DOCSLIB.ORG

Analysis of Treatment Efficacy and Molecular and Cellular Outcomes In

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Analysis of Treatment Efficacy and Molecular and Cellular Outcomes In Analysis of Treatment Efficacy and Molecular and Cellular Outcomes in Mouse Models of Congenital Epilepsy and Intellectual Disability. Karagh Loring BSc. (Biomedical Science) Hons. Intellectual Disability Laboratory Primary Supervisor: A/Prof Cheryl Shoubridge External Supervisor: A/Prof Quenten Schwarz Thesis submitted for the degree of Doctor of Philosophy in Discipline of Paediatrics, Adelaide Medical School Faculty of Health and Medical Sciences The University of Adelaide 2020 2 Contents List of Tables .......................................................................................................................... 6 List of Figures ......................................................................................................................... 8 Abstract ................................................................................................................................. 11 Thesis Format ....................................................................................................................... 13 Thesis Declaration ................................................................................................................ 14 Acknowledgments ................................................................................................................ 15 List of Abbreviations ............................................................................................................ 18 Chapter One: The Aristaless-related homeobox gene: understanding its role in intellectual disability and seizures and the search for effective treatments ................................................. 20 1.1 Introduction ..................................................................................................................... 21 1.2 ARX & neurodevelopmental disorders ........................................................................... 22 1.2.1 The Aristaless-related homeobox gene .................................................................... 22 1.2.2 Mutations in ARX ..................................................................................................... 23 1.2.3 Expanded polyalanine tract mutations ..................................................................... 24 1.2.4 Current treatments for seizures in ARX patients ...................................................... 30 1.3 ARX & interneurons ....................................................................................................... 31 1.3.1 Interneuron function ................................................................................................ 31 1.3.2 Interneuron migration .............................................................................................. 32 1.3.3 Interneuron subtypes ................................................................................................ 35 1.3.4 ARX & interneuron migration and function ................................................................ 37 1.4 Arx mouse models ........................................................................................................... 45 1.4.1 Expanded polyalanine tract mutations ..................................................................... 45 1.4.2 Other Arx mouse models .......................................................................................... 50 1.4.3 Benefits and limitations of mouse models for research ........................................... 53 1.5 Exogenous steroids as a treatment for infantile spasms and seizures ............................. 55 1.6 Concluding remarks ........................................................................................................ 59 1.7 Project overview ............................................................................................................. 60 Chapter Two: Materials and Methods ...................................................................................... 62 2.1 General reagents ............................................................................................................. 63 2.2 Animals ........................................................................................................................... 63 2.2.1 Animal husbandry .................................................................................................... 63 2.2.2 Drug preparation and injections ............................................................................... 64 2.2.3 Genotyping ............................................................................................................... 66 2.2.4 Behavioural analyses ............................................................................................... 70 2.2.5 Seizure monitoring and analysis .............................................................................. 76 2.2.6 Animal dissections and tissue collection ................................................................. 77 2.2.7 Statistical analysis .................................................................................................... 77 3 2.3 Gene expression analysis ................................................................................................ 78 2.3.1 RNA extraction ........................................................................................................ 78 2.3.2 RNA sequencing ...................................................................................................... 78 2.3.3 RNA sequencing validation ..................................................................................... 79 2.3.4 Gene enrichment analysis ........................................................................................ 83 2.4 Immunofluorescence ....................................................................................................... 84 2.4.1 Tissue sectioning ..................................................................................................... 84 2.4.2 Immunofluorescence ................................................................................................ 84 2.4.3 Microscopy .............................................................................................................. 85 2.4.4 Interneuron analysis ................................................................................................. 85 2.4.5 Statistical analysis .................................................................................................... 85 Chapter Three: Short-term 17β-estradiol treatment alleviates the seizure phenotype but not behavioural outcomes in PA1 and PA2 mouse models. ........................................................... 