Analysis of Fasl and TRAIL Induced Apoptosis Pathways in Glioma Cells

Analysis of FasL and TRAIL induced apoptosis pathways in glioma cells

Melissa J Knight1,2,3,4, Christopher D Rikin1,2,3, Andrea M Muscat1,2,3, David M Ashley1,2,3 and Christine J Hawkins*,1,2,3

1Department of Haematology and Oncology, Royal Children's Hospital, Parkville, Australia; 2Murdoch Children's Research Institute, Royal Children's Hospital, Parkville, Australia; 3Department of Paediatrics, University of Melbourne, Parkville, Australia; 4Department of Surgery, Royal Melbourne Hospital, University of Melbourne, Parkville, Australia

FasL and TNF-related apoptosis-inducing ligand therapies which induce apoptosis, such as radio- and (TRAIL) belong to a subgroup of the TNF superfamily chemotherapy. This study focuses on the death which induce apoptosis by binding to their death domain receptor mediated apoptotic pathways in glioma cells, containing receptors. In the present study we have induced by FasL (CD95L/Apo1L) and Tumor Necrosis utilized a panel of seven cell lines derived from human Factor-related apoptosis-inducing ligand (TRAIL/ malignant gliomas to characterize molecular pathways Apo2L). through which FasL and TRAIL induce apoptosis in FasL and TRAIL belong to a subgroup of the sensitive glioma cells and the mechanisms of resistance in Tumor Necrosis Factor (TNF) superfamily with the cell lines which survive the death stimuli. Our ®ndings unique ability to induce apoptosis. They do so via their indicate that FADD and Caspase-8 are essential for cognate death receptors Fas and DR4 (TRAIL-R1)/ FasL and TRAIL mediated apoptosis in glioma cells. DR5 (TRAIL-R2/Trick2) respectively, which are One sensitive cell line (D270) can be protected from characterized by a cytoplasmic death domain (reviewed FasL and TRAIL induced death by anti-apoptotic Bcl-2 by Reed, 2000). FasL and TRAIL can also bind to family members while another (D645) cannot, implying antagonist `decoy' receptors. DcR3/TR6/M68 is a that these lines may represent glioma examples of type II secreted soluble Fas decoy receptor which competes and type I cells respectively. For the ®rst time we with Fas for binding to FasL (Bai et al., 2000; Pitti et demonstrate resistance to FasL but not to TRAIL within al., 1998; Yu et al., 1999). Alternative splicing of the the one glioma cell line. Furthermore, we report distinct Fas gene can also give rise to mRNAs encoding mechanisms of resistance within dierent glioma lines, membrane bound proteins which lack the death including downregulation of Caspase-8 in U373MG. domain, such as the Fas Decoy Receptor (FDR) Cycloheximide sensitized four of the resistant cell lines (Jenkins et al., 2000). TRAIL can bind to the decoy suggesting the presence of labile inhibitors. None of the receptors DcR1 (TRAIL-R3/Trid/Lit) and DcR2 known apoptosis inhibitors examined accounted for the (TRAIL-R4/TRUNDD) which lack the intracellular observed resistance, suggesting novel inhibitors may exist death domain and are therefore incapable of inducing in glioma cells. Oncogene (2001) 20, 5789 ± 5798. the apoptotic pathway. TRAIL decoy receptors are expressed almost exclusively in normal cells (reviewed Keywords: apoptosis; glioma; resistance; TRAIL; Fas; by Reed 2000). Bcl-2 Studies in lymphoid cells suggest FasL and TRAIL engage similar apoptotic pathways in these cells. Aggregation of the death receptors by multimerized Introduction ligand induces the formation of a death-inducing signaling complex (DISC) (Kischkel et al., 1995; Sprick Malignant gliomas are the most frequent primary brain et al., 2000), involving the receptors' death domains tumors in adults and the prognosis of patients remains (DDs), the adaptor molecule FADD (Mort-1) and extremely poor (Hosli et al., 1998). Apoptosis is a Caspase-8 (FLICE, Mch5, MACH), which interact via highly evolutionarily conserved process fundamental to their death eector domains (DEDs). normal development and homeostasis. Defects in The subsequent activation of Caspase-8 at the Fas apoptosis regulation are implicated in a variety of DISC has been shown to propagate alternate apoptotic human diseases, including cancer (Reed, 1999). It is pathways (Scadi et al., 1998). In type I cells, active likely alterations in apoptotic pathways play a role in Caspase-8 directly cleaves downstream eector cas- the tumorigenesis of glioma and resistance to current pases, such as Caspase-3, which in turn cleave an array of substrates, leading to the systematic destruction of the cell (Wolf and Green, 1999). However in type II cells, DISC formation is less ecient and mitochon- *Correspondence: C Hawkins, Department of Haematology and drial ampli®cation of the death receptor induced signal Oncology, Royal Children's Hospital, Victoria Australia 3052; E-mail: [email protected] is required for apoptosis (Scadi et al., 1999b). Active Received 8 May 2001; revised 22 June 2001; accepted 5 July 2001 Caspase-8 cleaves the BH3-only Bcl-2 family member FasL and TRAIL induced apoptosis in glioma MJ Knight et al 5790 Bid and truncated Bid (tBID) translocates to the were sensitive to FasL, with the remainder being FasL mitochondria (Li et al., 1998). This results in the resistant (Figure 1a,b). D645 was also very sensitive to release of cytochrome-c, which binds to Apaf-1 and TRAIL induced apoptosis. U118MG, D270 and recruits Caspase-9 to form the àpoptosome' (Luo et U87MG displayed partial sensitivity to TRAIL, while al., 1998; Zou et al., 1999). This complex is involved in U251MG and U373MG were resistant (Figure 1d,e). the ìntrinsic' apoptotic pathway, which is triggered by D54 was completely resistant to FasL, but sensitive to serum withdrawal (Zhang et al., 2000b) and DNA TRAIL. Death receptor mediated apoptosis has been damage (Coultas and Strasser, 2000). The Bcl-2 protein shown to converge downstream with the ìntrinsic' family regulates apoptotic signals involving the apoptotic pathway which can be induced by che- mitochondria (reviewed by Gross et al., 1999). motherapy drugs. To examine sensitivity to such an Seven glioma cell lines were used in this study and apoptotic stimulus, cells were treated with the initially characterized for their sensitivity to FasL, chemotherapeutic agent cisplatin (Figure 1g,h). D270 TRAIL and cisplatin. The death receptor apoptotic was particularly sensitive to cisplatin with a second signal transduction pathways used by sensitive cells line, U118MG displaying intermediate sensitivity. and the mechanisms employed by resistant cells to D645, the most sensitive cell line to FasL and TRAIL, elude apoptosis were investigated. was resistant to cisplatin. U373MG and U251MG were resistant to all three death stimuli.

