-Lluch fermenting PubMed lead A, Hernandez defects 1990;172(10):5686-9. pyrophosphatase G, essential Serrano-Bueno is bacteriology. Pyrophosphatase of 8. al. et Journal S, PMC526883. Blanquet PMCID: JM, coli. Central Schmitter Escherichia PubMed F, Leveque of M, growth Fromant A, for 13444110. Brevet enzymology J, PMID: in Chen PubMed Advances 7. 1957;18:191-240. reactions. biochemistry. biosynthetic of and in subjects phosphorylases structure related and an of and Pyrophosphorylases is Divergence A. BT2127 Kornberg al. PMCPMC3342813. 6. thetaiotaomicron et PMCID: 10.1021/bi201181q. Central Bacteroides SC, doi: PubMed Almo 2011/09/08. 21894910; superfamily: C, Epub PMID: Pandya enzyme PubMed 2011;50(41):8937-49. JD, dehalogenase Biochemistry. Farelli pyrophosphatase. haloacid R, inorganic Toro the Y, in mechanisms. PMID: Patskovsky function three PubMed H, substrate, Huang 10.1016/j.febslet.2013.05.003. one 5. doi: pyrophosphatases: Inorganic 2013/05/21. A. Epub Goldman 23684653. Mol 2013;587(13):1863-9. J, Prog Kellosalo Lett. pyrophosphatase. T, FEBS inorganic 10448675. Kajander Cytoplasmic PMID: R. PubMed 4. Lahti 1999/08/17. A, Epub Goldman 1999;23:127-50. the BS, of Biol. Cooperman last Subcell AA, the Baykov 10.1016/j.sbi.2014.03.007. pyrophosphatases: doi: 3. pumping 2014/04/29. Proton/sodium Epub A. 2014;27:38-47. 24768824. Goldman Biol. PMID: YJ, Struct PubMed Opin Sun Curr J, pumps. ion Kellosalo primary JY, PubMed Tsai prokary- 10.1128/mmbr.00003-13. in 2. doi: transport PMCPMC3668671. H+ PMCID: 2013/05/24. and Central Epub Na+ PubMed 2013;77(2):267-76. Pyrophosphate-fueled 23699258; R. Rev. PMID: Lahti Biol Mol HH, Microbiol Luoto AM, otes. Malinen AA, Baykov 1. 9 Posted on Authorea 12 Aug 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159724520.02458989 — This a preprint and has not been peer reviewed. Data may be preliminary. 8 agY a ,YnJ agD a ,ZagJ ta.Iogncprpopaae(P1 sanegative a is (PPA1) pyrophosphatase 2016/01/02. Inorganic Epub al. 2015;8(10):12482-90. PMCPMC4680380. et Pathol. PMCID: J, is Exp Central Zhang Clin overexpression PubMed Z, J 26722435; Int Bai Pyrophosphatase PMID: doi: D, cancer. Wang PubMed gastric J, human al. 2012;33(6):1889-98. jour- for Yin et marker J, the prognostic Medicine. Cai WS, : Y, and Ha biology Yang Tumour Biology BI, 28. Oncodevelopmental cancer. Cho 22797819. for gastric YJ, PMID: in Society PubMed Lee prognosis International 10.1007/s13277-012-0449-5. YH, poor the and Cho of invasion, GH, nal migration, cell Ko with SH, doi: associated Regulation Jeong 2015;10(4):e0124864. for PMC4414593. Elements One. PMCID: Critical PLoS Central 27. of PubMed Cells. 25923237; Identification Cancer PMID: SK. Breast of PubMed Mishra MCF7 analysis in BM, 10.1371/journal.pone.0124864. (PPA1) Proteomic Krishna 16447818. Pyrophosphatase S, PMID: Inorganic al. PubMed Chaudhary of et DR, 2005;27(5):263-72. International H, Mishra Cytology. the Jornvall of / 26. B, histology Society Franzen and American cytology M, [and] quantitative Cytology and Hellstrom Analytical of G, Academy cancer. Auer 10.1002/cam4.894. prostate C, in validation doi: expression Palmberg functional protein and H, 2016/10/30. significance Lexander Epub Clinical PMCPMC5083733. al. 2016;5(10):2800-12. 25. PMCID: et Central L, Med. Wan PubMed Cancer doi: W, 27666431; Zhou PMID: tumors. S, 2017/12/14. PubMed various Zhao Epub W, in PPA1 Shen 2018;70(2):641-9. G, of Wang pyrophosphatase D, Cytotechnology. PMCPMC5851958. inorganic Luo PMCID: of 24. humans. Central validation PubMed functional in 29234945; and lymphoma PMID: significance cell PubMed Clinical and B A. 10.1007/s10616-017-0165-5. potential Jin large malignant D, diffuse PM- Luo tumor in Aruna, PMCID: regulates L, Central PPA1 Li PubMed Q. 23. 