Cooperative Agreement Implementation Department of Health and Human Services, USA Centers for Disease Control and Prevention

Ministry of Health, Mongolia National Center of Communicable Diseases

ANNUAL REPORT: 2007/2008

covering the period from September 15, 2004 to September 14, 2008 of the Project “Development of Influenza Surveillance Network” approved by the Cooperative Agreement between DHHS/CDC, USA and MoH/NCCD, Mongolia

Cooperative Agreement No: U50/CCU024411 PAN: B5265G1 1 B5265G1 Annual Report – 2007/2008

Content

List of abbreviations used ...... 7 Foreword ...... 9 One. Background...... 10 1.1. Geography and Climate of Mongolia ...... 10 1.2. Political System and Administrative Structure of Mongolia ...... 13 1.3. Demography and Main Health Indicators of Mongolia ...... 13 1.4. Health Service Delivery of Mongolia ...... 15 1.5. USA/Mongolia Collaboration in Health Fields ...... 16 1.6. History of the US/Mongolia Cooperative Agreement “Development of Influenza Surveillance Network” ...... 17

Two. Influenza surveillance in Mongolia ...... 18 2.1. History ...... 18 2.2. Current Surveillance System ...... 21 2.3. Epidemiology of ILI in the last five seasons ...... 23 2.3.1. Outpatient-based ILI surveillance ...... 23 2.3.2. Hospital-based pneumonia surveillance ...... 38 2.3.3. Laboratory Quality Assurance ...... 40

Three. Cooperative Agreement Implementation: ...... 43 3.1. Project Goal ...... 43 3.2. Project Objectives ...... 43 3.3. Project Implementation Status as September 14, 2006 ...... 43 3.4. Project Implementation in the 2006/2007 and 2007-2008 season (status as September 14, 2008) ...... 70

Four. Annexes ...... 96 Annex 1. IST Composition ...... 96 Annex 2. ISAC Composition ...... 96 Annex 3. ILI sentinel surveillance sites in the capital city ...... 97 Annex 4. ILI sentinel surveillance sites in the provinces ...... 98 Annex 5. Program of the 1st National Influenza Workshop (NIW1) September 8-9, 2005 ...... 99 Annex 6. Participants’ list (204) of the NIW1 September 8-9, 2005, Ulaanbaatar ...... 101 Annex 7. Recommendation from NIW1 ...... 109 Annex 8. Unified program of training workshops for clinical ILI surveillance, 2004/2005 ...... 112 Annex 9. Program of the Workshop in UB, April 16, 2005 ...... 114 Annex 10. Participants list (30) of the training workshop in Selenghe province, January 9, 2005...... 115

2 Content

Annex 11. Participants list (30) of the training workshop in Dornogovi province, January 9, 2005...... 116 Annex 12. Participants list (80) of the training workshop in UB, April 16, 2005 ...... 117 Annex 13. Participants list (30) of the training workshop in Uvurkhangai province, April 30, 2005 ...... 120 Annex 14. Participants list (30) of the training workshop in Dornod province, July 6, 2005 ...... 121 Annex 15. Participants list (30) of the training workshop in Khovd province, July 8, 2005 ...... 122 Annex 16. Equipment and Devices supplied to IST Epidemiology group in 2004/2005 season ...... 123 Annex 17. Equipment and Devices supplied to IST Epidemiology group in 2005/2006 season ...... 123 Annex 18. Training program for epidemiologists and public health professionals on “Influenza surveillance and prevention”, November 9, 2005 ...... 124 Annex 19. Participants list of the training for epidemiologists and public health professionals on “Influenza surveillance and prevention”, November 9, 2005 ...... 125 Annex 20. Training program of the workshop on absenteeism surveillance for heads of Ulaanbaatar city units, October 31, 2005 ...... 127 Annex 21. Participants list of the workshop on absenteeism surveillance for heads of Ulaanbaatar city units, October 31, 2005 ...... 128 Annex 22. Training program of the workshop on “Development of hospital based influenza surveillance”, November 25, 2005 ..129 Annex 23. Participants list of the workshop on “Development of hospital based influenza surveillance”, November 25, 2005 ...... 130 Annex 24. Training program for physicians from FGP and Health Departments of Orkhon and Darkhan-Uul provinces, September 3-8, 2006 ...... 132 Annex 25. Participans list of the training workshop for physicians from FGP and Health Departments of Orkhon and Darkhan-Uul provinces, September 3-8, 2006 ...... 133 Annex 26. Training program for doctors of Ulaanbaatar city, November 2-4, 2005 ...... 137 Annex 27. Participants list of the training workshop-1 for family doctors of Ulaanbaatar city, November 2, 2005 ...... 138 Annex 28. Participants list of the training workshop-2 for doctors of Ulaanbaatar city, November 4, 2005 ...... 140 Annex 29. Laboratory and office equipment received in VL/NCCD in the fiscal year of 2004/2005 ...... 141 Annex 30. Laboratory reagents and other consumables received in VL/ NCCD in the fiscal year of 2004/2005...... 143 3 B5265G1 Annual Report – 2007/2008

Annex 31. Laboratory and office equipment received in VL/NCCD in the fiscal year of 2005/2006 ...... 145 Annex 32. Laboratory reagents and other consumables received in VL/ NCCD in the fiscal year of 2005/2006...... 145 Annex 33. Office equipment and devices supplied to Management team in 2005/2006 season ...... 146 Annex 34. Training program of the workshop on “Need for establishment of biosafety III level laboratory”, November 23, 2005 ...... 147 Annex 35. Participans list of the workshop on “Need for establishment of biosafety III level laboratory”, November 23, 2005 ...... 148 Annex 36. Refrigerators and thermometers, tube stands and sockets supplied to sentinel sites in the fiscl year of 2005/2006 ...... 149 Annex 37. Training program of the workshop for veterinarians of Ulaanbaatar city, November 17, 2005 ...... 149 Annex 38. Partcipants list of the workshop for veterinarians of Ulaanbaatar city, November 17, 2005 ...... 150 Annex 39. Training program of the workshop for pharmacists of Ulaanbaatar city, November 18, 2005 ...... 150 Annex 40. Partcipants list of the workshop for pharmacists of Ulaanbaatar city, November 18, 2005 ...... 151 Annex 41. IST composition (approved by the order ¹253/2006 of the Minister of health, Mongolia) ...... 152 Annex 42. ISAC composition (approved by the order ¹253/2006 of the Minister of health, Mongolia) ...... 152 Annex 43. ILI sentinel surveillance sites in the capital city (status as September 14, 2007) ...... 153 Annex 44. ILI sentinel surveillance sites in the provinces (status as September 14, 2007) ...... 155 Annex 45. Program of the 2nd National Influenza Workshop (NIW2) October 4-5, 2006 ...... 158 Annex 46. Participants’ list (220) of the NIW2 October 4-5, 2006, Ulaanbaatar ...... 161 Annex 47. Recommendation from NIW2 ...... 171 Annex 48. Recommendatoon of Dr. M. Tashiro, STC, WHO from NIID, Japan on strengthening of virology laboratory capacity ...... 172 Annex 49. Program of the workshop on hospital-based surveillance for medical doctors, September 2006 ...... 175 Annex 50. Participants’ list of the workshop on hospital-based surveillance for medical doctors of NCCD, September 20, 2006...... 176 Annex 51. Participants’ list of the workshop on hospital-based surveillance for medical doctors of 5 district hospitals and MCHRC, September 22, 2006 ...... 178

4 Content

Annex 52. Participants’ list of the on-the-job training for laboratory technicians, November 01, 2006 - February 01, 2007 ...... 180 Annex 53. Participants’ list of the on-the-job training for virologists, November 01, 2006 - February 01, 2007 ...... 180 Annex 54. Program of the training on “ICRT procedures for Adenovirus, RSV and Influenza A, B virus antigen detection” January 19, 2007 ...... 181 Annex 55. Participants’ list of the training on “ICRT procedures for Adenovirus, RSV and Influenza A, B virus antigen detection” January 19, 2007 ...... 181 Annex 56. Program of the workshop on fourth quarter activities in 2006 for sentinel surveillance sites in the capital city, January and February 2007 ...... 182 Annex 57. Participants’ list of the workshop on fourth quarter activities in 2006 for FGP - based sentinel surveillance sites in the capital city, January 22, 2007 ...... 183 Annex 58. Participants’ list (74) of the workshop on fourth quarter activities in 2006 for hospital-based sentinel surveillance sites in the capital city, February 06, 2007 ...... 186 Annex 59. Program of the meeting with pathologists, June 29, 2007 ...... 189 Annex 60. Participants’ list (29) of the meeting with pathologists from the Center of Pathology, MoH June 29, 2007 ...... 190 Annex 61. Program of the workshop on first quarter activities in 2007 for sentinel surveillance sites in the capital city, July 02, 2007 ...... 191 Annex 62. Participants’ list (130) of the workshop on first quarter activities in 2007 for sentinel surveillance sites in the capital city, July 02, 2007 ...... 192 Annex 63. Equipment and Devices supplied to IST Epidemiology and Management group in 2006/2007 season ...... 198 Annex 64. Laboratory and office equipment received in VL/NCCD in the fiscal year of 2006/2007 ...... 199 Annex 65. Laboratory reagents and other consumables received in VL/NCCD in the fiscal year of 2006/2007 ...... 200 Annex 66. Program of the 3rd National Influenza Workshop (NIW3) October 11-12, 2007 ...... 203 Annex 67. Participants’ list (220) of the NIW3 October 11-12, 2007, Ulaanbaatar ...... 206 Annex 68. Recommendation from NIW3 ...... 215 Annex 69. Program of the workshop on second and third quarter activities in 2007 for sentinel surveillance sites in the capital city, October 18, 2007 ...... 216

5 B5265G1 Annual Report – 2007/2008

Annex 70. Participants’ list (162) of the workshop on second and third quarter activities in 2007 for sentinel surveillance sites in the capital city, October 18, 2007 ...... 217 Annex 71. Program of the workshop on fourh quarter activities in 2007 for sentinel surveillance sites in the capital city, January 16, 2008 ...... 222 Annex 72. Participants’ list of the workshop on fourh quarter activities in 2007 for sentinel surveillance sites in the capital city, January 16, 2008 ...... 223 Annex 73. ISSS assessment results of the capital city, 2007 ...... 228 Annex 74. ISSS assessment results of the provinces, 2007 ...... 229 Annex 75. Program of the workshop on IPPP national assessment, April 15-17, 2008 ...... 231 Annex 76. Participants’ list (30) of the workshop on IPPP national assessment, April 15-17, 2008 ...... 233 Annex 77. IPPP national assessment, April 2008...... 234 Annex 78. Program of the workshop on first quarter activities in 2008 for sentinel surveillance sites in the capital city, May 2, 2008 ...... 237 Annex 79. Participants’ list (133) of the workshop on first quarter activities in 2008 for sentinel surveillance sites in the capital city, May 2, 2008 ...... 238 Annex 80. Program of the workshop for TTX moderators on IPPP subnational assessment, September 29, 2008 ...... 242 Annex 81. Participants’ list (13) of the workshop for TTX moderators on IPPP subnational assessment, September 29, 2008 ...... 242 Annex 82. Equipment and Devices supplied to IST Epidemiology and Management group in 2007/2008 season ...... 243 Annex 83. Laboratory and office equipment received in VL/NCCD in the fiscal year of 2007/2008 ...... 244 Annex 84. Laboratory reagents and other consumables received in VL/NCCD in the fiscal year of 2007/2008 ...... 245

6 List of abbreviations used

List of abbreviations used

ARI – Acute Respiratory Infections; ADB – Asian development Bank; CC – Collaborating Center; CDC – Canter for Disease Control and Prevention, USA; CIDNF – Center for Infectious Diseases with Natural Foci, MoH; CoP – Center of Pathology, MoH; CVR – Central Veterinary Laboratory, MoFA; BG – Bayangol district, UB city, Mongolia BSL – biosafety level BZ – Bayanzurkh district, UB city, Mongolia ChD – Chingeltei district, UB city, Mongolia DA – Darkhan-Uul province, Mongolia; DG – Dornogobi province, Mongolia; DO – Dornod province, Mongolia; DHHS – Department of Health and Human Service, USA; DPM – Division of Payment Management, DHHS; EQAP – External quality assurance program, WHO; FGP – Family Group Practices; GDP – Gross Domestic Products; GGM - CDC – Global Grantee Meeting; GMT – Geometric mean titer; HA – hemagglutinin; HI – Hemoagglutination inhibiting (titer etc); HIT - Hemoagglutination inhibition test; HD – Health Department; HIV – Human Immune Deficiency Virus HQ – Head Quarter; HSUM – Health Science University of Mongolia; ICD10 – International Statistical Classification of Diseases and related Health Problems, 10th Revision; ICRT – Immunochromatographic rapid test; IEC – Information, Education and Communication; IFM – immunofluorescent microscopy; ILI – Influenza and Influenza-like Illnesses; IPPP-Influenza Pandemic Preparedness Plan ISAC – Influenza Surveillance Advisory Committee; ISSS – Influenza Sentinel Surveillance Site; IST – Influenza Surveillance Team; IV – Influenza Virus; KhO- Khovd province, Mongolia; Khu– Khuvsgul province, Mongolia; KOICA – Korean Organization for International Cooperation and Assistance MAS – Mongolian Academy of Sciences; MCHRC – Maternal and Child Health Research Center

7 B5265G1 Annual Report – 2007/2008

MDCK – Madin Darby Canine Kidney (cell culture); MNT – Mongolian National Tugrug (currency); MoFA – Ministry of Food and Agriculture; MoH – Ministry of Health; NCCD – National Center of Communicable Diseases; NCHD – National Center of Health Development; NEMA – National Emergency Management Agency (former SEMA), Mongolia; NIC – National Influenza Center; NIHEM – National Institue of Hygiene, Epidemiology and Micobiology; MoH (1964-1966); NIID – National Institue of Infectious Diseases, Tokyo, Japan; NIW1 – 1st National Influenza Workshop; NIW2 – Second National Influenza Workshop; NIW3 – 3rd National Influenza Workshop; ODA – Official Development Assistance; OR – Orkhon province, Mongolia; PAN – Project Access Number, DPM; PHC – primary health care; PHI – Public Health Institue, MoH (since 1996); PPE – Personal Protector Equipment; RCDT – Regional Center for Diagnosis and Treatment; RT-PCR – Reverse Transcriptase Polymerase Chain Reaction; RSV – Respiratory sincytial virus; SAR – special administrative region, China; SARS – Severe Acute Respiratory Syndrome; SB – Sukhbaatar district, UB city, Mongolia; SE – Selenge province, Mongolia; SKh – Songinokhairkhan district, UB city, Mongolia; SPIA – State Professional Inspection Agency; STC – Short term consultant SU – Soviet Union; TB – Tuberculosis; TTX – table top exercise; UB – Ulaanbaatar (Capital City of Mongolia); UN – United Nations; UNFPA – United Nations Fund for Population Activities; UNICEF – United Nations Children`s Fund; USA – United Nations of America; UV – Uvurkhangai province, Mongolia; VL – Virology laboratory; VRI – Veterinary Reseach Institue University of Agriculture, Mongolia; WB – World Bank; WHO – World Health Organization; WPRO – Western Pacific Regional Office, WHO; WR – WHO Country Representative, Ulaanbaatar, Mongolia;

8 Foreword

FOREWORD

It’s my pleasure to introduce this 4th Annual Report on the activities implemented with support of the US- Mongolia Cooperative Agreement “Development of Influenza Surveillance Network” U50/CCU024411 establsihed between DHHS/CDC, USA and MoH/NCCD, Mongolia in 2004. The Influenza pandemic alert by WHO since 2003 has urged Ministry of Health, Mongolia (MoH) to take steps to strengthen the influenza surveillance as the first step to prepare to pandemics. However, both expertise and logistics were not in place. So, MoH has started seeking assistance from our partners. The pioneering response came from USA and Department of Health and Human Services, USA has signed a Cooperative Agreement with our Ministry on Development of Influenza Surveillance Network, Mongolia in 2004. A laboratory based sentinel surveillance network was established within this project which covers 8 districts of Ulaanbaatar city and 7 aimags. Its activities have now become consistent, the Virology laboratory, NCCD has been provided with adequate equipment, reagents and diagnostic kits, professionals are trained. The hard work of the Project Team led by Prof. P.Nymadawa, MD, PhD, DSc (Med) has enabled our National Influenza Center activities to meet now the level required by WHO, the number of viruses isolated had increased from year to year, the isolated viruses have been identified at the molecular genetics level. This first joint project has raised awareness in other relevant sectors national economy and the foreign assistance in these sectors is increasing now. The successful implementation of our Project aims was possible with extensive support of the responsible officers at CDC and DPM/DHHS, especially Mrs. Ann Moen, Assistant Chief, Extramural Programmes, Influenza Division, CDC, Dr. Alexander Klimov, PhD, Chief, Strain Surveillance Section, Influenza Division, CDC, Mrs. Theresa Turski, Health Scientist, Influenza Division, CDC, Mr. Steward Nichols, Grant Management Specialist, International and Territories Acquisition and Assistance Branch, CDC and Ms. Janet Morgan Fowler, DPM/DHHS. The visits of Mrs. Theresa Turski, and Dr. Goldie MacDonald from CDC, USA to Mongolia during this budget period and their active participation in the first assessments of our influenza pandemic preparedness plan (IPPP) is an important input to our country’s IPPP review and updating.

On behalf of the Ministry of Health, Mongolia and myself personally, I would like to express our deepest thanks to CDC/DHHS, USA for their valuable assistance for the improvement of the influenza pandemic preparedness in my country though this Project.

Mr. S. Lambaa, PhD(Econ.) Minister of Health, Government of Mongolia, Member, Parliament of Mongolia

December 15, 2008

9 B5265G1 Annual Report – 2007/2008

ONE. BACKGROUND

1.1. Geography and Climate of Mongolia

Mongolia is a landlocked country in Northeast Asia located between the latitudes of 41035″N and 52009″E and the longitudes of 87044″E and 119056″E bordering in the North with the Siberian part of the Russian Federation and in the East, West and South with the People’s Republic of China (Figure 1). Mongolia`s total area is 1,566,600 km2. The distance between the most western and the most eastern points is 2,392 km, and between the most northern to the most southern points is 1,259 km. Mongolia is the seventh largest country in Asia and the 18th largest in the world. Also, Mongolia is one of the largest landlocked countries in the world. Mongolia`s territory reaches relatively high altitudes: while the average altitude is 1,580 meters above sea level, 81.2% of the territory is higher than 1,000 meters above sea level, and half of the territory is higher than 1,500 meters above sea level. In Mongolia, all natural zones such as high mountains, valleys between the mountain ranges, wide steppe, desert and semi-desert zones are combined. Ecologically, Mongolia occupies a critical transition zone in Central Asia: here the great Siberian taiga forest, the Central Asian steppe, the high Altai mountains and the Gobi desert converge. Altitude (m, above sea level)

Figure 1. Geographical map of Mongolia

10 Bacêground: Geography and Climate of Mongolia

The northwest and central parts of Mongolia are high mountainous regions, while the eastern part is a vast steppe region. The southern part of the country represents the semi-desert and desert area that is known as the Mongolian Gobi. Forests cover 8.1% of the country`s territory, consisting mainly of larch and pine. Saxaul forests occupy certain areas in the Gobi. The climate of Mongolia is a harsh continental with four distinctive seasons, high annual and diurnal temperature fluctuations, and a low rainfall. Because of the country`s high altitude, it is generally colder than that of other countries in the same latitude. Average annual temperatures range between 8.50C in the Gobi and -7.80C in the high mountainous areas. The extreme minimum temperature is usually between -310C and –52.90C in January and the extreme maximum temperature ranges from +28.50C to +42.20C in July (Figure 2 and 3).

Figure 2. Mean summer temperature, Mongolia

The average annual precipitation is low (200-220 mm) and represents a range between 38.4 mm per year in the extreme South (Gobi desert region) and 389 mm per year in limited areas in the North (Figure 4). Most precipitation occurs in the months of June, July and August; the driest months occur between November and March. Droughts in the spring and summer periods occur about once every five years in the Gobi region, and once every ten years over the most other parts of the country. Mongolia receives an average of 3,000 hours of sunshine annually, which is well above the amount received by other countries of the same latitude. 11 B5265G1 Annual Report – 2007/2008

Figure 3. Mean winter temperature, Mongolia

Figure 4. Mean annual precipitation, Mongolia

12 Background: Political System and Administrative Structure

1.2. Political System and Administrative Structure of Mongolia

Mongolia has drastically changed in 1990 the political system followed for the last 70 years: from the one-party dictatorship to a multi- party parliamentarian democracy and the same time trying to shift from a centrally planned economy to a market-oriented one. According to the Constitution adopted in 1992 the Head of the State is the President who is elected for 4 years by a secret ballot of all citizens of electoral age (above age of 18). The Government has 3 branches: • Legislative-Ikh Khural (Parliament) with 76 seats elected for 4 years, • Executive-Cabinet: Prime Minister (approved by the Parliament on the nomination of the President) and Ministers (approved by the Parliament on the proposal of the Prime Minister), Provincial Governors (approved by the Prime Minister on the proposal of local Khurals: Province Parliaments), • Judical-Constitutional Court (approved by the Parliament on the equal nominations by the President, Parliament and the Cabinet), Supreme Court and Provincial and District Judges (approved by the Parliament on the proposal of the President). Administratively, Mongolia is divided into 21 Provinces (Aimags) and the Capital City-Ulaanbaatar. Provinces are divided into districts (soums) and districts are further fragmented into sub-districts (bags). The capital city has also 9 city districts (duuregs) and city districts are subdivided into city sub-districts (khoroos). Currently Mongolia has 340 districts and 1,671 sub-districts including city districts and city sub-districts.

1.3. Demography and Main Health Indicators of Mongolia1

At the end of 2007, the resident population of Mongolia stood at 2,533.1 thousand. Currently, 48.7% of the population are male and 51.3% are female. In 2007, the percentage of population aged under 15 years was 28.9, aged 15-64 years was 67.0% and aged 65 years and older was 4.1.

1 Most of the statistical data have been taken from “Health Facts Mongolia-2007” prepared by National Cen- ter for Health Development, MoH, 2007;

13 B5265G1 Annual Report – 2007/2008

Although the population has doubled since 1960, the average population density - 1.5 persons per square kilometer - remains one of the lowest in the world. Still, the density is highly variable, ranging from a high of 162 persons per square kilometer in Ulaanbaatar to a low of 0.3 people in the Umnugobi (South-Gobi) province. Some 56.6% of the population lives in urban area. The capital city, Ulaanbaatar, alone is home to 32% of the population. Population growth rate was relatively high in 1960-1970 reaching 3-4% per year. From the 1980s population growth rate has shown rapid decline and it was in average 1.4% for the last 5 years. So, in the last decade of the past century Mongolia has experienced demographic transition (Figure 5).

1992 2002 Figure 5. Population Pyramid of Mongolia in 1992 and 2002 Mongolian population has gone into epidemiological transition also in 1990s (Figure 6). So, Mongolia is experiencing double health burden like many of middle-income countries of the world.

Figure 6. Dynamics of the Leading Causes of Population Mortality in Mongolia in 1987-2007

14 Background: Demography and Main Health Indicators

In Mongolia by the statistics of 2007, the life expectancy at birth is 66.5, infant mortality rate is 17.8/1,000 live births, under 5 mortality rate is 22.0/1,000 live births, and maternal mortality rate is 89.6/100,000 live births. Diseases of the respiratory system are leading in general population and in the childhood in the registered morbidity structure (Table 1).

Table 1. Leading causes of morbidity per 10,000 population in Mongolia (1999-2007)

In general population

Diseases of the respiratory system (ICD-10, Chapter X) 883.8

Diseases of the digestive system (ICD-10, Chapter XI) 793.4

Diseases of the uro-genital system (ICD-10, Chapter XIV) 715.4

Diseases of the circulatory system (ICD-10, Chapter IX) 577.8

Injury, poisoning and certain other consequences of external causes 409.1 (ICD-10, Chapter XIX)

1.4. Health Service Delivery in Mongolia

Mongolia has a mixed health care system with dominating Government health institutions of three levels (Table 2). Mongolian health care system offers with total 35,876 employees including 7,458 medical doctors (28.3/10,000 population), and 16,575 middle level health personnel: nurses, doctor’s assistants, laboratory technicians etc (62.9/10,000 population) has relatively good health manpower supply among developing countries. As of 2007, health financing compromises: 71.9% from the Government budget, 23.5% from the Health Insurance Fund and 4.6% out of pocket expenses. Total Government health spending is 4.5% of GDP and 12% of total Government Expenditure (2007). 10% of total health expenditure is ODA. The main ODA resource flows in the health sector are provided by bilateral resources from Government of Japan, Germany and Korea, and multilateral institutions: WHO, UNFPA, UNICEF, UN Global Fund and ADB, WB.

15 B5265G1 Annual Report – 2007/2008

Table 2. Health Service Delivery in Mongolia (2006)

Outpatient Health Institutions Hospital Number Beds visits admissions

Total 1,256 18,371 558,221 13,874,487

1. Primary level: 571 4,579 152,022 7,712,980 • District Hospital (Government) 296 3,866 129,126 2,227,062 • Inter-District hospital (Govern ment) 31 713 22,896 355,071 • Family Group Practice (Private) 230 0 0 5,130,847

2. Second level: 34 4,644 136,652 3,388,714 • Inter-district General Hospital (Government) 4 282 8,588 123,563 • General Hospitals of Provinces (Government) 18 3,089 82,202 1,614,236 • General Hospital of City Districts (Government) 12 1,273 45,862 1,650,915

3. Tertiary level: 20 5,815 166,044 1,395,239 • Regional Center for Diagnosis and Treatment 3 1,635 55,650 333,372 • General and Specialized Hospitals and Centers in Ulaanbaatar 17 4,180 110,394 1,061,867

4. Others: 622 3,333 103,503 1,377,564 • Private Hospitals 143 1,839 58,013 0 • Private Clinics 434 0 0 841,856 • Others 45 1,494 45,490 535,708

1.5. USA/Mongolia collaboration in Health Field Health sector was not a priority area of US ODA in Mongolia. Therefore, the US/Mongolia health sector collaboration was based mostly on occasional connections of health institutions, philanthropic societies, professionals and NGOs till mid 2000s. An attempt for the national level collaboration in the health field was made in 1995, when CDC and MoH has signed an agreement for a year’s duration on collaboration of epidemiological surveillance and control of infectious diseases, especially regarding meningococcal epidemics which was serious concern of the Government of Mongolia that time. The collaboration has resulted in very successful control of meningococcal

16 Background: USA/Mongolia collaboration in Health Field epidemics2. Unfortunately, the Agreement has not been extended after a subsequent change of Governments on both sides.

1.6. History of the US/Mongolia Cooperative Agreement “Development of Influenza Surveillance Network”

NCCD, MoH, Mongolia has submitted to CDC in May 2004 an application intended for 5 years duration in response to the call of CDC/ DHHS, USA for institutional development application on “Development of Influenza Surveillance Network” under Program Announcement Number 04016. NCCD/MoH, Mongolia has received on August 31, 2004 an official letter from DHHS containing a Cooperative Agreement Document informing an award for 163,033.00 US$ covering the period from September 15, 2004 to September 14, 2005. However, DHHS has requested clarifications for several activities proposed before launching the fund release. So, a detailed explanation and calculations were sent from NCCD/MoH in September 2005, and Prof P.Nymadawa, MD, PhD, DSc(Med), Scientific advisor of the Director-General, NCCD has been officially delegated to CDC in October 2004. He has personal meetings with officials of Influenza Branch, CDC and discussed every detail of the requested clarifications and they have reached a common understanding on project aims and performances. After the review of the “Preliminary Annual Report 2004/2005” for the Project in June 2005 CDC has extended the project duration from September 15, 2005 to September 14, 2006 and released 175,000.00 US$ to fund the Project activities. Based on the successful implementation of the project activities in the first two fiscal investment years in July 2006, CDC has awarded a project extention with almost a million US$ from September 15, 2006 to September 14, 2007. Taken into consideration of the increasing flow of the funding from other sourses into IPPP implementation of Mongolia, CDC/ DHHS,USA funding for the 4th year of the Project from September 15,2007 to September 14, 2008 has been reduced to 400,000.00 US$.

2 WHO (1995): Meningococcal Disease, Mongolia, Weekly Epidemiological Record,. 70: 281-282;

17 B5265G1 Annual Report – 2007/2008

TWO. INFLUENZA SURVEILLANCE IN MONGOLIA

2.1. History

Starting 1970s influenza and influenza-like illness (ILI) became serious concern of Health Service of Mongolia due to rapidly increasing population and urbanization in the country. In connection with this it has been initiated in the National Institute of Hygiene, Epidemiology and Microbiology, MoH (NIHEM – since 1996 Public Health Institute, MoH – PHI) laboratory investigations to clarify etiology of ILI outbreaks3. In 1974 on the basis of Virology Laboratory in NIHEM the National Influenza Center (NIC) was set up and it has began epidemiological and virological surveillance of ILI on the seasonal basis (from October to June). NIC in collaboration with experienced researchers from Moscow (D.I.Ivanovsky Institute of Virology) and Sofia (Institute of Epidemiology, Microbiology and Infectious Diseases) has described yearly outbreaks and 4 bigger epidemics of influenza in Mongolia in 1970s and identified the causative organisms4.

3 Krylov, V.F., Obrosova-Serova, N.P., Zilina, N.N., Evstigneeva, N.A., Molibog, E.V., Zakstelskaya, L.Ya., Kupul, A., Cerenčimed, O., Hišigdorћ, A. (1973): Clinical and epidemiological features of an outbreak of influenza in Ulan-Bator in 1971, Bull.Wld.Hlth.Org., 49:567-570; - Äîðæ, Ñ., Õèøãýý, Ø. (1974): Òîìóó ºâ÷íèé òóõàé, Ìîíãîëûí Àíàãààõ Óõààí, 3-4(19- 20):21-24 [Dorsh, S., Khishgee, Sh. (1974): About a outbreak of influenza, Mongolian Medical Sciences, 3-4 (19-20): 21-24]; 4 Äîðæ, Ñ. (1976): Èçîëèðàíå íà ãðèïåí âèðóñ À â Ìîíãîëèÿ, Åïèäåìèîëîã., ìèêðîáèîëîã. è èíôåêö.áîë.,13(3): 195-199 [Dorћ, S. (1976): Isolation of Influenza A virus in Mongolia, Epidemiol.microbiol.infect.bol.(Sofia); 13(3):195-199]; - Îáðîñîâà-Ñåðîâà, Í.Ï., Èñà÷åíêî, Â.È., ×åøèê, Ñ.Ã., Àðñëàí, Ð., Äîðæ, Ñ., Àëòàíõóÿã, Ñ., Õèøèãäîðæ, À. (1977): Íåêîòîðûå îñîáåííîñòè âñïûøêè ãðèïïà â Óëàí-Áàòîðå â 1974 ã, Âîïð.âèðóñîë., 22(3):291-294 [Obrosova-Serova, N.P., Isachenko, V.I., Cheshik, S.G., Arslan, R., Dordzh, S., Altanguyag, A., Khishigdorzh, A,. Kupul, Zh. (1977): Some features of influenza outbreak in Ulan-Bator, 1974, Vopr.virusol., 3:291-294]; - Ïîä÷åðíÿåâà, Ð.ß., Ñ÷àñòíûé, Ý.È., Ìàëüåùåâ, Í.À., Æàìáà. Ã., Î÷èðâààíü. Ã., Àðñëàí, Ð., Òèìîôååâ, Ý.Â., Àëòàíõóÿã. Ñ., Øîìáîí, Í., Ãàëáàäðàõ, Ä., Ëüâîâ, Ä.Ê., (1977): Ê ýòèîëîãèè ÎÐÇ ñðåäè íàñåëåíèÿ ÌÍÐ â 1976 ã.  êí.: Îáçîð Ðåãèîíàëüíîãî Öåíòðà ïî ãðèïïó çà IV êâàðòàë 1976 ã., ñ.8-11; [Podchernyaeva, R.Ya., Schastnyi, E.I., Malyshev, N.A., Jamba, G., Ochirvaani, G., Arslan, R., Timofeev, E.V., Altankhuyag, S., Shombon, N., Galbadrakh, D., Lvov, D.K. (1977): To the etiology of ILI among population of MPR in 1976, In: Proceedings of the Regional Center for Influenza in SU for IV quarter 1976, pp.8-11]; - Ãàëáàäðàõ, Ä., Àðñëàí, Ð., Òèìîôååâ, Ý.Â., Àëòàíõóÿã, Ñ., Øîìáîí, Í. (1979): Òîìóó, òîìóó òºñò ºâ÷íèéã äàðõàí-òóÿàðàëò áè÷èëõàðóóðûí àðãààð îíîøëîñîí ä¿í, Ìîíãîëûí Àíàãààõ Óõààí, 2 (32): 56-59 [Galbadrakh, D., Arslan, R., Timofeev, E.V., Altankhuyag, S., Shombom, N. (1979): Results of fluorescent microscopy study of patients with influenza and influenza-like illnesses, Mongoliam Medical Sciences, 2 (32): 56-59]; 18 Influenza Surveillance in Mongolia

In 1980s NIC activity was strengthened and expanded with supporting groups in 18 province (aimag) centres and 6 sentinel sites based on Pediatric Hospitals in Ulaanbaatar city. Weekly tolerant limits of ILI morbidity for Ulaanbaatar and whole country have been calculated the first time and used for evaluation of the ILI events. Yearly outbreak of ILI and 6 major influenza epidemics in 1980-1990s were described and causative agents were isolated and identified: IV A(H1N1) and A(H3N1)-variants5. ILI morbidity for whole country in 1990s and beginning of 2000 was about 3 times lower than the registered ILI morbidity in 1980s (Figure 7). The reasons for this phenomenon may be explained by the following: • ILI registration in provinces and districts are weakly than in Ulaanbaatar city, • Due to demographic transition (see, Part 1.3., Figure 5 ) the share of child age population groups has declined where ILI events are usually prevailing. Some limited epidemiological trials of inactivated and live (intranasal and oral) influenza vaccines produced in the former SU have been undertaken in early 1980s in Mongolia. Despite good seroconversion results of these vaccines, the epidemiological outcome was quite low.