Results Caspase-3 activity correlates with sensitivity Apoptosis triggered by all three agents studied has Glioma cell lines differ in their susceptibility to death been demonstrated in other cell types to involve stimuli activation of caspases. The tetrapeptide DEVD is A panel of seven glioma cell lines was characterized for cleaved by eector caspases such as Caspase-3. FasL and TRAIL sensitivity (refer to Table 1 and Cleavage of the ¯uorogenic substrate DEVD-AMC Discussion) using the sensitive lymphoid cell line was used to quantify activated Caspase-3 (and similar Jurkat as a control. Two distinct methods were used caspases) in each of the cell lines following treatment to assess cell viability with comparable results. The with FasL and TRAIL. Figure 1c,f demonstrate that glioma cell lines displayed dierential sensitivity to the amount of Caspase-3-like activity correlates with each of the death stimuli. D645, D270 and U118MG the susceptibility of the cells to apoptosis. Absolute

Table 1 Summary of glioma cell line characteristics and apoptotic pathway analysis DISC Bcl-2 family Type I or Tumor components proteinsa Sensitivity Sensitized by Type IIb Proposed death receptor type Sex Age (Figure 3a) (Figure 3b) (Figure 1) CHX (Figure 5) (Figure 4) resistance mechanism

U118 Anaplastic M 50 Intact F, High 3 May express low levels glioma T, Intermediate 3 of labile FasL and C, Intermediate x TRAIL inhibitor

U251 Glioblastoma M 75 Intact Low Bcl-2 F, Resistant x Mutated component or multiforme T, Resistant x inhibitor with long C, Resistant x half-life

U87 Glioblastoma F 44 Intact Low Bid F, Intermediate 3 May express low levels multiforme Low Bcl-xL T, Intermediate 3 of labile FasL and C, Low x TRAIL inhibitor

U373 Glioblastoma M 50 Low levels F, Resistant x Low levels of multiforme FADD and T, Resistant x Caspase-8 Caspase-8 C, Resistant x

D54 Mixed F 36 Intact High Bid F, Resistant 3 Fas specific labile anaplastic Low Bcl-2 T, High upstream inhibitor glioma C, Resistant x

D270 Glioblastoma M 42 Intact High Bid F, High 3 Type II May express low levels multiforme High Bad T, Intermediate 3 of labile TRAIL Low Bcl-xL C, High x inhibitor

D645 Glioblastoma F 10 Intact F, High Type I multiforme T, High C, Resistant x

F=FasL, T=TRAIL, C=Cisplatin. aChange from the average only. bType I: inhibited by FADD DN and CrmA, Type II: inhibited by FADD DN, CrmA, Bcl-2 and Bcl-xL

Oncogene FasL and TRAIL induced apoptosis in glioma MJ Knight et al 5791

Figure 1 Analysis of FasL (a,b,c), F-LZ-TRAIL (d,e,f) and cisplatin (g,h,i) induced apoptosis in the glioma line panel. Glioma cell lines were treated with TRAIL, FasL or control medium for 24 h (a,b,d,e)or6h(c,f) and 10 mg/ml cisplatin for 24 h (g,h)or12h (i). (a,d,g) Cell viability was assessed by colorimetric MTT assay. (b,e,h) Membrane integrity was measured by propidium iodide uptake. The data are expressed as percentage of viability relative to the cells exposed to the control media. Graphs represent the average and standard deviation of three individual experiments. (c,f,i) Caspase activity was measured ¯uorometrically by DEVD- AMC cleavage. The data are expressed as relative ¯uorescence units (RFU) per hour corrected for control

DEVD-ase activity was less in cisplatin treated cells, cells (Figure 2a) and in each line the protein was full but the relative levels of Caspase-3-like activity length (Figure 2b). The FasL decoy receptor DcR3 was correlated with sensitivity (Figure 1i). not detected in lysates (Figure 6a) or conditioned media (data not shown) of any of the cell lines. Mutations of Fas in melanoma cells have been Receptor expression does not correlate with sensitivity or described (Shin et al., 1999). Given the dierential resistance sensitivity of D54 to FasL and TRAIL, the Fas coding Flow cytometry and immunoblotting were used to region from D54 was sequenced. It was found to be survey the expression of death and decoy receptors in wild type, thus ruling out the possibility of a point the glioma cells. Fas was expressed on the surface of all mutation or small insertion/deletion of the death

Oncogene FasL and TRAIL induced apoptosis in glioma MJ Knight et al 5792

Figure 3 Expression of candidate pathway components. The levels of the apoptotic pathway components were assayed by immunoblotting. (a) FADD, Caspase-8 and Caspase-3 protein levels. (b) Bcl-2 family members

Figure 2 Expression of FasL (a,b) and TRAIL (c,d) receptors. (a,c) Surface expression of Fas and the four apoptosis-related TRAIL receptors on the glioma cell line panel was analysed using ¯ow cytometry on un®xed cells. The mean ¯uorescence ratio (MFR) and percentage positive cells are indicated. (b,d) Using immunoblotting, the size of the proteins were assayed

receptor being responsible for the resistance of D54. D54 was atypical with respect to TRAIL receptor expression, bearing high levels of DR5 and DR4 and intermediate levels of DcR2 (Figure 2c,d). DcR2 was also expressed in U87MG cells, and all cell lines expressed moderate levels of DR5 on their surface. DcR1 was non-detectable by immunoblotting (data not shown).