28938583; Fu Epub PMID: using L, 2017;8(35):58611-24. PubMed engineering Huang Oncotarget. genome J, 10.18632/oncotarget.17381. pathways. CPMC5601679. Zhao Multiplex JNK doi: through Q, adenocarcinoma al. Mei 2017/09/25. colon et Y, of N, Zhou outcome clinical P, Habib 10.1126/science.1231143. Wang R, doi: Barretto PMCPmc3795411. 22. PMCID: S, 2013/01/05. Central Epub Lin PubMed 23287718; D, 2013;339(6121):819-23. PMID: Cox PubMed Science. FA, of Ran systems. Identification L, CRISPR/Cas Cong al. Association 15041719. et American the PMID: 21. T, of PubMed journal Maeda official 2004;10(6):2007-14. agarose Y, an using Research. by : Kodera Cancer cancer research for M, cancer colorectal Clinical primary Oh-Ishi in electrophoresis. S, modifications gel two-dimensional Yamaguchi post-translational and K, expression Matsushita protein altered T, 10.1074/mcp.M113.028027. Tomonaga between doi: PMC3708182. differences 20. label-free PMCID: Proteomic 2013;12(7):2006-20. Central and al. PubMed gel-based Proteomics. et 23462207; combined F, Cell PMID: a Weber Mol PubMed by W, investigated study. Naboulsi tissue proteomics M, liver quantitative Ahrens nontumorous M, and Kohl carcinoma 2002/05/03. T, hepatocellular Epub Bracht DA, mapping 2002;74(8):1779-91. Megger separations/mass liquid Chem. 19. 11985308. 2-D Anal PMID: A cancers. PubMed DM. ovarian Lubman 10.1021/ac011159c. of KR, doi: comparison Cho interlysate DR, PMID: Schwartz for of PubMed H, method analysis Wang 2002;8(7):2298-305. MT, Proteomic Research. Kachman research Cancer al. cancer 18. for Clinical et Association JM, tumors. American Taylor in the proteins KA, of of Shedden 12114434. journal set DG, official expressed Thomas highly an a CC, : of two-dimensional Huang identification TG, A adenocarcinoma: Gharib lung G, al. 10.1002/pmic.200300606. Chen et doi: and FR, 17. cancer Miller 2004/03/05. breast Epub of MT, studies 14997480. Kachman 2004;4(3):562-77. proteomic PMID: P, for PubMed Kreunin Proteomics. spectrometry NS, mass identification. with Buchanan biomarker coupled K, method Zhu separation RL, liquid-phase Hamler 16. 10 Posted on Authorea 12 Aug 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159724520.02458989 — This a preprint and has not been peer reviewed. Data may be preliminary. 1 kae ,Aoe K umnnH umnnV at ,GlmnA ta.Acmlt struc- complete A al. Epub et 2007;46(5):1228-39. A, Biochemistry. Goldman 17260952. R, pyrophosphatase. PMID: Lahti yeast PubMed V, of 10.1021/bi0619977. Tuominen cycle doi: for H, catalytic basis 2007/01/31. Tuominen the structural of AK, The description Ahonen A. 8994974. tural E, Goldman PMID: Oksanen BS, PubMed Cooperman 1996/12/15. 41. R, Epub Lahti 1996;4(12):1491-508. A, Structure. Baykov J, catalysis. pyrophosphatase Lehtonen P, 10.1006/jmbi.2001.5149. Heikinheimo doi: 40. 2002/02/16. Epub doi: 2001;314(3):633-45. 11846572. their of Re- and structures PMID: Biol. resolution The PubMed Mol atomic 2007/01/02. al. at J et CaPP(i) al. Epub KM, or implications. Polyakov Ca(2+) inter- VS, et mechanistic with Lamzin complexed NN, catalytic Vorobyeva pyrophosphatase SA, 2007;366(4):1305-17. EV, inorganic coli Rodina Kurilova trapped Escherichia AN, Popov AN, Biol. VR, Samygina fluoride: Popov Mol 39. by J NN, 17196979. Vorobyeva pyrophosphatase PMID: EV, inorganic PubMed studies. 