Ligand Through TNF-Related Apoptosis-Inducing Production in T

Home , Death receptor 4, OX40 ligand, Trail

Enhanced Proliferation and Increased IFN-␥ Production in T Cells by Signal Transduced Through TNF-Related Apoptosis-Inducing Ligand1

Ai-Hsiang Chou,2* Hwei-Fang Tsai,2* Ling-Li Lin,* Shie-Liang Hsieh,† Ping-I Hsu,‡ and Ping-Ning Hsu3*

TNF-related apoptosis-inducing ligand (TRAIL, also called Apo2L), a novel member of TNF superfamily, induces apoptosis in transformed cell lines of diverse origin. TRAIL is expressed in most of the cells, and the expression is up-regulated in activated T cells. Four receptors for TRAIL have been identiﬁed, and there is complex interplay between TRAIL and TRAIL receptors in vivo. The actual biological function of TRAIL/TRAIL receptor is still not clear. Growing evidence has demonstrated that members of TNF superfamily transduce signals after engagement with their receptors. Cross-linking of TRAIL by plate-bound rTRAIL receptor, death receptor 4-Fc fusion protein enhanced T cell proliferation and increased IFN-␥ production in conjunction with immobilized suboptimal anti-CD3 stimulation in mouse splenocytes. The increase of T cell proliferation by death receptor 4-Fc was dose dependent, and this effect could be blocked by soluble rTRAIL proteins, indicating the occurrence of reverse signaling through TRAIL on T cell. The enhanced secretion of IFN-␥ mediated via TRAIL could be blocked by SB203580, a p38 mitogen- activated protein kinase-speciﬁc inhibitor. Thus, in addition to its role in inducing apoptosis by binding to the death receptors, TRAIL itself can enhance T cell proliferation after TCR engagement and signal the augmentation of IFN-␥ secretion via a p38-dependent pathway. This provides another example of reverse signaling by a member of TNF superfamily. In conclusion, our data suggest that TRAIL can itself transduce a reverse signal, and this may shed light on the biological function of TRAIL. The Journal of Immunology, 2001, 167: 1347–1352.

he TNF family of cytokines includes physiological death cated death domain DcR2/TRAIL-R4 lack functional death do- factors and influences a variety of immunological func- mains and are unable to activate apoptosis (7, 9, 11–13). Further- tions, such as cell activation and death (1). TNF and Fas more, it has been shown that these two inhibitory receptors could T 4 ligand (L) have received the most intense study, and were shown inhibit TRAIL-mediated apoptosis, and TRAIL-R3 and to participate in activation-induced cell death, immune privilege, TRAIL-R4 were suggested to act as decoy receptors to protect autoimmune disorders, and tumor evasion from the immune normal tissues from cell death (11–13), based on the selective ex- system (2–5). TNF-related apoptosis-inducing ligand (TRAIL; pression of TRAIL-R3 on normal tissue, but not in transformed APO-2L) is another family member of TNF superfamily that is cell lines, suggesting that TRAIL may be involved in tumor killing capable of inducing apoptosis (6). Four receptors for TRAIL have in vivo (7, 9). There is complex interplay between TRAIL and been identified. The ability to transduce death signals is restricted TRAIL receptors in TRAIL-induced apoptosis in vivo. So far, the to death receptor (DR)4/TRAIL-R1 and DR5/TRAIL-R2 (7–10). actual biological function of TRAIL/TRAIL receptor is still not In contrast, TRAIL receptor without an intracellular domain/decoy clear. receptor 1 (DcR1)/TRAIL-R3 and TRAIL receptor with a trun- TRAIL exists mainly in membrane-bound form, and its expression on T cells is induced after T cell activation by anti-CD3 or type I IFN (14). TRAIL and members of this ligand superfamily *Graduate Institute of Immunology, College of Medicine, National Taiwan Univer- primarily interact with their receptors by direct cell-cell contact sity, Taipei, Taiwan, Republic of China; †Department of Microbiology and Immu- nology, National Yang-Ming University, Taipei, Taiwan, Republic of China; and (15). This observation, coupled with the cross-species sequence ‡Department of Internal Medicine, Veterans General Hospital-Kaohsiung, Kaohsiung, conservation of the cytoplasmic domains of these ligands, has led Taiwan, Republic of China to the suggestion that signaling occurs in both directions for this Received for publication February 6, 2001. Accepted for publication June 1, 2001. family of ligand-receptor pairs (15). Recently, there is growing The costs of publication of this article were defrayed in part by the payment of page evidence that ligands of the TNF superfamily, such as CD40L charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. (CD154) (16–18), CD30L (19), CD27L (CD70) (20), FasL (21, 1 This work was supported by grants from the National Health Research Institute, 22), CD137L (23), OX40L (24), and TNF-related activation-in- Taiwan (NHRI-GI-EX89S942C), and National Taiwan University Hospital (NTUH duced cytokine (TRANCE) (25), also transduce signals after en- 89S2011). gagement with their receptors. It has been shown that reverse sig- 2 A.-H.C. and H.