87 3.1 Abstract ........................................................................................................................... 90 3.2 Introduction ..................................................................................................................... 91 3.3.1 Optimisation of drug preparation and injections ..................................................... 94 3.4 Results............................................................................................................................. 96 3.4.1 Estradiol treatment trial strategy .............................................................................. 96 3.4.2 Estradiol treatment reduces seizure frequency and severity in PA mutant mice. .... 98 3.4.3 Estradiol treatment does not improve mortality in PA mutant mice ..................... 104 3.4.4 Body and tissue weights are unaffected by estradiol in PA mutant mice .............. 107 3.4.5 Behavioural deficits are present in PA mutant mice prior to seizure onset, and do not improve with estradiol treatment. ............................................................................. 112 3.5 Discussion ..................................................................................................................... 133 3.5.1 Reproducibility of phenotypic outcomes in different mouse models .................... 133 3.5.2 Relating behavioural testing to patient phenotypes ............................................... 134 3.5.3 No change to the survival of mice with estradiol treatment .................................. 136 3.5.4 Behavioural deficits are present prior to seizure onset .......................................... 136 3.5.5 Estradiol and cognition and behaviour .................................................................. 138 3.5.6 Reproducibility of behaviour testing outcomes ..................................................... 139 3.5.7 Side effects of estradiol treatment ......................................................................... 142 3.6 Study outcomes ............................................................................................................. 143 Chapter Four: The deregulated transcriptome in PA1 and PA2 Arx mutant mice is not restored by early postnatal 17β-estradiol treatment. ............................................................................. 144 4.1 Abstract ......................................................................................................................... 146 4.2 Introduction ................................................................................................................... 147 4.3 Results........................................................................................................................... 150 4.3.1 PA1 and PA2 mice have a deregulated cortical
Load more

Recommended publications
  • Astrin-SKAP Complex Reconstitution Reveals Its Kinetochore
    RESEARCH ARTICLE Astrin-SKAP complex reconstitution reveals its kinetochore interaction with microtubule-bound Ndc80 David M Kern1,2, Julie K Monda1,2†, Kuan-Chung Su1†, Elizabeth M Wilson-Kubalek3, Iain M Cheeseman1,2* 1Whitehead Institute for Biomedical Research, Cambridge, United States; 2Department of Biology, Massachusetts Institute of Technology, Cambridge, United States; 3Department of Cell Biology, The Scripps Research Institute, La Jolla, United States Abstract Chromosome segregation requires robust interactions between the macromolecular kinetochore structure and dynamic microtubule polymers. A key outstanding question is how kinetochore-microtubule attachments are modulated to ensure that bi-oriented attachments are selectively stabilized and maintained. The Astrin-SKAP complex localizes preferentially to properly bi-oriented sister kinetochores, representing the final outer kinetochore component recruited prior to anaphase onset. Here, we reconstitute the 4-subunit Astrin-SKAP complex, including a novel MYCBP subunit. Our work demonstrates that the Astrin-SKAP complex contains separable kinetochore localization and microtubule binding domains. In addition, through cross-linking analysis in human cells and biochemical reconstitution, we show that the Astrin-SKAP complex binds synergistically to microtubules with the Ndc80 complex to form an integrated interface. We propose a model in which the Astrin-SKAP complex acts together with the Ndc80 complex to stabilize correctly formed kinetochore-microtubule interactions. *For correspondence: DOI: https://doi.org/10.7554/eLife.26866.001 [email protected] †These authors contributed equally to this work Introduction Competing interests: The The macromolecular kinetochore complex links chromosomes to dynamic microtubule polymers and authors declare that no harnesses the forces generated by microtubule growth and depolymerization to facilitate accurate competing interests exist.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Expression Gene Network Analyses Reveal Molecular Mechanisms And
    www.nature.com/scientificreports OPEN Diferential expression and co- expression gene network analyses reveal molecular mechanisms and candidate biomarkers involved in breast muscle myopathies in chicken Eva Pampouille1,2, Christelle Hennequet-Antier1, Christophe Praud1, Amélie Juanchich1, Aurélien Brionne1, Estelle Godet1, Thierry Bordeau1, Fréderic Fagnoul2, Elisabeth Le Bihan-Duval1 & Cécile Berri1* The broiler industry is facing an increasing prevalence of breast myopathies, such as white striping (WS) and wooden breast (WB), and the precise aetiology of these occurrences remains poorly understood. To progress our understanding of the structural changes and molecular pathways involved in these myopathies, a transcriptomic analysis was performed using an 8 × 60 K Agilent chicken microarray and histological study. The study used pectoralis major muscles from three groups: slow-growing animals (n = 8), fast-growing animals visually free from defects (n = 8), or severely afected by both WS and WB (n = 8). In addition, a weighted correlation network analysis was performed to investigate the relationship between modules of co-expressed genes and histological traits. Functional analysis suggested that selection for fast growing and breast meat yield has progressively led to conditions favouring metabolic shifts towards alternative catabolic pathways to produce energy, leading to an adaptive response to oxidative stress and the frst signs of infammatory, regeneration and fbrosis processes. All these processes are intensifed in muscles afected by severe myopathies, in which new mechanisms related to cellular defences and remodelling seem also activated. Furthermore, our study opens new perspectives for myopathy diagnosis by highlighting fne histological phenotypes and genes whose expression was strongly correlated with defects. Te poultry industry relies on the production of fast-growing chickens, which are slaughtered at high weights and intended for cutting and processing.