Elucidation of pathway components Immunoblotting was used to evaluate the levels of the candidate FasL and TRAIL signaling molecules FADD, Caspase-8 and Caspase-3. FADD and Cas- pase-8 have been implicated as components of the FasL and TRAIL DISC. Formation of the DISC results in activation of eector proteases such as Caspase-3. All cell lines express similar levels of Caspase-3 (Figure 3a), however U373MG expressed very low levels of FADD and Caspase-8, as discussed below. As the sensitive lines expressed FADD and Caspase-8 we investigated whether these molecules are required for FasL and TRAIL apoptotic signaling in Figure 4 Enforced expression of inhibitors implicates apoptosis pathway components. (a) D270 and (b) D645 cells were sensitive cells by introducing inhibitors. Transfection of transfected with either empty vector or plasmids encoding CrmA, a dominant negative mutant of FADD (FADD DN) FADD DN, Bcl-2 or Bcl-xL together with a lacZ reporter or CrmA, a viral inhibitor of Caspase-8, abolished the plasmid. Transfected cells were treated with control medium or apoptotic signals of both FasL and TRAIL in D645 media containing FasL, TRAIL or cisplatin 3 mg/ml. Following X-gal staining, the percentages of transfected (blue) cells which and D270 cells (Figure 4a,b), suggesting that FADD were apoptotic were determined microscopically. Error bars and Caspase-8 are crucial for FasL and TRAIL represent standard deviations from three replicates from one signaling in glioma cells. As expected, FADD DN representative experiment

Oncogene FasL and TRAIL induced apoptosis in glioma MJ Knight et al 5793 and CrmA transfected D270 cells were killed by cisplatin treatment as eciently as control transfected cells (Figure 4a). Transfection of the anti-apoptotic proteins Bcl-2 and Bcl-xL into D270 cells abolished cisplatin induced apoptosis (Figure 4a), a stimulus known to utilize the mitochondrial `intrinsic' pathway. Interestingly, transfection of Bcl-2 and Bcl-xL into D270 cells completely inhibited FasL and TRAIL induced apoptosis, while D645 cells remained sensitive after similar transfections (Figure 4b). This suggests the Bcl-2 family of proteins can regulate signals emanating from death receptors in some glioma cells. Expression levels of Bcl-2 family members may therefore account for the resistance to these stimuli exhibited by other glioma lines, so endogenous levels of Bcl-2 family members were examined by immunoblotting. However, resistant lines did not express signi®cantly higher levels of the anti- apoptotic family members Bcl-2 and Bcl-xL (Figure 3b), arguing against this hypothesis. Both D270 and D54 cell lines express large amounts of the pro- apoptotic protein Bid. D270 cells express very low levels of Bcl-xL and Bad while the TRAIL sensitive cell line D54 expressed very low levels of Bcl-2.

Different mechanisms of resistance There are two general hypothetical mechanisms for resistance to apoptotic stimuli: either a cell has a defective or underexpressed apoptotic pathway component, or it contains an inhibitor which blocks that pathway. To distinguish between these possibilities, Figure 5 Sensitization to apoptosis by cycloheximide. Cells were incubated with control medium, cycloheximide (CHX) 10 mg/ml apoptosis assays were performed in the presence of the and FasL, TRAIL or cisplatin 10 mg/ml as indicated. Apoptosis potent translation inhibitor cycloheximide (CHX) was assessed by ¯ow cytometry using Alexa 568-conjugated (Figure 5). HeLa cells were used as a control as they annexin-V and the percentage of annexin-V positive cells is have previously been shown to become sensitive to indicated. Control media and CHX treatment alone killed less FasL following CHX treatment (Somia et al., 1999). than 10% of cells and the percentage values have been subtracted from the treatment group data Inhibition of translation by CHX substantially increased the sensitivity of D270, U118MG and U87MG lines to both TRAIL and FasL induced apoptosis after 6 h of incubation. Interestingly, D54 was dramatically negative inhibitor cFLIP (long or short) was detected sensitized to FasL-induced death following exposure to in the lysates of any of the glioma cell lines, thus being CHX. This ®nding suggests that D54 may express a excluded as a possible mechanism of resistance. labile inhibitor which speci®cally blocks FasL-induced Similarly, no expression of the Fas speci®c candidate apoptosis. U251MG and U373MG, which are resistant inhibitors DcR3 or LFG mRNA was detected. The to both FasL and TRAIL, remain resistant in the expression levels of the caspase inhibitor XIAP and presence of CHX, suggesting that their resistance is due PEA-15 mRNA did not dier signi®cantly between the to either a defective death pathway(s), or the presence dierent cell lines. of an inhibitor(s) with a longer half-life. This is consistent with the above ®nding that U373MG cells Sensitizing resistant cell lines express low levels of FADD and Caspase-8. Sequen- cing of Caspase-8 and FADD in these resistant cell Rendering resistant cell lines sensitive to apoptosis is a lines revealed them to be wild-type. Inhibition of means to con®rm the proposed mechanism of translation by CHX did not sensitize any of the lines to resistance. The results described above suggest the cisplatin. glioma cell line U373MG is resistant to both TRAIL and FasL induced apoptosis due to low levels of the crucial signaling components FADD and/or Caspase-8. Analysis of expression of candidate inhibitors Figure 7 demonstrates that enforced expression of Figure 6a,b show expression levels of previously Caspase-8 into U373MG sensitized the cells equally to identi®ed FasL or TRAIL inhibitors in the glioma cell FasL and TRAIL mediated apoptosis. Similar enforced lines. Neither splice variant of the Caspase-8 dominant expression of FADD had no eect (data not shown).

Oncogene FasL and TRAIL induced apoptosis in glioma MJ Knight et al 5794 lines to both TRAIL and FasL induced apoptosis (Rieger et al., 1998) and the data presented here con®rm these ®ndings. In addition, we demonstrate that glioma cell lines potentially utilize dierential apoptotic pathways and exhibit a number of mechanisms of resistance to death receptor induced apoptosis, summarized in Table 1.