10.1016/j.jmb.2006.11.082. cryo-crystallographic Rodina coli in Escherichia VM, mediates of Moiseev inhibition VR, versible Samygina 7827037. Biochemistry. PMID: function catalysis? PubMed and to Structure 38. key 10.1021/bi00003a011. the al. ion doi: et hydroxide J, 1995/01/24. a Heinonen is Epub A, pyrophosphatase: Goldman 1995;34(3):782-91. inorganic J, coli Kankare P, Escherichia PMID: Heikinheimo of of PubMed J, analysis Discovery Kapyla T, OV. 10.1021/acschembio.6b00510. Salminen ACS Tsodikov 37. doi: S, tuberculosis. Garneau-Tsodikova 2016/09/14. Mycobacterium Epub TJ, from Pyrophosphatase McQuade 27622287. 2016;11(11):3084-92. Inorganic MJ, of Biol. Larsen Inhibitors Chem A, inhibition Med Selective Bisphosphonate Garzan J and 16162013. AH, al. Allosteric PMID: pyrophosphatase. Pang et PubMed vacuolar E, 10.1021/jm058220g. soluble Broderick 36. brucei doi: Z, 10.1016/j.bmc.2013.11.011. Trypanosoma Tovian 2005/09/16. the Epub S, Faelens of doi: 2005;48(19):6128-39. 3-(3-aryl- JM, activity Chem. of Chan exopolyphosphatase Synthesis 2013/12/10. Y, the Song Epub of al. E, et Kotsikorou MI, 2014;22(1):406-18. PMCPMC3914758. 35. PMCID: Hamed pyrophos- Central A, inorganic PubMed Chem. Ghafoor 24315189; inhibit Med PMID: MN, also PubMed Bioorg Seleem cell and KL, cancer activity PubMed Molland antibacterial the phatase. B, 10.1155/2013/639401. have of Banerjee that regulators doi: W, pyrrolidin-1-yl)-5-aryl-1,2,4-triazines as Lv 2013/06/14. compounds Epub Natural 34. PMCPMC3670510. M. 2013;2013:639401. PMCID: Diederich Central Biol. PubMed M, Cell 23762063; Dicato PMID: J F, Int Radogna 10.1007/s00726-016- profiling C, metabolism. Proteomic doi: Cerella PMCPMC4875942. al. 2016/03/08. PMCID: 33. Central et Epub laryngeal PubMed R, in 2016;48(6):1469-76. 26948660; metastasis Grenman PMID: of A, Acids. PubMed biomarker Marszalek Amino potential 2201-8. L, a carcinoma. as Szylberg cell protein K, (PPA1) squamous Bednarek pyrophosphatase ovarian inorganic M, epithelial the Luczak human identifies PMCID: M, inhibits Central PPA1 Bodnar PubMed Silencing 32. 29100310; al. PMID: et PubMed Z, Ye 10.18632/oncotarget.19346. W, PMCPMC5652704. 2017;8(44):76266-78. Shen doi: Oncotarget. Z, pathway. 2017/11/05. Yin signaling Epub Wnt/beta-catenin Y, Poor the Xu suppressing with by W, metastasis Correlates Zhou cancer (PPA1) H, 2017;241(2):165-73. Pyrophosphatase Niu Inorganic medicine. 31. experimental of 28202851. of Expression PMID: journal Q. PubMed Tohoku Wang The 10.1620/tjem.241.165. Z, Cancer. doi: Li Ovarian PMCID: Epithelial N, of Central Xiao Prognosis PubMed H, 29740496; Li PMID: recurrence 30. PubMed future with 10.3892/ol.2018.8278. 2018;15(5):8095- associated is Lett. doi: expression Oncol PMCPMC5934715. 1 2018/05/10. cholangiocarcinoma. Pyrophosphatase intrahepatic Epub G. with Yu patients J, 101. Chinese Wang in X, survival Gu overall Y, and Miao D, Xu 29. 11 Posted on Authorea 12 Aug 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159724520.02458989 — This a preprint and has not been peer reviewed. Data may be preliminary. 4 dm D fnn V ukciG hnV,Ehl ,HadJ,e l h hnxsfwr for software Phenix The al. 2011/08/09. PMC3193589. et Epub PMCID: JJ, Central Headd 2011;55(1):94-106. PubMed N, 21821126; Echols PMID: Methods. VB, PubMed Chen structures. 10.1016/j.ymeth.2011.07.005. G, macromolecular doi: Bunkoczi of PMID: PV, determination PubMed Afonine automated PD, 10.1107/s0907444903028956. Adams Biol D doi: 54. Crystallogr Acta 2004/03/03. functions. Epub rotation fast 14993666. 3):432-8. Likelihood-enhanced RJ. 2004;60(Pt Read AJ, Crystallogr. McCoy LC, PMCID: Storoni interface Central 53. graphical PubMed new 21460445; 4):271-81. a PMID: 2011;67(Pt PubMed iMOSFLM: Crystallogr. AG. Biol 10.1107/s0907444910048675. PMC3069742. Leslie D doi: Crystallogr HR, novel Acta Powell 2011/04/05. a MOSFLM. O, Epub with HaloTag: Johnson Epub processing L, diffraction-image al. 2008;3(6):373-82. Kontogiannis for et TG, Biol. C, Battye Chem Zimprich ACS 18533659. 