5 Íÿìäàâàà, Ï., Àëòàíõóÿã, Ñ., Òóíãàëàãòóÿà, Ï., Áàòáîëä, ¨. (1988): Óëààíáààòàð õîòîä 1980-1986 îíä á¿ðòãýãäñýí àìüñãàëûí çàìûí öî÷ìîã õàëäâàðò ºâ÷íèé õàëäâàð ñóäëàëûí òºðõ, ¿¿ñãýã÷èéí á¿ðýëäýõ¿¿í, Ìîíãîëûí Àíàãààõ Óõààí, 3 (67): 19-34 [Nymadawa, P., Altankhuyag, S., Tungalagtuya, P., Batbold, Yo. (1988): Etiological features and etiological structure of acute respiratory infections registered in Ulaanbaatar city in 1980- 1986, Mongolian Medical Sciences, 3 (67): 19-34]; - Íÿìäàâàà, Ï. (1989): Çàáîëåâàåìîñòü âèðóñíûìè èíôåêöèÿìè è ïîïóëÿöèîííûé èììóíèòåò ê âèðóñàì (íà ïðèìåðå Ìîíãîëüñêîé Íàðîäíîé Ðåñïóáëèêè), Äîêëàä îáîáùàþùèé îïóáëèêîâàííûe ðàáîòû íà ñîèñêàíèå ó÷åíîé ñòåïåíè äîêòîðà ìåäèöèíñêèõ íàóê, Ìîñêâà, ñ.40-52 [Nymadawa, P. (1989): Viral infections and population immunity to viruses (on example of the Mongolian People’s Republic), Thesis for DSc(Med) Degree, Moscow, pp.40-52]; - Ìýíäñàéõàí, Æ., Òóíãàëàãòóÿà, Ï., Ãàíòºìºð, ×., Óóãàíæàðãàë, ×. (1994): Àìüñãàëûí çàìûí öî÷ìîã õàëäâàðûí ¿¿ñãýã÷èéí á¿ðýëäýõ¿¿í, “Âèðóñ ñóäëàëûí òóëãàìäñàí àñóóäëóóä” îíîë-ïðàêòèêèéí åñä¿ãýýð áàãà õóðàë, (èëòãýëèéí òîâ÷ëîë) íîìîíä, õ.5 [Mendsaikhan, J., Tungalagtuya, P., Gantumur, Ch., Uuganjargal, Ch. (1994): Etiological structure of acute viral respiratory infections, In: The Ninth Conference “Current topics of Virology” (Abstracts), pp.5; 49-50]; - Íÿìäàâàà, Ï., Ìýíäñàéõàí, Æ., Ãàíöýöýã, Ò. (1999): Ìîíãîë óëñàä òîìóóãèéí ýïèäåì ¿¿ñãýã÷ âèðóñèéí áèîëîãèéí òºðõ áà õóâüñàìæ, “Àíàãààõ óõààíû ýðäìèéí á¿òýýëèéí òîâ÷îîí-1998 îí” íîìîíä, õ.51-58 [Nymadawa, P., Mendsaikhan, J., Gantsetseg, T. (1999): Influenza activity in Mongolia in 1996-1998, In: Proceedings of Medical Research, pp. 51-58];

19 B5265G1 Annual Report – 2007/2008

Figure 7. Median ILI morbidity in Ulaanbaatar, Capital City of Mongolia in 1993-2005 Also, isolation of some atypical IV strains containing genes of PR8/34-strains from patients, domestic and wild birds, horses and camels has jeopardized further extension of IV vaccination trials, while PR8/34-strain was utilized in the SU for designing of fast growing industrial vaccine strains6. Due to lack of funds and also change of profile in PHI (former NIHEM) in the last part of 1990s the IV virological surveillance has been gradually died. Therefore in 2001 NIC activities were transferred to the newly established NCCD and the re-establishment of IV laboratory studies has been started.

6 Ëüâîâ, Ä.Ê., ßìíèêîâà, Ñ.Ñ., Øåìÿêèí, È.Ã., Àãàôîíîâà, Ë.Â., Ìÿñíèêîâà, È.À., Âëàäèìèðöåâà, Å.À., Íèìàäàâà, Ï., Äàøöåðåí, Ö., Áýõ-Î÷èð, Æ., Æäàíîâ, Â.Ì. (1982): Ïåðñèñòåíöèÿ ãåíîâ ýïèäåìè÷åñêèõ âèðóñîâ ãðèïïà (H1N1) â ïðèðîäíûõ ïîïóëÿöèÿõ, Âîïð.âèðóñîë. 27(4):17-21 [Lvov, D.K., Yamnikova, S.S., Shemyakin, I.G., Agafonova, L.V., Myasnikova, I.A., Vladimirtseva, E.A., Nymadawa, P., Dashtseren, Ts., Bekh-Ochir, Zh., Zhdanov, V.M., (1982): Persistence of genes of epidemic influenza viruses (H1N1) in natural population, Vopr. Virusol, 27(4):17-21]; - ßìíèêîâà, Ñ.Ñ., Íèìàäàâà, Ï., Ïåòðîâ Í.À., Âàñèëåíêî, Ñ.Ê., ßõíî, Ì.À., Ñåìåíîâà, Í.Ï., Ëüâîâ, Ä.Ê. (1991): Õàðàòåðèñòåêà âèðóñà ãðèïïà À (H1N1) ðîäñòâåííûõ À/PR/8/34, èçîëèðîâàííûõ â ÌÍÐ, Âîïð. âèðóñîë., 36 (3): 188-191[Yamnikova, S.S., Nymadawa, P., Petrov, N.A., Vasilenko, S.K., Yakhno, M.A., Semionova, N.P., Lvov, D.K. (1991): Characterization of influenza viruses (H1N1) derived from A/PR/8/34 isolated in MPR, Vopr. Virusol., 36(3):188-191] - Yamnikova, S.S., Mandler, J., Bekh-Ochir, Z., Dashtseren, Ts., Ludwig, S., Lvov, D.K., Scholtossek, C. (1993): A reassortant H1N1 influenza A virus caused fatal epizootics among camels in Mongolia, Virology, 1975 58-563; - Anchlan, D. (1995): Molecularepidemiologische Untersuchurgen an menschichen Influenza- A-Viren des Subtyps H1N1 aus der Mongolei, PhD Dissertation, Giessen, 1995. [Anchlan, D. (1995): Molecular-epidemiological studies on human influenza A(H1N1) strains from Mongolia, PhD Dissertation, Giessen, 119 pp.]; 20 Influenza Surveillance in Mongolia

2.2. Current Surveillance System

ILI surveillance is coordinated by NIC in NCCD. The surveillance was seasonal: from October 1 to May 31 next year till 2006/2007 season. By the order of the Minister of the Health, Mongolia starting from 2006/2007 season the ILI surveillance has been extended to cover whole year. The surveillance has 2 tiers: epidemiological and virological. Epidemiological surveillance is based on clinical diagnosis of ILI in outpatient and inpatient visits: • Routine weekly information ILI/all outpatient visits from all 21 provinces and 9 City-districts by phone, • Daily active reporting by phone ILI/all outpatient visits from 64 sentinel sites (2 National Centers and 20 FGPs in Ulaanbaatar city and 42 FGPs in 7 provinces: Selenghe, Dornogobi, Uvurkhangai, Khovd, Dornod, Orkhon and Darkhan-Uul, Figures 8 and 9). • Weekly active reporting by phone pneumonia hospitalizations/all patients from 15 sentinel sites (2 National Centers and 6 district hospitals in Ulaanbaatar city and 7 provincial hospitals in the above mentioned provinces, Figures 8 and 9) as a hospital-based sentinel site.

Figure 8. ILI Epidemiological Surveillance Structure in Mongolia

21 B5265G1 Annual Report – 2007/2008 1. National Center of Communicable Diseases 2. Maternal and Child Health Research Center Figure 9. ILI sentinel surveillance sites in Ulaanbaatar city

22 Influenza Surveillance in Mongolia

Virological surveillance is based on daily collection of samples from ILI patients visiting sentinel sites of UB and weekly transportation of samples from ILI patients visiting 78 sentinel sites in 7 provinces. VL in NIC/NCCD has capacity: • IV antigen detection by rapid immuniochromatographic tests, • ILI antigen detection by immunofl uorescent microscopy, • IV isolation in MDCK cell culture and embryonated hen’s eggs, • IV strain identifi cation and detection of signifi cant mutations of IV genes in RT-PCR, • Sequencing of IV genes, and • IV HA identifi cation and antibody titration in HIT.

2.3. Epidemiology of ILI in the last five seasons

2.3.1. Outpatient – based ILI surveillance

ILI events were relatively low in the last five (2003/04, 2004/05, 2005/06, 2006/07 and 2007/08) seasons (Figure 10) in comparison to the reported morbidities in 1980-1990s (see part 2.1). There were no countrywide big epidemics; however, it has been observed localized outbreaks of ILI events in different parts of the country.

Figure 10. ILI epidemiological and virological surveillance in the last five seasons in Mongolia

23 B5265G1 Annual Report – 2007/2008

In 2003/2004, 2004/2005 and 2005/2006 influenza seasons ILI morbidity peak has been observed mainly in December and January. In 2003/2004 influenza season ILI at the national level and in Ulaanbaatar were above the epidemic threshold from 47th week and reached maximum value during 48th and 49th week. In 2004/2005 ILI parameters were above the epidemic threshold from 44th week and reached maximum value during 51st and 52nd weeks. In 2005/2006 season ILI reached maximum value during 1st and 2nd weeks of 2006 and was above the epidemic threshold from 49th week until 4th week in 2006. But in 2006/07 and 2007/08 seasons the peaks have been shifted to February/March and a mild influenza epidemic were registered at the end of March 2007 and in end of February 2008. During last two seasons ILI at the national level and in Ulaanbaatar were reached maximum meaning at 11th, 12th weeks of 2007 and 7th and 8th weeks of 2008 (Figure 10). From 14th week of 2007 ILI morbidity has been decreased slowly and from 22nd week ILI has been decreased by 2 times in comparison with the same periods of previous years. From 9th week of 2008 ILI morbidity has been decreased slowly and from 16th week ILI has been registered under upper tolerant limits. At the national level there were registered approximately 737.9 ILI per 10,000 population per year with 6.5% of all registered outpatient visits in average in 2000-2007. In 2003/2004 at the national level there were registered approximately 753.8 ILI per 10,000 population, which consists 8.5 % of all registered outpatient visits. In 2004/2005 this indicator decreased up to 701.1. In 2005/2006 season the registered ILI morbidity has been decreased by 1.12% in comparison to the previous season. In 2006/2007 influenza season there have been registered 753.8 ILI per 10,000 population which consists 5.8% of all 3,309,421 outpatient visits. The registered ILI morbidity per 10,000 population was higher by 18.3 cases and percentage of outpatient visits with ILI was 0.3% lower in comparison with 2005/2006 season. In comparison with the average of the three previous seasons the registered morbidity per 10,000 population among children from 0-11 months old was higher by 265.6 cases, in age group from 1 to 4 years old-by 415.1 cases and in the age group from 5 to 9 years old by 147.3 cases. In 2007/08 influenza season there have been registered 745.1 ILI per 10,000 population which consists 4.8% of all 3,947,059 outpatient visits. ILI events have been relatively low in this season (1 October, 2007 to 1 June, 2008) in comparison to reported morbidities in the last four seasons. In 2007/08 influenza season ILI morbidity was lowest in comparison with the average of the last five seasons (Table 3). 24 Influenza Surveillance in Mongolia

Table 3 Comparative indicators of ILI surveillance in the last five seasons7

2003/04 2004/05 2005/06 2006/07 2007/08 Indicators season season season season season 1. Epidemiology ILI/ total outpatient 8.5% 7.2% 6.1% 5.8% 4.8% visits (%) Total 753.8 701.1 735.5 753.8 745.1 morbidity/10,000 Morbidity of 0-11 10,626.9 9,974.5 9,532.2 10,194.4 11,028.5 months olds /10,000 Morbidity of 1-4 2,375.0 2,629.7 2,645.4 2,932.0 2,997.8 years olds/10,000 Morbidity of 5-9 1,245.0 1,339.9 1,341.5 1,475.2 1,342.5 years olds/10,000 Morbidity of 10-15 903.2 697.5 769.1 827.2 701.5 years olds/10,000 Morbidity of 16-64 219.2 179.6 217.0 315.0 266.8 years olds/10,000 Morbidity of 65 year 694.4 349.8 427.8 323.8 340.9 and older/10,000 2. Laboratory Number of samples 701 1,112 2,728 5,0887 5,8237 collected IV antigen positive 0 144/1,112 0 0 0 /tested (%) (12,9%) IV isolation 4/113 13.0/144 161/2,728 513/5,088 198/5,823 /tested (%) (3.5%) (9.0%) (5.9%) (10.08%) (3.4%)

IV A(H1N1) [%] 0 8(61.5%) 2(1.2%) 144 (28%) 1(0.5%) IV A(H3N2) [%] 4(100%) 5(38.5%) 159(98.8%) 12 (2.3%) 72(36.2%) IV B [%] 0 0 0 357 (69.6%) 125(63.1%) IFM: positive/tested 117/985 (%) (11,9%)

Influenza A 30(25.6%) Influenza B Not 14(11.9%) tested RS Virus Not tested Not tested Not tested 18(15.38%) Adenovirus 20(17.09%) Parainfluenza virus 1 10(8.54%) Parainfluenza virus 2 7(5.98%) Parainfluenza virus 3 18(15.38%)

7 This number is the part of samples collected in the influenza season (September 2006-June 2007) of all collected samples. 25 B5265G1 Annual Report – 2007/2008

The morbidity per 10,000 population among children from 0 to 11 months old was higher by 2,663.6 cases, in age group from 1 to 4 years old – by 810.9 cases and in the age group from 5 to 9 years old by – 262.0 cases. The registered ILI morbidity per 10,000 population was lower by 8.7 cases and percentage of outpatient visits with ILI was 1.0% lower in comparison with 2006/07 season. The laboratory surveillance during the period under the description has been expanded dramatically thanks to the activities through this USA/Mongolia Cooperative Agreement: number of samples, collected has increased from 701 (2003/2004 season) up to 5,823 (2007/2008 season). If in 2003/2004 season have been isolated 4 viruses, in 2007/2008 season have been isolated 198 influenza viruses, almost 50 times more. In 2007/2008 season a testing for antigen of influenza A, B and other respiratory viruses (RSV, Parainfluenza 1,2,3 and adenoviruses 4) by IFM using mixed hybrid cell culture (R-Mix, DHI, USA) was introduced and 117 viruses have been detected by this method. In 2004/2005 season collected samples have been increased by 411, IV antigen detection by 1,112 and IV isolation by 3.2 times in comparison with the previous year. All collected nasal swabs were studied for influenza virus (IV) antigen detection by BD Directigen Flu A+B test kits. 144 (12.9%) samples were positive by this methods and 141 (97.9%) were influenza A and 3 (2.1%) were influenza B. All IV positive specimens were inoculated into MDCK cell culture and 13 viruses were isolated. All of them were influenza A viruses by RT-PCR8. The study of antigenic variants of influenza viruses was successfully conducted alongside with surveillance activity during the last five influenza seasons in Mongolia. In 2003/04 season the majority of A(H3N2) viruses were antigenetically similar to A/Moscow/10/99, A/Kumamoto/102/2002 and A/Wyoming/03/2003 viruses which are A (H3N2) vaccine component recommended for that period. A strain A/Mongolia/18/2003 (H3N2) has had weak reaction with the reference sera to vaccine strains by the antigenic property (Table 4).

8 Äàðìàà, Á., Áóðìàà, À., Äàøöýðýí, Ë., Ýíõñàéõàí, Ä., Òóóë, Ð., Íÿìäàâàà, Ï.(2005): 2004-2005 îíû õ¿éòíèé óëèðàëä Ìîíãîëûí õ¿í àìûí äóíä ýðãýëòýíä áàéñàí òîìóóãèéí âèðóñèéã òàíäàí ñóäàëñàí ä¿í, Õàëäâàðò ºâ÷èí ñóäëàëûí Ìîíãîëûí ñýòã¿¿ë, ¹4(7): 2-5; [B.Darmaa, A.Burmaa, L.Dash-tseren, D.Enkhsaihan, R.Tuul, P. Nymadawa (2005): Influenza viruses circulating in the population of Mongolia in 2004/2005 cold season, Mongolian Journal of Infections Diseases, 4(7): 2-5; English abstract on p.69;]

26 Influenza Surveillance in Mongolia

Table 4 HIT identification of Mongolian IV A(H3N2) strains isolated in 2003/2004 season (negative titers)

Reference antisera

No Reference antigens A/Moscow/10/99 A/Chile/6416/2001 A/Panama/2007/99 A/Wyoming/03/2003 A/Ishikawa/102/2002 A/Hong ong/1550/2002 A/Kumamoto/102/2002

1 A/Wyoming/03/2003 640 1280 640 160 160 320 80 2 A/Ishikawa/102/2002 320 640 640 160 160 320 80 3 A/Kumamoto/102/2002 640 2560 1280 320 320 1280 160 4 A/Panama/2007/99 80 640 640 640 80 640 160 5 A/Moskow/10/99 80 320 1280 320 2560 1280 320 6 A/Hong Kong/1550/2002 320 640 1280 1280 2560 5120 640 7 A/Chile/6416/2001 80 320 640 320 640 2560 640 Test antigens 1 A/Mongolia/15/2003 320 320 640 80 80 320 80 2 A/Mongolia/18/2003 160 160 160 80 40 160 40 3 A/Mongolia/96/2003 320 640 2560 1280 2560 5120 1280 4 A/Mongolia/416/2004 640 1280 1280 320 20 320 40

10 of 13 IV strains isolated in 2004/2005 season were identified at the CDC (Table 5 and 6)9. Among the IV isolates were dominating A/ New Calidonia/20/99-like strains.

9 NIC is thankful to Drs A. Klimov PhD, Chief, Strain Surveillance Section, Influenza Branch, CDC, J.M. Katz, Ph.D, Team Leader, Immunology and Viral Pathogenesis Unit, Influenza Branch/CDC for the kind performance of this identification.

27 B5265G1 Annual Report – 2007/2008

Table 5 HIT identification of Mongolian IV A (H1N1) strains isolated in 2004/2005 season (negative titers)

Reference ferret antisera

No Reference antigens A/Beijing A/New A/Hawaii/ /262/95 Caledona/20/99 15/2001 1 A/Beijing/262/95 320 640 80 2 A/New Caledonia/20/99 160 640 80 3 A/Hawaii/15/2001 0 20 160 Test antigens 1 A/Mongolia/344/04 160 1280 160 2 A/Mongolia/388/04 160 1280 160 3 A/Mongolia/565/04 80 640 80 4 A/Mongolia/757/04 320 1280 160 5 A/Mongolia/327/04 160 640 80

Table 6 HIT identification of a Mongolian IV A (H3N2) strain isolated in 2004/2005 season (negative titers)

Reference ferret antisera No Reference antigens A/Wyoming/ A/California/ A/New York/ 3/2003 07/2004 55/2004 1 A/Wyoming/03/2003 640 160 80 2 A/California/07/2004 320 640 320 3 A/New York/55/2004 320 640 640 Test antigen 1 A/Mongolia/333/04 640 640 640

In 2005/06 season the samples tested were increased more than 2 times in comparison to the previous season and the isolated IVs were also increased by 12.4 times. In 2005/2006 season VL, NCCD has collected 2,728 samples from ILI patients and isolated 161 strains of IV which marked an increase by 1,616 of collected samples, and an elevation by 12.4 times of the isolated IV strains (Table 3). By RT-PCR it has been characterized as A(H1N1) of 2(3.1%) strains and 159(96.9%) strains as A(H3N2). By HIT 2 strains of A(H1N1) were identified as A/New Calidonia/20/99-like, and 108(70.9%) strains of 153 tested A(H3N2) isolates were A/New York/55/2004(H3N2)-like, and 7(4.5%) strains were low reactors to the vaccine strain of A(H3N2)( Table 7,8,9). 28 Influenza Surveillance in Mongolia

However, a serological surveillance using sera from practically healthy people from UB and Dornogobi province collected in January- March, 2005 has shown also active circulation of IV A(H3N2) and B strains. Table 7 HIT identification of Mongolian IV A (H3N2) strains isolated in 2005/2006 season (negative titers)

Reference ferret antisera

Reference antigens 6705 5205 1/2004 Sample 03/2003 NY5504 0704/No1 Wisconsin Hiroshima California/ Wellington/ Gunma 1605 A/Wyoming/ collected date

A/Wyoming/03/2003 640 640 320 640 160 160 320 - Wellington/1/2004 320 1280 320 640 640 320 640 1/26/04 California/0704/No1 160 1280 640 1280 640 320 640 - A/New York/55/04 320 1280 1280 5120 1280 640 1280 - A/GUNMA/16/2005 160 640 80 80 640 40 80 1/17/05 A/Hiroshima/52/2005 80 320 640 640 320 1280 1280 10/24/05 A/Wisconsin/67/2005 160 640 640 640 320 640 2560 - Test antigens 1 A/Choibalsan/2083/05 320 1280 2560 2560 1280 2560 5120 12/21/05 2 A/Ulaanbaatar/2164/05 320 640 2560 1280 640 2560 5120 12/23/05 3 A/Ulaanbaatar/1922/05 320 1280 2560 1280 640 2560 5120 12/14/05 4 A/Sainshand/0080/2006 320 1280 2560 1280 1280 2560 5120 1/3/06 5 A/Choibalsan/0170/06 320 640 2560 1280 320 2560 2560 1/7/06 6 A/Khovd/0262/06 320 1280 2560 1280 1280 2560 5120 1/10/06 7 A/Khovd/0269/06 320 1280 2560 1280 1280 2560 5120 1/6/06 8 A/Arvaikheer/0510/06 160 1280 2560 1280 640 2560 2560 1/23/06 9 A/Ulaanbaatar/0006/06 320 640 2560 1280 640 1280 2560 1/6/06 10 A/Sukhbaatar/1568/05 320 640 1280 640 640 1280 2560 11/28/05 11 A/Ulaanbaatar/0003/06 160 320 640 640 320 640 1280 1/3/06 12 A/Sainshand/0075/06 160 160 640 640 160 640 640 1/2/06 13 A/Arvaikheer/2094/05 80 160 640 320 80 320 640 12/2/05 14 A/Ulaanbaatar/1599/05 160 80 320 320 40 160 320 11/29/05

29 B5265G1 Annual Report – 2007/2008

Table 8

HIT identification of Mongolian IV A (H3N2) strains isolated in 2005/2006 season (negative titers)

Reference ferret antisera Reference antigens Sample date CA/7 NY/55 WI/67 HIR/52

1 A/California/07/2004 640 320 640 160 - 2 A/New York/55/2004 640 320 640 320 - 3 A/Wiskonsin/67/2005 160 320 2560 640 - 4 A/Hiroshima/52/2005 80 160 2560 1280 - Test antigens 1 A/Ulaanbaatar/1806/2005 80 80 320 160 12/1/2005 2 A/Choibalsan/2076/2005 320 640 2560 640 12/20/2005 3 A/Choibalsan/2079/2005 80 160 320 160 12/20/2005 4 A/Ulaanbaatar/1575/2005 320 160 NT NT 11/28/2005 5 A/Sukhbaatar/1580/2005 320 320 NT NT 11/29/2005 6 A/Sukhbaatar/1587/2005 320 320 NT NT 12/7/2005 7 A/Sainshand/1589/2005 320 160 NT NT 11/28/2005 8 A/Arvaikheerr/2101/2005 320 160 NT NT 12/21/2005 9 A/Sukhbaatar/1991/2005 160 160 NT NT 12/21/2005

Table 9 HIT identification of Mongolian IV A (H1N1) strains isolated in 2005/2006 seasons (negative titers)

Reference ferret antisera Reference antigens Sample date BJ/262 NC/20 A/HI/15

1 A/Beijing/ 262/95 320 320 80 1/9/1995 2 A/New Caledonia/ 20/99 160 1280 80 6/9/1999 3 A/Hawaii/ 15/2001 20 40 160 2/17/2001 Test antigens 1 A/Ulaanbaatar/ 1429/2005 320 1280 160 11/17/2005 2 A/Arvaikheer/ 1446/2005 320 1280 160 11/16/2005

During the period of 15 September, 2006 to 14 September, 2007 VL, NCCD has collected and processed 7,08510 nasopharyngeal samples from patients with ILI from 78 ISSSs.

10 From the period of 15 September, 2006 to 14 September, 2007 VL has started whole year round influenza virus surveillance. This data includes the data of samples, collected during summer season also. 30 Influenza Surveillance in Mongolia

All specimens were inoculated in to MDCK cell lines and embryonated chicken eggs, and have been isolated 513 (7.0%) influenza viruses. Of these 156 (30.3%) were influenza A and 375 (69.6%) were influenza B viruses by RT-PCR. Among the influenza A isolates 144 (28%) were A(H1N1) and 12 (2, 3%) were A(H3N2) viruses (Figure 10, and Table 3). 5,908(76, 3%) of all samples were collected from outpatient visits. Of these samples were isolated 441 (8,0 %) influenza viruses. 9 influenza strains were isolated in embryonated eggs and they were all A(H1N1) by RT-PCR. 18(3.8%) influenza strains were sent to CDC, USA and 21(4.5%) influenza strains have been sent to WHO CC, NIID, Tokyo, Japan and the results were received back during the 2006/2007 influenza season. In the 2006/2007 season there were co-circulated A(H1N1), A(H3N2) and B viruses (Figure 10). The antigenecity of influenza strains has been determined by a HI test using WHO surveillance kits (Tables 10, 11, 12).

Table 10 HIT identification of Mongolian IV A (H1N1) strains isolated in 2006/2007 season (negative titers)

Reference antisera Strains Sample date New Cal 20/99 Solomon Islands Lot.05 /3/2006 0306 Lot.2 1 A/New Caledonia/20/99 1280 160 2 A/Solomon Islands/3/2006 160 640 Test antigens 1 A/Khovd/0333/07 1/9/2007 640 80 2 A/Ulaanbaatar/0845/07 1/24/2007 160 80 3 A/Ulaanbaatar/0665/07 1/29/2007 640 320 4 A/Ulaanbaatar/97/07 1/4/2007 320 80 5 A/Ulaanbaatar/116/07 1/3/2007 640 80 6 A/Ulaanbaatar/0848/07 1/29/2007 640 80 7 A/Sukhbaatar/0927/07 1/31/2007 40 320 8 A/Sainshand/1136/07 2/6/2007 40 320 9 A/Ulaanbaatar/1227/07 2/13/2007 80 640 10 A/Ulaanbaatar/2212/07 3/13/2007 40 320

31 B5265G1 Annual Report – 2007/2008

Table 11 HIT identification of Mongolian IV A (H3N2) strains isolated in 2006/2007 season

Reference antisera Reference antigens NY HIR Sample date WY WELL CA /55/04 /52/05 1 A/Wyoming/03/2003 640 640 320 640 160

2 A/Wellington/1/2004 320 1280 320 640 320 1/26/04

3 A/California/07/2004 160 1280 640 1280 320

4 A/New York/55/04 320 1280 1280 5120 640

6 A/Hiroshima/52/2005 80 320 640 640 1280 10/24/05

Test antigens 1 A/Ulaanbaatar/1106/2007 L 80 80 80 80 160 2/6/2007

2 A/Ulaanbaatar/1085/2007 L 320 20 160 80 160 2/6/2007

Table 12 HIT identification of Mongolian IV B strains isolated in 2006/2007 season

Reference antisera Reference antigens Sampling date B/Sh/ B/Fl/ B/Mal/ B/Ohio/ 2002 2004 2004 2005 1 B/Shanghai/361/ 2002 2002/12/06 1280 1280 80 <10 2 B/Florida/7/2004 2004/11/24 1280 1280 80 <10 3 B/Malaysia/2506/2004 <10 10 2560 80 4 B/Ohio/01/2005 <10 <10 1280 80 Test antigens 1 B/Arvaikheer/2476/2007 2007/03/14 640 160 10 <10 2 B/Orchon/2505/2007 2007/03/15 640 80 10 <10 3 B/Ulaanbaatar/2373/2007 2007/03/13 640 40 <10 <10 4 B/Ulaanbaatar/2263/2007 2007/03/12 <10 <10 320 <10 5 B/Ulaanbaatar/1924/2007 2007/03/06 <10 <10 320 <10 6 B/Ulaanbaatar/2232/2007 2007/03/13 <10 <10 320 <10 7 B/Ulaanbaatar/2202/2007 2007/03/12 <10 <10 320 <10 8 B/Sukhbaatar/2488/2007 2007/03/14 <10 <10 320 <10 9 B/Ulaanbaatar/1885/2007 2007/03/05 80 10 20 1280 10 B/Choibalsan/2276/2007 2007/03/12 5 5 160 160

32 Influenza Surveillance in Mongolia

10 A(H1N1), 17 A(H3N2) and 8 B strains were chosen for HA gene sequence analyses in WHO CC CDC, Atlanta, USA and NIID, Tokyo, Japan. The phylogenetic tree of A(H1N1) strains shown that some strains isolated in 2007 were closely related to A/Solomon Islands/03/ 2006(H1N1) and some strains isolated in 2004 and 2005 were related to A/New Caledonia/20/99(H1N1) (Figure 11).

Figure 11. Genetic relatedness of HA gene of A (H1N1) strains isolated in Mongolia in 2007 33 B5265G1 Annual Report – 2007/2008

In the phylogenetic tree of the B strains there were 2 major clades representing the B/Vic and the B/Yam lineages (Figure 12). The HA1 sequences of 5 viruses isolated in Mongolia were closely related to the Victoria lineages, 3 strains belonged to Yamagata lineages (B/Florida/7/2004).