-F.T. contributed equally to this work. naling via CD40L is involved in a range of different immune 3 Address correspondence and reprint requests to Dr. Ping-Ning Hsu, Graduate In- processes, such as cytokine production, costimulation of T cell stitute of Immunology, College of Medicine, National Taiwan University, No. 1, Sec. 1, Jen-Ai Road, Taipei, Taiwan, Republic of China. E-mail address: phsu@ha. activation, and proper formation of germinal centers (17). Blair et mc.ntu.edu.tw al. (18) also demonstrated that CD40L could trigger short-term 4 Abbreviations used in this paper: L, ligand; CKI, casein kinase I; DcR, decoy re- CD4 T cell activation as well as mediating the secretion of immu- ceptor; DR, death receptor; MAPK, mitogen-activated protein kinase; TRAIL, TNF- related apoptosis-inducing ligand; TRANCE, TNF-related activation-induced nomodulatory cytokines and apoptosis. Cross-linking of OX40L cytokine. on CD40L-stimulated B cells results in a significantly enhanced

Copyright © 2001 by The American Association of Immunologists 0022-1767/01/$02.00 Downloaded from http://classic.jimmunol.org by guest on September 30, 2021. Copyright 2001 Pageant Media Ltd. 1348 REVERSE SIGNAL TRANSDUCED THROUGH TRAIL proliferative response of B cells and the down-regulation of the EDTA, 0.5% Nonidet P-40), and proteins were eluted by boiling for 5 min transcription factor B cell lineage-specific activator protein (24). In in SDS sampling buffer (100 mM Tris-HCl, pH 6.8, 4% SDS, 0.2% bro- addition, cross-linking of CD30L by a mAb or by CD30-Fc fusion mophenol blue, 20% glycerol), separated by 12% SDS-PAGE. The gel was then stained with Coomassie blue staining buffer (0.25% Coomassie blue, protein induced the production of IL-8 by freshly isolated neutro- 25% methanol, 10% acetic acid). phils (19). Recently, it has been further demonstrated that maximal proliferation of CTL requires reverse signaling through FasL (21, Mouse T cell isolation 22). Moreover, reverse signaling via CD27L/CD70 has been The BALB/c mice were maintained in the animal center at the National shown to induce a subset of leukemic B cells to proliferate vigor- Taiwan University Medical Center and were used between 8 and 12 wk of ously, an effect that is synergistically enhanced by ligation of age. All experiments were performed in accordance with our institutional guidelines. CD40, but inhibited by the presence of IL-4 (20). Meanwhile, ad- Mice were sacrificed by cervical dislocation, and total splenocytes were dition of CD137-Fc fusion protein induces a substantial degree of isolated and treated with RBC lysis solution (Sigma, St. Louis, MO), and proliferation in human peripheral monocytes (23). In a recent re- resuspended in RPMI 1640 medium supplemented with 10% heat-inacti- port, Chen further demonstrated that TRANCE enhanced IFN-␥ vated FCS. Adherent cells were removed by incubation with nylon wool, and the enriched T cells were isolated by passing through a nylon wool secretion in activated Th1 cells (25). These studies provide evi- column. The purity of T cells isolated was near 90% after checking with dence to demonstrate the importance of reverse signaling in acti- anti-CD3 staining in flow cytometry. vation of the immune system. It is interesting to know whether T cell proliferation assay bidirectional signaling might also occur in other members of TNFR superfamily. Therefore, we investigated the possible signal For assaying T cell proliferation with DR4 costimulation, isolated T cells ϫ 5 transduction via TRAIL after engagement with its receptor on T (2 10 cells/well) were cultured for 72 h in 96-well flat-bottom microtiter plates precoated with anti-murine CD3 (500 ng/ml, 2C11 clone) and cells. DR4-Fc recombinant protein (10 ␮g/ml). The cultures were pulsed with In this study, we report that cross-linking of TRAIL by plate- [3H]thymidine (1 ␮Ci/well) 18 h before harvesting the cells, and [3H]thy- bound DR4-Fc fusion protein enhanced T cell proliferation and midine incorporation was measured in a Microbeta Plus liquid scintillation increased IFN-␥ production in conjunction with immobilized sub- counter (Wallac, Gaithersburg, MD). Cultures were run in triplicate, and optimal anti-CD3 stimulation in activated T cells in a dose-depen- each experiment was repeated at least three times. dent manner. The effect of increased IFN-␥ production could be Cytokine assays blocked by SB203580, a p38 mitogen-activated protein kinase To trigger the activation of T cells via TRAIL, purified T cells (2 ϫ 105 (MAPK)-specific inhibitor. Thus, it appears that reverse signaling cells/well) were stimulated with suboptimal concentration of plate-bound is also occurring following the interaction of TRAIL and DR4. anti-CD3 mAb (500 ng/ml, 2C11) and DR4-Fc fusion protein (10 ␮g/ml) This provides yet another example of reverse signaling by a mem- or human IgG1 (10 ␮g/ml; Sigma) for 72 h in 96-well flat-bottom micro- ber of TNF superfamily. titer plates in the presence or absence of p38 MAPK inhibitor, SB203580. Cell culture supernatants were collected, and levels of IFN-␥ and IL-4 were quantified using commercial ELISA kits (Endogen, Woburn, MA), accord- Materials and Methods ing to the vendor’s instructions. For some