52. N, PMID: analysis. PubMed Karassina protein DD, 10.1021/cb800025k. and imaging Hartzell doi: cell MG, 2008/06/07. for McDougall 26494625; technology LP, labeling PMID: Encell and protein GV, PubMed Structural Los al. 10.1074/jbc.M115.674176. 51. et M, doi: PMCPMC4683271. Yogavel Chem. Biol PMCID: H, J Central 2015/10/24. Belrhali PubMed brucei. brucei C, Epub Trypanosoma Venien-Bryan Pathogen from L, 1 2015;290(51):30498-513. Bannwarth Protein Soluble AR, Vacuolar of and Round Highlights Functional PubMed Structural A, Jamwal 10.1016/j.jsb.2015.08.010. al. doi: et 50. GA, 2015/08/25. Epub Cisneros Mycobacterium from S, 2015;192(1):76-87. pyrophosphatase 26296329. Barnard-Britson inorganic Biol. PMID: T, the Struct of Biswas J mechanism AH, catalytic tuberculosis. Pang the SW, of doi: dissection Characterization Dewage computational Biochemical AC, 2017/07/14. and Pratt Epub PMCPMC5507929. Structural PMCID: 49. 2017;7(1):5255. Central A. PubMed Sharma reports. 28701714; SK, PMID: Scientific Jain PubMed MZ, Pyrophosphatases. 10.1038/s41598-017-05234-y. Abdin Inorganic hyperthermophilic M, Apicomplexan PMCID: the Yogavel of Central of A, structure Jamwal PubMed Crystal 14695284; 48. al. PMID: et PubMed Y, Epub Liu 1):420-7. 10.1016/s0006-3495(04)74118-1. Pt H, PMCPMC1303807. 2004;86(1 Pang J. doi: Biophys W, Zhou horikoshii. 2003/12/26. Pyrococcus R, doi: archaeon Gao the from M, 1994/07/01. pyrophosphatase Bartlam inorganic Epub B, inorganic PMCPMC2142889. Liu of PMCID: 1994;3(7):1098-107. structure 47. Central Crystal PubMed al. Sci. 7920256; et Protein T, PMID: Samejima PubMed H, thermophilus. 10.1002/pro.5560030713. Kaji K, Thermus Ishii from KS, 11248042; Wilson pyrophosphatase PMID: G, Obmolova PubMed A, Teplyakov a 10.1073/pnas.061612498. elec- Toward 46. doi: The al. 2001/03/15. Acad PMCPMC30617. et Epub Natl PMCID: AA, Central Baykov Proc al. 2001;98(6):3121-6. PubMed BS, pyrophosphatase. A. et in Cooperman S transfer R, U A, Teplyakov phosphoryl Sci Lahti AK, metal-assisted Ahonen of Chem. A, description V, Biol quantum-mechanical Tuominen Goldman J 11279052. P, PMID: pyrophosphatase. AS, Heikinheimo PubMed yeast Shestakov 45. of 10.1074/jbc.M100343200. mechanism VN, doi: catalytic the 2001/03/30. Kasho in Epub P, phosphates 2001;276(21):17629-34. group Pohjanjoki leaving AB, and trophilic Zyryanov 11031269. PMID: Chem. PubMed Biol J 44. 10.1074/jbc.M007360200. essential measurements. doi: Probing inhibition fluoride 2000/10/14. al. and et Epub Saccha- mutagenesis AA, Baykov directed 2001;276(1):434-41. of A, by Goldman pyrophosphatase kinetics BS, yeast Cooperman in Single-turnover VN, water Kasho BS. IP, Fabrichniy P, Pohjanjoki Cooperman 43. doi: R, 2002/10/03. Lahti 12356302. Epub PMID: A, 2002;41(40):12025-31. PubMed Goldman Biochemistry. 10.1021/bi026018z. AA, pyrophosphatase. inorganic Baykov cerevisiae P, romyces Halonen 42. 12 Posted on Authorea 12 Aug 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159724520.02458989 — This a preprint and has not been peer reviewed. Data may be preliminary. al .Dt olcinadrfieetstatistics. refinement PMID: and PubMed collection Data to 1998/04/30. 1. inflammation Table Epub (JNK)–from kinase 1998;10(2):205-19. N-terminal c-Jun Tables biology. the cell by in transduction opinion Signal 9561845. inorganic RJ. Current of Davis Upregulation YT, development. 25748422. al. 2015;128:94- Ip PMID: et Sci. PubMed H, Life 62. 