Figure 12. Genetic relatedness of HA gene of influenza B type viruses isolated in Mongolia in 2007

37 of the sequenced HA genes of influenza strains were deposited in GeneBank the accession numbers are listed in Table 13. HA gene sequences of influenza viruses used for phylogenetic analyses were downloaded from the Influenza Virus Resources available through GenBank (http://www.ncbi.nlm.nih.gov/genomes/FLU). 34 Influenza Surveillance in Mongolia

Table 13 Gene bank accession numbers of the genes of the Mongolian strains

HA gene NA gene ¹ Sequenced strains Lab ID accession accession number number 1. A/Mongolia/15/2003(H3N2) ISDN303123 2. A/Mongolia/18/2003(H3N2) ISDN303124 3. A/Mongolia/96/2003(H3N2) ISDN303125 4. A/Mongolia/416/2004(H3N2) ISDN303126 5. A/Choibalsan/2083/2005(H3N2) ISDN140668 EU501628 6. A/Sukhbaatar/1568/2005(H3N2) ISDN140712 EU501780 7. A/Ulaanbaatar/1599/2005(H3N2) ISDN140716 EU501818 EU791294 8. A/Ulaanbaatar/1922/2005(H3N2) ISDN140717 EU501819 9. A/Ulaanbaatar/2164/2005(H3N2) ISDN140718 EU501820 10. A/Arvaikheer/0510/2006(H3N2) ISDN303127 11. A/Khovd/0262/2006 (H3N2) ISDN140698 12. A/Khovd/0269/2006(H3N2) ISDN140699 EU791289 13. A/Ulaanbaatar/0003/2006(H3N2) ISDN140714 14. A/Ulaanbaatar/0006/2006(H3N2) ISDN140715 15. A/Ulaanbaatar/1809/2007(H1N1) ISDN256630 EU791308 16. A/Ulaanbaatar/1830/2007(H1N1) ISDN240667 EU791302 17. A/Orkhon/1901/2007(H1N1) ISDN240668 EU791304 18. A/Sainshand/1142/2007(H1N1) ISDN240666 EU791300 19. A/Ulaanbaatar/1094/2007(H1N1) ISDN240665 EU791298 20. A/Ulaanbaatar/1380/2007(H3N2) ISDN241545 EU791306 21. B/Arvaikheer/2476/2007 ISDN240705 EU791320 EU791322 22. B/Orchon/2505/2007 ISDN240729 EU791321 EU791323 23. B/Sukhbaatar/2488/2007 ISDN240702 EU791318 EU791324 24. B/Ulaanbaatar/1924/2007 ISDN240699 EU791316 EU791325 25. B/Ulaanbaatar/2202/2007 ISDN240701 EU791317 EU791326 26. B/Ulaanbaatar/2232/2007 ISDN240700 EU791314 EU791327 27. B/Ulaanbaatar/2263/2007 ISDN240698 EU791315 EU791328 28. B/Ulaanbaatar/2373/2007 ISDN240703 EU791319 EU791329 29. A/Mongolia/327/2004(H1N1) ISDN128413 30. A/Ulaanbaatar/1429/2005 (H1N1) ISDN130903 31. A/Arvaikheer/2101/2005(H3N2) ISDN133348 32. A/Sukhbaatar/1587/2005(H3N2) ISDN133349 33. A/Ulaanbaatar/116/2007(H1N1) ISDN238644 34. A/Ulaanbaatar/2212/2007(H1N1) ISDN256047 35. A/Ulaanbaatar/0957/2007(H1N1) ISDN256060 36. A/Ulaanbaatar/1106/2007(H3N2) ISDN242937 37. B/Ulaanbaatar/1885/07 ISDN243497 35 B5265G1 Annual Report – 2007/2008

In the 2007/2008 season VL has collected 5,823 samples and all samples were processed for influenza virus isolation. There were isolated 198(3.4%) influenza strains and 125(63.1%) were B and 73(36.7%) were A viruses (Table 3). 985(16.9%) of all collected samples were tested for antigens of other respiratory viruses (Infl uenza A,B, RSV, Adenovirus, Parainfl uenza 1,2, and 3) detection by IFM using mixed hybrid cell culture (R-Mix, DHI, USA). There were detected 117 (11.9%) positive samples. HI test results of representative strains of 2007/2008 season shown in the table 14, 15 and 16. One A(H1N1) strain of 2008 was related antigenically to A/ Brisbane/59/2007 which is the WHO recommended strain for the 2008- 2009 Northern Hemisphere vaccine formulation (Table 14). The A(H3N2) isolates of 2007/2008 were characterized as antigenically similar to A/Wisconsin/67/2005, a vaccine strain for 2006- 07 influenza season. Some isolates have reduced titers with antibodies against A/Wisconsin/67/2005 and A/Brisbane/10/2007 vaccine strain, such as A/Ulaanbaatar/1600/08(H3N2) virus (Table 15).

Table 14

HIT identification of a Mongolian IV A (H1N1) strain isolated in 2007/2008 season

Reference antisera Reference serum A/SOLOMON A/BRISBANE/ COLLECTED DATE ISLANDS/03/2006 59/2007 A/SOLOMON 1 640 320 8/21/2006 ISLANDS /03/2006

2 A/BRISBANE /59/2007 320 320 7/1/2007 Test antigen

A/ULAANBAATAR 1 160 320 1/23/2008 /0607/08

36 Influenza Surveillance in Mongolia

Table 15 HIT identification of Mongolian IV A (H3N2) strains isolated in 2007/2008 season

Reference antisera Reference antigens A/WISCONSIN/ A/BRISBANE/ COLLECTED 67/2005 10/2007 DATE 1 A/WISCONSIN/67/2005 1280 640 8/31/2005 2 A/BRISBANE/10/2007 1280 1280 2/6/2007 Test antigens 1 A/SAINSHAND/0643/08 320 320 1/21/2008 2 A/ULAANBAATAR/0598/08 40 160 1/22/2008 3 A/ULAANBAATAR/1600/08 80 80 2/13/2008 4 A/DARKHAN/2695/2008 80 320 2008/03/04 5 A/ARVAIKHEER/2796/2008 40 160 2008/03/04

Table 16 HIT identification of Mongolian IV B strains isolated in 2007/2008 season

Reference antisera Reference antigens B/FL/ B/BRIS/ B/OH/ B/MAL/ COLLECTED 04/2006 03/2007 01/2005 2506/2004 DATE B/FLORIDA/04/2006 640 320 40 80 11/1/2006 B/BRISBANE/03/2007 640 640 40 80 3/9/2007 B/OHIO/01/2005 5 5 2560 640 2/23/2005 B/MALAYSIA/2506/2004 5 5 2560 1280 6/12/2004 Test antigens 1 B/ULAANBAATAR/0249/08 320 320 160 80 1/8/2008 2 B/SUKHBAATAR/0330/08 640 640 160 160 1/14/2008 3 B/ULAANBAATAR/0590/08 320 320 80 80 1/21/2008 4 B/ULAANBAATAR/0678/08 640 640 160 160 1/23/2008 5 B/ULAANBAATAR/0856/08 320 320 320 80 1/28/2008 6 B/ULAANBAATAR/0872/08 320 320 160 80 1/28/2008 7 B/SUKHBAATAR/0914/08 320 160 320 80 1/29/2008 8 B/ULAANBAATAR/1117/08 320 320 160 80 2/1/2008 9 B/ULAANBAATAR/1175/08 320 320 160 160 2/4/2008 10 B/ULAANBAATAR/1247/08 320 320 160 80 2/4/2008 11 B/ULAANBAATAR/1117/08 640 640 160 80 2/1/2008 12 B/ULAANBAATAR/1525/08 320 160 160 80 2/11/2008 13 B/ULAANBAATAR/1568/08 320 320 320 160 2/13/2008 14 B/ORKHON/2536/08 320 320 160 160 2/26/2008 15 B/ULAANBAATAR/2481/08 320 320 80 80 2/27/2008

37 B5265G1 Annual Report – 2007/2008

B viruses predominated at the end of the season and HI test results shown that the most isolates were related antigenically to B/ Florida/04/2006-like virus :B/Yamagata lineage (Table 16). 4 shipments were sent to WHO CCs: 21 strains to CDC, Atlanta, USA, 10 strains to NIID, Tokyo, Japan and the results have been received back during 2007/2008 season.

2.3.2 Hospital-based pneumonia surveillance

Since 2006/07 influenza season has been started a hospital based- surveillance on pneumonia in the selected sentinel sites (7 provinces: Darkhan-Uul, Dornogovi, Dornod, Ovorkhangai, Orkhon, Selenghe, Khovd and 6 UB District general hospitals, MCHRC and NCCD in Ulaanbaatar city). During two seasons under description we have observed totally 21,983 cases of pneumonia with 85(0.4 %) mortality cases in the selected 15 hospitals. Mainly mortality cases were registered during the influenza epidemic period. 82.4% of all mortality cases were registered in under 4 years olds (Figure 13).

Figure 13. Hospital-based surveillance on pneumonia in the last two seasons in Mongolia VL has collected 1,718 samples from hospitalized patients and isolated 72(4,1%) influenza viruses in the 2006/07 influenza season (Table 17). Among them 50(69.4%) were influenza B isolates, 19 (26.3%) were A(H1N1) and 3(4.1%) were A(H3N2) viruses (Table 17).

38 Influenza Surveillance in Mongolia

Table 17 Results of hospital-based pneumonia surveillance in Mongolia in 2006/07 and 2007/08 seasons

Indicators 2006/2007 2007/2008

1. Epidemiology

Total hospital admissions 159,364 160,434 (in the selected sites-7 provinces and UB) Total pneumonia admission (%) 11,026(6.9%) 10,957(6.8%) Total pneumonia mortality number (%) 52(0.5%) 33(0.3%) Pneumonia mortality in 0-4 years old (%) 43(82.7%) 27(81.8%) Pneumonia mortality in 5-9 years old (%) 0(0.0%) 2(6.1%) Pneumonia mortality in10-19 years old (%) 3(5.8%) 0(0.0%) Pneumonia mortality in 20-59 years old (%) 6(11.5%) 1(3.0%) Pneumonia mortality in 60 and older ages (%) 0(0.0%) 3(9.1%)

2. Laboratory

Number of samples collected 1,718 2,126 IV isolation / tested (%) 72/1,718(4.1%) 22/2,126(1.03%)

IV A(H1N1) (%) 19 (26.3%) 0 IV A(H3N2) (%) 3(4.1%) 7(31.8%) IV B(%) 50(69.4%) 15(68.2%) Antigen detection by IFM (Total) 60/545(11%)

Influenza A 12(20%) Not tested Influenza B 3(5%) RSV 14(23.3%) Adenovirus 14(23.3%) Parainfluenza viruses 17(28.3%)

During the 2007/2008 season 2,126 samples were collected from hospitalized patients and all samples were inoculated to MDCK cells for infl uenza virus isolation. We have isolated 22(1.03%) infl uenza viruses. Of these 7(31.8%) were infl uenza A(H3N2) and 15(68.2%) infl uenza B viruses by RT-PCR. 545(25.6%) of all samples were inoculated in to Mixed Cell Culture (R-Mix, DHI, USA) for other respiratory virus detection by IFM. There were 60(11%) positive: 12(20%) infl uenza A, 3(5%) infl uenza B, 14(23.3%) RSV, 14(23.3%) adenovirus and 17(28.3%) parainfl uenza viruses respectively (Table 17).

39 B5265G1 Annual Report – 2007/2008

2.3.3. Laboratory Quality Assurance VL has started participating in WHO EQAP from the beginning of 2007. The first panel was not received due to difficulties encountered with transportation of samples. VL has received the Panel 2, Panel 3 and Panel 4 for the detection of influenza virus type A by PCR in the coded samples prepared in the Virology Division, Centre for Health Protection, Public Health Laboratory Center, Hong Kong SAR, China. The coded samples of the panels were analyzed by conventional RT- PCR and real time RT-PCR for a detection of A/M, A/H1, A/H3, A/ H5, B/NP, N1 and N2 target genes using in-house reagents and primers. VL has been reported back the results within the specified time periods and received the reports of all panels (Tables 18, 19, 20).

Table 18 Excerpts from WHO EQAP 2nd Panel Report Lab code: 151 (VL, NCCD, Mongolia) Summary of your reported results:

Sample ID Intended result Your result 2007-11 H5 H5N1 2007-12 H5 H5N1 2007-13 H3 H3N2 2007-14 H5 H5N1 2007-15 NEG FluA Neg 2007-16 H5 H5N1 2007-17 H1 H1N1 2007-18 NEG FluA Neg 2007-19 H5 nontypeable (H5 Neg) 2007-20 H5 H5N1 2007-21 NEG FluA Neg 2007-22 H5 H5N1 2007-23 H5 H5N1 2007-24 NEG FluA Neg

Note: ‘NEG’ denotes negative. Comments: Failure to detect low concentration clade 1 H5 strain: - review the H5 gene primers/probes for clade 1 H5 strain

40 Influenza Surveillance in Mongolia

Table 19

Excerpts from WHO EQAP 3rd Panel Report Lab code: 151 (VL, NCCD, Mongolia) Data of your laboratory received the panel: 1/18/2008 Data of your laboratory reported results: 2/15/2008 Your TAT (day): 28 Summary of your reported result:

Sample ID Intended result Your result

2008-01 H5 H5 2008-02 H5 H5 2008-03 H5 H5 2008-04 Negative FluA Neg 2008-05 H5 H5 2008-06 H1 H1 2008-07 H5 H5 2008-08 Negative FluA Neg 2008-09 H5 H5 2008-10 H3 H3

Comments: You have reported all correct results.

41 B5265G1 Annual Report – 2007/2008

Table 20 Excerpts from WHO EQAP 4th Panel Report Lab code: 151 (VL, NCCD, Mongolia)

Data of your laboratory received the panel (dd/mm/yyyy): 14/07/2008 Data of your laboratory reported results: 18/07/2008 Your TAT (day): 4

Summary of your reported results:

Sample ID Intended result Your result 2008-11 H5 H5 2008-12 H5 H5 2008-13 H5 H5 2008-14 H1 H1 2008-15 H5 H5 2008-16 H5 H5 2008-17 H5 H5 2008-18 H3 H3 2008-19 Negative FluA Neg 2008-20 Negative FluA Neg

Comments: You have reported all correct results.

42 Cooperative Agreement Implementation

THREE. COOPERATIVE AGREEMENT IMPLEMENTATION

3.1. Project Goal: To strengthen Influenza Surveillance Network in Mongolia.

3.2. Project objectives:

1. To strengthen coordination and collaboration activities in influenza surveillance 2. To strengthen influenza reporting system 3. To strengthen influenza clinical surveillance activities. 4. To strengthen influenza laboratory surveillance network and activities 5. To strengthen sentinel surveillance of influenza 6. To strengthen influenza outbreak response system 7. To strengthen influenza surveillance activities in animals 8. To monitor and evaluate activities on influenza surveillance 9. To promote international collaboration on influenza surveillance

3.3. Project Implementation Status as September 14, 2006

3.3.1 Strengthen coordination and collaboration activities

By the order No. 241 of the Minister of Health, Mongolia, issued on November 17, 2004 have been established: - IST with the chair of Director-General, NCCD (Annex 1 and Figure 14), - ISAC with the chair of President, Mongolian Academy of Medical Sciences, including representatives of MoH, MoFA, CIDNF and CVL (Annex 2 and Figure 14), - Sentinel sites based on 20 FGPs in Ulaanbaatar City (Annex 3), - Sentinel sites based on 24 FGPs in Uvurhangai, Dornogovi, Khovd, Dornod and Selenghe provinces (Annex 4). With this organizational structure, as the and of 2005 more than 350 personnels are dealing every day with ILI surveillance activities (Figures 15-56).

43 B5265G1 Annual Report – 2007/2008

Figure 14. A joint meeting of IST and ISAC (April 2005) From left to right: D. Tserennorov, CIDNF; Dr. N. Tsend, NCCD; Dr. O. Oyunchimeg, UB Health Department; Dr. R. Tuul, NCCD; Ass.Prof. G. Zulkhuu, HSUM; Prof. T. Altantsetseg, NCCD; IST Chair; Prof. P. Nymadawa, MAS, ISAC Chair; Prof. T. Erkhembaatar, MCHRC; Dr. L. Dashtseren, NCCD; Dr. T. Navchaa, NCCD; Ass. Prof. J.Bekh-Ochir, VRI;

44 Cooperative Agreement Implementation

Figure 15: ISSS,UB, Bayanzurkh Figure 16: ISSS, UB, Bayanzurkh District, FGP „Nasan-Urt“ District, FGP „Amgalan-Itgehui“

Figure 17: ISSS,UB,Bayanzurkh Figure 18: ISSS,UB, Khan-Uul District, FGP „Eruul-Urkh“ District, FGP „Enkh-Titem“

Figure 19: ISSS, UB, Khan-Uul Figure 20: ISSS, UB, Khan-Uul District, FGP „Manal-Uils“ District, FGP „Amin-Tus“

45 B5265G1 Annual Report – 2007/2008

Figure 21: ISSS, UB, Figure 22: ISSS, UB, Songinokhairkhan District, FGP Songinokhairkhan District, FGP „Buyant Manal“ „Enkh-Elberel”

Figure 23: ISSS, UB, Figure 24: ISSS, UB, Bayangol Songinokhairkhan District, FGP District, FGP „Gurvan Sanchir“ „Une-Achit”

Figure 25: ISSS, UB, Bayangol Figure 26: ISSS, UB, Bayangol District, FGP „Itgel Ugtah” District, FGP „Shar Degd”

46 Cooperative Agreement Implementation

Figure 27: ISSS, UB, Chingeltei Figure 28: ISSS, UB, Chingeltei District, FGP „Tumen Jargalan“ District, FGP „Tegsh Ulzii“

Figure 29: ISSS, UB, Chingeltei Figure 30: ISSS, UB, Sukhbaatar district, FGP „Uils Negten“ District, FGP „Sankoll“

Figure 31: ISSS, UB, Sukhbaatar Figure 32: ISSS, UB, Sukhbaatar District, FGP „Enkh-Sunder“ District, FGP „Tegsh-Mend“

47 B5265G1 Annual Report – 2007/2008

Figure 33: ISSS, Dornogobi province, Figure 34: ISSS, Dornogovi province, FGP „Goyo-Mend“ FGP „Misheelt Mana“

Figure 35: ISSS, Dornogovi Province, Figure 36: ISSS, Dornogovi Province, FGP „Railway“ FGP „Agatova“

Figure 37:ISSS, Selenghe Province, Figure 38: ISSS, Selenghe Province, FGP „ Egneshgui“ FGP „ Khadankhui“

48 Cooperative Agreement Implementation

Figure 39: ISSS, Selenghe Province, Figure 40: ISSS, Selenghe Province, FGP „Nomtkhan“ FGP of Sukhbaatar II

Figure 41: ISSS, Selenghe Province, Figure 42: ISSS, Khovd Province, FGP „Zovlokh bag“ FGP „Baatarkhairkhan“

Figure 43: ISSS, Khovd Province, Figure 44: ISSS, Khovd Province, FGP „Bugat“ FGP „Jargalant“

49 B5265G1 Annual Report – 2007/2008

Figure 45: ISSS, Khovd Province, Figure 46: ISSS, Khovd Province, FGP „Rashaant“ FGP „Buyant“

Figure 47: ISSS, Uvurkhangai Figure 48: ISSS, Uvurkhangai Province, FGP „Narny Dusht“ Province, FGP „Uyan-Setgel“

Figure 49: ISSS, Uvurkhangai Figure 50: ISSS, Uvurkhangai Province, FGP „Enkhiin Khurd“ Province, FGP „Tushig Dolgoon“

50 Cooperative Agreement Implementation

Figure 51: ISSS, Dornod Province, Figure 52: ISSS, Dornod Province, FGP „Asralt Uils“ FGP „Eruul Zon“

Figure 53: ISSS, Dornod Province, Figure 54: ISSS, Dornod Province, FGP „Dornyn Ireedui“ FGP „Yagaan Tseene“

Figure 55: ISSS, Dornod Province, Figure 56: ISSS, Dornod Province, FGP „Myangan Jargalan“ FGP „Tseene Tsetseg“

51 B5265G1 Annual Report – 2007/2008

The establishment of a full-time Management Team consisting Prof. P. Nymadawa, PI and Project Director, Mrs D. Enkhsaikhan, Project Manager, and Dr. D. Sodbayar, Outreach Supervisor in October 2005 has substantially improved the Project implementation. IST and ISAC have had quarterly meetings separately and/or jointly and reviewed the project implementation and discussed current problems challenging. The most important event in the influenza control in Mongolia was the organization of the 1st National Influenza Workshop (NIW1) in the beginning of the 2005/2006 season. NIW1 was held in September 8-9, 2005 in the Capital city Ulaan-baatar with more than 200 participants (Figure 57, Annexes 5 and 6).

Figure 57. Participants of the 1st National Influenza Workshop (NIW1), Mongolia, Ulaanbaatar, September 8-9, 2005, in front of the main building of the National Center of Communicable Diseases, Ministry of Health Mongolia.

Inauguration of the NIW1 by the Vice Minister of Health, Government of Mongolia and participation with lectures of Drs Weigong Zhou and Ok Park from WPRO, WHO have been highly appreciated by the participants and we are very thankful for them for this kind offer. NIW1 has issued a recommendation based on group discussions held in 5 directions (Annex 7).

52 Cooperative Agreement Implementation

3.3.2 Strengthen influenza reporting system

The initial action of the Project Team was establishment of ISSSs in accordance to the Minister’s order No 24/2004 and the training of the personnel in ISSSs. For this propose the Project Team has developed a Unified Programme for Initial Training for ISSSs: 2 days in the Provinces and one day in UB (Annexes 8 and 9). The trainings of the ISSSs have been realized stepwise: in January 2005 in Selenghe and Dornogobi Provinces, in April 2005 in Ulaan-baatar City and Uvurkhangai Province, in July 2005 in Dornod and Khovd provinces (Annexes 10-15, Figures 58-62). Therefore, actually 2004/2005 season was a period of the establishment of a laboratory-based influenza surveillance in Mongolia centered on ISSSs. To strengthen the influenza reporting system IST Epidemiology Group has been supplied in the fiscal year of 2004/2005 some information technology equipment and consumables in total sum of 2,470.8 US$ was supplied from the Project Fund (Annex 16).

Figure 58. Workshop in Ulaanbaatar city, April 2005

53 B5265G1 Annual Report – 2007/2008

Figure 59. Workshop in Dornod Province, July 2005

Figure 60. Workshop in Dornogobi Province, January 2005

Figure 61. Workshop in Uvurkhangai Province, April 2005

Figure 62. Workshop in Khovd Province, July 2005

54 Cooperative Agreement Implementation

In the fiscal year of 2005/2006 the Epidemiology Group has received equipment and supplies in total sum of 1,420 US$ from the Project Fund (Annex 17). From the Project Fund it has been used 535.7 US$ in 2004/2005 and 619.7 US$ in 2005/2006 for payment of phone ILI reporting and 186.1 US$ in 2004/2005 and 478.8 US$ in 2005/2006 in for encouragement of the Provincial Epidemiologists as remuneration. As a result weekly ILI reporting from Provinces are improving (Table 21).

Table 21 Weekly reporting from the provinces in 2004/2005 and 2005/2006 seasons

2004/2005 2005/2006 Number Number Number Number Provinces of of reports of reports Percentage of reports Percentage reports expected received received expected 1. Ulaanbaatar 34 34 100.0% 34 34 100.0% 2. Dornogovi 34 21 61.8% 34 34 100.0% 3. Dundgovi 34 33 97.1% 34 34 100.0% 4. Ovorkhangai 34 25 73.5% 34 34 100.0% 5. Sukhbaatar 34 19 55.9% 34 33 97.1% 6. Uvs 34 24 70.6% 34 33 97.1% 7. Khovsgol 34 11 32.4% 34 33 97.1% 8. Dornod 34 1 2.9% 34 32 94.1% 9. Khovd 34 22 64.7% 34 32 94.1% 10. Khentii 34 10 29.4% 34 32 94.1% 11. Govisumber 34 14 41.2% 34 31 91.2% 12. Orkhon 34 25 73.5% 34 31 91.2% 13. Omnogovi 34 20 58.8% 34 31 91.2% 14. Selenge 34 29 85.3% 34 31 91.2% 15. Tov 34 11 32.4% 34 31 91.2% 16. Arkhangai 34 16 47.1% 34 30 88.2% 17. Bayan-Olgii 34 22 64.7% 34 30 88.2% 18. Darkhan-Uul 34 15 44.1% 34 30 88.2% 19. Zavkhan 34 8 23.5% 34 30 88.2% 20. Bayankhongor 34 34 100.0% 34 28 82.4% 21. Bulgan 34 22 64.7% 34 28 82.4% 22. Govi-Altai 34 18 52.9% 34 28 82.4%

In 2005/2006 season all Provinces have reported the requested ILI events over 80% (UB City and 3 Provinces have reported 100%) whereas 55 B5265G1 Annual Report – 2007/2008

18(85.7%) Provinces were reporting ILI events under 80% (8 Provinces were reporting under 50%) in 2004/2005 season. The Project Team has organized also a workshop in 2005 involving epidemiologists and some other public health professionals to expand the circles concerning ILI and influenza pandemics (Annexes 18 and 19). The Project Team has initiated absenteeism surveillance in schools and kinder-gartens in UB in 2005/2006 season in collaboration with UB City Government (Annexes 20 and 21), however it hasn’t met the expected results, so it has been decided to discontinue this activity in 2006/2007 season.

3.3.3 Strengthen clinical surveillance activities

ILI clinical surveillance initial training workshops were organized 6 times in 2004/2005 mostly including medical doctors from FGPs with uniformly developed Program (Annexes 8 and 9) and totally 230 personnel were covered (Annexes 10-15, and Figures 58-62). Considering possibility to add a hospital-based scheme to the existing ILI surveillance system the Project Team has called a workshop on “Development of hospital-based surveillance” inviting possible future participants to the new scheme in November 2005 (Annexes 22 and 23). Based on findings and recommendations of this workshop it has been developed a proposal to extend the coverage of the outpatient ILI surveillance to two more provinces (Darkhan-Uul and Orkhon) and to establish hospital-based surveillance built mostly on the existing ISSSs starting from 2006/2007 season and submitted to the Ministry of Health, Mongolia for a review. The new scheme of ILI sentinel surveillance has been approved by a Minister’s order in July 2006 (No 253/2006). So, in September 2006 the initial trainings for new ISSSs in Darkhan-Uul and Orkhon Provinces (Annexes 24 and 25) have been organized in the respective Provinces. In November 2005 it has been organized two refresher training workshops for ISSS family doctors in UB (Annexes 26, 27 and 28). Totally around 4,000 US$ has been spent from the Project Fund on the training workshops for clinical surveillance. As a result quantity and quality of samples collected from ISSSs are improving permanently (Table 3).

56 Cooperative Agreement Implementation

3.3.4 Strengthen Laboratory surveillance network and activities

IST Laboratory Group (Figure 63) has worked hard not only in laboratory, also in the field for training of FGP staff for specimen collection, handling and transportation.

Figure 63. IST Laboratory Group From left to right: Ms.U. Naranchimeg, Laboratory Assistant; Ms. D. Enkhsaikhan, BSc (Biol.), MSc (Genetics),Virologist; Dr. B. Darmaa, MD. Virologist; R. Tuul, MD, Head, VL, NCCD, Ms. P. Zolzaya, Laboratory Assistant

The laboratory equipment and supply has been substantially improved (Figures 64-68) by the supplies through the Project (Annexes 29-33) and the performance for IV isolation and identification have been progressed markedly (Table 3).

Figure 64. Isolation of IV in cell culturse is now routine in VL, NCCD

57 B5265G1 Annual Report – 2007/2008

Figure 65. Routine works in IV serology laboratory, VL, NCCD

Figure 66. Gel-electrophoresis of IV genes, VL NCCD

58 Cooperative Agreement Implementation

Figure 67. Gel image documentation is now easy and obligatory for every experiment

With the continously increasing workload in VL, NCCD and the emergence of avian flu in bird population in Mongolia, the bio-safety issues have increasing importance. Therefore in November 2005 has been organized a workshop on “Need for establishment of bio-safety III level laboratory” (Annexes 34 and 35), in which participated more than 20 representatives from NCCD, CIDNF, VRI, and the invited speakers from Virology and Biotechnology Center “Vector” of Novosibirsk, Russian Federation. A BSL3 facility has been built in 2007-2008 for CVR, MoFA with the support of KOICA, Korea and it is now fully functional.

3.3.5 Strengthen sentinel surveillance of influenza

In 2004/2005 season ISSSs (Annexes 3 and 4) have been established and the personnel have been trained (Annexes 8-15). ISSSs were regularly supplied by the prepared specimen collection kits and in UB sites were visited weekly starting 2005/2006 season by the outreach supervisor when the Project got a full-time post for this purpose, collecting the samples and advising doctors and nurses on sample collection and ILI registration. The cost of the transportation was born by NCCD so far. 59 B5265G1 Annual Report – 2007/2008

In the fiscal year of 2005/2006 sentinel ISSSs were provided by the Project with mini-refrigerators for sample storage, and sockets, thermometers, and tube stands of total sum of around 10,500.00 US $ ( Figure 68 and Annex 36).

Figure 68. Refrigerator, thermometer and tube stand, supplied to ISSSs

Due to excellent work of ISSSs the collected sample quantity and quality are improving permanently (Tables 22-24).