    [Show full text]
  • The Functional Profiles of Chicken Eggs Incubated Under
    THE FUNCTIONAL PROFILES OF CHICKEN EGGS INCUBATED UNDER MONOCHROMATIC LIGHTING A Dissertation by MOHAMED MAGDY ABDELFATTAH IBRAHIM Submitted to the Office of Graduate and Professional Studies of Texas A&M University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Chair of Committee, Giridhar Athrey Committee Members, John B. Carey Luc R. Berghman Gregory S. Archer Head of Department, Audrey McElroy May 2021 Major Subject: Poultry Science Copyright 2021 Mohamed Magdy Abdelfattah Ibrahim ABSTRACT Poultry production remains susceptible to significant infectious disease threats such as Avian Flu, and Newcastle Disease Virus (NDV), which threaten the supply of poultry production. My dissertation research addresses this challenge by leveraging avian circadian biology to improve responses to vaccines to enhance poultry performance. The central hypothesis is that specific visible light wavelengths would enhance circadian rhythm development in ovo, leading to improved immune responses. I addressed an essential question regarding the effect of providing photoperiods with different wavelengths (Blue, Green, and White) on circadian rhythm development and its interplay with the immune response following the NDV challenge in chick embryos using the RNAseq technology. Our results showed that incubating chicken embryos under blue light 450nm was most efficient in entraining the circadian rhythm in lung tissue, compared to white light or dark treatment. Blue light showed a specific impact on skeletal muscle, regulation of striated muscle contraction, Glycerolipid metabolism, and development of neurons. The white light incubation led to a photo-acceleration stimulant effect on epidermal growth factor receptor signaling pathway, ErbB signaling pathway, MAPK signaling pathway, and Insulin signaling pathway were upregulated in white light non-challenged treatment.
    [Show full text]
  • Entrez Symbols Name Termid Termdesc 117553 Uba3,Ube1c
    Entrez Symbols Name TermID TermDesc 117553 Uba3,Ube1c ubiquitin-like modifier activating enzyme 3 GO:0016881 acid-amino acid ligase activity 299002 G2e3,RGD1310263 G2/M-phase specific E3 ubiquitin ligase GO:0016881 acid-amino acid ligase activity 303614 RGD1310067,Smurf2 SMAD specific E3 ubiquitin protein ligase 2 GO:0016881 acid-amino acid ligase activity 308669 Herc2 hect domain and RLD 2 GO:0016881 acid-amino acid ligase activity 309331 Uhrf2 ubiquitin-like with PHD and ring finger domains 2 GO:0016881 acid-amino acid ligase activity 316395 Hecw2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 GO:0016881 acid-amino acid ligase activity 361866 Hace1 HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 GO:0016881 acid-amino acid ligase activity 117029 Ccr5,Ckr5,Cmkbr5 chemokine (C-C motif) receptor 5 GO:0003779 actin binding 117538 Waspip,Wip,Wipf1 WAS/WASL interacting protein family, member 1 GO:0003779 actin binding 117557 TM30nm,Tpm3,Tpm5 tropomyosin 3, gamma GO:0003779 actin binding 24779 MGC93554,Slc4a1 solute carrier family 4 (anion exchanger), member 1 GO:0003779 actin binding 24851 Alpha-tm,Tma2,Tmsa,Tpm1 tropomyosin 1, alpha GO:0003779 actin binding 25132 Myo5b,Myr6 myosin Vb GO:0003779 actin binding 25152 Map1a,Mtap1a microtubule-associated protein 1A GO:0003779 actin binding 25230 Add3 adducin 3 (gamma) GO:0003779 actin binding 25386 AQP-2,Aqp2,MGC156502,aquaporin-2aquaporin 2 (collecting duct) GO:0003779 actin binding 25484 MYR5,Myo1e,Myr3 myosin IE GO:0003779 actin binding 25576 14-3-3e1,MGC93547,Ywhah
    [Show full text]
  • Stelios Pavlidis3, Matthew Loza3, Fred Baribaud3, Anthony