10.1016/j.lfs.2015.02.019. Nishigori cerebellum. chick J, doi: embryonic 10.1016/s0092- Yamauchi hypothyroid 2015/03/10. K, in Epub doi: Kagami phosphatase 100. JNK Y, a ki- Inomata 1997/09/23. as N, MAP 1 Epub pyrophosphatase Herai the Y, of Tezuka 1997;90(5):859-69. mechanism 61. Activation Cell. EJ. 9298898. Goldsmith PMID: phosphorylation. MH, PubMed dual Cobb 8674(00)80351-7. scoring by A, new ERK2 Khokhlatchev a nase BJ, with PMCPMC3041641. docking PMCID: Canagarajah Central of PubMed 2009/06/06. accuracy 60. Epub 19499576; and PMID: 2010;31(2):455-61. speed PubMed Chem. the Comput 10.1002/jcc.21334. improving of J doi: diagrams Vina: multithreading. and schematic AutoDock optimization, 7630882. generate AJ. efficient PMID: function, Olson to PubMed O, program and Trott 1995/02/01. a search Epub 59. LIGPLOT: EMBL-EBI 1995;8(2):127-34. JM. The Eng. Thornton doi: Protein al. RA, interactions. 2019/04/13. Laskowski et protein-ligand Epub AC, N, Wallace PMCPMC6602479. 2019;47(W1):W636-w41. Madhusoodanan PMCID: T, Res. 58. Central Acids Gur PubMed Nucleic 30976793; N, PMID: Buso 2019. PubMed J, in 10.1093/nar/gkz268. APIs Lee Epub tools YM, 2004;25(13):1605-12. analysis Park sequence Chimera–a F, Chem. UCSF Madeira Comput al. 15264254. J et 57. PMID: EC, PubMed analysis. Meng 10.1002/jcc.20084. DM, and Greenblatt doi: research GS, Crystallogr exploratory 2004/07/21. Couch CC, for Acta Huang system TD, PubMed Coot. visualization Goddard of 10.1107/s0907444910007493. EF, development Pettersen doi: and 56. PMC2852313. Features 2010/04/13. PMCID: Epub K. Central Cowtan PubMed 4):486-501. 20383002; WG, 2010;66(Pt PMID: Scott Crystallogr. B, Biol Lohkamp D P, Emsley 55. < R utpiiy4.5 N/A ( Resolution Refinement N/A multiplicity Anomalous (%) completeness Anomalous Multiplicity CC 60418 (%) Completeness reflections unique of No. ( Resolution 21 21 P21 γ β α Native ( c ( b ( a parameters Unit-cell group Space collection Data ( merge I/ ( ( ° 216.44 = c ) A ˚ ° ° 50.27 = a ) A ˚ 90 ) 137.04 = b ) A ˚ 1/2 90 90 ) ) σ (I) (%) > b 84.94–2.39 ) A ˚ 84.94–2.39 ) A ˚ a 13 11.8 (98.9) 99.9 0.99 8.1 Posted on Authorea 12 Aug 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159724520.02458989 — This a preprint and has not been peer reviewed. Data may be preliminary. Figures refinement. from excluded were which (6%) respectively. factors structure c ofreflection b a R ausi aetee r o h ihs-eouinshell highest-resolution the for are parentheses in Values R work merge = = Σ hkl Σ hkl hkl — . | Σ F i | I obs i ( | hkl - | F - ) calc R free < | ules()0.7 0 96.6 (%) Outliers (%) Favored plot Ramachandran ae 38.6 39.19 526 1135 ( angles R.m.s.d., ( bonds R.m.s.d., Water Protein ( factors NativeB Water Protein atoms of No. collection Data o frflcin 60418 R reflections of No. I / — work scluae sfor as calculated is ( hkl /R Σ hkl ) free > | F A ˚ +(%) ++ | obs 2 / ) Σ | hkl 0.008 ) A ˚ where , ° 1.248 ) c Σ 14 R i I i work ( hkl F obs u nyuearnol eetdsbe fdata of subset selected randomly a use only but ,where ), and 19.3/25.1 F < calc I ( r h bevdadcalculated and observed the are hkl ) > steaeaeintensity average the is Posted on Authorea 12 Aug 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159724520.02458989 — This a preprint and has not been peer reviewed. Data may be preliminary. o aayi nteyatPaeaeidctdb le rage h euneof sequence The triangle. shown). filled (not a residues by 76 indicated of are extension PPase N-terminal yeast a the letter italic in red structures. catalysis a for with known indicated with are with dimerization PPases PPA1 sequence, PPA1 human eukaryotic the above of indicated 3 are PPA1 alignment human in Sequence present structures 1. Figure 10 ei,and helix, β tadrsetvl.Nmeigi