60 Cooperative Agreement Implementation

Table 22 Daily reporting from the sentinel sites in 2004/2005 and 2005/2006 seasons

2004/2005 2005/2006

Surveillance number number number number sites of of of of reports Percentage Percentage reports reports reports expected received expected received Dornogovi 1. 127 127 100% 167 167 100% Province Khovd 2. 127 127 100% 167 167 100% Province UB, 3. 127 127 100% 167 167 100% Gurvansanchir UB, Itgel 4. 127 127 100% 167 167 100% ugtakh 5. UB, Shar degd 127 127 100% 167 167 100% UB, 6. 127 127 100% 167 167 100% Tumenjargalan UB, Tegsh- 7. 127 127 100% 167 167 100% Olzii 8. UB, Uilsnegten 127 127 100% 167 167 100% 9. UB, Nasan Urt 127 127 100% 167 167 100% UB, Amgalan 10. 127 127 100% 167 167 100% -Itgekhui UB, Eruul 11. 127 127 100% 167 167 100% orkh UB, 12. 127 127 100% 167 167 100% Tegshmend 13. UB, Sankol 127 127 100% 167 167 100% UB, 14. 127 127 100% 167 167 100% Enkhsunder UB, 15. 127 127 100% 167 167 100% Buyantmanal UB, 16. 127 127 100% 167 167 100% Enkhelberel UB, Ono- 17. 127 127 100% 167 167 100% Achit 18. UB, Amintus 127 127 100% 167 167 100% UB, Manal- 19. 127 127 100% 167 167 100% Uils 20. UB, Enkhtitem 127 127 100% 167 167 100% 21. UB, Baganuur 127 127 100% 167 167 100% 61 B5265G1 Annual Report – 2007/2008

Ovorkhangai 22. 127 113 89% 167 167 100% Province Selenge 23. 127 104 82% 167 167 100% Province 24. UB, Nalaikh 127 85 67% 167 167 100% Dornod 25. 127 46 36% 167 167 100% Province

Table 23 Samples collected from the sentinel sites in 2004/2005 season

Number Number of Number of of samples Districts and specimens samples with No Family clinics with positive Provinces submitted to influenza virus IV antigen NCCD isolation (%) detection (%) 1 Amin tus 30 9 (30.0) 0 (0.0) Ulaanbaatar, 2 Enkhtitem 89 19 ( 21.3) 2 (2.2) Khan –uul district 3 Manal uils 94 14 (15) 4 (4.2) 4 Shar degd 70 11 (15.7) 0 (0.0) Ulaanbaatar, 5 Itgel ugtakh 59 8 (13.6) 0 (0.0) Bayangol district 6 Gurvan sanchir 58 4 (6.9) 0 (0.0) 7 Unu achit Ulaanbaatar, 39 3 (7.7) 0 (0.0) 8 Enkh elberel Songinokhairkhan 69 8 (11.6) 0 (0.0) 9 Buyant manal district 34 12 (35.3) 4 (4.2) 10 Tumen jargalan 111 7 (6.3) 0 (0.0) Ulaanbaatar, 11 Tegsh Ulzii 37 11 (29.7) 0 (0.0) Chingeltei district 12 Uils negten 10 2 (20) 0 (0.0) 13 Sankoll Ulaanbaatar, 32 5 (15.6) 0 (0.0) 14 Tegsh mend Sukhbaatar 84 9 (0.9) 0 (0.0) 15 Enkh sunder district 42 2 (4.8) 0 (0.0) 16 Eruul urkh 33 7 (21.2) 1 (3.0) Ulaanbaatar, Amgalan 17 Bayanzurkh 85 2 (2.3) 0 (0.0) itgekhui district 18 Nasan urt 84 8 (9.5) 2 (2.4) 19 Ami erdene UB, Nalaikh 1 1 (100) 0 (0.0) 20 Enerelt Ulzii UB, Baganuur 0 0 (0) 0 (0.0) Dornogobi 21 4 33 1 (3) 0 (0.0) Province 22 5 Selenghe Province 18 2 (11.1) 0 (0.0) Total (29 unit) 1112 144 (12.9) 13 (1.2) Average (for an unit) 38 5 (13.1) 0.4(1.0)

62 Cooperative Agreement Implementation

Table 24 Samples collected from the sentinel sites in 2005/2006 season

Number of Number of samples UB Districts and specimens No Family clinics with influenza virus provinces submitted to isolation (%) NCCD

1 Amin tus 49 3 (6.1) Ulaanbaatar, Khan uul 2 Enkhtitem 103 9 (8.7) district 3 Manal uils 66 7 (10.6) 4 Shar degd 53 5 (9.4) Ulaanbaatar, Bayangol 5 Itgel ugtakh 52 1 (1.9) district 6 Gurvan sanchir 44 3 (6.8) 7 Unu achit 75 7 (9.3) Ulaanbaatar, 8 Enkh elberel Songinokhairkhan 42 5 (11.9) district 9 Buyant manal 92 5 (5.4) 10 Tumen jargalan 46 1 (2.2) Ulaanbaatar, 11 Tegsh Ulzii 87 9 (10.3) Chingeltei district 12 Uils negten 58 2 (3.4) 13 Sankoll 71 6 (8.5) Ulaanbaatar, 14 Tegsh mend 72 1 (1.4) Sukhbaatar district 15 Enkh sunder 46 2 (4.3) 16 Eruul urkh 103 4 (3.9) Amgalan Ulaanbaatar, 17 32 2 (6.3) itgekhui Bayanzurkh district 18 Nasan urt 124 6 (4.8) 19 Ami erdene UB, Nalaikh district 256 18 (9.0) 20 Enerelt Ulzii UB, Baganuur district 180 8 (4.4) 21 Goyomend 100 8 (8.0) 22 Misheeelt mana 60 7 (11.7) Dornogobi Province 23 Agatova 46 4 (8.7) 24 Railway clinic 22 3 (13.6)

63 B5265G1 Annual Report – 2007/2008

22 Zovlokh bag 88 2 (2.3) 23 Nomt khan 56 1 (1.8) 24 Khadankhui Selenge Province 67 1 (1.5) 25 Egneshgui 78 2 (2.6) 26 Emnekh 53 1 (1.9) 27 Asralt uil 10 2 (20.0) 28 Dorniin ireedui 12 1 (8.3) Myangan 29 16 2 (12.5) jargalan Dornod Province 30 Tseene tsetseg 18 4 (22.2) 31 Eruul zon 21 0 (0.0) 32 Yagaan tseene 20 1 (5.0) 33 Narnii dush 68 2 (2.9) 34 Uyan setgel 108 4 (3.7) Uburkhangai Province 35 Enkhiin khurd 72 3 (4.2) 36 Tushig dulguun 94 5 (5.3) 37 Bugat 28 2 (7.1) 38 Baatarkhairkhan 16 1 (6.3) Khovd Province 39 Jargalant 4 0 (0.0) 40 Rashaant 20 1 (5.0) Total (40 unit) 2728 161 (5.9) Average 143.2 4 (2.8)

3.3.6 Strengthen influenza outbreak response system

Public and Government awareness on possible implications of influenza pandemics and avian flu has been substantially increased since implementation of the Project. NIW1 has attracted all interested parties and a Guideline on Influenza has been developed and printed in 3,000 copies in 2005. The book has been distributed to all participants of NIW1 and PHC providers. The new version of the Influenza Guideline was developed in 2006 based on “Influenza Report 2006” by “Flying Publisher” and printed also in 3,000 copies. The book has been placed on website: htpp://www. influenzareport.com/ir/lang.htm#mongolian for free references. Also some posters and prevention leaflets were developed and

64 Cooperative Agreement Implementation printed for free distribution. On these health promotional activities the Project has spent around 10,000.00 US $. A high political commitment to the influenza problem has been demonstrated by the adoption of the “Main Directives for Prevention of Avian Flu and Influenza Pandemics” by the Government Resolution 110/2006. Influenza vaccination in Mongolia is administered currently on voluntary basis. The Project has initiated a proposal which was supported by NIW1 to encourage a Government support for influenza vaccination of all health personnel of the country. In the beginning of 2005/2006 influenza season the Project has purchased 1,000 doses of 2 kinds of influenza vaccine with the WHO recommended composition and organized administration of the vaccines to medical personnel of ISSSs. The serological response to vaccines were studied on 100 person and the result has been published11. HI titers were elevated four and more times in 80-81% against A/New Caledonia/20/99(H1N1), and in 83- 86% against A/New York/55/04(H3N1) in subjects vaccinated by both vaccines. Geometric mean titres (GMT) of hemagglutination inhibition were increased against above-named influenza A virus strains in 10- 12 times in subjects vaccinated by both vaccines. Increase of HI titers against B/Shanghai/361/02 were different: 62% by “Grippol”, and 83% by “Agrippal”, the difference was statistically significant (p<0.05) GMT elevation was also different: 4.2 times by “Grippol”, and 18.4 times by “Agrippal” (statisticall signiticance, (p< 0.05). There were no serious side effects with both vaccines. However, mild local reactions, like pain and swelling at the injection site were observed at 3.9% vaccinees with “Grippol”, and at 8.0% vaccinees with “Agrippal”, and some minor general reactions, like subfebrility, running nose etc. have been recorded at 17.1% vaccinees with “Grippol”, and 31.4% vaccinees with “Agrippal”. To attract pharmacists to the influenza problem the Project has organized a workshop in November 2005 (Annexes 39 and 40). On the pledge of the Government of Mongolia, the Government of Japan has decided in March, 2006 to offer a million US$ for a year (March 2006 to March 2007) on “activities of behavioral change

11 Íÿìäàâàà, Ï., Äàðìàà, Á., Äàøöýðýí, Ë., Öàöðàë, Ñ., Íàðàíáîëä, Í., Áóðìàà, À., (2006): Òîìóóãèéí ýñðýã õî¸ð òºðëèéí âàêöèíû äàðõëàë òîãòîîõ èäýâõèéã õàðüöóóëàí ñóäëàñàí ä¿í, Õàëäâàðò ºâ÷èí ñóäëàëûí Ìîíãîëûí ñýòã¿¿ë, ¹3(10): 2-5; [P.Nymadawa, B.Darmaa, L.Dash-tseren, S.Tsatsral, N.Naranbold, A.Burmaa (2006): Comparative study of immunogenic- ity of two influenza vaccines, Mongolian Journal of Infectious Diseases Research, ¹ 3(10): 2-5; 65 B5265G1 Annual Report – 2007/2008 of population to prevent spread of avian influenza and influenza pandemics”, which has overtaken more activities in this area.

3.3.7 Monitoring and evaluation activities

In 2004/2005 season monitoring and evaluation activities were not undertaking separately. Starting 2005/2006 season the monitoring and evaluation of ISSS activities has been seriously considered and a full-time outreach supervisor has been recruited. The outreach supervisor has visited weekly the ISSSs in UB and quarterly the ISSSs in Provinces. Usually members of IST and chief specialists of the MoH on epidemiology and infectious diseases were accompanied the outreach supervisor to give professional advises to the ISSSs. This activity has consumed around 10,000.00 US$ from the Project Fund.

3.3.8 Strengthen influenza surveillance activities in animals

The emergence of the new sublineage of avian influenza H5N1 in the People’s Republic of China and Russian Federation in the spring and summer 2005 has been transferred to Mongolia (Figure 69).

Figure 69. Worldwide distribution of avian influenza H5N1 strain in bird populations (WHO, 2006)

NCCD has undertaken jointly with CIDNF, CVL, VRI and MAS with support of interested foreign parties (Japan, USA) some surveillance for avian influenza viruses in Mongolia (Figures 70-71) and revealed H5N1 HPAIV strains in wild bird populations in Mongolia (Figure 72).

66 Cooperative Agreement Implementation

Figure 70. Avian flu isolations in Mongolia, in 2001-2005; (Dr. D. Tserennorov, CIDNF)

Isolation of an avian influenza virus-A/Whooper swan /Mongolia/ 2/06 (H5N1) Isolation of an avian influenza virus-A/Common golden eye /Mongolia/ 5/06

(H5N1) Figure 71. Survellance of influenza in migratory birds in Mongolia in 2006 (Dr. R. Sodnomdarjaa, CVL, 2006)

67 B5265G1 Annual Report – 2007/2008

To attract of veterinarians to this problem the Project has organized a Workshop in UB (Annexes 37 and 38) and regularly inviting veterinarians to NIWs. NIC has coordinated control activities of the diseased birds during the wild bird outbreaks in July/August in Khuvsgul and Bulgan Provinces and preventive measures for personnel working with dead or diseased birds.

Figure 72. Phylogenetic tree analysis of H5N1 (HA gene, partial sequence) (Dr. R. Sodnomdarjaa, CVR, 2006)

68 Cooperative Agreement Implementation

3.3.9 Promoting international collaboration on influenza surveillance

NCCD has established a good working relations with CDC (USA), WPRO and HQ of WHO and NIID, Japan. The project coordinator Prof. P. Nymadawa has visited CDC (USA) in October 2004 to discuss about the project implementation and teleconferences were organized when it is needed with the Influenza Division, CDC. Short-term laboratory consultant Dr. Sazuko Nakajima from WHO/ WPRO was working in Influenza Laboratory for 2 weeks in May 2005 and conducted a training for local virologists and laboratory assistants on PCR methods and cell culture techniques. Short-term consultant from Influenza Division, CDC Dr. Weigong Zhou was working for 3 days in May 2005 on Influenza surveillance. Drs. B.Darma (virologist) and A.Burma (epidemiologist) were participated in WHO/CDC Training Workshop on “Human Influenza Surveillance and Control” which was held on 26-28, April, 2005 in Kuala Lumpur, Malaysia. Prof. P. Nymadawa has been invited to the WHO NIC Meeting on September 15, 2005, Malta and exchanged views and questions with fellow NIC delegates from other countries and WHO HQ. NCCD has used WHO influenza shipment fund for sending our isolates to NIID, Tokyo, Japan. 14 strains were sent to CDC, USA and 15 strains were sent to NIID, Tokyo, Japan for identify further antigenic and genetic characterizations. March 28-31, 2006 the outreach supervisor Dr D.Sodbayar has visited Irkutsk (Russian Federation) Sanitary-Epidemiological Station and met heads and specialists in charge of epidemiological surveillance. During the visit it has been discussed the possibility of collaboration on surveillance, especially on virological surveillance. Dr. B.Darma (virologist) has attended the training course on laboratory diagnosis and strain surveillance of H5N1 influenza, which was held on March 1-31, 2006 in NIID, Tokyo, Japan. May 22-27, 2006 four specialists (Dr Ts. Oyunchimeg, Director General, NCCD, Dr L. Dash-tseren, Head, Epidemiological Surveillance, NCCD, Mrs D.Enkhsaikhan, Project Manager, Development of Influenza Surveillance Network, Mrs S. Tsatsral, Project Virologist, Development of Influenza Surveillance Network) visited China, CDC and exchanged experiences and discussed further collaboration on influenza surveillance. WHO is sending regularly advisers to our NIWs and Mrs Ann Moen, Deputy Director, Influenza Division, CDC has visited Mongolia in 69 B5265G1 Annual Report – 2007/2008 the beginning of October 2006 and has acquainted on the spot with the activities of the Project.

3.4 Project implementation in 2006/2007 and 2007/2008 seasons (status as September 14, 2008)

In continuation of the original objectives of the Cooperative Agreement, activities were concentrated in the following five broad areas: 1. Pandemic Planning and Preparedness, 2. Improving Laboratory Capacity, 3. Improving Surveilance Capacity, 4. Strengthening Rapid Outbreak Response, 5. Ensuring Effective Risk Communication.

3.4.1. Pandemic Planning and Preparedness

On March 14, 2007 the Government of Mongolia has adopted “Plan of Implementation of the Main Directives to Control Avian Influenza and Human Pandemic Influenza” by the Resolution ¹61. In the development of this Resolution have taken part MoH, MoFA and NEMA. The new version of the Influenza Guideline developed on the basis of “Influenza Report 2006” issued by “Flying Publisher” has been distributed countrywide and the book has been placed on website: htpp://www. influenzareport.com/ir/lan.htm#mongolian for free references (Figure 74).

Figure 73. Meeting with pathologists, June 29, 2007. Figure 74. “Influenza Report 2006” guideline 70 Cooperative Agreement Implementation

The possibilities for collaboration on the joint study of samples taken from pathological materials of patients died from pneumonia were discussed (Annex 61) in the meeting with pathologists (Annex 62, Figure 73) from the Center of Pathology (CoP), MoH. NIW2 was held on 4-5 October 2006 in Ulaanbaatar city (Annex 45). This Workshop has been organized jointly with the “Influenza Emergency Risks Communication” project funded by Government of Japan.

Figure 75. NIW2 group photo taken in front of “Khan Palace” Kempinski Hotel

There were 220 participants in the workshop (Annex 46, Figure 75) including representatives from MoH, SEMA, MoFA, SPIA, Country Offices of WHO and UNICEF, Embassies of Japan and USA in Mongolia, Ulaanbaatar city Professional Inspection Agency, VRI, HSUM, NCHD, Steering Committee of the “Emergency Risks Communication” project, Directors and Deputy Directors of Health Departments from 21 provinces and Ulaanbaatar city districts, heads of selected FGPs, epidemiologists, officers of Emergency Departments from all provinces and Ulaanbaatar city districts, NCCD and CIDNF. Dr. Weigong Zhou, MD, PhD, WPRO, Manila, Dr. Wenjie Wang, MD, WPRO, Manila and Mrs. Ann Moen, Deputy Director, Influenza Division, CDC, USA have participated in NIW2 with their presentations. NIW2 adopted Recommendations (Annex 47). Third National Influenza Workshop (NIW3) was held on 11-12 October 2007 (Annex 66) in Ulaanbaatar city involving 220 participants 71 B5265G1 Annual Report – 2007/2008

(Annex 67 and front cover) from MoH, NEMA, MoFA, SPIA, Country Offices of WHO and UNICEF, USA Embassy in Mongolia, Ulaanbaatar City Professional Inspection Agency, VRI, HSUM, NCHD, Directors and Deputy Directors of Health Departments from 21 provinces and Ulaanbaatar city districts, heads of selected FGPs, epidemiologists, officers of Emergency Departments from all provinces and Ulaanbaatar city districts, NCCD and CIDNF. Mrs. Teresa Turski, Health Scientist, Influenza Division, CDC, USA, Dr. Takeshi Kasai, Western Pacific Regional Adviser on Infectious Diseases, WHO, Dr. Paul Cox, STC, WHO, Dr. Yuelong Shu, PhD, CDC, China and Mrs. Xin Li, CDC, China have participated in NIW3 with their presentations. Table top exercise (TTX) on assessing of pandemic influenza preparedness was organized by the workshop organizers in collaboration with Dr. P. Cox, STC, WHO on the second day of the NIW3. During the NIW3 the heads of the NIC of Mongolia and China discussed of strengthening the cooperation with clarified activities and a draft of MoU for collaboration between these two NICs was agreed. NIW3 adopted Recommendations (Annex 68). 15 minutes radio broadcast on NIW3 were transmitted within the country by the Mongolian National Radio. An IPPP assessment was conducted in collaboration with CDC specialists (Mrs. Theresa Turski, Dr. Goldie MacDonald and Dr. Danyeal Garcia) on April 14-19, 2008 (Figure 79, Annex 75). There were involved intotal 27 people from NEMA, MoH, NCCD, CIDNF, NCHD, MoFA, CVL, UN specialized organizations (such as WHO and UNICEF representatives in Mongolia), Peace Corps and Red Cross Society of Mongolia (Annex 76).

Figure 76. Photo taken during IPPP Assessment Workshop in April 2008 72 Cooperative Agreement Implementation

Participants assessed current national capacity on IPPP (Annex 77) by discussion with relevant stakeholders and agencies according to the assessment questionnaire. The brief report on IPPP Assessment was developed by workshop organizers and submitted to all relevant parties. The preliminary result of IPPP assessment was presented to the CDC Global Grantee Meeting (GGM) in Cairo, Egypt, 13-15, Aug 2008 by Prof. P. Nymadawa, PI and Project Director. (Figure 77).

Figure 77. Mongolian participants to the CDC GGM, Cairo, Egypt, August 2008

In the framework of the NIW4 preparation, there was conducted a workshop for TTX moderators on assessing of the subnational IPPP on 29 September 2008 (Annex 80). There were participants from MoH, NCCD, CIDNF, NCHD and WHO country office In Mongolia (Annex 81). Participants discussed a national inventory of core capabilities for Pandemic Influenza Preparedness and Response, and modified it according to the subnational level of Mongolia. The subnational level assessment of IPPP is expected to be conducted during NIW4.

3.4.2. Improving Laboratory Capacity

For the successful completion of the Project objectives have been recruited a fulltime virologist and a full-time driver (Figure 78) and a half-time accountant and a half-time epidemiologist in addition to the existing Project Team staff since September 15, 2006.

73 B5265G1 Annual Report – 2007/2008

In January 19, 2007 IVL has organized a training (Annex 16) on “ICRT procedures for Adenovirus, RSV and Influenza A, B virus antigen detection” with medical doctors and nurses (Annex 17) from 5 FGPs of UB city and NCCD. VL has organized 6 months on-the-job training for laboratory technicians (Annex 12) and virologists (Annex 14) from November 01, 2006 to May 01, 2007. There were trained 10 laboratory technicians (Annex 52) and 9 virologists (Annex 53) from PHI, CIDNF, and NCCD and all participants have got a certificate of specialization from NCCD (Figure 79). Dr. Masato Tashiro, Department of Viral Diseases and Vaccine Control, NIID, Japan has visited to the NCCD as the STC of WHO including countryside ILI sentinel sites (Figures 80 and 81) from 20 to 26 August, 2007 and produced recommendations on strengthening of the Virology Laboratory capacity (Annex 48). During the budget period of 2006/2007 IVL has received all necessary supplies through the Project fund (Annex 64 and 65). The VL has purchased Sequence Analyzer and Real Time PCR machine (Figures 82, 83) from Applied Biosystems by the project fund. An engineer from the Moscow Representative of Applied Biosystems has successfully installed equipments and conducted basic training course for the equipment for the laboratory staff of VL, NCCD, Mongolia from 30 July to 3 August, 2007. The number of specimens received in VL, NCCD has increased 2.6 fold and the percentage of influenza virus isolation 2.8 fold in comparison with the previous season (Table 21). The VL, NCCD has been provided with neccessary laboratory and office equipments (Annex 83), and reagents and other consumables (Annex 84) by the Project Fund in the fiscal year of 2007/2008.

74 Cooperative Agreement Implementation

Figure 78. Full-time virologist Figure 79. Participants and lecturers Dr. Ts. Naranzul, MD and driver of the on-the-job training on virology, Mr. S. Ganbaatar are prepared to November 2006. collect samples for virological tests from ISSSs

Figure 80. Dr. M. Tashiro, STC, Figure 81. WHO on the way to ISSSs in Dr. M. Tashiro in the VL/NCCD, Uvurkhangai province, Mongolia Mongolia

Figure 82. ABS 3130x1 Genetic Figure 83. HP Color LaserJet 1600 Analyzer printer and ABS 7500 Fast Real-time PCR System

75 B5265G1 Annual Report – 2007/2008

To ensure a successful take over the responsibilities by NCCD/MoH after the completion of the project virologists Mrs. D. Enkhsaikhan BSc(Biol), MSc(Genetics), Ms. S.Tsatsral BSc(Biol) and Dr. Ts. Naranzul, MD were transferred from the full-time project team to VL, NCCD since September 15, 2007. Dr. R. Tuul, MD, PhD, virologist, VL, NCCD has participated in the training course on Laboratory Bio-Safety organized by WHO on 17- 19 October 2007 in Beijing, China and got a certificate. Dr. U. Unursaikhan, MD, virologist, VL, CIDNF, Dr. R. Tuul, MD, PhD, virologist, VL, NCCD, Ms. S. Tsatsral, virologist, VL, NCCD have attended also the training course on Laboratory Bio-Safety and Bio-Security organized by CDC, USA on 5-13 November 2007 in Alma Ata, Kazakhstan and got certificates. Dr. B. Darmaa, MD, and Mrs. D. Enkhsaikhan, BSc(Biol)-Msc (Genetics) have attended one month laboratory training in the Influenza Division, CDC, USA from 6 November to 3 December, 2007. Dr. B. Darmaa has worked in the laboratory of the Influenza Strain Surveillance Section and Mrs. D. Enkhsaikhan in the laboratory of the Molecular Genetics Section, Influenza Division, CDC, USA. Dr. B. Darmaa, virological surveillance team leader and Ms. S. Tsatsral, virologist participated in follow-up EQAP, WHO training for the detection of influenza A viruses by PCR which held from 25 Feb to 1 March in Hong Kong, SAR, China. Mr. N. Naranbaatar, bio-imformatics consultant, Mrs. D. Enhsaihan virologist, Mr. N. Naranbold, virology laboratory assistant have attended the Viral Phylogenetics & Bioinformatics Workshop on 1- 4 April 2008 at the Department of Microbiology, Chinese University of Hong Kong, Prince of Wales Hospital, Shatin, New Territories, Hong Kong SAR, China. Dr. B. Darmaa participated in the Second Meeting for Asia- Pacific NICs on 21-24 April 2008 in Tokyo, Japan and presented poster presentation on Influenza Surveillance in Mongolia.

3.4.3. Improving Surveillance Capacity

The order ¹253, 2006 of Minister of Health, Mongolia on extention and strengthen of the laboratory-based sentinel surveillance network of ILI has been approved in July 10, 2006 replacing order ¹241, 2004 on introduction of laboratory-based sentinel surveillance network of ILI. The order ¹253 revised IST (Annex 41) and ISAC composition (Annex 42), and outpatient-based sentinel site list (Annex 43 and 44), their

76 Cooperative Agreement Implementation terms of reference, ILI specimen collection, transportation, storage and investigation guidance and line list for ILI recording. 36 new ISSSs (19 FGPs in Orkhon, Darkhan-Uul provinces, 6 District Hospitals in Ulaanbaatar City, 7 Provincial Hospitals in Uvurkhangai, Selenghe, Khovd, Dornod, Dornogovi, Darkhan- Uul, Orkhon Provinces, and 2 National Reference Centers [NCCD, MCHRC]) have been established (Annexes 43 and 44, Figures 84-116) and now ISN is covering around 55,3 % of the country’s territory and 63,2 % of the whole population. The new ISSSs were supplied with specimen collection and storage equipment and devices including refrigerator, tube stand, thermometer and ILI case recording log books (Figure 117, Annex 83). In connection with the increased number of ISSSs in and outside of Ulaanbaatar City a car for specimen transportation has been purchased and a full-time driver has been recruited (Figure 78). Completeness of ILI weekly reporting from provinces was improved in comparison with previous seasons (Tables 25, 26, 27 and 28).

Figure 84. Figure 85. ISSS, UB city, Khan-Uul ISSS, UB city, Bayangol district hospital district hospital

77 B5265G1 Annual Report – 2007/2008

Figure 86. Figure 87. ISSS, UB city, Sukhbaatar district ISSS, UB city, Chingeltei district hospital hospital

Figure 88. ISSS, UB city, Figure 89. ISSS, UB city, Songinokhairkhan district hospital Bayanzurkh district hospital

Figure 90. ISSS, UB city, NCCD Figure 91. hospital ISSS, UB city, MCHRC, Pediatric hospital 78 Cooperative Agreement Implementation

Figure 92. Figure 93. ISSS, Darkhan-Uul province hospital ISSS, Orkhon province hospital

Figure 94. ISSS, Khovd province Figure 95. ISSS, Selenghe province hospital hospital

Figure 96. Figure 97. ISSS, Uvurkhangai province hospital ISSS, Dornogobi province hospital

79 B5265G1 Annual Report – 2007/2008

Figure 98. ISSS, Dornod province Figure 99. ISSS, Orkhon province, hospital FGP “Achlalt nar”

Figure 100. ISSS, Orkhon province, Figure 101. ISSS, Orkhon province, FGP “Ankhny och” FGP “Elberelt uils”

Figure 102. ISSS, Orkhon province, Figure 103. ISSS, Orkhon province, FGP “Gerelt mandah” FGP “Mendbulag”

80 Cooperative Agreement Implementation

Figure 104. ISSS, Orkhon province, Figure 105. ISSS, Orkhon province, FGP “Munkhiin gegee” FGP “Uchralt bayar”

Figure 106. Figure 107. ISSS, Orkhon province, ISSS, Orkhon province, FGP “Niitsel” FGP “Khos chagnuur”

Figure 108. ISSS, Orkhon province, Figure 109. ISSS, Orkhon province, FGP “Itgeliin erel” FGP “Munkh sundrel”

81 B5265G1 Annual Report – 2007/2008

Figure 110. ISSS, Orkhon province, Figure 111. ISSS, Orkhon province, FGP “Uils badrah” FGP “Tsagaan agi”

Figure 112. ISSS, Darkhan-Uul Figure 113. ISSS, Darkhan-Uul province, FGP “Amin kholboo” province, FGP “Gos khot”

Figure 114. ISSS, Darkhan-Uul Figure 115. ISSS, Darkhan-Uul province, FGP “Enerelt naran” province, FGP “Tuvshin kholboo”

82 Cooperative Agreement Implementation

Figure 116. ISSS, Darkhan-Uul Figure 117. Supply with refrigerator for province, FGP “Gereltei” specimen storage

Figure 118. Workshop on hospital- Figure 119. Workshop on the 4th quarter based surveillance for medical doctors, activities in 2006 for outpatient-based September 2007 sentinel surveillance sites in the UB city, January 2007

Figure 120. Workshop on the 1st quarter activities in 2007 for inpatient- based sentinel surveillance sites in the Figure 121. Outreach supervision team UB city, July 2007 in Khovd province, January 2007

83 B5265G1 Annual Report – 2007/2008

Figure 122. Delegates from Mongolia with Dr. N. Cox, Chairperson, Organizing Committee of the Options VI Conference in Toronto, Canada, June 15-22, 2007

Figure 123. Prof. H. Oshitani and Dr. T. Kamigaki during their visit to an ISSS, Selenghe Province, July 2007

84 Cooperative Agreement Implementation

Table 25 Samples collected from the sentinel sites in 2006/2007 and 2007/2008

Number of samples Number of specimens District and with influenza virus No FGP submitted to NCCD provinces isolation (%) 2006/2007 2007/2008 2006/2007 2007/2008 1 Amin tus 166 139 22 (13.3%) 6(4.3%) 2 Enkh titemUlaanbaatar, 119 149 18 (15.1%) 4(2.6%) Khan-Uul 3 Manal uilsdistrict 124 68 13 (10.5%) 3(4.4%) 4 District hospital 216 314 8 (3.7%) 3(0.95%) 5 Shar degd 95 61 11 (11.6%) 0(0.0%) 6 Itgel ugtakhUlaanbaatar, 149 158 12 (8.1%) 1(0.63%) Bayangol 7 Gurvan sanchirdistrict 201 81 19 (9.5%) 1(1.2%) 8 District hospital 57 50 0 (0.0%) 1(2%) 9 Unu achit Ulaanbaatar, 70 175 4 (5.7%) 4(2.28%) 10 Enkh elberelSongi- 106 91 15 (14.2%) 6(6.5%) 11 Buyant manalnokhairkhan 114 123 24 (21.1%) 7(5.6%) 12 District hospitaldistrict 155 204 15 (9.7%) 2(0.98%) 13 Shijid dug 241 194 25 (10.4%) 8(4.1%) 14 Tegsh UlziiUlaanbaatar, 126 200 16 (12.7%) 7(3.5%) Chingeltei 15 Uils negtendistrict 138 162 15 (10.9%) 5(3.08%) 16 District hospital 44 64 0 (0.0%) 0(0.0%) 17 Sankoll 61 53 7 (11.5%) 0(0.0%) 18 Tegsh mendUlaanbaatar, 178 142 8 (4.5%) 8(5.6%) Sukhbaatar 19 Enkh sunderdistrict 181 239 7 (3.9%) 8(3.3%) 20 District hospital 192 367 9 (4.7%) 5(1.36%) 21 Eruul urkh 92 67 15 (16.3%) 5(7.4%) 22 Amgalan itgekhuiUlaanbaatar, 212 174 27 (12.7%) 9(5.1%) Bayanzurkh 23 Nasan urtdistrict 125 121 12 (9.6%) 6(4.9%) 24 District hospital 279 340 24 (8.6%) 1(0.29%) 25 NCCD Ulaanbaatar 194 44 0 (0.0%)1(2.2%) 26 MCHRC Ulaanbaatar 130 345 3 (2.3%) 4(1.15%) UB, Nalaikh 27 Ami erdene 231 179 7 (3.0%) 2(1.11%) district UB, 28 Enerelt Ulzii Baganuur 422 276 26 (6.2%) 8(2.8%) district 29 Goyo mend 112 101 9 (8.0%) 0(0.0%) 30 Misheelt mana 126 64 7 (5.6%) 3(4.6%) 31 Agatova Dornogobi 112 75 9 (8.0%)4(5.3%) 32 Railway clinicprovince 49 16 2 (4.1%) 0(0.0%) Provincial hos- 33 52 41 5 (9.6%) 0(0.0%) pital 85 B5265G1 Annual Report – 2007/2008

34 Zuvlukh bag 54 42 3 (5.6%) 1(2.6%) 35 Nomtkhan 45 34 6 (13.3%) 0(0.0%) 36 Khadankhui 69 71 6 (8.7%) 0(0.0%) Selenge 37 Egneshgui 59 32 4 (6.8%) 0(0.0%) province 38 Emnekh bag 49 28 3 (6.1%) 3(10.7%)