experiments, after stimulation Expression and purification of soluble DR4-Fc and TRAIL with plate-bound anti-CD3 and DR4-Fc or human IgG1 for 72 h, the cells were rested on noncoated plate for 24 h, and the T cells were then restim- To generate soluble rDR4-Fc fusion molecule, the coding sequence for the ulated with plate-bound anti-CD3 mAb (500 ng/ml, 2C11), in conjunction extracellular domain of human DR4 was isolated by RT-PCR using the with immobilized DR4-Fc fusion protein (10 ␮g/ml) or human IgG1 (10 forward primer, CGGATTTCATGGCGCCACCACCA, and the reverse ␮g/ml; Sigma). Supernatants were separated from cells by centrifugation, primer, GAAGATCTATTATGTCCATTGCC. The amplified product was and cytokine content was determined by ELISA. ligated in-frame into BamHI-cut pUC19-IgG1-Fc vector containing the human IgG1 Fc coding sequence. The fusion gene was then subcloned into Results pBacPAK9 vector (Clontech, Palo Alto, CA). DR4-Fc fusion protein was Expression of TRAIL in mouse-activated T cells recovered from the filtered supernatants of the recombinant virus-infected Sf21 cells using protein G-Sepharose beads (Pharmacia, Piscataway, NJ). To study the expression of TRAIL on T cells, we constructed a The bound DR4-Fc protein was eluted with glycine buffer (pH 3) and soluble fusion protein containing the extracellular domain of hu- dialyzed into PBS. man DR4 and the Fc domain of human IgG1 and a soluble recom- The extracellular portion of the TRAIL molecule was subcloned into pRSET(B) His vector (Invitrogen, Groningen, The Netherlands) and ex- binant protein of TRAIL containing the extracellular domain of pressed in Escherichia coli. The purification of rHis-TRAIL fusion protein human TRAIL. The rDR4-Fc fusion protein was recovered from was performed by metal chelate column chromatography using Ni-NTA the filtered supernatants of the recombinant baculovirus virus-in- resin, according to the manufacturer’s recommendations (Qiagen, Hilden, fected Sf21 cells using protein G-Sepharose beads. The cultured Germany). supernatant of recombinant baculovirus was purified via the pro- Immunoblotting tein G column, and analyzed in SDS-PAGE electrophoresis. As shown in Fig. 1A, the purified rDR4-Fc protein was demonstrated For immunoblotting, proteins were boiled for 5 min in SDS sampling buffer (100 mM Tris-HCl, pH 6.8, 4% SDS, 0.2% bromophenol blue, 20% by immunoblotting using anti-human IgG1Fc as the primary Ab. glycerol), separated by 12% SDS-PAGE, and transferred to nitrocellulose To determine that the rDR4-Fc protein is able to interact with membrane. The membrane was blocked with 5% milk in TBS (10 mM TRAIL, an in vitro binding assay was used to demonstrate the Tris-HCl, pH 7.6, 150 mM NaCl), washed with TBST (10 mM Tris-HCl, binding between DR4-Fc and TRAIL. The results of the in vitro pH 7.4, 0.9% NaCl, 0.2% Tween 20), and incubated with the indicated Ab for2hatroom temperature. The mouse anti-human IgG1 Fc (Chemicon, binding of TRAIL to DR4-Fc were shown in Fig. 1B. The soluble Temecula, CA) was used as first Ab. Bound Ab was revealed with HRP- DR4-Fc protein was incubated with or without soluble rTRAIL, conjugated anti-mouse IgG (Pharmacia) using ECL (Amersham, Arlington and was then subjected for immunoprecipitation with protein A- Heights, IL). Sepharose beads. rTRAIL was coimmunoprecipitated with DR4- In vitro binding assay Fc, as shown in Fig. 1B, indicating that the purified DR4-Fc could bind to rTRAIL protein in vitro. We also tested the apoptosis- For the in vitro binding assay, 10 ␮g soluble rTRAIL with or without inducing ability of rTRAIL on an in vitro apoptosis system. As DR4-Fc was incubated for 1 h with agitation at 4°C. Protein A-Sepharose beads (30 ␮l; Pharmacia, Piscataway, NJ), swollen and washed, were shown in Fig. 1C, the rTRAIL protein induced apoptosis in added and incubated for 4 h with agitation at 4°C. The beads were washed TRAIL-susceptible target cells, Jurkat cells (6) in a dose-depen- five times in cold buffer (50 mM HEPES, pH 7, 150 mM NaCl, 1 mM dent manner (Fig. 1C). Moreover, the apoptosis induced in Jurkat Downloaded from http://classic.jimmunol.org by guest on September 30, 2021. Copyright 2001 Pageant Media Ltd. The Journal of Immunology 1349

cells by rTRAIL could be specifically blocked by DR4-Fc fusion protein (Fig. 1C), indicating that both recombinant TRAIL and DR4-Fc fusion protein are with function. To determine the expression of TRAIL on mouse-activated T cells, T cells isolated from mouse spleen were cultured in vitro, activated with anti-CD3 mAb for 48 h, and stained with DR4-Fc and detected by FITC-labeled anti-human IgG1Fc Ab in flow cytometry. The results in Fig. 1D demonstrated that rDR4-Fc fusion proteins bound to surface of activated mouse splenic T cells. A significant shift in TRAIL-associated fluorescence was observed at 48 h after stimulation in mouse T cells, but not in isotype control (Fig. 1D). The surface expression of TRAIL was in accordance with the expression of TRAIL mRNA in mouse-activated T cells in RT-PCR analysis (data not shown). The results indicated that mouse-activated T cells expressed TRAIL on their surface.