o h ua P1sqec.Rsde novdi human in involved Residues sequence. PPA1 human the for is Numbering respectively. strand 15 i bv h eune ciest eiusimportant residues site Active sequence. the above .falciparum P. ,η, α, and h secondary The β for Ps has PPase α helix, Posted on Authorea 12 Aug 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159724520.02458989 — This a preprint and has not been peer reviewed. Data may be preliminary. ooiei tutrs h ufc ra r ooe codn oeetottcptnil,fo lefor blue PPA1 regions. from negative human most potentials, the the electrostatic of for to red representation according monomers to two surface colored white, The Electrostatic to are angles. positive, areas D) PDB viewing most surface (blue, different the The respectively. PPase two yeast magenta in structures. PPA1 and and human homodimeric (magenta) cyan of PPA1 structure colored human dimeric of are The structures C) monomeric 1E6A). the code protein. PPA1 of human the Superimposition of B) structure Overall 2. Figure 16 )Tesnl oanmnmrcstructure. monomeric domain single The A) Posted on Authorea 12 Aug 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159724520.02458989 — This a preprint and has not been peer reviewed. Data may be preliminary. rtmrrnee ncronmd r hw nsik.Hdoe od r ersne sylo sticks. yellow as represented are the to bonds to hydrophilic, Hydrogen belonging residues spheres. most sticks. key as the the in shown of shown for are some are blue molecules for water side-chains mode dodger The Structured cartoon from hydrophobic. in according most scale, colored rendered the are Kyte-Doolittle protomer for areas red the surface orange on The to hydrophobicity respectively. white, mode acid interface. cartoon amino homodimerization and PPA1 to mode human surface the in of differently view rendered graphic A 4. Figure starbursts. as represented dimerization are PPA1 interactions Hydrophobic human angstrom). the in number in a interactions by indicated molecular is of atoms presentation Ligplot interface. 3. Figure yrgnbnsaedsgae ihgendse ie tedsac ewe h w heavy two the between distance (the lines dashed green with designated are bonds Hydrogen 17 h w rtmr are protomers two The Posted on Authorea 12 Aug 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159724520.02458989 — This a preprint and has not been peer reviewed. Data may be preliminary. ihntecneto eaetd 181-MMT hexapeptide a substrates of peptide context potential the 182-MT with pentapeptide within site a phosphothreonine. active of PPA1 a human context and the phosphotyrosine of a models containing Structural 6. Figure atoms. the of values factor B to pocket site according active colored The is B) atom surface PPase. by The yeast (colored in PPA1. mode residues stick of catalytic in surface site shown active the are the on side-chains to The corresponding residues yellow). for PPA1. in type) human mode of surface transparent site by active (rendered putative The 5. Figure p PY p ,i on tteatv ie )Apopohenn (p-T183), phosphothreonine A B) site. active the at bound is V, p PY 18 p ,i on tteatv ie h phosphorylated The site. active the at bound is V, )Teatv iewt oee pyrophosphate modeled a with site active The A) )Apopoyoie(-15,wti the within (p-Y185), phosphotyrosine A A) Posted on Authorea 12 Aug 2020 — The copyright holder is the author/funder. All rights reserved. No reuse without permission. — https://doi.org/10.22541/au.159724520.02458989 — This a preprint and has not been peer reviewed. Data may be preliminary. etdsaernee nsikmd n pc-ligmd ntetopnl ftefigures. the of panels two the in mode space-filling and mode stick in rendered are peptides 19