Provincial 39 76 77 1 (1.3%) 2(2.5%) hospital

40 Asralt uils 69 12 7 (10.1%) 1(8.3%) 41 Dornyn ireedui 35 12 2 (5.7%) 0(0.0%) 42 Myangan jargalan 26 8 1 (3.8%) 0(0.0%) 43 Tseene tsestegDornod 19 7 0 (0.0%) 0(0.0%) province 44 Eruul zon 24 6 1 (4.2%) 0(0.0%) 45 Yagaan tseene 40 8 2 (5.0%) 0(0.0%) Provincial 46 30 19 0 (0.0%) 1(5.2%) hospital 47 Narny dush 63 96 1 (1.6%) 0(0.0%) 48 Uyan setgel 95 155 3 (3.2%) 0(0.0%) 49 Enkhiin khurdUvurkhangai 59 75 5 (8.5%) 0(0.0%) province 50 Tushig dulguun 67 93 2 (2.9%) 0(0.0%) Provincial 51 93 168 4 (4.3%) 2(1.19%) hospital 52 Bugat 25 49 4 (16.0%) 2(4.08%) 53 Baatarkhairkhan 24 52 3 (12.5%) 0(0.0%) 54 JargalantKhovd 18 9 2 (11.1%) 0(0.0%) province 55 Rashaant 21 71 1 (4.8%) 1(1.4%) Provincial 56 32 29 1 (3.1%) 0(0.0%) hospital 57 Gos khot 116 139 5 (4.3%) 0(0.0%) 58 Gerelt 105 93 3 (2.9%) 3(3.2%) 59 Enerelt naran 59 104 2 (3.4%) 3(2.8%) Dark- 60 Amin kholboo 70 108 3 (4.3%) 0(0.0%) han-Uul 61 Tuvshin kholbooprovince 39 113 3 (7.7%) 1(0.88%) 62 Nasan ulzii 1 0 0 (0.0%) 0(0.0%) Provincial hos- 63 53 48 1 (1.9%) 0(0.0%) pital

86 Cooperative Agreement Implementation

64 Munkhsunder 56 38 0 (0.0%) 0(0.0%) 65 Tsagaan agi 26 27 6 (23.0%) 0(0.0%) 66 Uchralt bayar 37 41 1 (2.7%) 0(0.0%) 67 Munkhiin gegee 17 44 0 (0.0%) 2(4.5%) 68 Elberelt uils 13 44 1 (7.7%) 0(0.0%) 69 Uils badrakh 15 72 1 (6.7%) 0(0.0%) 70 Niitsel 22 36 1 (4.5%) 0(0.0%) Orkhon 71 Achlalt narprovince 30 18 3 (10.0%) 0(0.0%) 72 Ankhny och 27 27 0 (0.0%) 0(0.0%) 73 Mendbulag 45 54 6 (13.3%) 0(0.0%) 74 Khos chagnuur 22 41 0 (0.0%) 0(0.0%) 75 Itgeliin erel 33 54 5 (15.2%) 0(0.0%) 76 Gerelt mandakh 32 46 0 (0.0%) 0(0.0%) Provincial hos- 77 36 38 1 (2.8%) 0(0.0%) pital Total (78 units) 7 085 7215 513 (7.2%) 144(2.0%) Average 91 92.5 6.6 (7.2%)1.8(2.0%)

87 B5265G1 Annual Report – 2007/2008 Table 26 (%) number of received reports reported expected number of (%) number of received reports reported expected number of (%) number of received reports reported expected number of (%) number of received reports 2004/2005 2005/2006 2006/2007 2007/2008 reported expected number of Weekly reporting of ILI from the provinces in last 4 seasons: 2004/2005, 2005/2006, 2006/2007 and 2007/2008 78 Dornogovi Dundgovi 34 34 11 (32.3%) 1 (2.94%) 34 34 33 (97.0%) 32 (94.1%) 52 52 50 (96.1%) 48 (92.3%) 52 52 52 (100%) 49 (94.2%) 23 Bayankhongor4 Bayan-Ulgii5 Bulgan 346 Darkhan-Uul Dornod 34 21 (61.7%)9 34 33 34 Govi-Altai (97.0%) 34 19 34 (55.8%) 25 34 (73.5%) 34 (100%) 34 24 34 (70.5%) 34 34 (100%) 22 52 33 (64.7%) 34 (97.0%) 34 (100%) 52 50 34 33 (96.1%) 52 (97.0%) 51 52 (98.0%) 32 52 (94.1%) 51 52 (98.0%) 47 52 (90.3%) 52 (100%) 52 51 52 (98.0%) 50 52 (96.1%) 51 51 (98.0%) (98.0%) 52 49 (94.2%) 52 52 (100%) 51 (98.0%) 1 Arkhangai 34 34 (100%) 34 34 (100%) 52 51 (98.0%) 52 52 (100%) 20 Uvurkhangai 34 34 (100%) 34 28 (82.3%) 52 52 (100%) 52 52 (100%) 10 Govisumber 34 1017 (29.4%) Tuv18 Umnugovi 34 3222 (94.1%) 34 Ulaanbaatar sity 34 52 15 34 (44.1%) 22 (64.7%) 45 18 (86.5%) (52.9%) 34 34 52 34 30 (88.2%) 30 (88.2%) 45 28 (86.5%) (82.3%) 52 52 52 50 (96.1%) 52 (100%) 52 52 (100%) 52 50 52 (96.1%) 52 (100%) 52 (100%) 12 Khovd13 Khuvsgul14 Orkhon15 Selenge16 Sukhbaatar 34 3419 34 Uvs 25 20 34 34 (73.5%) (58.8%)21 29 Zavkhan (85.2%) 16 11 34 34 (47.0%) (32.3%) 34 31 31 34 34 34 (91.1%) (91.1%) 34 31 (91.1%) 30 31 8 52 22 (88.2%) (91.1%) 52 (23.5%) (64.7%) 52 51 52 52 52 34 (98.0%) 34 (100%) 49 (94.2%) 47 51 30 52 28 (90.3%) (98.0%) 52 (88.2%) (82.3%) 52 52 50 52 (100%) 52 52 (96.1%) 52 52 (100%) 49 51 52 (94.2%) (98.0%) 50 (100%) (96.1%) 52 52 52 51 (100%) (98.0%) 11 Khentii 34 14 (41.1%) 34 31 (91.1%) 52 51 (98.0%) 52 50 (96.1%) No Provinces

88 Cooperative Agreement Implementation Table 27 received number of reports (%) of number reported expected received number of reports (%) reported expected number of received number of reports (%) reported expected number of received number of reports (%) 2004/2005 2005/2006 2006/2007 2007/2008 reported expected number of Daily reporting of ILI from the provinces in last 4 seasons: 2004/2005, 2005/2006, 2006/2007 and 2007/2008 78 Uvurkhangai province UB, Amin tus 127 113 (88.9%) 127 167 127 (100%) 167 (100%) 167 221 167 (100%) 216 (97.7%) 221 256 221 254 (100%) (99.2%) 256 256 (100%) 23 Dornod province4 Dornogovi province5 Khovd province6 Orkhon province Selenge province 127 1279 127 46 127 (100%) UB, Amgalan itgehui NA (36.2%) 127 127 167 167 (100%) 127 104 NA (81.8%) 167 167 167 (100%) 127 (100%) (100%) 167 167 (100%) 221 221 NA 167 167 (100%) 221 221 221 167 (100%) (100%) (100%) 221 NA 221 256 (100%) 256 221 221 (100%) 254 254 256 (99.2%) (99.2%) 221 221 (100%) 256 255 (99.6%) 216 254 256 (97.7%) (99.2%) 255 256 (99.6%) 255 (99.6%) 1 Darkhan-Uul province NA NA NA NA 221 221 (100%) 256 249 (97.2%) 20 UB, Nasan-Urt 12727 127 UB, Unu achit (100%) 167 167 127 (100%) 127 (100%) 221 221 167 (100%) 167 (100%) 256 256 (100%) 221 221 (100%) 256 256 (100%) 10 UB, Baganuur 12717 UB, Gurvan sanchir 12718 (100%) UB, Manal uils 167 12722 167 UB, Shar degd23 127 (100%) 127 (100%) UB, Tegsh mend24 UB, Tegsh -Ulzii25 127 167 UB, Tumenjargalan26 221 (100%) UB, Uils negten 167 127 221 127 167 (100%) (100%) 127 127 127 127 167 (100%) (100%) 256 127 221 127 (100%) 127 (100%) (100%) 256 167 167 221 (100%) 127 (100%) 221 167 167 (100%) 167 167 (100%) (100%) 221 167 256 167 167 (100%) (100%) (100%) 256 221 221 167 (100%) 256 (100%) 221 221 221 221 256 (100%) (100%) (100%) 221 221 221 (100%) (100%) 256 256 221 256 (100%) 256 256 256 (100%) (100%) 256 256 256 (100%) (100%) 256 (100%) 12 UB, Enkhelberel13 UB, Enkhsunder14 UB, Enkhtitem15 UB, Eruul urkh16 UB, Itgel ugtah 127 12719 127 127 UB, Nalaikh (100%) 127 127 (100%)21 127 127 UB, Sankoll 167 (100%) 127 167 (100%) 127 167 (100%) 167 (100%) 167 167 127 (100%) 167 167 (100%) 221 167 127 85 (100%) 221 167 (66.9%) (100%) 221 127 221 (100%) 221 (100%) 167 221 (100%) 221 221 256 (100%) 167 167 216 256 (97.7%) (100%) 221 256 (100%) 167 (100%) 256 256 (100%) 256 (100%) 221 256 256 (100%) 256 (100%) 221 221 256 (100%) (100%) 221 (100%) 256 256 256 (100%) 256 (100%) 11 UB, Buyant manal 127 127 (100%) 167 167 (100%) 221 221 (100%) 256 256 (100%) No Sentinel sites 89 B5265G1 Annual Report – 2007/2008

Table 28 Daily reporting from the inpatient -based sentinel sites in 2007/2008 seasons

2007/2008 season No Sentinel sites number of number of received expected reported reports (%) 1 UB, Songinokhairkhan district hospital 52 52 (100%) 2 UB, Khan-Uul district hospital 52 52 (100%) 3 UB, Bayangol district hospital 52 51 (98.0%) 4 UB, Bayanzurkh district hospital 52 52 (100%) 5 UB, Sukhbaatar district hospital 52 52 (100%) 6 UB, Chingeltei district hospital 52 52 (100%) 7 UB, NCCD 52 52 (100%) 8 UB, MCHRC 52 52 (100%) 9 SE provincial hospital 52 52 (100%) 10 DG provincial hospital 52 52 (100%) 11 DA provincial hospital 52 52 (100%) 12 OR provincial hospital 52 52 (100%) 13 KhO provincial hospital 52 52 (100%) 14 DO provincial hospital 52 52 (100%) 15 UV provincial hospital 52 52 (100%)

In addition to the existing out patient-based surveillance it has been established a hospital-based sentinel surveillance since 2006. The introductory workshops have been organized in UB city in September 2006 (Annexes 49-51). Currently there are totally 15 hospital-based sentinel surveillance sites functioning within our Influenza Surveilance Network, namely: 6 city-district hospitals, 7 provincial hospitals, MCHRC and NCCD. The workshops on influenza surveillance activities were organized quarterly (Annexes 69-72 and 75-76) in the UB city and the project implementation status has been discussed. During the period under this Annual Report there have been totally 76 ISSSs fully functional decreasing the number of ISSSs in comparison with previous year due to 2 FGP-based ISSSs was integrated into another ISSSs in Orkhon and Selenghe provinces. The assessment of ISSSs was done for all ISSSs including in-and out-patient-based sites. Sentinel surveillance sites were assessed with 90 Cooperative Agreement Implementation satisfactory results (Annexes 73 and 74). Dr. A. Burmaa, epidemiological surveillance team leader was attended to the Informal consultation on Influenza surveillance guidelines from 4 to 5 February 2008 in Manila, Philippines. Epidemiology group of the Project has been provided by necessary supplies through the Project Fund (Annex 82).

3.4.4. Strengthening Rapid Outbreak Response

In the beginning of 2006/2007 influenza season the Project has purchased 500 doses of influenza vaccine with the WHO recommended composition and organized immunization with medical personals of ISSSs in UB and some of selected provinces. The clinico- epidemiological observation and the study of serological response to the vaccine were completed. Study result showed that influenza virus split vaccine was with a low reactigenity. The vaccine should be used with special care for person who has high blood pressure or cardiovascular diseases. Acute respiratory infection occurrence, invalidity due to ILI and treatment cost were statistically significant higher (p≤0.005) in the control group compared with the vaccinated group. 100 doses of the human influenza-specific immunoglobulin have been experimentally produced in collaboration with the Production Unit of PHI and study on its clinical use for treatment was completed. Study group concluded that human influenza-specific immunoglobulin which was produced domestically is less allergenic and was effective for ARI therapy. The draft of instruction on how to use of human influenza- specific immunoglobulin was developed on the basis of the study results and has been submitted to PHI for a review and an approval.

3.4.5. Ensuring Effective Risk Communication

The “Influenza Emergency Risks Communication” project, funded by Government of Japan has organized in total 52 training workshops on Avian Flu all over the country. It has been trained 18 National Trainers of Trainers, 175 Regional Advisers. More than 1,800 people have been attended these workshops. During these workshops it has been distributed training CDs and other IEC materials as well as more than 1,770 copies of “Influenza-2006” guideline which was prepared and printed by our project. A World Bank project on Control of Avian Flu and IPPP is expected to start from October 2008. 91 B5265G1 Annual Report – 2007/2008

3.4.6. International Collaboration

International Collaboration has been dramatically increased in the 2006/2007 and 2007/2008 seasons. Dr. B. Enkhtuya, Respiratory team leader, NCCD has participated in the workshop on Avian Influenza and Pandemic Influenza Rapid Containment on 24 -28 March 2007 in Cambodia supported by WHO. Prof. P.Nymadawa, PI and Project Director has been invited to the NICs Meeting of WHO Asia-Pacific Regions in Melbourne, Australia on May 1-4, 2007 with poster presentation. Prof. P.Nymadawa, and Drs B.Darma (Head, Virology Laboratory, NCCD), A.Burma (Head, Epidemiology Branch, NCCD) were participated in the Options VI Conference in Toronto, Canada, on June 15-22, 2007 and have established important connections with representatives from NICs, influenza research networks and industry (Figure 122). Prof. Hitoshi Oshitani and Dr. Taro Kamigaki, Department of Virology, Tohoku University Graduate School of Medicine, Japan have visited Mongolia on 2-4 July, 2007 and discussed further collaboration on influenza burden studies (Figure 123). Dr. R. Oyungerel, MD, PhD, Scientific Secretary, NCCD has attended Workshop on Pandemic Influenza-Rapid Containment on July 2-5, 2007 in Alma-Ata, Kazakstan which was organized by WHO in collaboration with ADB. Mrs. D. Enkhsaikhan has attended to the training workshop on Avian Influenza Virus Bioinformatics and Genomics on 6-11 August, 2007 in Hanoi, Vietnam which was organized by WPRO in collaboration with CDC, Atlanta, USA and Hanoi School of Public Health. Dr. B. Darmaa has attended in the two-day Consultation Meeting on Laboratory Database Development of NICs in September, 2007 in WPRO, Manila, Philippine and gave 20 min presentation on Laboratory Database Development of NIC, Mongolia. The laboratory technician Mr. N. Naranbold from VL has participated in September 2007 in 2 weeks training on influenza virus microneutrilization assay in the section of Influenza Immunology and Pathogenesis, Influenza Division, CDC, Atlanta, USA. Dr. R. Tuul, MD, PhD, virologist, VL, NCCD has participated in the training course on Laboratory Bio-Safety organized by WHO in 17- 19 October 2007 in Beijing, China and got a certificate. Dr. U. Unursaikhan, MD, virologist, VL, CIDNF, Dr. R. Tuul, MD, PhD, virologist, VL, NCCD and Ms. S. Tsatsral, virologist, VL,

92 Cooperative Agreement Implementation

NCCD have attended the training course on Laboratory Bio-Safety and Bio-Security organized by CDC, USA on 5-13 November 2007 in Alma Ata, Kazakhstan they got certificates. Dr. B. Darmaa, MD, and Mrs. D. Enkhsaikhan, BSc(Biol) were attended one month laboratory training in the Influenza Division, CDC, USA on 6 November to 3 December, 2007. Dr. B. Darmaa has worked in the laboratory of the Influenza Strain Surveillance Section and Mrs. D. Enkhsaikhan in the laboratory of the Molecular Genetics Section, Influenza Division, CDC, USA. Dr. A. Burmaa, MD, epidemiological surveillance team leader has attended the Informal consultation on Influenza surveillance guidelines from 4 to 5 February 2008 in Manila, Philippines. Officers from US Embassy in UB, Mongolia have visited to the NCCD and introduced with the Project implementation status. Dr. B. Darmaa, virological surveillance team leader and Ms. S. Tsatsral, virologist participated in follow-up EQAP: WHO training for the detection of influenza A viruses by PCR on 25 Feb to 1 March, 2008 in Hong Kong, SAR, China. The influenza Project team from Mongolia consisteing of 4 persons (Prof. P. Nymadawa, Project director, Ms. D. Sodbayar, Project manager, Dr. A. Burmaa, Epidemiological surveillance team leader and Ms. S. Tsatsral, Virologist, NCCD) participated in the International Conference on Emerging Infectious Diseases (ICEID) during 16-19 March, 2008 and CDC Influenza Division study tour for professionals staff during 20-25 March 2008 in Atlanta city, Georgia, USA. All members of the team has received a certificate for participating in ICEID. Mr. N. Naranbaatar, Mrs. D. Enkhsaihan, Mr. N. Naranbold have attended in Viral Phylogenetics & Bioinformatics Workshop on 1-4 April 2008 at the Department of Microbiology, the Chinese University of Hong Kong, Prince of Wales Hospital, Shatin, New Territories, Hong Kong SAR. Dr. B. Darmaa has participated in the Second Meeting for Asia- Pacific NICs during 21-24, April 2008 in Tokyo, Japan and presented poster presentation on Influenza Surveillance in Mongolia. Prof. P. Nymadawa, PI and Project Director, Ms. D. Sodbayar, Project Manager, Dr. L. Enkhbaatar, Outreach supervisor have attended the Global Grantee meeting, Cairo, Egypt, 13-15 August 2008 and presented a report “IPPP evaluation exercise in Mongolia”.

93 B5265G1 Annual Report – 2007/2008

Total 11 persons from abroad have visited Mongolia and Project site in 2006-2008, namely: • Dr. Masato Tashiro, Department of Viral Diseases and Vaccine Control, NIID, Japan has visited Mongolia as a STC, WHO and has met laboratory personnel VL, NCCD and doctors and nurses of some ILI sentinel sites (Figures 80 and 81) on 20-26 August, 2007 and produced recommendations on strengthening of virology laboratory capacity (Annex 48). • Mrs. T. Turski, Dr. G. MacDonald, Dr. D. Garcia from CDC, USA have visited Mongolia and participated in the IPPP assessment workshop during April 14-19, 2008. • Prof. G.C. Gray, Center for Emerging Infectious Diseases, University of Iowa College of Public Health, Iowa city, Iowa, USA, Dr. J.L. Sanchez, United States Department of Defense, Global Emerging Infections Surveillance and Response System, Silver Spring, Maryland, USA, Dr. J.A. Pavlin, Armed Forces Research Institute of Medical Sciences, Bangkok, Thailand, Dr. R.V. Gibbons, Department of Virology, Armed Forces Research Institute of Medical Sciences, Bangkok, Thailand, Dr. K. Earhart, Medical Corps, U.S. Naval Medical Research Unit No3, Cairo, Egypt, Dr. J. A. Richt, National Animal Disease Center-ARS-USDA, Ames, IA, USA and other delegates of International Symposium on Emerging Infectious Diseases, Ulaanbaatar, Mongolia, May 15- 16, 2008, organized by NCCD, MoH, Mongolia in collaboration with University of Iowa College of Public Health, Iowa City, Iowa, USA, WR. Office in Mongolia have visited the Virology Laboratory, NCCD, MoH, Mongolia. • Prof. Hitoshi Oshitani, Ass. Prof. Taro Kamigaki from Tohoku University, Sendai, Japan visited Mongolia during May 24-31, 2008 and acquainted with sentinel site activities in Selenghe province. During their visit they met with heads of Health Statistics and Information Department of NCHD and MCHRC and discussed further collaboration on excess mortality study due to influenza in Mongolia. “Development of Influenza Surveillance Network” project team is planning to conduct community based influenza disease burden study in collaboration with Virology Department, Graduate School of Medicine, Tohoku University, Sendai, Japan in the next influenza season.

94 Cooperative Agreement Implementation

CONCLUSION

1. Cooperative Agreement Project has reached the planned aims. 2. In the first year of activity the emphasis given to the physical strengthening of the Network, especially VL/ NCCD. 3. In the second year of the activity the main attention has been placed on the establishment of the Project Management Team and the strengthening of the sentinel sites. 4. In the third year of implementation of the Project the main emphasis is given to strengthen laboratory capacity and sample transportation, and it has been introduced a full-year surveillance both for outpatient and inpatient sentinel surveillance sites. 5. In the fourth year of implementation of the Project the main emphasis has been given for assessments of ISSSs and IPPP and strengthening hospital-based sentinel surveillance sites.

95 B5265G1 Annual Report – 2007/2008

FOUR. ANNEXES ANNEX 1 IST composition:

(approved by the order No 241/2004 of the Minister of Health, Mongolia)

Team leader: Director-General of NCCD Secretary: Head, Department of Infectious Diseases Surveillance and Prognosis, NCCD (DIDSP), Members: - Deputy Director for Infectious Disease Surveillance, NCCD, - Head, Virology Laboratory, NCCD, - Head, Department of Infectious Diseases without Vaccine Prevention, NCCD, - Epidemiologist for Respiratory Infections, DIDSP, - Epidemiologist for ILI, DIDSP, - Virologist, VL, NCCD, - Manager, Medical care and Service quality, NCCD, - Officer in charge of Infectious Diseases, Health Department, UB city, Government.

ANNEX 2 ISAC composition:

(approved by the order No 241/2005 of the Minister of Health, Mongolia):

Chair: President, Subassembly of Medical Science, Mongolian Academy of Science, Secretary: Officer in charge of Infectious Diseases Control, MoH Members: Head of Virology Laboratory, Veterinary Research Institute, Agriculture University of Mongolia; Chief Infectionist, MoH Head, Department of Veterinary Service, MoFA Deputy Director, Center of Infectious Diseases with Natural Foci, MoH, Director-General, Maternal and Child Health Research Center, MoH.

96 Cooperative Agreement Implementation

ANNEX 3 ILI Sentinel Surveillance Sites in the Capital City

Location out of them

No FGP’s names City district Subdistrict Number of staffs medical doctors nurses others I II I II I II I II 1 “Amin tus” 10th 9 10 4 4 4 4 1 2 2 “Enkhtitem”Khan uul 3rd 7 9 4 3 3 3 0 3 3 ”Manal uils” 5th 7 8 3 3 3 3 1 2 4 ”Shar degd” 8 8 433312 5 ”Itgel ugtakh”Bayangol 12th 6 6 3 3 3 3 0 0 6 ”Gurvan sanchir” 11th 8 8 4 4 3 3 1 1 7 ”Unu achit” 13th 9 9 5 5 4 4 0 0 8 ”Enkh elberel”Songinokhairkhan 9th 7 7 3 3 3 3 1 1 9 ”Buyant manal” 1st 13 11 6 4 6 6 1 1 10 ”Tumen jargalan” 12th 9 9 4 3 4 5 1 1 11 ”Tegsh Ulzii”Chingeltei 16th 9 9 5 5 3 3 1 1 12 ”Uils negten” 18th 6 7 3 3 2 3 1 1 13 ”Sankoll” 13th 7 7 3 3 3 3 1 1 14 ”Tegsh mend”Sukhbaatar 3rd 7 8 4 5 3 3 0 0 15 ”Enkh sunder” 7th 8 8 4 4 4 4 0 0 16 ”Eruul urkh” 4th 10 10 4 4 5 5 1 1 17 ”Amgalan Bayanzurkh 12th 9 9 335511 itgekhui” 18 ”Nasan urt” 16th 7 7 3 3 4 4 0 0

19 ”Ami erdene” Nalaikh 12 12 5 5 5 5 2 2

20 ”Enerelt Ulzii” Baganuur 9 11 4 4 4 4 1 1

Total 167 173 78 74 74 76 15 21

Explanation: I – 2004/2005 season; II – 2005/2006 season;

97 B5265G1 Annual Report – 2007/2008

ANNEX 4 ILI Sentinel Surveillance Sites in the Provinces

Out of them

Number No FGP’s names Province of staff others nurses doctors medical

IIIIIIIIIIII 1 “Agatova“ 69333303 2 “Goyomend“ 6 6 3 3 3 3 0 3 Dornogovi 3 “Misheelt mana“ 6 8 3 3 3 3 0 3 4 “Railway clinic“ 5 8 3 4 2 4 0 4 5 “Asralt Uils“ 66333202 6 “Dornin ireedui“ 7 7 2 2 3 4 2 4 7 “Myangan jargalan“ 5 6 1 2 3 3 1 3 Dornod 8 “Tseene tsesteg“ 10 10 3 2 5 5 2 5 9 “Eruul zon“ 8 9 2 3 4 4 2 4 10 “Yagaan tseene“ 10 8 4 3 4 4 2 4 11 “Narni dush“ 67124414 12 “Tushig dulguun“ 11 11 3 3 5 5 3 5 Uvurkhangai 13 “Uyan setgel“ 11 11 4 4 5 5 2 5 14 “Enkhiin khurd“ 8 9 3 3 4 4 1 4 15 “Zuvlukh“ 66333303 16 “Nomt khan“ 7 7 3 3 3 3 1 3 17 “Khadan khui“Selenge 7 7 1 2 4 3 2 3 18 “Egneshgui“ 6 6 1 2 3 2 2 2 19 “Emnekh“ 3 5 1 2 2 2 0 2 20 “Baatarkhairkhan“ 77125414 21 “Bugat“ 8 8 4 3 3 4 1 4 22 “Buyant“Khovd 7 7 3 3 3 3 1 3 23 “Jargalant“ 9 9 4 3 3 4 2 4 24 “Rashaant“ 7 7 3 3 3 3 1 1

Total 172 184 62 66 83 84 27 82

Explanation: I – 2004/2005 season; II – 2005/2006 season;

98 Cooperative Agreement Implementation

ANNEX 5 Programme of the 1st National Influenza Workshop (NIW1), September 8-9, 2005, Ulaanbaatar

No Topic Time Responsible person FIRST DAY Registration 8.30-9.00 Organizers Moderator: Prof. T.Altantsesteg, MD, Opening Session 9.00-11.00 PhD, Director-General, NCCD, Head, NIC Opening 9.00-9.15 Sh. Enkhbat, Vice Minister of Health Global Influenza Dr Weigong Zhou, MD, PhD, Officer 9.15-10.15 Surveillance and Control of WPRO

Epidemiology of IILI during 2004/2005 Dr.N. Tsend, MD, PhD, Deputy Influenza saeson in 10.15-11.00 Director of NCCD, Chief Mongolia and prognosis Epidemiologist of MoH for the next season

Tea break 11.00-11.30 Moderator: Mr. R. Hagan, WR, First plenary session 11.30-13.00 Mongolia National Plan on Dr. J. Altantuya, MD,Head of Policy 11.30-12.15 Pandemic Preparedness Coordination Dept, MoH Implementation of Cooperative Agreement Prof. T.Altantsesteg, PhD, “ Influenza Surveillance 12.15-13.00 Director,NCCD, Head of NIC Network” supported by CDC, USA Lunch 13.00-14.00 Moderator: Prof. P. Nymadawa, Second plenary session 14.00-18.00 President, Mongolian Academy of Medical Science Avian Influenza situation Dr Ok Park, MD, PhD, Officer of in Asia and Pandemic 14.00-15.15 WPRO Preparedness Influenza virus ecology: Dr. J. Bekh-Ochir, Ph D, Senior situation in the world and 15.15-17.00 scientist, Veterinary Institute, University in Mongolia of Agriculture Discussion 17.00-18.00 SECOND DAY Moderator: Weigong Zhou, MD, PhD, Third plenary session 9.00-11.00 Officer of WPRO 99 B5265G1 Annual Report – 2007/2008

Clinical feature and Dr.G. Zulkhuu, MD, PhD, Chief 9.00-10.00 treatment of ILI Infectionist, MoH Prof. P. Nymadawa, President of Specific treatment and 10.00-11.00 Mongolian Academy of Medical prophylaxis of Influenza Sciences

Tea break 11.00-11.30

Discussion 11.30-12.30

Dr.N. Tsend, MD,PhD, Deputy Organization of working 12.30-13.00 Director of NCCD, Chief groups Epidemiologist of MoH

Lunch 13.00-14.00

1. Responsibilities of Central Government ( Moderators: Dr. J. Altantuya, Dr Ok Park WHO); 2. Responsibilities of local Government ( Moderators: Dr.N. Tsend, NCCD; Dr.D.Oyunsuren, Umnugovi Province Health Department) Working group’s 14.00-15.30 3. Responsibilities of Health Sector( discussion Moderators: Prof.P. Nymadawa, MAS, Weigong Zhou, WHO) 4. Responsibilities of Veterinary Sector ( Moderator: Dr.J. Bekh-Ochir,VRI) 5. Responsibilities of Citizens and Mass Media (Moderator: Prof. T.Altantsesteg, NCCD, Dr.V.Garmaa, NCHD)

Tea break 15.30-16.00

Moderators: Prof. T.Altantsesteg, MD, Closing session 16.00-18.00 PhD, Director-General, NCCD, Head, NIC

Discussion and 16.30-17.30 recommendations

Closure 17.30-18.00

100 Cooperative Agreement Implementation

ANNEX 6 Participants` list of the National Workshop on Influenza, September 8-9, 2005, Ulaanbaatar

No Participant`s name Organization Position

UN Organizations 1 R. Hagan WHO Representative Office Head 2 J. Mendsaikhan WHO Representative Office Officer 3 T. Altannavch UNICEF Officer Ministry of Health 4 Sh. Enkhbat Ministry of Health Vice minister 5 J. Altantuya Policy Coordination Department Head 6 D. Narangerel Policy Coordination Department Senior officer Officer in charge of drug 7 Ch. Munkhdelger - supply 8 I. Bat-Erdene Health Service Department Officer 9 Ch. Bayarmaa Health Service Department Officer US Embassy 10 Eric Wood Medical Department Medical officer 11 D. Batsuvd Medical Department Medical officer 12 Ms. S. Nielson Peace Corps in Mongolia Officer

Ministry of Food and Agriculture

13 J. Bekh-Ochir Veterinary Research Laboratory Chief 14 Ts. Sugar Veterinary Central Laboratory Bacteriologist 15 N. Lkhagvasuren Capital Veterinary Division Head State Professional Inspection Agency 16 D. Oyunchimeg Health Inspection Division Officer 17 D. Selenge Health Inspection Division Senior inspector Epidemiological Inspection 18 Sh. Lkhagvasuren Senior inspector Division Epidemiological Inspection 19 A. Enkhtuya Division. Leader of Senior inspector epidemiological unit

University of Health Science

101 B5265G1 Annual Report – 2007/2008

Chair of Infectious Diseases Lecturer, Chief 20 G. Zulkhuu Department Infectionist of the MoH

Maternal and Child Health Research Center

21 N. Tsendsuren Clinical Service Division Deputy director

National Center for Communicable Disease 22 T. Altantsesteg NCCD Director-General 23 P. Nymadawa NCCD Consultant 24 N. Tsend NCCD Deputy director 25 T. Navchaa NCCD Deputy director 26 J. Baatarchuluun NCCD Deputy director Management and Planning 27 D. Batmunkh Head Department 28 Ch. Erkhemtsesteg United Laboratory Chief Tuberculosis surveillance 29 N. Naranbat Head Department Surveillance and Prevention 30 B. Enkhtuya Head Department Surveillance and Prevention 31 N. Dondog Consultant Department 32 N. Tsolmandakh Ward of Respiratory Infections Chief 33 R. Tuul Respiratory Viral Laboratory Chief 34 B. Darmaa Respiratory Viral Laboratory Virologist 35 D. Enkhsaikhan Respiratory Viral Laboratory Virologist 36 P. Tserendlogor Outpatient Unit Medical doctor 37 Ch. Munkhtsesteg Immunization Ward Head 38 D. Naranzul Immunization Ward Epidemiologist 39 L. Dashtseren Surveiilance and Prevention Unit Head 40 A. Burmaa Surveiilance and Prevention Unit Epidemiologist 41 D. Baigalmaa Surveiilance and Prevention Unit Epidemiologist 42 S. Sarantsesteg Surveiilance and Prevention Unit Epidemiologist 43 S. Anand Surveiilance and Prevention Unit Epidemiologist 44 L. Enkhbaatar NCCD Medical doctor 45 D. Sodbayar Surveiilance and Prevention Unit Epidemiologist 46 M. Tsolmon Surveiilance and Prevention Unit Epidemiologist 47 S. Altanchimeg Surveiilance and Prevention Unit Epidemiologist 48 G. Surenkhand Immunization fund Manager 49 N. Oyungerel Surveiilance and Prevention Unit Epidemiologist 50 G. Tserendolgor Surveiilance and Prevention Unit Epidemiologist 51 D. Otgon Surveiilance and Prevention Unit Epidemiologist 52 D. Munkhtsesteg Surveiilance and Prevention Unit Epidemiologist 102 Cooperative Agreement Implementation