Apoptotic pathway components Although the glioma cells vary in their susceptibility, FasL and TRAIL appear to utilize similar apoptotic pathway components. The present study agrees with previous ®ndings that both Caspase-8 and FADD are essential for Fas (Juo et al., 1998, 1999) and DR5 mediated apoptosis (Sprick et al., 2000), and Caspase- 3-like caspases are important eector caspases for both death stimuli (Wrone-Smith et al., 2001). The Bcl-2 family of proteins plays a more con- troversial role in regulating death receptor mediated apoptosis. Reports of the inhibitory capacity of anti- apoptotic Bcl-2 family members on FasL and TRAIL killing range from no eect (Huang et al., 1999; Kim et al., 2001), to substantial eect (Hinz et al., 2000; Scadi et al., 1998). These contrasting results have been attributed variously to dierences in the cells used and the experimental agent used to aggregate the death Figure 6 (a) XIAP, cFLIP and DcR3 protein expression levels. receptors. (b) LFG and PEA-15 mRNA were analysed and loading is indicated by 28S rRNA. 293T transfectant positive controls are The sensitivity of D270 cells to cisplatin, FasL and to a shown lesser extent TRAIL, may re¯ect the endogenous protein expression levels of the Bcl-2 family members, expressing high levels of the pro-apoptotic Bid and low levels of the anti-apoptotic Bcl-xL. Enforced expression of the anti- apoptotic proteins Bcl-2 and Bcl-xL into D270 cells rendered them resistant to apoptosis, suggesting death receptor mediated apoptosis is routed via the mitochondria in these cells, as in type II cells. D645 cells remained sensitive to FasL and TRAIL in the presence of Bcl-2 and Bcl-xL, which may indicate that they are type I cells. The fact that glioma cell lines may be either type I or type II cells and thus dierentially regulated is currently being investigated further. This observation that the glioma cell lines may employ alternate apoptotic pathways complicates the determination of resistance mechanisms. However, both cell types utilize some common pathway components: receptors, DISC and downstream eector Figure 7 Enforced expression of Caspase-8 increases suscept- caspases. Therefore mutations or inhibitors of any of ibility of U373MG to FasL and TRAIL-induced apoptosis. U373MG cells were transfected with either FpIRESneo or these signaling components could render the cells FpIRES-Casp-8 together with a lacZ reporter plasmid. Trans- resistant to apoptosis. fected cells were treated with normal medium (white columns) or media containing FasL (grey columns) or TRAIL (black columns) and, following X-gal staining, the percentages of transfected Mechanisms of resistance (blue) cells which were apoptotic were determined microscopically. Error bars represent standard deviations from at least ®ve The most proximal step to suppress a death receptor replicates from one representative experiment pathway is inhibition of ligand binding. This could be achieved by lack of or mutations in death receptors or the presence of decoy receptors. Prior reports using glioma cell lines have examined TRAIL receptor mRNA Discussion levels by RT ± PCR (Rieger et al., 1998) and Northern blot (Wu et al., 2000). However, decoy receptor Previous studies in glioma cell lines have shown that localization studies in melanoma cells suggest that dierential sensitivities exist between the tumor cell mRNA levels of the receptors do not correlate with

Oncogene FasL and TRAIL induced apoptosis in glioma MJ Knight et al 5795 surface protein expression (Zhang et al., 2000a). There- The presence of anti-apoptotic intracellular proteins fore in the present study, we determined total protein which interfere with signaling is another potential levels of the receptors and surface expression levels. mechanism for tumor cell resistance. Similarly to Our ®ndings suggest there is no correlation between previous reports in glioma cell lines (Hao et al., 2001; TRAIL receptor surface expression and susceptibility Rieger et al., 1998; Wu et al., 2000), inhibition of protein to TRAIL induced apoptosis in glioma cell lines. This translation by CHX dramatically sensitized four of the is in accordance with some previous observations in glioma cell lines to TRAIL and FasL induced death. This various tumor types (Keane et al., 1999; Tschopp et al., suggests the presence of a labile inhibitor in these lines 1998; Wen et al., 2000) but not with others (Zhang et and expression levels of a number of known inhibitors al., 1999). All cell lines expressed the highest anity were examined. cFLIP is a dominant negative form of death receptor DR5 (Truneh et al., 2000) on their Caspase-8 which lacks residues important for substrate surface, with D54 having the highest levels of catalysis rendering it devoid of proteolytic activity. expression. D54 is also the only cell line with detectable Levels of cFLIPL have been correlated with resistance levels of DR4. While this cell line is susceptible to to FasL in lymphoid (Perlman et al., 1999) and TRAIL, D645 is the most sensitive and has similar melanoma cells (Irmler et al., 1997) and to TRAIL DR5 surface expression levels to the remaining cell induced apoptosis in melanoma cells (Grith et al., lines. In the present study, the levels of decoy receptor 1998) and various tumor types (Kim et al., 2000; expression were very low in all cell lines and would Leverkus et al., 2000). However, none of the glioma cell therefore not account for TRAIL resistance. lines in the present study expressed cFLIP. Expression of Fas on the surface of glioma cells has PEA-15/PED is a DED containing phosphoprotein been reviewed elsewhere (Roth and Weller, 1999). In expressed in brain which protects astrocytes from the present study, no correlation was found between TNF-a induced apoptosis (Kitsberg et al., 1999), Fas surface expression and susceptibility to FasL through interruption of FADD-Caspase-8 binding induced apoptosis. DcR3 is a secreted soluble protein (Condorelli et al, 1999). Twofold higher levels of which competes for binding to Fas with an equal PEA-15 have been implicated recently in the resistance anity to FasL, inhibiting apoptosis (Yu et al., 1999). of some glioma lines, including U373MG (Hao et al., DcR3 gene ampli®cation has been implicated in human 2001). While our attempts to obtain an antibody to lung and colon carcinoma (Pitti et al., 1998) and its evaluate PEA-15 protein levels have been unsuccessful, protein is over-expressed in gastro-intestinal tract RNA analysis suggests equal PEA-15 transcript levels tumors (Bai et al., 2000). Using an antibody which in all cell lines. This, coupled with the inability of readily detects DcR3 protein in 293T cells transfected overexpression of PEA-15 to confer resistance on the with a DcR3 expression plasmid, it was not possible to sensitive lines (data not shown), suggests that PEA-15 detect DcR3 in the supernatants (data not shown) or does not account for the resistance of the glioma cell lysates of any of the glioma lines (Figure 6a). lines used in the present study. The U373MG cells used Surprisingly, detection of DcR3 protein in concen- in this study dier from those used by Hao et al. (2001) trated supernatants of U87MG and U373MG cells has (it appears that our cells may express lower levels of recently been published (Roth et al., 2001). It is FADD and Caspase-8). It is therefore possible that the therefore possible, assuming that the antibody in those apparent discrepancies are due to the analysis of experiments did not detect residual bovine DcR3 from dierent sublines of U373MG. The ATCC catalog the culture medium, that DcR3 is expressed in these warns that mislabeling of U251MG cells as U373MG lines at levels below our detection threshold. cells may have occurred in the past. Our U251MG and A further downstream level at which apoptosis can U373MG lines are morphologically distinct, but this be inhibited is that of the apoptotic signaling confusion may partially explain the dierences ob- components. The U373MG cell line appears to be served between this study and that of Hao et al. (2001) resistant to death receptor mediated apoptosis due to The fact that D54 is remarkably sensitized to FasL lack of crucial signaling components, and expression of while being sensitive to TRAIL in the absence of CHX Caspase-8 sensitized this cell line to FasL and TRAIL suggests the presence of a labile inhibitor in D54 that is mediated apoptosis, while overexpression of FADD speci®c to the Fas apoptotic pathway. LFG is an did not. Many recent studies have reported methyla- intracellular protein which inhibits Fas but not TNF-a tion of the Caspase-8 gene as a mechanism for or TRAIL mediated apoptosis and could therefore decreased levels of protein expression in neuroblasto- account for this dierential sensitivity (Somia et al., mas, rendering cells resistant to apoptosis (Hopkins- 1999), however mRNA for LFG was not detected in Donaldson et al., 2000; Teitz et al., 2000). In U373MG any of the glioma cell lines. Further described cells however, demethylation with 5-aza-2'-deoxycyti- mechanisms of resistance to Fas mediated apoptosis dine did not increase Caspase-8 expression (data not include Fas-associated phosphotase-1 (FAP-1) over- shown), implying that methylation of the Caspase-8 expression in tumors (Myc et al., 1999; Sato et al., gene is not responsible for its low expression levels. 1995; Yanagisawa et al., 1997) and Toso, a membrane U251MG was similarly resistant to FasL and TRAIL. bound inhibitor of the Fas pathway con®ned to The lack of sensitization by CHX would imply that its lymphoid cells (Hitoshi et al., 1998). resistance is due to a mutated component or the Members of the IAP family of apoptosis inhibitors expression of an inhibitor with a long half-life. have been shown to directly inhibit eector Caspases-3,