Cross-linking of TRAIL by plate-bound DR4-Fc enhanced proliferation of murine T cells activated by suboptimal anti-CD3 Proliferation assays using purified T cells from mouse splenocytes revealed that cross-linking of TRAIL by plate-bound DR4-Fc induced proliferation of murine T cells activated by immobilized suboptimal anti-CD3 (Fig. 2). The plates precoated with human IgG1 were used as controls. As shown in Fig. 2A, the proliferation of T cells was significantly enhanced by immobilized DR4-Fc compared with immobilized human IgG1. This effect is dependent on anti-CD3, because cell proliferation was not detected in the absence of anti-CD3 (Fig. 2A). This proliferation effect by plate- bound DR4-Fc was dose dependent, and higher concentration of the plate-bound DR4-Fc induced increased proliferation of preactivated murine T cells (Fig. 2B). We found that cross-linking of TRAIL alone had no effect on the T cell proliferation. In contrast, when both TCR and TRAIL were cross-linked by anti-CD3 mAb (500 ng/ml) and DR4-Fc (10 ␮g/ml), respectively, the proliferation of T cells was enhanced dramatically (Fig. 2A). To pinpoint TRAIL as the source of the proliferative signal, soluble rTRAIL protein was added to block cell surface TRAIL/DR4 interactions. A significant decrease in the proliferation of T cells to the back- ground level was observed upon the addition to the culture of soluble TRAIL (Fig. 2A). Soluble TRAIL alone did not affect the proliferation response on murine splenic T cells. To further ex- clude the possibility that the neutralizing effect of TRAIL could be FIGURE 1. Expression of TRAIL on T cell surface. A, Expression and due to its cytotoxic effect on T cells, thereby suppressing their purification of rDR4-Fc recombinant protein. The DR4-Fc recombinant proliferation directly, and to ensure that the proliferation effect is protein was expressed in baculovirus expression system, and the recombi- via interaction between DR4 and TRAIL, we used anti- nant protein was purified from culture supernatant using protein G-Sepha- DR4-specific Ab (polyclonal antiserum to DR4; Alexis Biochemi- rose beads. The purified DR4-Fc recombinant proteins were run on 12% cals, San Diego, CA) to block the interaction between immobilized SDS-PAGE, and transferred to nitrocellulose membrane. The membrane DR4-Fc and TRAIL on T cell surface. The results in Fig. 2C dem- was immunoblotted with mouse anti-human IgG1 Fc mAb as first Ab. onstrated that anti-DR4 Ab, like that of TRAIL, could neutralize Bound Ab was revealed with HRP-conjugated anti-mouse IgG using ECL. the stimulatory effect of immobilized DR4-Fc. The anti-DR4 Ab The DR4-Fc recombinant protein existed as a dimer with molecular mass alone did not affect the proliferation response on mouse T cells. of 116 kDa. B, Direct binding of DR4-Fc recombinant protein with These results indicated that cross-linking of TRAIL on T cell sur- rTRAIL in vitro. DR4-Fc (10 ␮g) was mixed with or without soluble rTRAIL (10 ␮g) and incubated for 4 h. The mixture was immunoprecipi- face by plate-bound DR4-Fc induced maximal proliferation of mu- tated with protein A beads. The proteins pulled down were separated by rine T cells in conjunction with suboptimal anti-CD3. Similar re- SDS-PAGE in 12% gel. Lane 1, Soluble TRAIL only. Lane 2, DR4-Fc sults were also observed when purified human T cells were used only. Lane 3, DR4- Fc ϩ soluble TRAIL. C, rTRAIL protein induced ap- (data not shown). optosis in Jurkat cells. Cultured human Jurkat cells were incubated with 0.2–1.5 ␮g/ml soluble rTRAIL protein in culture medium for 24 h. The TRAIL engagement increased production of IFN-␥ in murine- killing was assayed by propidium iodide (PI) staining and analyzed in flow activated T cells cytometry. For determining the specificity of killing by rTRAIL protein, soluble DR4-Fc fusion proteins (50 ␮g/ml) were added into the culture to We then investigated the role of TRAIL in IFN-␥ secretion during block the killing of Jurkat cells. D, Expression of TRAIL on mouse-acti- T cell activation. To address this question, T cells were stimulated vated T cells. Mouse T cells were stimulated with immobilized anti-CD3 with plate-bound suboptimal concentration of anti-CD3 mAb, mAb for 48 h. The activated T cells were stained with either human IgG1 2C11 (500 ng/ml), in the presence of either immobilized soluble (thin line) or DR4-Fc (bold line) and analyzed by flow cytometry. DR4-Fc fusion protein or control human IgG1. The supernatant Downloaded from http://classic.jimmunol.org by guest on September 30, 2021. Copyright 2001 Pageant Media Ltd. 1350 REVERSE SIGNAL TRANSDUCED THROUGH TRAIL