53 M. Narantuya Surveiilance and Prevention Unit Epidemiologist 54 J. Khuukhenbaatar Surveiilance and Prevention Unit Epidemiologist assistant 55 N. Khandsuren Surveiilance and Prevention Unit Epidemiologist assistant 56 N. Enkhtsesteg Surveiilance and Prevention Unit Epidemiologist assistant 57 Ts. Bold-Erdene Surveiilance and Prevention Unit Epidemiologist assistant 58 Ts. Sugar Surveiilance and Prevention Unit Epidemiologist assistant 59 E. Oyuntuya Immunization Ward Doctor assistant 60 D. Togtokhbayar Immunization Ward Doctor assistant

Center for Infectious Disease with Natural foci

61 D. Otgonbaatar CIDNF Director 62 D. Tserennorov CIDNF Deputy director 63 Ts. Ankhtuya Surveillance Department Head National Center of Health Development 64 S. Dulamsuren NCHD Director 65 V. Garmaa NCHD Manager National Emergency Management 66 Enkhbat Officer Department Arkhangai province 67 R. Gandiimaa Provincial Health Department Deputy Provincial Emergency 68 D. Renchindorj Head Management Division 69 Ya. Khaltar Provincial Health Department Epidemiologist 70 J. Ariunaa Family clinic of “Armun” Leader physician Bayan-Ulgii province 71 A. Batai Provincial Health Department Head Provincial Emergency 72 J. Umirbek Head Management Division 73 R. Bolat Provincial Health Department Epidemiologist Bayankhongor province Provincial Emergency 74 D. Amarjargal Head Management Division 75 D. Algaa Provincial Health Department Head 76 A. Orkhonchimeg Provincial Health Department Epidemiologist 77 D. Tserenkhorloo Family clinic of “Otoch nomgon” Leader physician Bulgan province Provincial Emergency 78 D. Uuganbayar Head Management Division 79 B. Myagmar Provincial Health Department Head 80 D. Narantuya Provincial Health Department Epidemiologist 103 B5265G1 Annual Report – 2007/2008

81 G. Tsevelkhand Family clinic Leader physician Gobi-Altai province Provincial Emergency 82 N. Sodnomjamts Head Management Division 83 S. Bayarjargal Provincial Health Department Head 84 D. Baigalimaa Provincial Health Department Epidemiologist 85 D. Tugsbileg Family clinic Leader physician Gobisumber province Provincial Emergency 86 Ch. Amgalantuya Head Management Division 87 B. Tsetsegmaa Provincial Health Department Head 88 Sh. Altantsetseg Provincial Health Department Epidemiologist 89 O.Oyun Family clinic Leader physician Darkhan-Uul province Provincial Emergency 90 D. Lkhagvasuren Head Management Division 91 Zolboot Provincial Health Department Head 92 L.Ulziijargal Provincial Health Department Epidemiologist 93 S. Oyundelger Family clinic Leader physician

Dornogobi province

Provincial Emergency 94 M.Altangerel Head Management Division 95 G.Enkhtsetseg Provincial Health Department Head 96 Ch. Tsestegmee Provincial Health Department Epidemiologist 97 L.Purevsuren Provincial veterinary laboratory Chief 98 Ch. Ariungerel Family clinic of “Misheel mana” Leader physician

Dornod province

Provincial Emergency 99 Ch. Batsuuri Head Management Division 100 D. Doljin Provincial Health Department Head 101 D. Gereltuya Provincial Health Department Epidemiologist 102 D. Nyamsuren Provincial veterinary laboratory Chief 103 Ya. Erdenetuya Family clinic Leader physician

Dundgobi province

Provincial Emergency 104 Ch. Khureltogoo Head Management Division 105 Ts. Enkhsaikhan Provincial Health Department Head 106 D. Tsetsgee Provincial Health Department Epidemiologist 107 B. Erdenesuren Family clinic Leader physician

104 Cooperative Agreement Implementation

Zavkhan province

Provincial Emergency 108 D. Enkhbayar Head Management Division 109 M. Dulamjav Provincial Health Department Head 110 J. Gerelmaa Provincial Health Department Epidemiologist Coordinator in charge 111 G. Dashdavaa Provincial Health Department of soum hospitals and family clinics Orkhon province Provincial Emergency 112 G. Batbaatar Head Management Division 113 G. Ankhbayar Provincial Health Department Head 114 D, Jargal Provincial Health Department Epidemiologist 115 Kh. Saranchimeg Family clinic Leader physician

Uvurkhangai province

Provincial Emergency 116 G. Chuluunbaatar Head Management Division 117 B. Sayamaa Provincial Health Department Head 118 D. Narantsesteg Provincial Health Department Epidemiologist 119 J. Purev Provincial veterinary laboratory Chief 120 Yo. Oyuntsesteg Family clinic of “ Tegsh dulguun” Leader physician

Umnugobi province

Provincial Emergency 121 O. Sainkhuu Head Management Division 122 N. Oyunsuren Provincial Health Department Head 123 D. Sukhee Provincial Health Department Epidemiologist 124 L. Lkhagvasuren Family clinic Leader physician Sukhbaatar province Provincial Emergency 125 G. Ankhbayar Head Management Division 126 D. Bor Provincial Health Department Head 127 N. Enkhmaa Family clinic of “ Tegsh dulguun” Leader physician Selenge province 128 G. Tugsjargal Provincial Health Department Deputy 129 J. Tserendolgor Provincial Health Department Epidemiologist

105 B5265G1 Annual Report – 2007/2008

130 D. Chimgee Family clinic Leader physician

Tuv province

Provincial Emergency 131 D. Ganbat Head Management Division 132 D. Ochirbat Provincial Health Department Head 133 Ch. Purevsuren Provincial Health Department Epidemiologist 134 Tumendemberel Family clinic Leader physician Uvs province Provincial Emergency 135 D. Chuluunbaatar Head Management Division 136 B. Dorjgotov Provincial Health Department Head 137 B. Narantuya Provincial Health Department Epidemiologist 138 K. Oyunbileg Family clinic Leader physician

Khovd province Provincial Emergency 139 N. Buyantur Head Management Division 140 B. Jamsran Provincial Health Department Head 141 S. Bat-Ulzii Provincial Health Department Epidemiologist 142 B. Munkhbaatar Agricultural laboratory Chief 143 D. Urtnasan Family clinic Leader physician Khuvsgul province 144 D. Altantsesteg Provincial Health Department Officer 145 D. Oyunchimeg Provincial Health Department Epidemiologist 146 N. Lkhagva Family clinic Leader physician

Khentii province

Provincial Emergency 147 D. Batjargal Head Management Division 148 N. Orkhonchimeg Provincial Health Department Head 149 D. Baasandorj Provincial Health Department Epidemiologist 150 B. Ochirkhuyag Family clinic Leader physician

Capital Emergency Management Division Capital Emergency Management 151 S. Sukhbaatar Officer Division Bayangol district Emergency 152 Ch. Nergui Head Management Ward

106 Cooperative Agreement Implementation

Bayanzurkh district Emergency 153 A. Batmunkh Head Management Ward Khan-Uul district Emergency 154 Ch. Tumurkhuyag Head Management Ward Chingeltei district Emergency 155 Damtsagdorj Head Management Ward Songinokhairkhan district 156 A. Dugardorj Head Emergency Management Ward Baganuur district Emergency 157 S. Tsendsuren Head Management Ward Yo. Sukhbaatar district Emergency 158 Head Amarbayasgalan Management Ward Bagakhangai district Emergency 159 N. Dashpuntsag Head Management Ward Capital Professional Inspection Department Capital Professional Inspection 160 B. Sukhee Inspector Department Capital Professional Inspection 161 B. Tserennadmid Inspector Department 162 Ch. Urjee Epidemiological Unit Head 163 Ts. Tsetsegmaa Epidemiological Unit Epidemiologist Capital Health Department 164 Ts. Gankhuu Capital Health Department Director 165 D. Atarmaa Capital Health Department Deputy director 166 L. Tuvshinzaya Capital Health Department Epidemiologist Officer in charge for 167 D. Gantsetseg Capital Health Department family clinics Bayanzurkh District Health 168 B. Puntsag Head Department Bayanzurkh District Health 169 M. Suren Epidemiologist Department Bayanzurkh District Health 170 O. Oyunchimeg Epidemiologist Department 171 B. Altantuya Family clinic of “Eruul urkh” Leader physician Family clinic of “Amgalan 172 G. Oyunbileg Leader physician itgekhui” 173 Ch. Tserennadmid Family clinic of “Nasan urt” Leader physician Bayangol District Health 174 S. Tuul Head Department 175 D. Munkhjargal Family clinic of “3 sanchir” Leader physician 176 A. Tsend-Ayush Family clinic of “Itgel ugtakh” Leader physician

107 B5265G1 Annual Report – 2007/2008

177 J. Lkhagvasuren Family clinic of “Shar degd” Leader physician Sukhbaatar District Health 178 O. Byamba Head Department Sukhbaatar District Health 179 D. Erdenechimeg Epidemiologist Department 180 T. Goyochimeg Family clinic of “Enkh sunder” Leader physician 181 S. Selenge Family clinic of “Sankoll” Leader physician 182 D. Tsestegmaa Family clinic of “Tegsh mend” Leader physician Songinokhairkan District Health 183 A. Erdenetuya Head Department Songinokhairkan District Health 184 N. Narantuya Epidemiologist Department 185 S. Norjmaa Family clinic of “Uni achit” Leader physician 186 N. Unursaikhan Family clinic of “Enkh elberel” Leader physician 187 D. Altantsetseg Family clinic of “Buyant manal” Leader physician Chingeltei District Health 188 S. Tungalag Head Department Chingeltei District Health 189 O. Dashpagma Epidemiologist Department 190 M. Purevdorj Family clinic of “Tegsh Ulzii” Leader physician 191 B. Otgonbayar Family clinic of “Uils negten” Leader physician 192 R. Bolor Family clinic of “Tumenjargalan” Leader physician Khan-Uul District Health 193 Bold Head Department Khan-Uul District Health 194 I. Oyunchimeg Epidemiologist Department 195 J. Gungaasuren Family clinic of “Enkh titem” Leader physician 196 G. Tsolmon Family clinic of “Manal uils” Leader physician 197 D. Tuul Family clinic of “Amin tus” Leader physician Baganuur District Health 198 B. Soninkhuu Head Department Baganuur District Health 199 Ts. Khandtsoo Epidemiologist Department 200 I. Od Family clinic of “Enerelt Ulzii” Leader physician Parmaceutical compny of “Aglag 201 A. Bayartsesteg Officer med” 202 D. Altantsesteg Railway hospital Head 203 Nyamsuren Railway hospital Epidemiologist 204 B. Selenge General Intelligence Department Officer

108 Cooperative Agreement Implementation

ANNEX 7

Recommendation from National Influenza Workshop, - We, participants of the NWI: - recognising that the Influenza, Influenza-like illness are the most widely spreading human infectious disease poses real dangers to the health of young children, elderly and people with chronic disease, - considering that the avian influenza A ( H5N1 ) infection is creating critical signation requesting interagency collaboration in the world whole, - expressing our deep concern on the expansion of avian influenza A (H5N1) is causing 60-70% mortality among some populations of South East Asian countries like Vietnam, Cambodia and Thailand, - calling to increase the preparedness of government, health authoriies, public and oher related organisations to the possible influenza pandemic treat put forward the following recommendations:

Central Government responsibilities 1. To organize Influenza pandemic preparedness activities, improve an intersectoral collaboration and include WHO recommendations into influenza alert plan. 2. To include onfluenza pandemic activities into national/capital/ provincial emergency plan and, organize an exercise/training on pandemic preparedness. 3. To discuss oa operative plan for influenza pandemic steps by national/capital/provincial Public Health Committee, to monitor an implementation of a plan, to create a national/local stockpile of antivirals, vaccines, disinfectants and technical supplies needed for medical care service and control measures, to conduct systematically trainigs for medical staff in calm period. 4. To develop a plan for each seasonal influenza or influenza pandemic and every health institution/unit to nominate a management team/officer responsible for implementation of a plan. 5. To support trading companies in registering antiviral drugs, vaccines and vaccines.

109 B5265G1 Annual Report – 2007/2008

Local Government responsibilities 1. To organize an immunization locally 2. To create an Influenza pandemic fund, and develop its utilization procedures. 3. To improve an utilizaation of drugs and devices needed for treatment and control of complications, to create stockpiling of those drugs and devices, to make a calculation for funds of needed drugs, lab kits, mobile services, foods for medical staff and patients, and antiviral preparations. 4. To organize trainings of ILI prophylaxis for medical doctors, staff and general population.

Health Sector Responsibilities 1. To develope a pndemic preparedness plan in each health institution and to nominate a responsible team for management or surveillance/monitoring. 2. To create physical and phychological preparedness of case of pandemic/epidemic broke. 3. To make an expenditure calculation of medical staff and transportation during pandemic, to budget it, and to create a stockpile for a week 4. To create right reserves of PPEs and disinfectants, to habituate it on daily practice, 5. To immunizes own staffs by an influenza vaccine, or to create a stockpiling of antiviral preparations for chemioprophylaxis, in unavailable case of immunization. 6. To immunize high risk population by an epidemiological indication. 7. To conduct IEC on Influenza. 8. To learn continually from an experiences of foreign countries and collaborate with them sharing an information, to organize national/sectoral/regional workshop annually.

Veterinary sector responsibilities 1. To conduct a surveillance or epizootic investigation during bird migratory. 2. To make a calculation for surveillance among workers in a chicken or other domestic bird and pig firm, to conduct a surveillance. 3. To provide a preparedness for laboratory diagnosis.

110 Cooperative Agreement Implementation

4. To have a vaccine stock for chicken or other domestic birds, if necessary. 5. To conduct IEC.

Citizens and Mass Media responsibilities 1. Citizen has to implement any activities on the prevention of Influenza which were organized by the Government or its Health sector, to own correct habits for healthy life style (including clothes according to a season, physical exercises, respiratory etiquette, hand washing, ventilation). 2. In case of influenza, use a mask for prevention of further spread, avoid to loaf in public places until a recovery. 3. To take a voluntary immunization on influenza especially elderly people or chronic patients. 4. Mass Media has to provide for a population by a true and real information co-operatively with professional institutions, and to interview and advertise any activities organized by institutions during pandemic. In unavailable case of TV or radio, distribute IEC material. 5. To send a SMS message on a prevention of Influenza, to provide by a short information during `peak period` of TV program.

111 B5265G1 Annual Report – 2007/2008

ANNEX 8 Unified program of training workshops for clinical ILI surveillance

No Topic Time Responsible person

FIRST DAY

Epidemiologist of Provincial Health 1 Registration 9.00-9.20 Department (PHD) 2 Opening 9.20.9.40 Head of PHD

Country situation on 3 9.40-10.20 Epidemiologist from NCCD Infectious Diseases

Country situation on 4 Influenza and Influenza- 10.20-11.00 Epidemiologist from NCCD like Illnesses (IILI)

5 Tea break 11.00-11.15 Provincial situation on 6 IILI during 2004/2005 11.15-12.00 Epidemiologist of PHD Influenza season Introduction of the project of “Development of 7 12.00-13.00 Epidemiologist from NCCD laboratory-based network on influenza surveillance” 8 Lunch 13.00-14.00

Resolution No 241 of Health Minister on the 9 introduction of laboratory- 14.00-14.30 Epidemiologist from NCCD based network of sentinel surveillance on IILI

Influenza virus and 10 warning of Influenza 14.30-15.30 Laboratory staff from NCCD Pandemic 11 Tea break 15.30-15.45

Clinical aspect including Head / physician of Infectious 12 of diagnosis and treatment 15.45-16.30 Disease ward of Provincial hospital of IILI

Specimen collection, 13 16.30-17.30 Laboratory staff from NCCD storage and transportation

112 Cooperative Agreement Implementation

SECOND DAY

Laboratory investigation 1 of IILI, surveillance on 9.00-10.00 Laboratory staff from NCCD Influenza virus

2 Avian Influenza situation 10.00-11.00 Epidemiologist from NCCD

3 Tea break 11.00-11.15 Measures taken from PHD on the introduction of 4 laboratory-based sentinel 11.15-12.00 Epidemiologist of PHD surveillance network on IILI Report of family clinic as a 5 12.00-13.00 Head of a family clinic sentinel site 6 Lunch 13.00-14.00 Current problems on the introduction of laboratory All participants including organizers 7 14.00-16.00 based sentinel surveillance of workshop network of IILI 8 Tea break 16.00-16.15 Award of encouragement 9 on telephone reporting of 16.15-16.40 Workshop organizers IILI 10 Discussion 16.40-17.30 Workshop organizers

113 B5265G1 Annual Report – 2007/2008

ANNEX 9 Program of the workshop in UB, April 16, 2005

No Topic Time Responsible person

1 Registration 8.30-9.00 Epidemiologists of Surveillance Unit

T. Altantsetseg, Director general, 2 Opening 9.00-9.20 NCCD

Global situation on new and 3 re-emerging infections (IILI 9.20-10.00 N. Tsend, deputy director, NCCD and avian influenza)

Introduction of the project “Development of laboratory 4 10.00-11.00 P. Nymadawa, Consultant, NCCD based IILI surveillance network”

5 Tea break 11.00-11.15

6 IILI situation in the country 11.15-12.00 A. Burmaa, epidemiologist, NCCD

Influenza virus, pandemic 7 12.00-13.00 B. Darmaa, virologist, NCCD warning

8 Lunch 13.00-14.00

9 Treatment of IILI 14.00-15.00 P. Nymadawa, Consultant, NCCD

Specimen collection, 10 storage and transportation. 15.00-16.00 B. Darmaa, virologist, NCCD Laboratory investigation.

11 Tea break 16.00-16.15

Measures taken in a phase of 12 16.15-17.00 L. Dashtseren, chief, NCCD pandemic alert

13 Discussion 17.00-17.30 N. Tsend and organizers

Allowance of telephone 14 17.30-18.30 B. Darmaa, A. Burmaa expenditure

15 Closing 18.30-18.35 N. Tsend, deputy director, NCCD

114 Cooperative Agreement Implementation

ANNEX 10 Participants` list of the training workshop in Selenghe province, January 9, 2005

No Participant` s name Position 1 Sh. Dolgormaa Deputy of Provincial hospital 2 P. Tungalag General doctor 3 G. Tungalag General doctor on Pediatrician 4 D. Tserenbaljir Physician of Infectious Disease ward 5 Sh. Selenge Pediatrician 6 D. Tsolmon Physician 7 Kh. Tuvsanaa Physician, Outpatient clinic 8 Ts. Tsegmed Physician of Emergency service 9 L. Altantsetseg Physician of Emergency service 10 G. Altantsetseg Pediatrician 11 G. Unurjargal Physician, Family clinic of “Egneshgui” 12 J. Battungalag Nurses 13 P. Bayanjargal Physician, Family clinic of “Emnekh” 14 M. Oljmedekh Assistant doctor 15 D. Enkhtuvshin Consultant doctor 16 D. Bolormaa Physician 17 T. Suvdaa Assistant doctor 18 D. Chimgee Physician, Family clinic of “Nomt khan” 19 S. Nansalmaa Physician 20 J. Tserenbaatar Nurses 21 N. Alimaa Assistant doctor 22 D. Khaltar Physician, Family clinic of “Khadan khui” 23 S. Jargalsaikhan Assistant doctor 24 Ch. Tsevelmaa Physician, Family clinic 25 Kh. Tsegmed Physician, Family clinic 26 L.Erdenechimeg Physician, Family clinic 27 S. Gantsesteg Assistant doctor 28 N. Oyunbileg Nurses 29 O. Oyumaa Assistant doctor 30 A. Batsuren Physician 115 B5265G1 Annual Report – 2007/2008

ANNEX 11 Participants` list of the training workshop in Dornogovi Province, January 9, 2005

No Participant` s name Position 1 L. Badamgerel Physician, Family clinic of “Agatova” 2 V. Byambaa Physician, Family clinic of “Agatova” 3 D. Tungalag Physician, Family clinic of “Agatova” 4 Sh. Dugaasuren Nurse, Family clinic of “Agatova” 5 G. Sainbayar Physician, Family clinic of “Goyo mend” 6 A. Byambaa Physician, Family clinic of “Goyo mend” 7 Ts. Dulamjav Physician, Family clinic of “Goyo mend” 8 G. Gantsetseg Nurse, Family clinic of “Goyo mend” 9 B. Tsend Nurse, Family clinic of “Goyo mend” 10 B. Nyamgerel Physician, Family clinic of “Misheelt mana” 11 Ch. Ariungerel Physician, Family clinic of “Misheelt mana” 12 Kh. Dagiimaa Physician, Family clinic of “Misheelt mana” 13 U. Muchartsagaan Physician, Family clinic of “Misheelt mana” 14 S. Tsagaandari Nurse, Family clinic of “Misheelt mana” 15 D. Altantsesteg Nurse, Family clinic of “Misheelt mana” 16 L. Gulguu Nurse, Railway family clinic 17 M. Oyunbileg Nurse, Railway family clinic 18 G. Tamara Deputy of Provincial Health Department 19 V. Tsolmongerel Statistician, Provincial Health Department 20 Ch. Tsetsegmaa Epidemiologist, Provincial Health Department 21 Ch. Odonchimeg Pediatrician, Provincial Hospital 22 V. Urangoo Physician, Ambulance team, Provincial Hospital 23 L. Chuluunkhishig Technician, Provincial Hospital 24 Ts. Gereltuya Physician, Railway family clinic 25 L. Baigalimaa Nurse, Family clinic of “Agatova” 26 Kh. Khuukhen Pediatrician, Provincial Hospital 27 D. Tuyatsesteg Physician, Ambulance team, Provincial Hospital 28 T. Batchimeg Officer, Provincial Health Department 29 Ch. Oldokh Physician, Ambulance team, Provincial Hospital 30 S. Narantsesteg Nurse, Family clinic of “Goyo mend”

116 Cooperative Agreement Implementation

ANNEX 12 Participants` list of the trining workshop in UB, April 16, 2005

No Participant`s name Organization Position

1 O. Byambaa Sukhbaatar District Health Department Head

2 R. Tuul NCCD, Respiratory laboratory Chief

3 T. Bayarkhuu NCCD, Respiratory laboratory Technician

4 N. Narantsetseg Capital Health Department Officer

5 B. Baatarsukh Capital Health Department Officer

6 N. Oyunbileg Capital Health Department Chief

7 Ch. Unursaikhan SBD Enkh Elberel Family clinic Physician

8 S. Bolormaa SBD Enkh Elberel Family clinic Physician

9 O. Dulamsuren SBD Enkh Elberel Family clinic Physician

10 D. Gantsetseg Capital Health Department Officer

11 B. Soninkhuu Baganuur District Health Department Head

12 E. Tsetsegmaa Nalaikh District Health Department Deputy

13 Sh. Baasaikhuu Nalaikh Ami Erdene family clinic Physician

14 B. Tseveensuren Nalaikh Ami Erdene family clinic Physician

15 G. Namjilmaa Nalaikh Ami Erdene family clinic Physician

16 Ts. Erdenebat Nalaikh Ami Erdene family clinic Physician

17 E. Tuul Bayangol District Health department Head

18 E. Buyanmandakh Khan-Uul District Health Department Head

19 D. Norov SBD Sankoll family clinic Physician

20 A. Dolgormaa SBD Sankoll family clinic Physician

21 S. Selenge SBD Sankoll family clinic Physician

22 N. Altai SBD Buyant manal family clinic Physician

23 S. Saranchimeg SBD Buyant manal family clinic Physician

24 A. Tugssain SBD Buyant manal family clinic Physician

117 B5265G1 Annual Report – 2007/2008

25 O. Udvltsetseg SBD Buyant manal family clinic Physician

26 D. Altantsetseg SBD Buyant manal family clinic Physician

27 Ch. Budjav BGD Itgel ugtakh family clinic Physician

28 A. Tsend-Ayush BGD Itgel ugtakh family clinic Physician

29 D. Otgonbayar BGD Itgel ugtakh family clinic Physician

30 Ts. Tonya BZD Amgalan itgekhui family clinic Physician

31 O. Zorigmaa BZD Amgalan itgekhui family clinic Physician

32 N. Amaraa BZD Amgalan itgekhui family clinic Physician

33 M. Altankhuyag BZD Eruul urkh family clinic Physician

34 B. Altantuya BZD Eruul urkh family clinic Physician

35 J. Oyuntsetseg BZD Eruul urkh family clinic Physician

36 Ch. Tserennadmid BZD Nasan urt family clinic Physician

37 S. Dulamsuren BZD Nasan urt family clinic Physician

38 P. Purev BZD Nasan urt family clinic Physician

39 B. Tersaikhan BZD Nasan urt family clinic Physician

40 Ts. Munkhchimeg SBD Enkh sunder family clinic Physician

41 D. Pagam SBD Enkh sunder family clinic Physician

42 B. Unurtsetseg ChD Uils negten family clinic Physician

43 B. Munkhjargal Bagakhangai District Health Department Physician

44 J. Lkhagvasuren BGD Shar degd family clinic Physician

45 G. Lkhagvasuren BGD Shar degd family clinic Physician

46 O. Gantumur BGD Shar degd family clinic Physician

47 O. Enkhmaa ChD Tumenjargalan family clinic Physician

48 D. Tuul KhUD Amin tus family clinic Physician

49 Ch. Enkhbat KhUD Amin tus family clinic Physician

50 D. Erdenetsetseg KhUD Amin tus family clinic Physician

51 Ts. Altantsetseg KhUD Amin tus family clinic Physician

52 L. Zurnai SKhD Unu achit family clinic Physician

118 Cooperative Agreement Implementation

53 O. Tsengel SKhD Unu achit family clinic Physician

54 B. Munkhtsetseg SKhD Unu achit family clinic Physician

55 N. Sugarsuren SKhD Unu achit family clinic Physician

56 B. Bolormaa BGD 3 sanchir family clinic Physician

57 S. Altansukh BGD 3 sanchir family clinic Physician

58 J. Bolortuya BGD 3 sanchir family clinic Physician

59 D. Munkhjargal BGD 3 sanchir family clinic Physician

60 D. Tsetsegmaa SBD Tegsh mend family clinic Physician

61 N. Azjargal SBD Tegsh mend family clinic Physician

62 D. Urantsetseg KhUD Manal uils family clinic Physician

63 G. Tsolmon KhUD Manal uils family clinic Physician

64 B. Sarantuya KhUD Manal uils family clinic Physician

65 D. Narantsetseg KhUD Enkh titem family clinic Physician

66 J. Gungaasuren KhUD Enkh titem family clinic Physician

67 S. Javzanorolmaa KhUD Enkh titem family clinic Physician

68 D. Tsetsegsaikhan ChD Tegsh ulzii family clinic Physician

69 T. Nyamjav ChD Tegsh ulzii family clinic Physician

70 Ts. Nyamaa ChD Tegsh ulzii family clinic Physician

71 N. Purevdorj ChD Tegsh ulzii family clinic Physician

72 S. Sarantsetseg NCCD, respiratory team Epidemiologist

73 D. Sodbayar NCCD, respiratory team Epidemiologist

74 J. Khuukhenbaatar NCCD, respiratory team Epidemiologist

75 M. Tsolmon NCCD, nosocomial infection team Epidemiologist

76 D. Baigalimaa NCCD, respiratory team Epidemiologist

77 S. Anand NCCD, hepatitis team Epidemiologist

78 Ts. Bold-Erdene NCCD, monitoring unit Statistician

79 O. Ariuntuya NCCD, prognosis team Epidemiologist

80 B. Enkhtuya NCCD, Surveillance Department Head

119 B5265G1 Annual Report – 2007/2008

ANNEX 13 Participants` list of the training workshop in Uvurkhangai Province, April 30, 2005

No Participant` s name Position 1 Oyuntsesteg Physician, Family clinic of “Tushig dulguun” 2 Chuluuntsesteg Physician, Family clinic of “Narni dush” 3 Budjav Physician, Family clinic of “Enkhiin khurd” 4 Battseren Nurse, Family clinic of “Enkhiin khurd” 5 Oyuntsesteg Physician, Family clinic of “Enkhiin khurd” 6 Dulamsuren Nurse, Family clinic of “Enkhiin khurd” 7 Bold Nurse, Family clinic of “Tushig dulguun” 8 Avirmed Nurse, Family clinic of “Uyan setgel” 9 Tumennast Nurse, Family clinic of “Uyan setgel” 10 Otgon Physician, Family clinic of “Enkhiin khurd” 11 Shurentsesteg Nurse, Family clinic of “Uyan setgel” 12 Sodnom Nurse, Family clinic of “Uyan setgel” 13 Oyun Physician, Family clinic of “Tushig dulguun” 14 Oyuntsesteg Nurse, Family clinic of “Tushig dulguun” 15 Oyuntungalag Nurse, Family clinic of “Enkhiin khurd” 16 Chuluuntsetseg Nurse, Family clinic of “Tushig dulguun” 17 Enkhtsesteg Nurse, Family clinic of “Narni dush” 18 October Physician, Family clinic of “Narni dush” 19 Tserennadmid Nurse, Family clinic of “Narni dush” 20 Choijilsuren Officer of PH Dept of PHD 21 Amarjargal Physician, Family clinic of “Enkhiin khurd” 22 Tsendeebud Inspector of Provincial Professional Dept 23 Uranchimeg Physician 24 Ichinkhorloo Assistant epidemiologist 25 Narantsesteg Epidemiologist 26 Tsagaandari Physician, Provincial hospital 27 Purevdulam Nurse, Family clinic of “Narni dush” 28 Baymbasuren Nurse, Family clinic of “Uyan setgel” 29 Sorogsuren Nurse, Family clinic of “Enkhiin khurd” 30 Myagmarsuren Physician, Provincial hospital

120 Cooperative Agreement Implementation

ANNEX 14 Participants` list of the training workshop in Dornod Province, July 6, 2005

No Participant` s name Position

1 Bolorchuluun Physician 2 D. Enkhtsesteg Assistant doctor 3 Ichinkhorloo Physician 4 Azzaya Physician 5 Battulga Physician 6 Dulmaa Physician 7 Enkhtuya Physician 8 Oyunkhuu Physician 9 Erdenechimeg Assistant doctor 10 Battsesteg Deputy of Provincial Hospital 11 Gereltuya Epidemiologist of Provincial Health Dept 12 Sarantuya Assistant doctor of PHD 13 Sugarmaa Statistician 14 Burmaa Epidemiologist 15 Oyunbileg Physician of Infect.Dis.ward 16 Alimaa Physician 17 Oyundelger Physician 18 Batjargal Assistant doctor 19 Saruul Physician 20 Otgongerel Physician 21 Tsetsgee Assistant doctor 22 Enkhtuya Assistant doctor 23 Erdenechimeg Asisstant doctor 24 Battsengel Assistant doctor 25 Altantuys Physician 26 Erdenebayar Physician 27 Munkhtsetseg Physician 28 Baldansuren Statistician 29 Algaa Physician 30 Oyun Physician

121 B5265G1 Annual Report – 2007/2008

ANNEX 15 Participants` list of the training workshop in Khovd Province, July 8, 2005