Oncogene FasL and TRAIL induced apoptosis in glioma MJ Knight et al 5796 7 and 9 and to inhibit various cell death stimuli. The AAGACA AAATAGAG GAGATCCTTAGCAA GATCTA- CCATATAGAAAACGAGATAGCTCGTATCAAAAAGC- inhibition of Caspase-3 by XIAP (Ki=0.7 nM) (Dever- aux et al., 1997) probably re¯ects physiological TTATTGGTGAAG; 4: TTCTTCACCAATAAGCTTTTT- inhibitory potential. All the cell lines expressed similar GATACGAGCTATCTCGTTTTCTATATGGTAGATCTT- levels of XIAP suggesting this is not responsible for the GCTAAGG ATCTCCTCTATTTT GTCTTCGATCTGTTT- CATGGC; 5: GGAATTCGTGAGAGAAAGAGGTCC; 6: dierential sensitivities. GCGGATCCTTAGCCAACTAAAAAGGCCCCG; 7: GC- This study characterized the dierential sensitivity of AGATCTATGTCTCAGAGCAACCGGG; 8: GCTCTAG- glioma cell lines to FasL and TRAIL, demonstrating ACTATTTCCGACTGAAGAGTG. that sensitive glioma cells can exhibit characteristics of type I or type II cells. It is important to elucidate the Antibodies varying methods glioma cells have adopted to elude apoptosis induced by both conventional treatments and The following antibodies were used: anti-TRAIL-R1, R2, R3, death receptor ligands, as this may have important R4, Bcl-xL, Bad and XIAP (R&D Systems); anti-Fas DX2, implications for future multi-modal treatments. A FADD A662 and Caspase-3 (Pharmingen); anti-DcR3 TR6 number of hypotheses for resistance based on mechan- (Prosci); anti-Caspase-8 (Alexis); anti-Bid (Cell Signaling Technology); anti-cFLIP NF6 (a kind gift from Marcus isms of resistance previously described in other cell Peter); anti-Bcl-2 (Oncogene); anti-FLAG M2 and anti- types were examined. We have identi®ed that glioma mouse Ig-HRP (Sigma); anti-goat IgG HRP, anti-rabbit cells exhibit varying mechanisms of resistance to the HRP and anti-goat IgG FITC (Pierce); anti-mouse Ig-FITC death receptor apoptotic pathway, including down- (Silenus). Antibody speci®city was veri®ed by Western blot regulation of Caspase-8. None of the previously analysis of transfected 293T cell lysates or by ¯ow cytometric reported apoptosis inhibitors or resistance mechanisms analysis of transfected 293Ts (data not shown). examined here account for the resistance of the glioma cells to FasL or TRAIL mediated apoptosis, suggesting the resistance mechanisms may be novel or distinct in Generation of aggregated FasL and TRAIL glioma cells. Supernatant from the Neuro2A-CD95L cell line (Schneider et al., 1998) was the source of active aggregated FasL, and was routinely used at a one in 10 dilution. A one in 20 dilution was used for inhibitor transfection experiments. Supernatant Materials and methods from an empty vector control stable Neuro2A line was used for a negative control. Cell lines and plasmids Inclusion of both the FLAG and leucine zipper tags The `U' series of glioma cell lines was established at the increased TRAIL cytotoxicity following anti-FLAG antibody Wallenbery laboratory in Uppsala, Sweden, by Ponten and treatment relative to either tag alone (data not shown). Westermark and was obtained from ATCC. The `D' series FpIRES-LZ-TRAIL was transiently transfected into 293T was obtained from the Duke University Medical Center, cells then 4 days later the media was removed and centrifuged USA (Bigner et al., 1981). U87MG cells were maintained in at 13 k.r.p.m. to remove remaining cells. The supernatant Zinc Option Media (Life Technologies) with 10% fetal (veri®ed to contain F-LZ-TRAIL by Western blot) was bovine serum (FBS). Other cell lines were maintained in diluted one in three and pre-incubated with anti-FLAG DMEM with 10% FBS. antibody 1 mg/ml immediately prior to use in apoptosis and The plasmid CMV-lacZ has been previously described caspase activity assays. (Hawkins et al., 1996). A mammalian expression plasmid with an amino terminal FLAG epitope tag (F-pIRES) was Measurement of apoptosis constructed by annealing oligonucleotides 1 and 2 and ligating into NotI+EcoRI digested pIRESneo (Clontech). FpIRES- Cells were plated in triplicate and allowed to adhere Casp8 was generated by excising Caspase-8 from Casp8- overnight prior to experiments. pCUP1-(LEU2) (Hawkins et al., 1999) and inserting into FpIRES. Oligonucleotides 3 and 4 were annealed and ligated MTT assay 56103 cells well71 were plated in a 96-well into FpIRES to give FpIRES-LZ. The extracellular region of plate. Following treatment, MTT stock solution (Cell Titer human TRAIL was ampli®ed using oligonucleotides 5 and 6 961 Aqueous, Promega) was added to the medium and and cloned into F-pIRES-LZ to give FpIRES-LZ-TRAIL, the incubated with cells at 378C for 1 h to allow cell-mediated sequence of which was veri®ed by automated DNA sequencing. reduction of MTT. Absorbance was measured at 495 nm. The CrmA, Bcl-2 and FADD dominant negative expression plasmids for apoptosis inhibition studies have been previously Propidium iodide uptake 36104 cells well71 were plated in a published (Newton et al., 1998; Strasser et al., 1995). pEF- 24-well plate. Following treatment, cells were harvested and FLAG-Bcl-x was generated by PCR cloning and veri®ed by L resuspended in buer (1% BSA, 0.05% Na3Az in PBS) sequencing. The coding region of Bcl-xL was ampli®ed using containing 25 mg/ml propidium iodide (Sigma) and analysed oligonucleotides 7 and 8 and the product digested with BglII by ¯ow cytometry (Nicoletti et al., 1991). and XbaI prior to insertion into BamHI-XbaI cut pEF-FLAG- FLIPL puro (Scadi et al., 1999a). Oligonucelotides used in the construction of the plasmids Annexin-V binding 36104 cells well71 were plated in a 24- described above were: 1: GGCCACCATGGACTACAAGG- well plate. Following treatment, cells were harvested and ACGACGATGACAAGGCGGCCGCAGCTAGCG; 2: AA- resuspended in buer (10 mM HEPES, 140 mM NaCl, 5 mM TTCGCTAGCTGCGGCCGCCTTGTCATCGTCGTCCTT- CaCl2, pH 7.4) containing 1 : 100 Annexin-V-Alexa 568 GTAGTCCATGGT; 3: GGCCGCCATGAAACAGATCG- (Roche) and analyzed by ¯ow cytometry. Cycloheximide