was collected, and the cytokines secreted by T cells were quantified by ELISA. The results in Fig. 3 demonstrated that secretion of IFN-␥ by T cells was significantly enhanced when TRAIL was cross-linked by immobilized DR4-Fc compared with human IgG1 (Fig. 3A). The IL-4 secretion was also enhanced by immobilized DR4-Fc in T cell activated by suboptimal CD3; however, the levels of IL-4 in the culture supernatant were not as significantly elevated compared with IFN-␥ (Fig. 3B). We found that cross-linking of TRAIL alone had no effect on the production of IFN-␥. In contrast, when both TCR and TRAIL were cross-linked by anti-CD3 mAb (500 ng/ml) and DR4-Fc (10 ␮g/ ml), respectively, the secretion of IFN-␥ was enhanced dramatically (Fig. 3A). We also tested whether the engagement of TRAIL by DR4-Fc was cumulative. To address this question, T cells were preactivated by plate-bound anti-CD3 mAb with or without plate- bound DR4-Fc in both the priming and restimulation stages. Among the four groups tested, we found that the highest level of IFN-␥ production was produced when T cells were cross-linked by anti-CD3 mAb and DR4-Fc fusion proteins in both the priming and restimulation stages. The levels of IFN-␥ produced, from highest to lowest, were DR4-Fc/DR4-Fc Ͼ DR4-Fc/IgG1 Ͼ IgG1/ DR4-Fc Ͼ IgG1/IgG1 (Fig. 3C). This observation suggested that engagement of TRAIL could transduce a costimulatory signal to enhance IFN-␥ secretion during both priming and restimulation.

p38 MAPK inhibitor SB203580 blocked the up-regulation of IFN-␥ secretion via TRAIL on activated T cells To understand the signaling pathway transduced by TRAIL, mouse T cells activated by plate-bound anti-CD3 mAb and DR4-Fc were incubated with SB203580, a p38 MAPK inhibitor. As shown in Fig. 4, the increased IFN-␥ secretion by immobilized DR4-Fc could be signiﬁcantly suppressed by SB203580 in a dose-dependent manner (Fig. 4). The results indicated that the p38 MAPK inhibitor SB203580 blocked the up-regulation of IFN-␥ secretion via TRAIL on activated T cells. This suggested that the engagement of TRAIL enhances the secretion of IFN-␥ and which was dependent on the activation of p38 MAPK.

Discussion Our study has demonstrated that triggering of TRAIL by immobilized DR4-Fc, in conjunction with immobilized suboptimal anti- CD3 mAb, induced maximal proliferation response and enhanced IFN-␥ secretion by activated T cells. In our results, the T cell costimulation effects induced by immobilized DR4-Fc were dose FIGURE 2. TRAIL engagement enhances T cell proliferation in conjunction dependent and could be specifically blocked by soluble TRAIL with suboptimal concentration of immobilized anti-CD3. A, The mouse T cells and anti-DR4 Ab. In contrast, these effects were not observed in were cultured in plates precoated with anti-mouse CD3 mAb (500 ng/ml) and immobilized human IgG1; therefore, our data indicated that these human IgG1 Fc (10 ␮g/ml) or DR4-Fc (10 ␮g/ml) in the presence or absence of effects might result from immobilized DR4-Fc acting directly on soluble rTRAIL protein (250 ␮g/ml), as indicated in the figure. The cultures were preactivated T cells’ surface, instead of acting indirectly via FcRs pulsed with [3H]thymidine (1 ␮Ci/well) 18 h before harvesting the cells, and on surface of macrophages or other APCs. Thus, the T cell pro- [3H]thymidine incorporation was measured. Statistical analysis by two-tailed Stu- liferation response and enhanced IFN-␥ production induced by im- dent’s t test revealed significant differences between immobilized human IgG1- or mobilized DR4-Fc in our assay system might result from the re- Ͻ ء DR4-Fc-treated samples ( , p 0.05). B, Purified mouse T cells from splenocytes verse signaling by TRAIL on T cells. When plate-bound DR4-FC were cultured for 72 h in 96-well flat-bottom microtiter plates precoated with fusion protein was used in conjunction with suboptimal amounts of anti-mouse CD3 mAb (500 ng/ml) and DR4-Fc recombinant protein (1–10 ␮g/ml) or human IgG1 (10 ␮g/ml). The cultures were pulsed with [3H]thymidine (1 ␮Ci/ anti-CD3, a costimulatory signal was delivered for proliferation by well) 18 h before harvesting the cells, and [3H]thymidine incorporation was mea- TRAIL to T cells. These data demonstrated that