No Participant` s name Position 1 S. Nina Laboratory doctor 2 G. Oyuntsesteg General doctor 3 Kh.Tsetsegsuren Physician, Family clinic of “Jargalan” 4 D. Ganchimeg Physician, Family clinic of “Jargalan” 5 L.Oyuntsetseg Physician, Family clinic of “Jargalan” 6 Ch. Khandmaa Physician, Family clinic 7 Da. Amgalan Epidemiologist 8 Do.Amgalan Epidemiologist 9 M.Oyunchimeg Physician, Family clinic 10 G.Bayantsagaan Physician, Family clinic 11 L.Gerelchuluun Physician, Family clinic 12 B.Erdenechimeg Physician, Family clinic 13 V. Sovelkhan Physician, Family clinic 14 B. Javzmaa Physician, Family clinic 15 D. Urtnasan Physician, Family clinic 16 T. Enkhjargal Physician, Family clinic 17 S. Nina Physician, Family clinic of “Baatarkhairkhan” 18 Kh. Ziden Physician, Family clinic of “Baatarkhairkhan” 19 Sh. Tseelegsuren Physician, Family clinic of “Baatarkhairkhan” 20 Ch. Buyankhishig Physician, Family clinic of “Baatarkhairkhan” 21 S. Chogsuren Physician, Family clinic of “Rashaant” 22 E. Shotai Physician, Family clinic of “Rashaant” 23 R. Khorolsuren Physician, Family clinic of “Rashaant” 24 Z. Chooj Physician, Family clinic of “Rashaant” 25 M. Tsagaan Physician, Family clinic of “Bugat” 26 Ch. Kadilkhaan Epidemiologist 27 Ts. Myagmarsuren Physician, Infectious Disease ward 28 Bat-Ulzii Epidemiologist 29 M.Oyuntsesteg Physician, Family clinic 30 Ichinkhorloo Physician, Family clinic

122 Cooperative Agreement Implementation

ANNEX 16 Equipments and Devices supplied to IST Epidemiology Group in 2004/2005 season

No Description Quantity Unit price Total price

1 Fax/ telephone apparatus Panasonic KX- FT71 { Malasia Branch ) 1 158.3 158.3

2 WorkCentre PE 114e printer-scanner- copier ( Xerox Shanghai Branch) 2 300.0 600.0

3 PC iXtreme H803, Pentium IV, Packard Bell ( Malasia Branch ) 1 1,350.6 1,350.6

4 Deskjet 57 toner 1 28.2 28.2

5 Canon EP 21 toner 2 58.0 116.0

6 Workcenter PE 114e toner 2 80.0 160.0

7 EP-22 toner 1 58.0 58.0

Total 2,470.8

ANNEX 17 Equipment and Devices supplied to IST Epidemiology group in 2005/2006 season

No Description Quantity Unit price Total price

1 Dell computer 1 814.3 814.3

Telephone apparatus: KX-PS500MXW 2 2 14.75 29.5 Panasonic (Japan)

3 Flash disk 256 MB Sony 2 24.7 49.4

4 Spare part for Xerox printer 2 53.4 53.4

5 Flash disk 256 MB Sony 1 21.4 21.4

6 EP114 toner recharged 2 12.0 24.0

7 EP114 toner 6 75 450

TOTAL 1,441.8

123 B5265G1 Annual Report – 2007/2008

ANNEX 18 Training Programme for epidemiologists and public health professionals on “Influenza Surveillance and prevention”, November 9, 2005

Time Topic Responsible person

16.15-16.20 1 Opening Dr. D. Otgonbaatar

Dr. N. Tsend, 16.20-17.20 2 Influenza surveillance system Dr. L.Dashtseren 17.20-18.20 3 Feedback report and situation of influenza Dr. A. Burmaa

Current situation of flu in the 18.20-18.40 4 Dr. D. Otgonbaatar worldwide 18.40-18.50 5 Closing Dr. N. Tsend

124 Cooperative Agreement Implementation

ANNEX 19 List of participants of the training for epidemiologists and public health professionals on “Influenza Surveillance and prevention”, November 9, 2005

Participant’s name Organization Position

B. Enkhtuya NCCD Head of Department

M. Altankhuu NCCD Deputy Director

D. Otgonbaatar CIDNF Director

M. Tsolmon NCCD Epidemiologist

D. Ganbold CIDNF Chief of Laboratory

L. Oyuntsetseg NCCD Epidemiologist

S. Bujinlkham NCCD Bacteriologist

Ts. Ankhtuya CIDNF Epidemilogist

Ch. Baigalmaa NCCD Epidemilogist

UB city Professional Inspection Ch. Urjee Epidemiologist Agency

UB city Professional Inspection N. Tumurkhuyag Epidemiologist Agency

S. Anand NCCD Epidemiologist

D.Gereltuya Dornod Province Epidemiologist

Dornod Province Health D. Doljin Director Department

Ts. Munguntuya Dornod Province Epidemiologist

T. Lkhagvasuren NCCD Bacteriologist

R. Tuul NCCD Virologist

Epidemiologist Ts. Selenge NCCD

Ch. Tsetsegmaa Dornogovi Province Epidemiologist

A. Adyasuren Dornogovi Province Epidemiologist

P. Davaadulam Uvurkhangai Province Epidemiologist

125 B5265G1 Annual Report – 2007/2008

D. Narantsetseg Uvurkhangai Province Epidemiologist

N. Narantuya NCCD Epidemiologist

Sukhbaatar District Health O. Byambaa Director Department

N. Narantsetseg UB city Health Department Epidemiologist

B. Oyunchimeg UB city Health Department Epidemiologist

D. Altantsetseg NCCD Epidemiologist

G. Davaa Medical University Lecturer

D. Khandaasuren NCCD Epidemiologist

S. Altanchimeg NCCD Epidemiologist

A. Burmaa NCCD Epidemiologist

D. Sodbayar NCCD Epidemiologist

U. Dashtseren NCCD Epidemiologist

E. Oyuntuya NCCD Epidemiologist

Ts. Bolderdene NCCD Epidemiologist

N. Tsend NCCD Deputy Director

S. Naryad NCCD Epidemiologist

N. Dondog NCCD Adviser

Ts. Khandtsoo Baganuur District Epidemiologist

State Professional Inspection A. Enkhtuya Officer Agency

J. Tsetsegmaa NCCD Epidemiologist

T. Altantsetseg NCCD General Director

D. Narangerel Minisry of Health Officer

Ch. Munkhtsetseg NCCD Epidemiologist

N. Enkhtsetseg NCCD Epidemiologist

D. Naranzul NCCD Epidemiologist

126 Cooperative Agreement Implementation

ANNEX 20 Training Programme of the workshop on Absenteeism surveillance for heads of Ulaanbaatar city units to be involved, October 31, 2005

Topic Timeframe Lecturer’s name Dr. D. Sodbayar Project outreach 1 Registration 14.00-14.10 supervisor Prof. T. Altantsetseg General 2 Opening 14.10-14.15 Director, NCCD “Development of Influenza Prof. P. Nymadawa, Project 3 Surveillance Network” 14.15-15.00 coordinator Project Current situation of Prof. P. Nymadawa, Project 4 15.00-15.40 Influenza in Mongolia coordinator

Tea break 15.40-16.00

About the order of 5 Governor of UB City on the 16.00-16.20 Dr. A. Burmaa, Epidemiologist absenteeism surveillance

Absenteeism surveillance for Dr.D. Munkhjargal,, Officer,UB 5 16.20-17.00 schools and kindergardens Department of Education

6 Discussion 17.00-17.30 Organizers Prof. P. Nymadawa, Project 7 Closing 17.30-17.40 coordinator

127 B5265G1 Annual Report – 2007/2008

ANNEX 21 List of participants of workshop on Absenteeism surveillance, October 31, 2005

¹ Participant’s name organization Position 1 L.Suvdaa School ¹68 Director 2 B.Uranchimeg School ¹68 Physician 3 J.Javzanpagma Kindergarten ¹127 Physician 4 L.Odonchimeg School ¹20 Physician 5 Kh. Altanchimeg Kindergarten ¹105 Physician 6 S.Gereltuya Kindergarten ¹115 Head 7 Kh. Buyandalai School ¹76 Physician 8 S. Narantungalag Kindergarten ¹93 Physician 9 N.Tsetsegmaa Kindergarten ¹150 Physician 10 B. Jigestei School ¹57 Physician 11 S. Gurvanchuluun Kindergarten ¹71 Physician 12 G.Bolor School ¹48 Director 13 O. Tumurkhishig School ¹48 Physician 14 N. Tsend School ¹3 Physician 15 B. Hurgaa School ¹7 Physician 16 Z. Tsedenbaljir Kindergarten ¹22 Physician 17 S. Alagaa Kindergarten ¹22 Head 18 G. Enkhjargal Kindergarten ¹124 Physician 19 D.Enkhtuya Kindergarten ¹124 Head 20 J.Batjargal School ¹13 Physician 21 Ch. Erdenetsetseg School ¹13 Physician 22 R.Ulziikhishig School ¹7 Director 23 D. Munkhjargal School ¹7 Physician 24 G. Oyungerel Kindergarten ¹114 Head 25 S. Tsendsuren Kindergarten ¹114 Physician 26 J. Altantuya School ¹1 Physician 27 Ts. Tserenhuu School ¹1 Manager 28 D. Tungalag School ¹57 Manager 29 M. Dagvabazar School ¹76 Manager 128 Cooperative Agreement Implementation

ANNEX 22 Training Program of the workshop on “Development of hospital based influenza surveillance”, November 25, 2005

Topic Responsible person Time

Acute respiratory diseases caused Prof. P. Nymadawa, 1 13.00-13.40 by viruses and bacteria Project coordinator Influenza Surveillanceand 2 Importance of hospital based Dr. A. Burmaa 13.40-14.20 surveillance Virology analysis of ILI and 3 specimen collection, handling Dr. B. Darmaa 14.20-15.00 and transportation.

Tea break 15.00-15.20 Implementation of Hib 5 meningitis surveillance in UB Dr. N. Suvdmaa 15.20-16.00 City Experience of introduction of 6 pentavalent vaccine in IEP in Dr. B. Enkhtuya 16.00-16.30 Mongolia Principles of bacterial meningitis specimen collection, handling 7 and transportation Dr. D. Altantsetseg 16.30-17.00

Prof. P. Nymadawa, 8 Discussion 17.00-18.00 Project coordinator

129 B5265G1 Annual Report – 2007/2008

ANNEX 23 List of participants of the training workshop on “Development of hospital based influenza surveillance”, November 25, 2005

Participant’s name organization Position S. Erdenechimeg NCCD Physician D. Erdenetsetseg NCCD Microbiologist S. Tsevelmaa Khan-Uul District Hospital Deputy Director Ts. Tuya Khan-Uul District Hospital Physician D. Surenjav Khan-Uul District Hospital Physician S. Oyungerel NCCD Physician T. Lkhagvasuren NCCD Physician J. Myagmar Khan-Uul District Hospital Physician G. Otgon Khan-Uul District Hospital Statistician D. Badamgarav Maternity and Child Health Center Physician T. Erdenechimeg Maternity and Child Health Center Physician L. Oyunchimeg Maternity and Child Health Center Physician O. Enkhchimeg Maternity and Child Health Center Physician B. Gantovch Maternity and Child Health Center Physician T. Buyanjargal Sukhbaatar District Hospital Physician I. Jargalmaa Sukhbaatar District Hospital Physician G. Oyunchimeg Sukhbaatar District Hospital Physician E. Narantungalag Sukhbaatar District Hospital Physician N. Khajidsuren Sukhbaatar District Hospital Physician J. Khishigt Bayan-Zurkh District Hospital Physician Ts. Songinosuren Bayan-Zurkh District Hospital Physician T. Tsevelmaa Bayan-Zurkh District Hospital Physician Yo. Altantsetseg Bayan-Zurkh District Hospital Physician B. Chuluunkhuu NCCD Physician D. Surenkhorloo NCCD Physician D. Gantsetseg NCCD Physician M. Norjmaa Maternity and Child Health Center Physician B. Otgonchimeg Maternity and Child Health Center Physician Songino-Khairkhan District G. Tseyen Physician Hospital

130 Cooperative Agreement Implementation

Songino-Khairkhan District E. Narantuguldur Physician Hospital Songino-Khairkhan District B. Oyunchimeg Physician Hospital Songino-Khairkhan District B. Majigsuren Physician Hospital B. Batsukh NCCD Physician T. Odgerel NCCD Microbiologist Immunisation Unit S. Naryad NCCD officer Immunisation Unit D. Gantulga NCCD officer Immunisation Unit Ts. Oyunchimeg NCCD officer

131 B5265G1 Annual Report – 2007/2008

ANNEX 24 Training program for physicians from family clinics and health departments of orkhon and Dakhan-Uul provinces,September 3-8, 2006

No Topic Time Responsible person

1 Registration 08.30-09.30 Dr. L. Enkhbaatar

Directors of Provincial 2 Opening 09.30-09.40 Health Departments

Goal of sentinel sites activities in provinces. Expanding and improving 3 09.40-10.40 Dr. A. Burma epidemiological surveillance network

Characteristics of influenza viruses. 4 Collecting, transporting and 10.40-11.40 Dr. B. Darma handling of specimens

Tea break 11.40-12.00

5 Discussions and recommendations 12.00-13.00 Dr. L. Enkhbaatar

Lunch 13.00-14.00

Pathogenesis, clinic, treatment, 6 diagnosis and prophylaxis of 14.00-15.00 Dr. O. Baatarkhuu influenza virus

9 Discussion 15.30-16.30 Dr. L. Enkhbaatar

132 Cooperative Agreement Implementation

ANNEX 25 List of participants of trainings for physicians from family clinics and health departments of Orkhon and Dakhan-Uul provinces

No Participant’s name Position

Workshop in ORKHON PROVINCE

1 G.Baasankhuu Province Human recourse manager

2 G. Gankhuyag Head of provincial Health Department

3 J. Batjargal Physician, Family clinic “Itgelyn Enerel”

4 D.Narantuya Nurse, Family clinic “Itgelyn Enerel”

5 D. Oyun-Erdenet Physician, Family clinic “Khos Chagnuur”

6 L.Altanchimeg Nurse, Family clinic “Khos Chagnuur”

7 T. Enkhtuya Physician, Family clinic “Mend Bulag”

8 S.Tseyenregzen Nurse, Family clinic “Mend Bulag”

9 Sh. Dolgorma Physician, Family clinic “Donosa”

10 S.Khishigjav Nurse, Family clinic “Donosa”

11 S. Erdenesuvd Physician, Family clinic “Ankhny Och”

12 T.Otgon-Oyun Nurse, Family clinic “Ankhny Och”

13 S. Mandakh Physician, Family clinic “Achlalt Nar”

14 L.Udval Nurse, Family clinic “Achlalt Nar”

15 Ts. Dulamjav Physician, Family clinic “Gerelt Mandakh”

16 N.Narantsetseg Nurse, Family clinic “Gerelt Mandakh”

17 L. Chantsaldulam Physician, Family clinic “Uils Badrakh”

18 B. Tumennast Nurse, Family clinic “Uils Badrakh”

19 T. Gerelma Physician, Family clinic “Munkhyn Gegee”

20 Kh.Shijirtuya Nurse, Family clinic “Munkhyn Gegee”

21 J.Oyuntsetseg Physician, Family clinic “Elberelt Uils”

22 Ya.Chimedbaljir Nurse, Family clinic “Elberelt Uils”

133 B5265G1 Annual Report – 2007/2008

23 Kh. Barchidsuren Physician, Family clinic “Niytsel”

24 S.Ariunbileg Nurse, Family clinic “Niytsel”

25 B. Jargalsaikhan Physician, Family clinic “Munkh Sundrel”

26 N.Erdenetsetseg Nurse, Family clinic “Munkh Sundrel”

27 D.Bolorma Nurse, Family clinic “Tsagaan Agi”

28 Ts.Otgonbileg Physician, Family clinic “Uchralt Bayar”

29 E.Enkhjargal Nurse, Family clinic “Uchralt Bayar”

30 S. Otgonkhuyag Physician, Hospital in Jargalant soum

31 D. Tsetsegma Specialist in educational methods

32 O.Bat-Tsengel Assistant

33 D. Lkhagvajav Epidemiologist

34 B. Enkhtuvshin Epidemiologist, physician

35 T. Burma Statistician

36 G.Munkhtsetseg Head of Provincial Therapeutics Department

37 G. Enkhjargal Specialist, Provincial Health Department

38 D. Baasanjav Chief of Provincial Pediatric Department

39 G. Oyunchimeg Specialist, Provincial Health Department

40 G.Myadagma Physician, Provincial railway hospital

41 N. Munkhtsetseg Specialist, Provincial Health Department

42 Ts. Oyunbal Physician Provincial Health Department

43 Ts.Sarantsetseg Physician

44 J. Oyundalai Epidemiologist, State Provincial Hospital

45 Yu. Altantuya Specialist

46 T.Otgon Laboratory of bacteriology

47 G. Altanzul Informatic

48 L. Davaajav Assistant worker

49 N.Erdenechimeg Physician

50 D.Davaajav Physician

134 Cooperative Agreement Implementation

Workshop in DARKHAN-UUL PROVINCE

1 B. Bolorma Physician in family clinic

2 Ch. Tuvshinjargal Physician in family clinic

3 B. Bat-Tsengel Physician in family clinic

4 S. Namsrai Physician in family clinic

5 U. Davaakhorol Physician in family clinic

6 E. Baasankhuu Physician in family clinic

7 B. Ulzi Physician in family clinic

8 Ya. Jontoon Nurse in family clinic

9 B. Tungalag Nurse in family clinic

10 D. Tseren-Od Nurse in family clinic

11 D. Norovbanzad Nurse in family clinic

12 L. Ariunjargal Nurse in family clinic

13 N. Munkhjargal Nurse, Social Health Department

14 Ts. Tumurtogo Physician in NCCD

15 B. Dulamjav Physician in NCCD

16 S. Altantuya Pediatrician

17 B. Tuya Therapeutic

18 B. Lkhagvajav Therapeutic

19 L. Bayanzul Physician

20 S. Enkhtuya Physician, Ambulance team

21 L. Oyungerel Laboratory doctor

22 B. Bulgan Laboratory doctor

Vice director of treatment, Provincial state 23 D. Batmandakh hospital

24 S. Baigalma Quality manager, Provincial state hospital

25 Ts. Erdenetsetseg Physician

26 G. Nergui Vice director, Provincial health department

27 B. Khandsuren Therapeutic

135 B5265G1 Annual Report – 2007/2008

28 D. Tseveendulam Pediatric specialist

Human resource manager, Provincial health 29 S. Oyuntsetseg department

30 L. Ulzijargal Physician

31 R. Zagdkhorlo Ophthalmologist

Physician, statistician, Provincial health 32 N. Enkhtuya department

33 O.Otgontsetseg Physician

34 N. Narantsetseg Physician

35 G. Chantsalma Nerve specialist, State provincial hospital

36 L.Ariuna Project employee,

37 T.Enkhtsetseg Midwife, assistant doctor

38 S. Tuya Physician, Family clinic “Enerelt Naran”

39 B. Erdenetuya Traumatologist

40 M. Sunjidma Nerve specialist

41 Ts. Tsetsegma Physician, Family clinic “Khos Aylal Zuur”

42 R. Baasankhishig Physician

43 B. Tserma Physician

44 D. Ganbold Physician

45 B. Odontungalag Physician, Family clinic “Munkhyn Gegee”

46 D. Lkhagvabayar Physician, Family clinic “Mend Bulag”

47 B. Altantsetseg Physician, Family clinic “Niitsel”

48 Ts. Dulamjav Physician, Family clinic “Gerelt Mandakh”

49 D. Badamtsetseg Physician, Family clinic “Enerelt Naran”

50 D. Altantsetseg Nurse, Family clinic “Enerelt Naran”

136 Cooperative Agreement Implementation

ANNEX 26 Training Programme for the family doctors of Ulaanbaatar city, November 2-4, 2005

Topic Responsible person Time

1 Registration Dr. D. Sodbayar 8.30-9.00

2 Influenza epidemiology Dr. A. Burmaa 9.00-10.00

Current situation of infectious 3 diseases in UB city and Dr. L. Dashtseren 10.00-10.45 prognosis

Tea break 10.45-11.00

Influenza Viruses and principles of virus specimen 4 Dr. B. Darmaa 11.00-11.45 collection, handling and transportation.

Results of Hib meningitis 5 Dr. D. Sodbayar 11.45-12.30 surveillance

6 Questions and discussion Dr. D. Sodbayar 12.30-13.00

Lunch 13.00-14.00

General principles of clinical 7 diagnosis and treatment of Dr. T. Navchaa 14.00-14.45 influenza

Specific prevention and Prof. P. Nymadawa, Project 8 14.45-15.30 antiviral drugs of influenza coordinator

Tea break 15.30-15.45

Diagnosis and treatment of respiratory diseases Prof. D. Agvaandorj, 9 according to WHO Integrated Lecturer of Medical 15.45-16.30 Management of Childhood University “Monos” Diseases

13 Discussion Dr. D. Sodbayar 16.30-17.00

137 B5265G1 Annual Report – 2007/2008

ANNEX 27 List of family doctors participated in the workshop-1 for family doctors of UB, November 2, 2006

Participant’s name Organization Position

L.Bayardorj Bagakhangai District Hospital General Clinician

S.Oyuntsetseg Baganuur District Hospital Officer in charge of Children

Ts. Khandtsoo Baganuur District Hospital Epidemiologist

D. Sainzaya Baganuur District Hospital Children’s Emergency

R. Baatarkhuu Baganuur District Hospital Manager

B. Oyunchimeg Nalaikh District Hospital Director

S. Tsetsegmaa Nalaikh District Hospital Deputy Director

B. Bayarkhuu Nalaikh District Hospital Epidemiologist

D. Nergui Nalaikh District Hospital Children’s Emergency

U.Narantungalag Sukhbaatar District Hospital Epidemiologist

Bayanzurkh District Health D. Buyandelger Children’s Emergency Department Bayanzurkh District Health B. Uranchimeg Metodologist Department Chingeltei District Health D. Dariimaa Physician Department Bayangol District Health N. Uyanga Children’s Emergency Department Bayangol District Health N. Bayaraa Officer in charge of Children Department Bayangol District Health O. Oyunchimeg Epidemiologist Department Sukhbaatar District Health D. Erdenechimeg Epidemiologist Department Sukhbaatar District Health M. Chimgee Officer in charge of Children Department Sukhbaatar District Health Ch. Oyun Children’s Emergency Department

138 Cooperative Agreement Implementation

Sukhbaatar District Health L. Enkhtuya Children’s Emergency Department Chingeltei District Health Ts. Oyunchimeg Children’s Emergency Department Chingeltei District Health B. Rentsenkhand Officer in charge of Children Department Khan-uul District Health B. Onon Officer in charge of Children Department Khan-uul District Health Ts. Oyunchibeg Epidemiologist Department Chingeltei District Health N. Bayansuren Epidemiologist Department Songino-khairkhan District Sh. Dolgormaa Deputy Director Hospital

Songino-khairkhan District B. Oyunchimeg Officer in charge of Children Health Department

Songino-khairkhan District D. Gantsetseg Epidemiologist Health Department Bayanzurkh District Health B. Oyunchimeg Epidemiologist Department Bayanzurkh District Health M. Sarantsetseg Officer in charge of Children Department

Ts. Battsengel First Hospital Physician

N. Amgalanbaatar UB city Emergency Manager

B. Dulamsuren Military Hospital Epidemiologist

Ts. Oyun Military Hospital Epidemiologist

G. Tsersendolgor NCCD Epidemiologist

Ch. Urtnasan NCCD Epidemiologist

139 B5265G1 Annual Report – 2007/2008

ANNEX 28 List of participants of the training workshop-2 for the doctors of Ulaanbaatar city, November 4, 2005

Participant’s name organization Position D. Dariimaa NCCD Physician P. Selenge NCCD Physician Ts. Jambaldorj NCCD Physician T. Tungalag NCCD Physician N. Uugantsetseg NCCD Physician D. Gantsetseg NCCD Physician G. Ganchimeg NCCD Physician O. Oyunchimeg NCCD Physician M. Uuganchimeg NCCD Physician B. Batbayar NCCD Physician B. Dolgor NCCD Physician G. Tsetsegmaa NCCD Physician A. Tsengel bat NCCD Physician E. Tuya NCCD Physician S. Erdenechimeg NCCD Physician P. Unenchimeg NCCD Physician O. Enkhjargal NCCD Physician B. Tumurkhuyag State Professional Inspection Agency Officer Ts. Selenge NCCD Epidemiologist D. Munkhtsetseg NCCD Epidemiologist J. Erdenechimeg Sukhbaatar District Emergency team Physician B. Saruul NCCD Physician M. Oyungerel NCCD Physician Bayan-Zurkh District Hospital, Children’s U. Tuul Head Department L. Jambaldorj UB city Emergency Physician Ch. Davaatsetseg UB city Emergency Physician L. Baatartumur UB city Railway Station Physician L. Chinzorig Khan-uul District Health Department Epidemiologist M. Suren Bayanzurkh District Health Department Epidemiologist G. Narantuya NCCD Epidemiologist

140 Cooperative Agreement Implementation

ANNEX 29 Laboratory and office equipment received in VL/NCCD in the fiscal year of 2004/2005

Îffice equipment Unit Total No Description quantity price price Fax/telephone apparatus Panasonic KX-FT71 1 1 158.3 158.3 (malasia Branch) Pentium IV Notebook ( SV25-4C234/C26) 2 1 1,484.9 1,484.9 Samsung V26 (Samsung, Korea ) 3 PG-A10XSL LCD-projector ( Sharp, Japan ) 1 2,013.4 2,013.4 WorkCentre PE 114e printer-scanner- copier 4 1 300.0 300.0 (Xerox Shanghai Branch) Telephone apparatus KX-PS500MXW Panasonic 5 1 13.4 13.4 (Japan PC iXtreme H803, Pentium IV, Packard Bell 6 2 1,350.6 2,701.2 (Malasia Branch Total 6,671.20

Laboratory equipment and devices: Unit Total No Description quantity price price 1 Microwave oven ER-JY3B (Toshiba, Japa) 1 125.8 125.8 2 Refrigirator SH-22T-G2S (Sharp, Japan) 2 243.3 486.6 Deep freezer ULT 1386-9-V35, cap. 380 l 3 1 15,613.1 15,613.1 (Revco, USA) Freezer -20°C Frestech-BD141G from Henan 4 1 134.2 134.2 Xin Fei Electric 5 Laboratory files cupboard 1 120.1 120.1 6 CO2 balloon gas pressure regulator 2 23.5 47.1 7 Laboratory glassware cupboard 1 159.4 159.4 8 Inverted microscope Leica 1 9,000.0 9,000.0 9 PCR Workstation 34750-77 (USA) 1 4,600.0 4,600.0 10 Termocycler 93941-00 (Biotech) 1 7,300.0 7,300.0 Vortex 04725-12 ( Barnstead international 11 1 630.0 630.0 USA) 12 Autoclave 10785-35 1 1,300.0 1,300.0 13 Pump 07530-50 ( Cole-Parmer ) 1 320.0 320.0

141 B5265G1 Annual Report – 2007/2008

14 Vacuum pipe 06413-20 20 feet 3.7 75.0 15 Duar 50 l 03773-619 ( USA ) 1 1,900.0 1,900.0 16 Duar 20 l 03779-12 ( USA ) 1 1,800.0 1,800.0 Micropipet 0,1-2,5 μl 24506-00 (Germany, 17 1 500.0 500.0 Brinkman) Micropipet 0,5-10 μl 24506-10 (Germany, 18 1 500.0 500.0 Brinkman) Micropipet 2-20 μl 24506-20 (Germany, 19 1 500.0 500.0 Brinkman) Micropipet 10-100 μl 24506-30 (Germany, 20 1 500.0 500.0 Brinkman) Micropipet 20-200 μl 24506-40 (Germany, 21 1 500.0 500.0 Brinkman) 22 Timer 94440-00 ( China) 1 210.0 210.0 23 Laminar Flow box ( US Federal standards ) 2 4,365.0 8,730.0 24 Electric connector ES-N610 3 8.4 25.2 Total 55,076.5

142 Cooperative Agreement Implementation

ANNEX 30 Laboratory reagents and other consumables received in VL/NCCD in the fiscal year of 2004/2005

Reagents: Description unit quantity Unit Price Total price Hank’s Balanced Salt Sol.10x, 1 bottles 10 31.0 310.0 500 ml Gentamicin Reagent Solution 2 Pkg 1 441.0 441.0 (10 ml ), 10 bottles per pkg 3 Agarose, 100g bottle 1 158.0 158.0 DMEM, 500 ml, 10 bottles 4 Pkg 6 140.0 840.0 per pkg HEPES, 100 ml, 6 bottles 5 Pkg 2 265.0 530.0 per pkg 6 Bovine Alb. Solution, 100 ml bottles 10 36.0 360.0 7 DNA ladder, 100 bp pcs 2 131.0 262.0 8 Sterilised Primers pcs 10 36.1 361.0 9 Fetal bovine serum, 100 ml bottles 5 168.0 840.0 10 Trypsin-EDTA, 100 ml bottles 10 11.0 110.0 Trypsin-EDTA, 100 ml, 20 11 Pkg 2 160.0 320.0 bottles per pkg Penicillin-Streptomicin. 12 bottles 10 19.0 190.0 Solution Penicillin-Streptomicin. 13 Pkg 1 320.0 320.0 Solution,20 bottles per pkg Human Placental 14 pcs 2 94.0 188.0 Ribonuclease Inhibotor 15 L-Glutamine, 200 mM bottles 10 8.0 80.0 Gentamicin Reagent Solution 16 Pkg 2 411.0 822.0 (10 ml ), 10 bottles per pkg QIAmp Viral RNA Mini Kit 17 Pkg 8 617.0 4,936.0 ( 50 ) Qiagen oneStep RT-PCR ( 18 Pkg 4 1,560.0 6,240.0 100 ) Total 17,308.0

143 B5265G1 Annual Report – 2007/2008

Consumable: Unit Total No Description unit quantity Price price 1 Stir bar 5/8x5/16 08549-00 pcs 1 6.0 6.0 2 Stir bar 1x5/16 04775-55 pcs 1 8.0 8.0 3 Stir bar 1,5x5/16 04775-55 Pcs 1 10.0 10.0 4 Stir bar 2x5/6 04775-65 Pcs 1 10.0 10.0 5 Plastic flask 1000 ml 06110-20 pcs 1 40.0 40.0 6 Plastic flask 2000 ml 06110-30 pcs 1 50.0 50.0 7 Tube rack 03775-64 Pkg 1 85.0 85.0 8 Stopper 10/pk 62992-14 (black) Pkg 1 50.0 50.0 9 Stopper 10/pk 62994-02 Pkg 1 50.0 5.0 10 Stopper 62994-04 Pkg 1 8.0 80.0 11 Glass pipet 2ml x12 pcs 25562-04 Pkg 2 415.0 415.0 12 Glass pipet 5ml x12 pcs 25562-08 Pkg 1 210.0 210.0 13 Glass pipet 10 mlx12 pcs 25562-10 Pkg 1 260.0 260.0 14 Centrifuge tube 50ml 500 pcs/ pk 17400-30 Pkg 1 440.0 440.0 15 Cylinder 100 ml 06137-76 pcs 10 10.0 100.0 16 Cylinder 250 ml 06137-78 pcs 10 12.0 120.0 17 Cylinder 100 ml 06137-80 pcs 10 17.0 170.0 18 Cylinder 250 ml 06137-82 pcs 10 20.0 200.0 19 Thermometer -90° C-20°C 93907-00 pcs 1 100.0 100.0 20 Thermometer -30° C- 0°C 93907-02 pcs 1 80.0 80.0 21 Media bottle 250 ìë 1 pkx48 pcs 08913-25 Pkg 1 350.0 350.0 22 PCR tube 0,2 μl 1 pk/125 pcs 67103-70 Pkg 1 180.0 180.0 23 PCR tube 0,5 μl 1 pk/1000 pcs 67103-60 Pkg 1 90.0 90.0 24 Tube rack ( yellow ) 06737-62 Pkg 4 32.5 130.0 25 Tube rack 1pk/5pcs 67101-00 Pkg 3 70.0 210.0 26 Tube rack 1pk/5pcs 67102-10 Pkg 2 85.0 190.0 27 Carrier 1pk/150 pcs 03727-01 Pkg 1 180.0 180.0 28 Nunc Cryotube ( 1,8 ml stepneckx 50 ) Pkg 4 73.0 292.0 29 Nunc Cryotube ( 1,8 ml screw capsx 50 ) Pkg 4 73.0 292.0 30 Nunc 96-well plates U bottom ( 135 ) Pkg 4 0.47 253.8 31 Barrier Pipet Tips, 10-200 ul (240) Pkg 4 192.0 768.0 32 Barrier Pipet Tips, 100-1000 ul (250) Pkg 4 25.0 100.0 33 25 ml flasks for tissue culture Pcs 2 84.85 169.7 Total 5,572.2