Oncogene FasL and TRAIL induced apoptosis in glioma MJ Knight et al 5797 (CHX) (10 mg/ml) was added simultaneously with the death LFG or PEA-15. Ten micrograms of RNA was resolved on a stimuli or with control media. 1% agarose-formaldehyde gel and transferred to Hybond-N membrane (Amersham) overnight. 32P-labeled (Gigaprime, Geneworks) cDNA was hybridized to the membrane over- Determination of Caspase activity night at 688C with Express Hyb (Clontech). The membrane Cells were treated with FasL and TRAIL for 6 h and cisplatin was washed twice with 26SSC, 0.1% SDS at 508C and 10 mg/ml for 12 h. The cells were washed, lysed in buer A (Miller bands visualized by autoradiography. Equal loading was et al., 1997) and the protein concentration measured. Lysate con®rmed by the 28S ribosomal band intensity which has (30 ml) containing 25 mg of protein was mixed with 70 mlofthe been shown to be a more consistent method than GAPDH ¯uorogenic caspase substrate DEVD-AMC (Calbiochem) in probing (de Leeuw et al., 1989). buer B (Miller et al., 1997), which is cleaved by Type II caspases such as Caspase-3. The DEVD-ase activity in the extracts was Transfection studies measured ¯uorometrically at 508 nm for a 2 h period. One 6105 cells well71 were seeded in 24-well plates and allowed to adhere overnight. Cells were transfected using Western blots Lipofectamine 2000 (Life Technologies) according to manu- Cells were lysed in triple lysis buer (Sambrook et al., 1989) then facturer's instructions. Triplicate coded wells were transfected sonicated to shear DNA. Protein quantitation was performed with 0.1 mg of the reporter plasmid CMV-lacZ (Hawkins et using Protein Assay Dye Reagent Concentrate (Biorad) and al., 1996) and 0.9 mg of expression plasmid bearing the gene 50 mg of protein was loaded on 12% SDS ± PAGE gels. Equal of interest or no insert. The following day, the media was loading was con®rmed by coomassie staining (data not shown). replaced with media containing supernatants from empty The proteins were transferred to Hybond-P membrane (Amer- vector, FasL or F-LZ-TRAIL transfectants (+1 mg/ml M2 sham), blocked in 1% Blocking Reagent (Roche) in PBS and antibody for TRAIL) for 6 h, or cisplatin for 24 h. The death probed with the indicated antibodies in 1% Blocking Reagent in stimuli were used at a concentration required to kill PBS with 0.05% Tween 20. HRP conjugated antibodies were approximately 60% of cells at the above timepoints (FasL detected by chemiluminescence using Super Signal1 West Dura 1 : 20, F-LZ-TRAIL 1 : 3 and cisplatin 3 mg/ml). The cells Extended Duration Substrate (Pierce). were ®xed (2% formamide, 2% gluteraldehyde in PBS) for 5 min and stained overnight (0.1% X-gal, 5 mM potassium ferricyanide, 5 m potassium ferrocyanide, 2 mM MgCl in Surface protein expression M 2 PBS). Blue cells were scored for apoptosis using morpholo- Surface expression of TRAIL receptors and Fas was gical criteria as previously described (Miura et al., 1993). To determined by ¯ow cytometric analysis by measuring the examine the eect of expression of Caspase-8 on FasL and binding of anti-TRAIL receptor and anti-Fas antibodies. TRAIL sensitivity of U373MG cells, the media was replaced One6105 cells were incubated in 100 ml with 1 mg/ml of 6 h following transfection and 24 h later cells were ®xed, primary antibody (TRAIL receptor, Fas or control) in buer stained and scored as above. (1% BSA, 0.05% Na3Az in PBS) for 30 min at room temperature. The cells were washed twice with buer, before incubation with secondary antibody for 30 min at room Abbreviations temperature. After further washing, the cells were resus- CHX, cycloheximide; DD, death domain; DED, death pended in 200 ml of buer and analysed by ¯ow cytometry. eector domain; DISC, death-inducing signaling complex; The mean ¯uorescence ratio (MFR) of cells labeled with non- PBS, phosphate buered saline; TNF, tumor necrosis immune control antibody and cells labeled with anti-receptor factor; TRAIL, TNF-related apoptosis-inducing ligand antibody was calculated. The dierence between the percentage of receptor-labeled and isotype control-labeled Acknowledgments cells above the point of intersection of the two pro®les de®nes The authors acknowledge the advice and generous dona- the percentage of cells positive for receptor expression. tions of reagents from the following people: Drs David Vaux, David Huang, Andreas Strasser, Paul Ekert, Marcus Peter, Andriano Fontano, Darell Bigner, Mark Schmitt Northern blots and also Janna Stickland for her help with the preparation Total RNA was isolated from the glioma cell lines of Figures. This study was funded by a James S McDonnell (Chomczynski and Sacchi, 1987). Positive control RNA was Foundation Program Grant and a National Health and isolated from 293T cells transiently transfected with F-pIRES Medical Research Council Project Grant.