    Supplementary Data Th2 and non-Th2 molecular phenotypes of asthma using sputum transcriptomics in UBIOPRED Chih-Hsi Scott Kuo1.2, Stelios Pavlidis3, Matthew Loza3, Fred Baribaud3, Anthony Rowe3, Iaonnis Pandis2, Ana Sousa4, Julie Corfield5, Ratko Djukanovic6, Rene 7 7 8 2 1† Lutter , Peter J. Sterk , Charles Auffray , Yike Guo , Ian M. Adcock & Kian Fan 1†* # Chung on behalf of the U-BIOPRED consortium project team 1Airways Disease, National Heart & Lung Institute, Imperial College London, & Biomedical Research Unit, Biomedical Research Unit, Royal Brompton & Harefield NHS Trust, London, United Kingdom; 2Department of Computing & Data Science Institute, Imperial College London, United Kingdom; 3Janssen Research and Development, High Wycombe, Buckinghamshire, United Kingdom; 4Respiratory Therapeutic Unit, GSK, Stockley Park, United Kingdom; 5AstraZeneca R&D Molndal, Sweden and Areteva R&D, Nottingham, United Kingdom; 6Faculty of Medicine, Southampton University, Southampton, United Kingdom; 7Faculty of Medicine, University of Amsterdam, Amsterdam, Netherlands; 8European Institute for Systems Biology and Medicine, CNRS-ENS-UCBL, Université de Lyon, France. †Contributed equally #Consortium project team members are listed under Supplementary 1 Materials *To whom correspondence should be addressed: [email protected] 2 List of the U-BIOPRED Consortium project team members Uruj Hoda & Christos Rossios, Airways Disease, National Heart & Lung Institute, Imperial College London, UK & Biomedical Research Unit, Biomedical Research Unit, Royal
    [Show full text]
  • Product Data Sheet
    Product Data Sheet ExProfileTM Human AMPK Signaling Related Gene qPCR Array For focused group profiling of human AMPK signaling genes expression Cat. No. QG004-A (4 x 96-well plate, Format A) Cat. No. QG004-B (4 x 96-well plate, Format B) Cat. No. QG004-C (4 x 96-well plate, Format C) Cat. No. QG004-D (4 x 96-well plate, Format D) Cat. No. QG004-E (4 x 96-well plate, Format E) Plates available individually or as a set of 6. Each set contains 336 unique gene primer pairs deposited in one 96-well plate. Introduction The ExProfile human AMPK signaling related gene qPCR array profiles the expression of 336 human genes related to AMPK-mediated signal transduction. These genes are carefully chosen for their close pathway correlation based on a thorough literature search of peer-reviewed publications, mainly including genes that encode AMP-activated protein kinase complex，its regulators and targets involved in many important biological processes, such as glucose uptake, β-oxidation of fatty acids and modulation of insulin secretion. This array allows researchers to study the pathway-related genes to gain understanding of their roles in the different biological processes. QG004 plate 01: 84 unique gene PCR primer pairs QG004 plate 02: 84 unique gene PCR primer pairs QG004 plate 03: 84 unique gene PCR primer pairs QG004 plate 04: 84 unique gene PCR primer pairs Shipping and storage condition Shipped at room temperate Stable for at least 6 months when stored at -20°C Array format GeneCopoeia provides five qPCR array formats (A, B, C, D, and E) suitable for use with the following real- time cyclers.
    [Show full text]
  • Myosin Vb Mediates Cu+ Export in Polarized Hepatocytes Arnab Gupta1,*,‡, Michael J
    © 2016. Published by The Company of Biologists Ltd | Journal of Cell Science (2016) 129, 1179-1189 doi:10.1242/jcs.175307 RESEARCH ARTICLE Myosin Vb mediates Cu+ export in polarized hepatocytes Arnab Gupta1,*,‡, Michael J. Schell1, Ashima Bhattacharjee2, Svetlana Lutsenko2 and Ann L. Hubbard1 ABSTRACT myosin Vc (MYO5C; hereafter referred to as MyoVa and The cellular machinery responsible for Cu+-stimulated delivery of the MyoVc, respectively) are not highly expressed. Mutations in the MYO5B Wilson-disease-associated protein ATP7B to the apical domain of human gene lead to microvillus inclusion disease hepatocytes is poorly understood. We demonstrate that myosin Vb (MVID), in which the filamentous actin (F-actin)-rich apical regulates the Cu+-stimulated delivery of ATP7B to the apical domain microvilli of enterocytes are absent, with concomitantly of polarized hepatic cells, and that disruption of the ATP7B-myosin Vb disrupted localization of apical membrane proteins that include interaction reduces the apical surface expression of ATP7B. P-type ATPases (Knowles et al., 2014; Müller et al., 2008). The Overexpression of the myosin Vb tail, which competes for binding apical microvilli of hepatocytes are also disrupted in MVID, and of subapical cargos to myosin Vb bound to subapical actin, disrupted clinically MVID is associated with diarrhea and cholestasis the surface expression of ATP7B, leading to reduced cellular Cu+ (Girard et al., 2014; Knowles et al., 2014; Thoeni et al., 2014). export. The myosin-Vb-dependent targeting step occurred in parallel The cholestasis may be explained as a complication secondary to with hepatocyte-like polarity. If the myosin Vb tail was expressed hyperalimentation therapy.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Sodium Pumps Mediate Activity-Dependent Changes in Mammalian Motor Networks