the source of this .p Ͻ 0.05). The results shown are representative of three independent positive signal is the TRAIL expressed on the T cells ,ء) sured experiments. C, The mouse T cells were cultured in plates precoated with anti- The role of TCR engagement in conjunction with the TRAIL mouse CD3 mAb (500 ng/ml) and human IgG1 Fc (10 ␮g/ml) or DR4-Fc (10 signal remains unclear. Other molecules known for their positive ␮g/ml) in the presence or absence of anti-DR4 Ab (15 ␮g/ml), as indicated in the signaling capabilities have recently been implicated in the death of figure. The cultures were pulsed with [3H]thymidine (1 ␮Ci/well) 18 h before cells in the absence of a concomitant Ag receptor signal. For ex- Ͻ ء 3 harvesting the cells, and [ H]thymidine incorporation was measured ( , p 0.05, ample, signaling through CD40 without concurrent engagement of when compared with immobilized human IgG1-treated samples). The results the B cell receptor leads to Fas-mediated cell death (26, 27), and shown are representative of three independent experiments. may serve an immunoregulatory role by removing nonspecific B Downloaded from http://classic.jimmunol.org by guest on September 30, 2021. Copyright 2001 Pageant Media Ltd. The Journal of Immunology 1351

FIGURE 4. Suppression of immobilized DR4-Fc enhanced IFN-␥ secretion by p38 MAPK inhibitor, SB203580. Mouse T cells puriﬁed from splenocytes were cultured with plate-bound anti-CD3 mAb plus human IgG1 (10 ␮g/ml) (ᮀ) or anti-CD3 mAb plus DR4-Fc (10 ␮g/ml) (■)inthe presence of 0–1 ␮M concentration of SB203580 for 3 days. Supernatant was harvested and assayed for their IFN-␥ production by ELISA.

discovery that CD40 signals can direct germinal center B cells to become memory B cells (28), one could speculate on the role of TRAIL in the clonal expansion of Ag-specific T cells and the generation of memory T cells. Although it is important to note that the molecules mediating these signals have yet to be identified, due to the short cytoplasmic domain of TRAIL, it has not been noticed that TRAIL might have the capability to transduce signal by itself. This implied that there might be other important intracellular molecules associated with TRAIL to transduce the signal. Even though the phenomenon of reverse signaling has been observed in several members of TNF superfamily, including CD40L/CD154, CD30L, CD27L/CD70, FasL, CD137L, OX40L, and TRANCE (16–25), the downstream signaling pathways after cross-linking of TNF and other members of TNF family have not been elucidated until recently. It has been reported that a casein kinase I (CKI) consensus sequence is con- served in the cytoplasmic domain of 6 of 15 members of the type II integral membrane TNF ligand family (29). Therefore, Watts et al. (29) speculated that the CKI motif might be also phosphory- lated in other TNF ligand family member. This represents a new insight into the mechanism of reverse signaling in this cytokine family. However, there is no CKI motif in the cytoplasmic region of TRAIL, and our study provides evidence that p38 MAPK is involved in reverse signaling via TRAIL. This raises the question as to whether MAPK signaling pathways are also initiated via other members of TNF superfamily. In a recent report, Chen et al. FIGURE 3. TRAIL engagement enhances IFN-␥ secretion by mouse T (25) also demonstrated that p38 MAPK was involved in reverse cells. A and B, Mouse T cells purified from splenocytes were cultured with signal through TRANCE. The presence of reverse signaling further plate-bound anti-CD3 mAb plus human IgG1 (10 ␮g/ml) or anti-CD3 mAb increases the complexity to our current understanding of TNF/ plus DR4-Fc (10 ␮g/ml) for 3 days. Supernatants were harvested and as- TNFR superfamilies. sayed for their cytokine production in IFN-␥ (A) and IL-4 (B) by ELISA In recent studies, results obtained using soluble rTRAIL recep- p Ͻ 0.05). C, Mouse T cells from splenocytes were stimu- tor DR5-Fc in mice exacerbated autoimmune arthritis and led to ,ء) measured lated with anti-CD3 mAb plus immobilized IgG1 (G) or DR4-Fc (D) for 3 profound hyperproliferation of synovial cells and arthritogenic days, rested, and followed by restimulation with plate-bound anti-CD3 (30). Furthermore, Hilliard et al. (31) found that chronic TRAIL mAb in conjunction with human IgG or DR4-Fc for 24 h. Supernatants were harvested and assayed for IFN-␥ production by ELISA. The results blockade in mice with soluble