References

Bai C, Connolly B, Metzker ML, Hilliard CA, Liu X, Sandig V, Coultas L and Strasser A. (2000). Apoptosis, 5, 491 ± 507. Soderman A, Galloway SM, Liu Q, Austin CP and Caskey de Leeuw WJ, Slagboom PE and Vijg J. (1989). Nucleic Acids CT. (2000). Proc. Natl. Acad. Sci. USA, 97, 1230 ± 1235. Res., 17, 10137 ± 10138. Bigner D, Bigner S, Ponten J, Westermark B, Mahaley M, Deveraux Q, Takahashi R, Salvesen G and Reed J. (1997). Ruoslahti E, Herschman H, Eng L and Wikstrand C. Nature, 388, 300 ± 304. (1981). J. Neuropathol. Exp. Neurol., 40, 201 ± 229. GrithTS,ChinWA,JacksonGC,LynchDHandKubin Chomczynski P and Sacchi N. (1987). Anal. Biochem., 162, MZ. (1998). J. Immunol., 161, 2833 ± 2840. 156 ± 159. Gross A, McDonnell J and Korsmeyer S. (1999). Genes Dev., Condorelli G, Vigliotta G, Ca®eri A, Trencia A, Andolo P, 13, 1899 ± 1911. Oriente F, Miele C, Caruso M, Formisano P and Beguinot F. (1999). Oncogene, 18, 4409 ± 4415.