    906 • The Journal of Neuroscience, January 25, 2017 • 37(4):906–921 Systems/Circuits Sodium Pumps Mediate Activity-Dependent Changes in Mammalian Motor Networks X Laurence D. Picton, XFilipe Nascimento, XMatthew J. Broadhead, XKeith T. Sillar, and XGareth B. Miles School of Psychology and Neuroscience, University of St Andrews, St Andrews KY16 9JP, United Kingdom Ubiquitously expressed sodium pumps are best known for maintaining the ionic gradients and resting membrane potential required for generating action potentials. However, activity- and state-dependent changes in pump activity can also influence neuronal firing and regulate rhythmic network output. Here we demonstrate that changes in sodium pump activity regulate locomotor networks in the spinal cord of neonatal mice. The sodium pump inhibitor, ouabain, increased the frequency and decreased the amplitude of drug-induced locomotor bursting, effects that were dependent on the presence of the neuromodulator dopamine. Conversely, activating the pump with the sodium ionophore monensin decreased burst frequency. When more “natural” locomotor output was evoked using dorsal-root stimulation, ouabain increased burst frequency and extended locomotor episode duration, whereas monensin slowed and shortened episodes. Decreasing the time between dorsal-root stimulation, and therefore interepisode interval, also shortened and slowed activity, suggesting that pump activity encodes information about past network output and contributes to feedforward control of subsequent locomotor bouts. Using whole-cell patch-clamp recordings from spinal motoneurons and interneurons, we describe a long-duration (ϳ60 s), activity-dependent, TTX- and ouabain-sensitive, hyperpolarization (ϳ5 mV), which is mediated by spike-dependent increases in pump activity. The duration of this dynamic pump potential is enhanced by dopamine.
    [Show full text]
  • Atrazine and Cell Death Symbol Synonym(S)
    Supplementary Table S1: Atrazine and Cell Death Symbol Synonym(s) Entrez Gene Name Location Family AR AIS, Andr, androgen receptor androgen receptor Nucleus ligand- dependent nuclear receptor atrazine 1,3,5-triazine-2,4-diamine Other chemical toxicant beta-estradiol (8R,9S,13S,14S,17S)-13-methyl- Other chemical - 6,7,8,9,11,12,14,15,16,17- endogenous decahydrocyclopenta[a]phenanthrene- mammalian 3,17-diol CGB (includes beta HCG5, CGB3, CGB5, CGB7, chorionic gonadotropin, beta Extracellular other others) CGB8, chorionic gonadotropin polypeptide Space CLEC11A AW457320, C-type lectin domain C-type lectin domain family 11, Extracellular growth factor family 11, member A, STEM CELL member A Space GROWTH FACTOR CYP11A1 CHOLESTEROL SIDE-CHAIN cytochrome P450, family 11, Cytoplasm enzyme CLEAVAGE ENZYME subfamily A, polypeptide 1 CYP19A1 Ar, ArKO, ARO, ARO1, Aromatase cytochrome P450, family 19, Cytoplasm enzyme subfamily A, polypeptide 1 ESR1 AA420328, Alpha estrogen receptor,(α) estrogen receptor 1 Nucleus ligand- dependent nuclear receptor estrogen C18 steroids, oestrogen Other chemical drug estrogen receptor ER, ESR, ESR1/2, esr1/esr2 Nucleus group estrone (8R,9S,13S,14S)-3-hydroxy-13-methyl- Other chemical - 7,8,9,11,12,14,15,16-octahydro-6H- endogenous cyclopenta[a]phenanthren-17-one mammalian G6PD BOS 25472, G28A, G6PD1, G6PDX, glucose-6-phosphate Cytoplasm enzyme Glucose-6-P Dehydrogenase dehydrogenase GATA4 ASD2, GATA binding protein 4, GATA binding protein 4 Nucleus transcription TACHD, TOF, VSD1 regulator GHRHR growth hormone releasing
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]