DR5 exacerbated experimental au- shown are representative of three independent experiments. toimmune encephalomyelitis induced by myelin oligodendrocyte glycoprotein. These effects might not only result from the blockage of TRAIL/TRAIL receptor interaction in vivo, but it also raised the cells. It will be interesting to determine whether TRAIL can still possibility that these effects might result from the DR5/TRAIL signal without engagement of the CD3/TCR complex, and to an- engagement to transduce a reverse signal to preactivated T cells. alyze the consequences of such uncoupled signaling. In light of the Our study has clearly demonstrated that triggering of TRAIL by Downloaded from http://classic.jimmunol.org by guest on September 30, 2021. Copyright 2001 Pageant Media Ltd. 1352 REVERSE SIGNAL TRANSDUCED THROUGH TRAIL immobilized DR4-Fc, in conjunction with immobilized suboptimal TRAIL-induced apoptosis by a family of signaling and decoy receptors. Science anti-CD3 mAb, induced maximal proliferation response and en- 277:818. 10. Walczak, H., M. A. Degli-Esposti, R. S. Johnson, P. J. Smolak, J. Y. Waugh, hanced IFN-␥ secretion by activated T cells. Thus, the exacerbated N. Boiani, M. S. Timour, M. J. Gerhart, K. A. Schooley, C. A. Smith, et al. 1997. autoimmune arthritis and hyperproliferation of synovial cells as TRAIL-R2: a novel apoptosis-mediating receptor for TRAIL. EMBO J. 16:5386. 11. Degli-Esposti, M. A., P. J. Smolak, H. Walczak, J. Waugh, C. P. Huang, well as promotion of experimental autoimmune encephalomyelitis R. F. DuBose, R. G. Goodwin, and C. A. Smith. 1997. Cloning and character- in mice chronically treated with DR5 might result from the trig- ization of TRAIL-R3, a novel member of the emerging TRAIL receptor family. gering of preactivated T cells in vivo. This observation provides an J. Exp. Med. 186:1165. 12. Degli-Esposti, M. A., W. C. Dougall, P. J. Smolak, J. Y. Waugh, C. A. Smith, and explanation for the profound hyperproliferation of synovial cells R. G. Goodwin. 1997. The novel receptor TRAIL-R4 induces NF-␬B and protects and encephalomyelitic lymphocytes, and heightened the produc- against TRAIL-mediated apoptosis, yet retains an incomplete death domain. Im- tion of cytokines and autoantibodies after DR5 treatment in mice munity 7:813. 13. Marsters, S. A., J. P. Sheridan, R. M. Pitti, A. Huang, M. Skubatch, D. Baldwin, (30, 31). J. Yuan, A. Gurney, A. D. Goddard, P. Godowski, and A. Ashkenazi. 1997. A To date, the actual biological function of TRAIL and its four novel receptor for Apo2L/TRAIL contains a truncated death domain. Curr. Biol. receptors in vivo is still not clear, and it is also not known whether 7:1003. 14. Kayagaki, N., N. Yamaguchi, M. Nakayama, H. Eto, K. Okumura, and H. Yagita. these four different TRAIL receptors have different effects on 1999. Type I interferons (IFNs) regulate tumor necrosis factor-related apoptosis- TRAIL. Among the four TRAIL receptors, the DcR1/TRAIL-R3 inducing ligand (TRAIL) expression on human T cells: a novel mechanism for and DcR2/TRAIL-R4 do not contain death domain and are unable the antitumor effects of type I IFNs. J. Exp. Med. 189:1451. 15. Smith, C. G., T. Farrah, and R. G. Gooswin. 1994. The TNF receptor superfamily to transduce death signal like DR4/TRAIL-R1 and DR5/TRAIL- of cellular and viral proteins: activation, costimulation, and death. Cell 76:959. R2. However, DcR1 and DcR2 might be able to cross-link TRAIL 16. Cayabyab, M., J. H. Philips, and L. L. Lainier. 1994. CD40 preferentially co- ϩ to transduce the reverse signal. Thus, DcR1 and DcR2 might play stimulates activation of CD4 T lymphocytes. J. Immunol. 152:1523. 17. Van Essen, D., H. Kikutani, and D. Gary. 1995. CD40 ligand-transduced co- another role in the reciprocal signaling between TRAIL and stimulation of T cells in the development of helper function. Nature 378:620. TRAIL receptors. It will be interesting to know the differential 18. Blair, P. J., J. L. Riley, D. M. Harlen, R. Abe, D. K. Tadaki, S. C. Hoffmann, L. White, T. Francomano, S. J. Perfetto, A. D. Kirt, and C. H. June. 2000. CD40 effect of TRAIL receptor on TRAIL reverse signaling. Our study ϩ ligand (CD154) triggers a short-term CD4 T cell activation response that results may provide a new insight into the biological function of TRAIL. in secretion of immunomodulatory cytokines and apoptosis. J. Exp. Med. 191: In conclusion, our results provide another evidence to demon- 651. 