Oncogene FasL and TRAIL induced apoptosis in glioma MJ Knight et al 5798 Hao C, Beguinot F, Condorelli G, Trencia A, Van Meir EG, Reed JC. (2000). Am. J. Pathol., 157, 1415 ± 1430. Yong VW, Parney IF, Roa WH and Petruk KC. (2001). Rieger J, Naumann U, Glaser T, Ashkenazi A and Weller M. Cancer Res., 61, 1162 ± 1170. (1998). FEBS Lett., 427, 124 ± 128. Hawkins CJ, Uren AG, Hacker G, Medcalf RL and Vaux Roth W, Isenmann S, Nakamura M, Platten M, Wick W, DL. (1996). Proc. Natl. Acad. Sci. USA, 93, 13786 ± 13790. KleihuesP,BahrM,OhgakiH,AshkenaziAandWeller Hawkins CJ, Wang SL and Hay BA. (1999). Proc. Natl. M. (2001). Cancer Res., 61, 2759 ± 2765. Acad. Sci. USA, 96, 2885 ± 2890. Roth W and Weller M. (1999). Cell. Mol. Life Sci., 56, 481 ± Hinz S, Trauzold A, Boenicke L, Sandberg C, Beckmann S, 506. Bayer E, Walczak H, Kaltho H and Ungefroren H. Sambrook J, Fritsch E and Maniatis T. (1989). Molecular (2000). Oncogene, 19, 5477 ± 5486. Cloning: A Laboratory Manual. 2nd ed. Cold Spring Hitoshi Y, Lorens J, Kitada SI, Fisher J, LaBarge M, Ring Harbor Laboratory Press. HZ, Francke U, Reed JC, Kinoshita S and Nolan GP. Sato T, Irie S, Kitada S and Reed JC. (1995). Science, 268, (1998). Immunity, 8, 461 ± 471. 411 ± 415. Hopkins-Donaldson S, Bodmer JL, Bourloud KB, Brognara CB, Scadi C, Fulda S, Srinivasen A, Friesen C, Li F, Tomaselli Tschopp J and Gross N. (2000). Cancer Res., 60, 4315 ± 4319. K, Debatin K-M, Krammer P and Peter M. (1998). EMBO Hosli P, Sappino A, de Tribolet N and Dietrich P. (1998). J., 17, 1675 ± 1687. Ann. Oncol., 9, 589 ± 600. Scadi C, Schmitz I, Krammer P and Peter M. (1999a). J. Huang D, Hahne M, Schroeter M, Frei K, Fontana A, Biol. Chem., 274, 1541 ± 1548. Villunger A, Newton K, Tschopp J and Strasser A. (1999). Scadi C, Schmitz I, Zha J, Korsmeyer SJ, Krammer PH Proc. Natl. Acad. Sci. USA, 96, 14871 ± 14876. and Peter ME. (1999b). J. Biol. Chem., 274, 22532 ± 22538. Irmler M, Thome M, Hahne M, Schneider P, Hofmann B, Steiner Schneider P, Holler N, Bodmer JL, Hahne M, Frei K, V, Bodmer JL, Schroter M, Burns K, Mattmann C, Rimoldi D, Fontana A and Tschopp J. (1998). J. Exp. Med., 187, French LE and Tschopp J. (1997). Nature, 388, 190 ± 195. 1205 ± 1213. Jenkins M, Keir M and McCune JM. (2000). J. Biol. Chem., Shin M, Park W, Kim S, Kim H, Kang S, Song K, Park J, 275, 7988 ± 7993. Dong S, Pi J, Oh R, Lee J, Yoo N and Lee S. (1999). Am. J. Juo P, Kuo CJ, Yuan J and Blenis J. (1998). Curr. Biol., 8, Pathol., 154, 1785 ± 1791. 1001 ± 1008. Somia N, Schmitt M, Vetter D, Van Antwerp D, Heinemann JuoP,WooMS,KuoCJ,SignorelliP,BiemannHP,Hannun S and Verma I. (1999). Proc. Natl. Acad. Sci. USA, 96, YA and Blenis J. (1999). Cell Growth Dier., 10, 797 ± 804. 12667 ± 12672. Keane MM, Ettenberg SA, Nau MM, Russell EK and SprickMR,WeigandMA,RieserE,RaucCT,JuoP,Blenis Lipkowitz S. (1999). Cancer Res., 59, 734 ± 741. J, Krammer PH and Walczak H. (2000). Immunity, 12, Kim EJ, Suliman A, Lam A and Srivastava RK. (2001). Int. 599 ± 609. J. Oncol., 18, 187 ± 194. Strasser A, Harris AW, Huang D, Krammer PH and Cory S. Kim K, Fisher MJ, Xu SQ and el-Deiry WS. (2000). Clin. (1995). EMBO J., 14, 6136 ± 6147. Cancer Res., 6, 335 ± 346. Teitz T, Wei T, Valentine MB, Vanin EF, Grenet J, Valentine Kischkel FC, Hellbardt S, Behrmann I, Germer M, Pawlita M, VA, Behm FG, Look AT, Lahti JM and Kidd VJ. (2000). Krammer PH and Peter ME. (1995). EMBO J., 14, 5579 ± 5588. Nat. Med., 6, 529 ± 535. Kitsberg D, Formstecher E, Fauquet M, Kubes M, Cordier Truneh A, Sharma S, Silverman C, Khandekar S, Reddy J, Canton B, Pan G, Rolli M, Glowinski J and Chneiweiss MP, Deen KC, McLaughlin MM, Srinivasula SM, Livi H. (1999). J. Neurosci., 19, 8244 ± 8251. GP, Marshall LA, Alnemri ES, Williams WV and Doyle Leverkus M, Neumann M, Mengling T, Rauch CT, Brocker ML. (2000). J. Biol. Chem., 275, 23319 ± 23325. EB, Krammer PH and Walczak H. (2000). Cancer Res., Tschopp J, Irmler M and Thome M. (1998). Curr. Opin. 60, 553 ± 559. Immunol., 10, 552 ± 558. LiH,ZhuH,XuCandYuanJ.(1998).Cell, 94, 491 ± 501. WenJ,RamadeviN,NguyenD,PerkinsC,WorthingtonE Luo X, Budihardjo I, Zou H, Slaughter C and Wang X. and Bhalla K. (2000). Blood, 96, 3900 ± 3906. (1998). Cell, 94, 481 ± 490. Wolf B and Green D. (1999). J. Biol. Chem., 274, 20049 ± Miller TM, Moulder KL, Knudson CM, Creedon DJ, 20052. Deshmukh M, Korsmeyer SJ and Johnson EM. (1997). Wrone-Smith T, Izban KF, Ergin M, Cosar EF, Hsi ED and J. Cell Biol., 139, 205 ± 217. Alkan S. (2001). Exp. Hematol., 29, 572 ± 581. Miura M, Zhu H, Rotello R, Hartweig EA and Yuan J. Wu M, Das A, Tan Y, Zhu C, Cui T and Wong MC. (2000). (1993). Cell, 75, 653 ± 660. J. Neurosci. Res., 61, 464 ± 470. Myc A, Arscott PL, Bretz JD, Thompson NW and Baker JR. Yanagisawa J, Takahashi M, Kanki H, Yano-Yanagisawa (1999). Endocrinol., 140, 5431 ± 5434. H, Tazunoki T, Sawa E, Nishitoba T, Kamishohara M, Newton K, Harris AW, Bath ML, Smith KG and Strasser A. Kobayashi E, Kataoka S and Sato T. (1997). J. Biol. (1998). EMBO J., 17, 706 ± 718. Chem., 272, 8539 ± 8545. Nicoletti I, Migliorati G, Pagliacci MC, Grignani F and YuKY,KwonB,NiJ,ZhaiY,EbnerRandKwonBS. Riccardi C. (1991). J. Immunol. Meth., 139, 271 ± 279. (1999). J. Biol. Chem., 274, 13733 ± 13736. Perlman H, Pagliari LJ, Georganas C, Mano T, Walsh K and Zhang X, Franco A, Myers K, Gray C, Nguyen T and Hersey Pope RM. (1999). J. Exp. Med., 190, 1679 ± 1688. P. (1999). Cancer Res., 59, 2747 ± 2753. Pitti RM, Marsters SA, Lawrence DA, Roy M, Kischkel FC, Zhang XD, Franco AV, Nguyen T, Gray CP and Hersey P. Dowd P, Huang A, Donahue CJ, Sherwood SW, Baldwin (2000a). J. Immunol., 164, 3961 ± 3970. DT, Godowski PJ, Wood WI, Gurney AL, Hillan KJ, Zhang XJ, Yan J, Cuttle L, Endre Z and Gobe G. (2000b). Cohen RL, Goddard AD, Botstein D and Ashkenazi A. Biochem. Biophys. Res. Commun., 277, 487 ± 493. (1998). Nature, 396, 699 ± 703. Zou H, Li Y, Liu X and Wang X. (1999). J. Biol. Chem., 274, Reed J. (1999). J. Clin. Oncol., 17, 2941 ± 2953. 11549 ± 11556.

Oncogene