19. Wiley, S. R., R. G. Goodwin, and C. A. Smith. 1996. Reverse signaling via CD30 strate the existence of reverse signaling in a member of TNF su- ligand. J. Immunol. 157:3635. perfamily, suggesting bidirectional signaling might be a general 20. Lens, S. M., P. Drillenburg, B. F. den Drijver, G. van Schijndel, S. T. Pals, phenomenon in ligand/receptor interactions of TNF/TNFR R. A. van Lier, and H. M. van Oers. 1999. Aberrant expression and reverse signaling of CD70 on malignant B cells. Br. J. Haematol. 106:491. superfamilies. 21. Suzuki, I., and P. J. Fink. 1998. Maximal proliferation of cytotoxic T lymphocytes requires reverse signaling through Fas ligand. J. Exp. Med. 187:123. 22. Suzuki, I., and P. J. Fink. 2000. The dual functions of Fas ligand in the regulation Acknowledgments ϩ ϩ of peripheral CD8 and CD4 T cells. Proc. Natl. Acad. Sci. USA 97:1707. We thank Dr. Yao-Ming Wu for critical review of the manuscript, and Mr. 23. Langstein, J., J. Michel, and H. Schwarz. 1999. CD137 induces proliferation and Jiann-Jyh Lai and Ms.Ting-Fang Wang for technical assistance. We also endomitosis in monocytes. Blood 94:3161. thank Dr. Jen Ni (Human Genome Sciences, Rockville, MD) for kindly 24. Stuber, E., M. Neurath, H. Calderhad, H. P. Fell, and W. Strober. 1995. Cross- providing the human TRAIL and DR4 cDNA. linking of OX40 ligand, a member of the TNF/NGF cytokine family, induces proliferation and differentiation in murine splenic B cells. Immunity 2:507. 25. Chen, N. J., M. W. Hung, and S. L. Hsieh. 2001. Enhanced secretion of IFN-␥ by References activated Th1 cells occurs via reverse signaling through TNF-related activation- 1. Armitage, R. J. 1994. Tumor necrosis factor receptor superfamily members and induced cytokine. J. Immunol. 166:270. their ligands. Curr. Opin. Immunol. 6:407. 26. Rathmell, J. C., S. E. Townsend, J. C. Xu, R. A. Flavell, and C. C. Goodnow. 2. Russell, J. H. 1995. Activation-induced death of mature T cells in the regulation 1996. Expansion or elimination of B cells in vivo: dual roles for CD40- and Fas of immune responses. Curr. Opin. Immunol. 7:382. (CD95)-ligands modulated by the B cell antigen receptor. Cell 87:319. 3. Ju, S. T., D. J. Panka, H. Cui, R. Ettinger, M. el-Khatib, D. H. Sherr, 27. Rothstein, T. L., J. K. M. Wang, D. J. Panka, L. C. Foote, Z. Wang, B. Stanger, B. Z. Stanger, and A. Marshak-Rothstein. 1995. Fas (CD95)/FasL interactions H. Cui, S.-T. Ju, and A. Marshak-Rothstein. 1995. Protection against Fas-depen- required for programmed cell death after T-cell activation. Nature 373:444. dent Th1-mediated apoptosis by antigen receptor engagement in B cells. Nature 4. Negata, S. 1997. Apoptosis by death factor. Cell 88:355. 374:163. 5. Krammer, P. H. 1999. CD95 (APO-1/Fas)-mediated apoptosis: live and let die. 28. Arpin, C., C. Dechanet, C. van Kooten, P. Merville, G. Brouard, F. Briere, Adv. Immunol. 71:163. J. Banchereau, and Y. J. Liu. 1995. Generation of memory B cells and plasma 6. Wiley, S. R., K. Schooley, P. J. Smolak, W. S. Din, C. P. Huang, J. K. Nicholl, cells in vitro. Science 268:720. G. R. Sutherland, T. D. Smith, C. Rauch, C. A. Smith, et al. 1995. Identification 29. Watts, A. D., N. H. Hunt, Y. Wanigasekara, G. Bloomfield, D. Wallach, and characterization of a new member of the TNF family that induces apoptosis. B. D. Roufogalis, and G. Chaudhri. 1999. A casein kinase I motif present in the Immunity 3:673. cytoplasmic domain of members of the tumor necrosis factor ligand family is 7. Pan, G., J. Ni, Y. F. Wei, G. Yu, R. Gentz, and V. M. Dixit. 1997. An antagonist implicated in “reverse signaling.” EMBO J. 18:2119. decoy receptor and a death domain-containing receptor for TRAIL. Science 277: 30. Song, K., Y. Chen, R. Goke, A. Wilmen, C. Seidel, A. Goke, B. Hilliard, and 815. Y. Chen. 2000. Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) 8. Pan, G., K. O’Rourke, A. M. Chinnaiyan, R. Gentz, R. Ebner, J. Ni, and is an inhibitor of autoimmune inflammation and cell cycle progression. J. Exp. V. M. Dixit. 1997. The receptor for the cytotoxic ligand TRAIL. Science 276: Med. 191:1094. 111. 31. Hilliard, B., A. Wilmen, C. Seidel, T. S. Liu, R. Goke, and Y. Chen. 2001. Roles 9. Sheridan, J. P., S. A. Marsters, R. M. Pitti, A. Gurney, M. Skubatch, D. Baldwin, of TNF-related apoptosis-inducing ligand in experimental autoimmune enceph- L. Ramakrishnan, C. L. Gray, K. Baker, W. I. Wood, et al. 1997. Control of alomyelitis. J. Immunol. 166:1314.