144 Cooperative Agreement Implementation

ANNEX 31 Laboratory Equipment and Supplies Received by VL/NCCD in the fiscal year of 2005/2006

No Description quantity Total price $ 1 Gel documentation system, UVP, BioDoc-IT 1 14,500.0 2 Universal centrifuge Hermle Z 300 1 9,760.0 3 Autoclave 1 5,350.0 4 Incubator Yamato Scientific DX-300 1 2,450.0 5 Titer plate shaker Labline 1 1,700.0 6 Electrophoresis system Mopid-EX 2 2,720.0 7 Vacuum pump 1 580.0 8 Mini centrifuge Cole-Parmer 1 530.0 9 Multichannel Pipet system 1 470.0 10 Pure water tester 2 110.0 11 Preparative comb 1 85.0 12 Preparative comb 1 73.0 Total 38,328.0

ANNEX 32 Laboratory Reagents Received by VL/NCCD in the fiscal year of 2005/2006

No Description unit quantity Unit price $ Total price $ 1 Acetone, 99.5%,500 ml bottle 10 35.0 350.0 2 Plates Microwell box 4 900.0 3600.0 3 Mayer solution bottle 2 93.0 186.0 4 Eosin solution bottle 2 65.0 130.0 5 FITC Immunoglobulin bottle 2 230.0 460.0 6 Tris borate EDTA buffer box 10 90.0 900.0 7 Phosphate buffer bottle 10 190.0 1900.0 8 Seiken RDE box 2 348.0 696.0 9 Quedel A+B Flu box 20 230.0 4600.0 10 RSV strip box 10 120.0 1200.0 11 Adenovirus strip box 10 70.0 700.0 12 Influenza A/H5 strip box 10 250.0 2500.0 13 Mononucleosis IGM S/P strip box 1 70.0 70.0 Total 17292.0

145 B5265G1 Annual Report – 2007/2008

ANNEX 33 Office Equipment and Devices Supplied to Management Team in 2005/2006 season

No Description Quantity Unit price $ Total price $ 1 Hedy computer system P4 2 688.0 1,376.0 2 Hedy computer 1 768.0 786.0 3 Lenovo notebook 1 1,349.0 1,349.0 4 Canon digital camera 1 225.0 225.0 5 Canon printer 1 157.0 157.0 Battery charger with 4 rechargeable 6 1 32.6 32.6 batteries CHSN 34 HR 7 HP 407 Digital camera 1 253.3 253.3 128 MB Flash memory for HP 8 1 32.7 32.7 camera 9 Telephone apparatus Panasonic 1 12.6 12.6 10 256 MB LG flash memory disk 6 32.9 230.3 11 Powercom UPS 2 64.8 129.6 12 Internet separator 1 22.5 45.1 13 Recharging of toner 1 12.0 12.0 14 EP- 26 toner 1 65.5 65.5 15 Charging of EP 26 toners 2 9.8 19.7 16 PE 114 toner 6 75.0 450.0 17 Cart Canon 303 toner 3 60.0 180.0 Total 5,356.4

146 Cooperative Agreement Implementation

ANNEX 34 Training Program of the Workshop “Need for establishment of biosafety III level laboratory”, November 23, 2005

Topic Time Responsible person

1 Registration 08.30-09.00 Organizers

Emerging and reemerging infectious Prof. P. Nymadawa, Project 2 diseases and risk for health sector 09.00-10.00 Coordinator workers Importance of establishing of Dr. D. Tserennorov, 3 10.00-11.00 biosafety III level laboratory CIDNF

4 Tea break 11.00-11.30

The experience of establishment of S.I Zolotyh, Virology and biosafety III level laboratory at the Biotechnology Center 5 11.30-13.00 Virology and Biotechnology Center “Vector” of Novosibirsk, “Vector” of Novosibirsk, RF RF

6 Lunch 13.00-14.00

The experience of establishment 7 of biosafety III level laboratory at 14.00-15.30 Dr. N. Naranbat, NCCD Mycobacterial Laboratory, NCCD

8 Tea break 15.30-15.45

Prof. P. Nymadawa, Project 9 Discussion 15.45-17.00 Coordinator

147 B5265G1 Annual Report – 2007/2008

ANNEX 35 Participants list of the Workshop “Need for establishment of biosafety III level laboratory”, November 23, 2005

Participant’s organization Position name P.Nymadawa NCCD Project Coordinator

D. Otgonbaatar CIDNF Director

D. Tserennorov CIDNF Deputy Director

B. Undraa CIDNF Epidemiologist

D. Ganbold CIDNF Bacteriologist

J. Bekhochir Veterinarian Institute of Veterinary, Researcher

Virology and Biotechnology Center S.I. Zolotikh Research Specialist “Vector”, Novosibirsk, Russian Federation

D. Abmed NCCD Virologist

N.Tsend NCCD Deputy Director

N.Naranbat NCCD Head Of Department

M.Tsolmon NCCD Epidemiologist

B.Agiimaa Epidemiologist

B.Darmaa NCCD Virologist

D.Enkhsaikhan NCCD Virologist

R.Sugar Central Veterinarian Laboratory Virologist

148 Cooperative Agreement Implementation

ANNEX 36 Refrigerators, thermometers, tube stands and sockets supplied for sentinel sites in the fiscal year of 2005/2006

No Description units Quantity Unit price US Total price $ 1 Toshiba refrigerators pieces 31 136.52 4,178.8 2 Akira refrigerators pieces 57 98.81 5,632.2 3 Thermometers pieces 90 2.0 180.0 4 ES-U36 sockets pieces 85 4.0 342.4 5 Tube stand pieces 50 3.94 197.0 Total 10,530.40

ANNEX 37 Training Program for veterinarians of Ulaanbaatar City, November 17, 2005

Topic Responsible person Time 1 Registration Dr. D. Sodbayar 8.30-9.00 Current situation of animal and 2 Dr. D. Tserennorov 9.00-10.00 avian influenza 3 Introduction to Influenza virus Dr. B. Darmaa 10.00-11.00 4 Tea break 11.00-11.15 Animal specimen collection, 5 D. Sugar, D.Batchuluun 11.15-12.10 handling and transportation Measures in case of human avian 6 Dr. D. Otgonbaatar 12.10-13.00 influenza Lunch 13.00-14.00 Current situation of reported 7 human avian influenza in the Dr. D. Sodbayar 14.00-14.45 worldwide 8 Prevention of avian influenza P. Bolortuya 14.45-15.30 9 Coffee break 15.30-15.45 Source measures in case of 10 P. Bolortuya 15.45-17.00 reported avian influenza

149 B5265G1 Annual Report – 2007/2008

ANNEX 38 List of participants of training for veterinarians of Ulaanbaatar city, November 17, 2005

Participant’s name organization Position D. Sugar Central Veterinary Laboratory Head of Department P. Bolortuya Ministry of Food and Agriculture Officer J. Urtnasan “Bohog” poultry Veterinarian N.Baigalmaa Fermer’s Union Officer J. Bekh ochir Veterinarian Institute Researcher S. Oyunchimeg “Bohog” poultry Physician D. Batchuluun Central Veterinary Laboratory Researcher Kh. Tungalag CIDNF Biologist G. Khuderchuluun Nalaikh District Veterinary Department Veterinarian B. Undraa CIDNF Officer Ts. Otgonchimeg CIDNF Bacteriologist B. Khorolsuren CIDNF Epidemiologist D. Otgon NCCD Epidemiologist U. Unursaikhan CIDNF Bacteriologist A. Khaadmaa Zalaat Poulry Manager P. Damdindorj Bohog Poultry Ex. Director

ANNEX 39 Training Program for pharmacists of Ulaanbaatar city, November 18, 2005

Topic Responsible person Time 1 Registration Dr. D. Sodbayar 8.30-9.00 2 Epidemiology of influenza and prevention activities Dr. L. Dashtseren 9.00-10.00 Current situation of human cases of avian flu 3 Dr.D. Sodbayar 10.00-11.00 worldwide Tea break 11.00-11.15 4 Management of ILI Dr.T. Navchaa 11.15-12.30 Lunch 12.30-13.30 5 Specific prevention and treatment of influenza Prof. P. Nymadawa 13.30-15.30 Tea break 15.30-15.45 6 Use of antiviral drugs, registered in Mongolia Dr. T. Zorig 15.45-16.45 150 Cooperative Agreement Implementation

ANNEX 40 List of participants of the training for pharmacists of Ulaanbaatar city, November 18, 2005

Participant’s name organization Position

Z. Oyungerel Drugstore ‘’Badaan’’ Pharmacist

L. Sanjid Drugstore ‘’Mik-keen’’ Adviser

L. Sugartseren Drugstore ‘’Tun erdene’’ Director

Ts. Donon Drugstore ‘’Bolor khishig’’ Head

B. Munkhdelger Drugstore ‘’Ombol farm’’ Director

N. Bayarmaa Second Hospital Head

D. Enkhtuya Drugstore ‘’Tsombo’’ Head

Kh. Demid State Professional Inspection Agency Officer

B.Bayartsetseg NCCD Pharmacy Head

B. Oyunchimeg Public Health Institute Officer

A. Myadagmaa Drugstore ‘’Tavin us’’ Pharmacist

L. Orlamjav Drugstore ‘’Tsakhiur tumur’’ Pharmacist

U. Tugsbileg Drugstore ‘’Urgan delgerekh’’ Pharmacist

J. Nina Drugstore ‘’Mon farm’’ Director

B. Gantuya Drugstore ‘’Gamba treid’’ Director

Sh. Mukhamed Drugstore ‘’Monos’’ Manager

B. Oyunerdene First Hospital Head

N. Altantsetseg Drugstore ‘’Mon enzyme’’ Director

D. Suvd Drugstore ‘’Mon enzyme’’ Deputy Director

D. Tuvshinjargal Drugstore ‘’Munkhiin tun’’ Pharmacist

G. Surenkhand NCCD Immunization Manager

151 B5265G1 Annual Report – 2007/2008

ANNEX 41 IST Composition:

(approved by the order No 253/2006 of the Minister of Health, Mongolia)

Team leader: Director-General of NCCD

Secretary: Head, Department of Infectious Diseases Surveillance and Research (DIDSR), NCCD

Members: Chair, Influenza Surveillance Advisory Committee First Deputy Director in charge of Infectious Diseases Surveillance, NCCD Deputy Director in charge of medical care and service Consultant in charge of Infectious Diseases Surveillance, NCCD Head, Information Technology Dept, NCCD Head, Virology Laboratory, NCCD Epidemiologist in charge of Respiratory infections, DIDSR, NCCD Virologist, VL, NCCD

ANNEX 42 ISAC Composition:

(approved by the order No 253/2006 of the Minister of Health, Mongolia)

Chair: President, Subassembly of Medical Science, Mongolian Academy of Science

Secretary: Project manager, ‘Development of Influneza surveillance network’

Members: Officer in charge of Infectious Diseases, MoH Chief Infectionist, MoH Director General, MCHRC, MoH Deputy Director, CIDNF, MoH Officer in charge, MoFA Head, Virology Laboratory, Veterinaru Research Institute, MoFA Virologist, Virology Laboratory, Veterinaru Research Institute, MoFA

152 Cooperative Agreement Implementation NNEX 43 out of them medical doctors nurses other 333234113 445554112 332555114 336444004 444444124 434333033 334333125 I II III I II III I II III I II III Number of staff NANA5NANA5NANA0NANA0 NANA6NANA6NANA0NANA0 ILI sentinel sites in the capital city “Sijid dug” FGP 9 9 18 4 3 8 4 5 6 1 1 4 Maternal and Child Health Research Center “Eruul urkh” FGP 10“Amin tus” FGP 10 11 9 10 12 National Center of Communicable Diseases City district Site’s title Chingeltei district Khan-Uul district Bayanzurkh district 8 “Enkh titem” FGP 7 9 10 7 4569 “Amgalan itgekhui” FGP “Nasan Urt” FGP 9 District hospital 9 7 11 “Manal uils” FGP NA 7 NA 14 5 7 NA NA 8 5 12 NA NA 0 NA NA 0 2 UB city 3 1 UB city 10 District hospital NA NA 5 NA NA 4 NA NA 1 NA NA 0 14 District hospital NA NA 5 NA NA 4 NA NA 1 NA NA 0 1213 “Tegsh Ulzii” FGP “Uils negten” FGP 9 6 9 7 15 10 5 5 7 3 3 4 1 1 4 11 №

153 B5265G1 Annual Report – 2007/2008 554553223 445444111 433333124 333333002 446335114 555444003 334333113 645663116 445443003 334334112 453333003 “Ami erdene” FGPEnerelt ulzii’ FGP 12 12 9 10 9 10 “Unu achit” FGP 9“Enkh sunder” FGP 9 12 8 8 11 “Shar degd” FGP 8 8 10 Nalaikh district Baganuur district Songino- khairkhan district Sukhbaatar district Bayangol district Destination: I – 2004/2005 season II – 2005/2006 season III- 2006/2007 season NA – non available (site was not established that time) TOTAL 167 171 273 78 74 122 74 76 82 15 21 66 28 27 20 “Enkh elberel” FGP 7 7 10 171822 “Gurvan sanchir” FGP23 District hospital 82425 826 NA 15 District hospital NA 5 “Sankoll” FGP NA “Tegsh mend” FGP NA NA District hospital NA 3 5 7 7 NA NA NA 8 7 NA NA 2 NA 10 9 4 NA 5 NA NA NA NA 0 NA 1 3 NA NA NA NA 0 2 NA NA 0 1621 “Itgel ugtakh” FGP 6 6 “Buyant manal” FGP 8 13 11 14 19 15

154 Cooperative Agreement Implementation ANNEX 44 out of them medical doctors nurses other ILI sentinel sites in the provinces Number of staff I II III I II III I II III I II III Zuvlukh bag 6 6Goyoo mend 6 3 6 3 6Asralt uils 3 6 3 3 3 6 3 3 7 3 0 7 3 0 3 3 0 3 3 3 0 3 0 2 0 3 0 2 1 Province Site’s title Province Site’s Dornogobi Dornod Selenge 7 8 Misheelt mana 6 8 8 3 3 3 3 3 3 0 2 2 23456 Nomt bag Khadah khui Egneshgui Emnekh bag 7 7 Provincial hospital NA 9 6 8 3 NA 10 6 8 5 6 3 6 1 NA 8 3 NA 1 2 1 4 4 2 3 2 NA 3 2 4 NA 3 3 1 3 3 2 NA 3 2 3 2 NA 1 2 2 0 3 3 2 3 0 3 2 2 2 2 2 9 Agatova 6 9 9 3 3 3 3 3 3 0 3 3 1 1718 Yagaan tseene Provincial hospital NA 10 NA 11 5 9 NA 4 NA 5 3 NA 3 NA 4 0 NA 4 NA 4 0 2 4 2 10 Rail way 5 8 8 3 4 4 2 4 4 0 0 0 13141516 Dornyn ireedui Myangan jargalan Tseene tsetseg 7 5 Eruul zon 10 8 10 9 12 9 8 2 10 1 11 2 3 2 10 3 2 3 2 3 2 3 3 4 5 3 3 4 5 3 4 2 5 1 4 4 2 3 4 2 5 3 2 3 4 3 12 11 Provincial hospital NA NA 5 NA NA 5 NA NA 0 NA NA 0 №

155 B5265G1 Annual Report – 2007/2008 Narny dush 6 10Bugat 8 1 2 8 11 2 7 4 4 4 3 4 3 1 3 4 4 2 3 1 4 1 Munkhsunder NA NA 9 NA NA 3 NA NA 4 NA NA 2 Uvurkhangai Khovd Orkhon 20 Uyan setgel 11 14 10 4 4 4 5 5 4 2 5 2 272830 Jargalant Rashaant 9 7 1137 738 8 7 4 3 Achlalt nar 3 Ankhny och 3 3 NA 3 3 NA NA 3 NA 4 11 9 3 NA 4 NA NA 3 2 NA 5 1 3 4 NA 1 NA NA 1 NA 5 1 4 NA NA NA NA 1 2 222324 Tushig dulguun Provincial hospital 11 NA NA 13 5 9 NA 3 NA 3 5 NA 2 NA 5 0 5 NA NA 4 0 3 5 3 252629 Buyant Baatarkhairkhan32 733 Provincial hospital 7 1034 NA35 9 9 NA36 Uchralt bayar 7 5 1 Munkhiin gegee NA Elberelt uils 3 2 NA39 NA NA Uils badrakh NA NA 3 3 Niitsel 3 12 NA 9 3 5 NA NA NA NA NA NA NA NA 10 Mendbulag 3 4 NA 11 NA 2 4 NA 3 4 3 NA NA NA NA NA NA NA NA 3 9 1 NA NA 4 NA NA 4 NA 0 5 NA 1 4 9 4 NA NA NA NA NA 3 2 NA NA 4 NA 4 NA NA 5 1 NA 3 NA 4 2 NA NA NA NA NA 4 2 NA 2 NA 4 NA NA 1 NA 1 19 21 Enkhiin khurd 8 11 11 3 3 4 4 4 5 1 4 2 31 Tsagaan agi NA NA41 7 NA NA 3 Khos chagnuur NA NA NA NA 3 9 NA NA NA NA 1 4 NA NA 4 NA NA 1

156 Cooperative Agreement Implementation Gos khot NA NA 33 NA NA 14 NA NA 17 NA NA 2 Itgeliin erel NA NA 7 NA NA 3 NA NA 3 NA NA 1 TOTAL 172 221 457 62 66 190 83 84 190 27 71 77 Darkhan- Uul Orkhon Explanation: I – 2004/2005 season; II – 2005/2006 season; III- 2006/2007 season; NA – non available (site was not established that time); 4748 Gereltei Amin kholboo NA NA NA NA 18 19 NA NA NA NA 7 8 NA NA NA NA 8 9 NA NA NA NA 3 2 4649 Enerelt naran NA Tuvshin kholboo NA NA 18 NA NA 16 NA NA 6 NA NA 5 NA NA 9 NA NA 7 NA NA 3 NA 4 434445 Gerelt mandakh Provincial hospital NA NA NA NA 8 4 NA NA NA NA 3 4 NA NA NA NA 4 0 NA NA NA NA 1 0 42 51 Provincial hospital NA NA 5 NA NA 5 NA NA 0 NA NA 0

157 B5265G1 Annual Report – 2007/2008

ANNEX 45

Program of the Second National Influenza Workshop (NIW2), October 4-5, 2006, Ulaanbaatar, Mongolia

Topic Time Responsible person FIRST DAY Registration 08:30-09:00 Organizers Chairpersons: Prof. Ts. Oyunchimeg, MD; Director-General, NCCD; Opening Session 09:00-09:45 Head, National Influenza Center (NIC), Mr R. Hagan, WHO Representative in Mongolia Prof. Ts. Oyunchimeg, MD; Opening Speech and 09:00-09:10 Director-General, NCCD; Introduction of the Guests Head, NIC Dr A. Otgonbold, MD, PhD Inaugural Speech 09:10-09:20 Vice Minister of Health, Government of Mongolia Mr. B. Goldbeck, US Embassy in Greeting 09:20-09:30 Mongolia Mr R. Hagan, WHO Representative in Greeting 09:30-09:40 Mongolia Greeting 09.40-09.50 Mr Y. Mazumder, UNICEF, Mongolia Announcements and Photo 09.50-10.00 Participants Session Tea/Coffee Break 10:00-10:30 Moderators: Prof. P.Nymadawa, MD, PhD, Plenary Session I 10:30-13:00 DSc(Med), MAMS, Mr Y. Mazumder, UNICEF, Mongolia

Global Influenza Update 10.30-11.30 Dr. A. Moen, CDC, USA (Southern Hemisphere 2006)

Dr A. Burmaa, MD, Surveilance Human influenza situation in Division, NCCD, Mongolia in 2004/2005 and 11.30-12.15 Dr B. Darmaa, MD, Virology 2005/2006 seasons laboratory, NCCD 158 Cooperative Agreement Implementation

Realizations of the recommendations from NIW1 Dr J. Altantuya, MD, 12:15-13:00 and expected outcomes from Policy Coordination Department, MoH NIW2 Lunch 13:00-14:00 Moderators: Plenary Session II Dr J. Altantuya, MD, 14:00-16:00 Policy Coordination Department, MoH Dr. A. Moen, CDC, USA Implementation status of Mr G. Ganbold, Deputy Chief, the Mongolian Government State Emergency Management Agency, Resolution on “Directive for 14.00-14.45 Mongolia control and prevention of influenza pandemics” Implementation status of the Prof. P.Nymadawa, MD, PhD, USA/Mongolia Cooperative DSc(Med), Agreement “Development 30.30-30.30 President, MAMS & Project Director of Influenza Surveillance Network” Implementation status of the “Emergency risk Dr Ts. Enkhbayar, MD, communication for influenza 15.30-16.00 First Deputy Director, NCCD pandemics” project supported by the Government of Japan Tea/Coffee Break 16:00-16:30 Moderators: Plenary Session II Dr J. Altantuya, MD, 16:30-18:00 (continuation) Policy Coordination Department, MoH Dr. A. Moen, CDC, USA Expanding of onfluenza Dr. N. Khorolsuren, MD, PhD, surveillance netwrok by Deputy Dircetor, NCCD 16.30- 17.00 introduction of hospital based Dr. L. Dashtseren, MD, surveillance Monitoring Division, NCCD Discussions on the presentations of the plenary 17.00-18.00 sessions I and II

SECOND DAY

Moderators: Dr. D. Tserennorov, PhD, Deputy Director, Plenary Session III 9.00-11.00 Center for Infectious Diseases with Natural Foci (CIDNF), MoH Dr. Wengji Wang, WHO, Manila

159 B5265G1 Annual Report – 2007/2008

Avian Influenza situation in Dr Weigong Zhou, MD, PhD, the world and global strategy in 09.00-10.00 WHO, Manila the control of avian influenza Avian influenza viruses isolated Prof. R. Sodnomdarjaa, PhD, from wild birds in Mongolia 10.00-10.30 Central Veterinary Sanitary and the clinical presentations Laboratory, MoFA Avian Influenza control in 10.30-11.00 Dr. Ts. Purevkhuu, MoFA Mongolia Tea/Coffee Break 11.00-11.30 Tea/Coffee Break Moderators: Dr Ts. Sodnompil, MD, PhD, NCHD, Plenary Session IV 11.30-13.30 MoH, Ms Ts. Undarma, UNICEF, Mongolia Methodology for health 11.30-12.00 education to control and Dr. B. Garmaa, MD, NCHD prevent avian influenza Experiences of ACEAN countries for table top exercise Dr D.Sodbayar, MD, NCCD, on influenza 12.00-13.00 Dr D.Oyuntsetseg, MD, SEMA, pandemic preparedness assessment Discussions on the presentations of the plenary 30.30-30.30 sessions III and IV Lunch 13.30-14.30

Moderators: Table top exercise on Dr Ts. Enkhbayar, MD, NCCD, pandemic preparedness 14:30-17:00 Dr D.Sodbayar, MD, NCCD and assessment Dr D.Oyuntsetseg, MD, SEMA, Tea/Coffee Break 17:00-17:30 Moderators: Ass. Prof. B. Batsereedene, MD, PhD Closing Session 17:30-18:00 State Secretary, MoH Dr Weigong Zhou, MD, PhD, WHO, Manila Discussion and adoption of the 17:30-18:00 NIW2 Recommendations

160 Cooperative Agreement Implementation

ANNEX 46. Participants’ list of the NIW2 october 4-5, 2006, Ulaanbaatar

No Parcitipant`s name Organization Title Vice Minister of 1 A. Otgonbold Ministry of Health Health 2 B. Batsereedene Ministry of Health State Secretary Officer in charge 3 D. Narangerel Ministry of Health of communicable diseases Officer in charge of 4 Ch. Munkhdelger Ministry of Health drug “Emergency Risk Communication” 5 Ch. Bold-Erdene Project coordinator project Secretary of “Emergency Risk Communication” 6 D. Saranchimeg Boarding Committee project of the Project WHO representative office in 7 R. Hagan Representative Mongolia WHO representative office in Immunization 8 J. Mendsaikhan Mongolia adviser WHO representative office in 9 J. Narantuya CSR officer Mongolia 10 Weigong Zhou WPRO, WHO CSR officer

11 Wengji Wang WPRO, WHO CSR officer

12 B. Goldbeck US embassy in Mongolia Officer

13 B. Primm US embassy in Mongolia Officer

14 K. Johnston USAID Officer

15 A. Moen Influenza branch, CDC, USA Head

16 N. Tomokhiro Japanese embassy in Mongolia Consultant

17 N. Sergelen Japanese embassy in Mongolia Officer in charge

18 Y. Mazumder UNICEF office in Mongolia Coordinator

19 B. Dismoulins UNICEF office in Mongolia Representative

20 Ts. Undarmaa UNICEF office in Mongolia Project staff

161 B5265G1 Annual Report – 2007/2008

State Emergency Management 21 T. Ganbold Deputy chief Agency State Emergency Management 22 D. Oyuntsesteg Officer Agency State Emergency Management 23 Delgermaa Officer Agency Capital Emergency Management 24 S. Tsogtbaatar Head Dept Bayangol district Emergency 25 Ch. Nergui Chief Management Dept Bayanzurkh district Emergency 26 A. Batmunkh Chief Management Dept Khan-Uul district Emergency 27 Ch. Tumurkhuyag Chief Management Dept Chingeltei district Emergency 28 A. Damtsagdorj Chief Management Dept Songinokhairkhan district 29 A. Dugardorj Chief Emergency Management Dept Baganuur district Emergency 30 S. Tsendsuren Chief Management Dept Yo. Sukhbaatar district Emergency 31 Chief Amarbayasgalan Management Dept Bagakhangai district Emergency 32 N. Dashpuntsag Chief Management Dept Naliakh district Emergency 33 Kh. Damdin Chief Management Dept 34 Ts. Purevkhuu Ministry of Food and Agriculture Officer in charge State Central Veterinary and 35 R. Sodnomdarjaa Head Sanitary Lab State Central Veterinary and 36 S. Sugar Laboratory doctor Sanitary Lab 37 M. Macklean FAO Consultant Inspection Division of Hygeine and 38 A. Buzmaa Senior inspector Epidemiology, SPSA 39 Tumurbaatar Boarder control Dept, SPSA Officer 40 D. Oyunchimeg Health Dept, SPSA Officer 41 Byambaa University of Agriculture, Mongolia Director Health Science University, 42 Ts. Lkhagvasuren Director Mongolia

162 Cooperative Agreement Implementation

Health Science University, 43 Ya. Dagvadorj Lecturer Mongolia Health Science University, 44 G. Zulkhuu Lecturer Mongolia Health Science University, 45 O. Baatarkhuu Lecturer Mongolia Divison of Epidemiology, Capital 46 Ch. Urjee Chief Professional Specialized Dept Bacteriology Laboratory, Veterinary 47 J. Bekh-Ochir Head Institute 48 Erdenebayar Eagle TV Correspondent 49 E. Enkhmaa Today newspaper Correspondent 50 U. Zolbayar TM TV Correspondent 51 Gantsetseg “Zuuny medee” newspaper Correspondent 52 Ts. Oyunchimeg NCCD Director General First Deputy 53 Ts. Enkhbayar NCCD Director in charge of surveillance Deputy Director in 54 N. Khorolsuren NCCD charge of medical care and service 55 D. Abmed United Lab, NCCD Head 56 N. Batdelger Outpatient clinic, NCCD Head “Development of Influenza 57 P. Nymadawa Project coordinator Surveillance Network” project “Development of Influenza 58 L. Enkhbaatar Outreach superviser Surveillance Network” project “Development of Influenza Temporary 9 N. Dondog Surveillance Network” project consultant Infectious Disease Surveillance 60 A. Burmaa Head Division, NCCD Respiratory team, Infectious 61 B. Enkhtuya Disease Surveillance Division, Chief NCCD 62 B. Darmaa Respiratory virus lab, NCCD Chief

63 R. Tuul Respiratory virus lab, NCCD Doctor

64 S. Tsatsral Respiratory virus lab, NCCD Virologist

65 D. Enkhsaikhan Respiratory virus lab, NCCD Biologist

163 B5265G1 Annual Report – 2007/2008

66 M. Saranchimeg Respiratory virus lab, NCCD Lab staff Information Technology Division, 67 L. Dashtseren Head NCCD 68 G. Surenkhand Immunization Division, NCCD Head

69 D. Sodbayar International Division, NCCD Officer in charge

70 D. Tuul Economy Division, NCCD Head National Center of Health 71 Ts. Sodnompil Director Development National Center of Health 72 L. Oyun Head Development National Center of Health Methodologist 73 V. Garmaa Development doctor 74 T. Erkhembaatar MCHRC Director General 75 G. Chimgee MCHRC, Pediatrician clinic Head MCHRC, Pediatrician outpatient 76 Bayasgalantai Head clinic 77 Altantuya Mongolian Air Trans Deputy director 78 Sh. Davaa DHL General manager 79 N. Dashdorj Mongolian National TV Correspondent 80 G. Jargal MN 25 Channel TV Correspondent 81 Khishigt Daily news newspaper Correspondent 82 Ts. Lkhagvaa Aero Mongolia General Director 83 G. Choijamts Mongolian drug impex Head 84 I. Baljinnyam Monos Pharma Delagate 85 Sonya Public Health Institute Laboratory specialist 86 Ts. Gankhuu Capital Health Dept (HD) Head 87 N. Narantsesteg Capital Health Dept (HD) Epidemiologist Bayanzurkh district Health 88 Ts. Davaakhuu Deputy Department Bayanzurkh district Health 89 O. Oyunchimeg Physician Department 90 N. Jantsan Bayanzurkh district hospital Head “Eruul urkh” FGP, Bayanzurkh 91 B. Altantuya Physician district “Amgalan itgekhui” FGP, 92 G. Oyunbileg Physician Bayanzurkh district

164 Cooperative Agreement Implementation

“Nasan urt” FGP, Bayanzurkh 93 P. Purvee Physician district Bayangol district Health 94 S. Tuul Head Department 95 S. Kuma Bayangol district hospital General Physician Bayangol district Health 96 Oyunchimeg Epidemiologist Department “Itgel ugtakh” FGP, Bayangol 97 A. Tsend-Ayush Physician district “Shar degd” FGP, Bayangol 98 J. Lkhagvasuren Physician district “Gurvan sanchir” FGP, Bayangol 99 D. Minkhjargal Head district 100 O. Byamba Sukhbaatar district hospital Head Sukhbaatar district Health 101 D. Erdenechimeg Epidemiologist Department “Enkh sunder” FGP, Sukhbaatar 102 T. Goyochimeg Physician district “Konver-2” FGP, Sukhbaatar 103 Ts. Ulambayar Physician district “Tegsh mend” FGP, Sukhbaatar 104 D. Tsetsegmaa Physician district Songonikhairkhan district Health 105 A. Erdenetuya Head Department Songonikhairkhan district Health 106 N. Narantuya Epidemiologist Department 107 S. Galsantseden Songonikhairkhan district hospital Physician “Unu achit” FGP, 108 S. Norjmaa Physician Songinokhairkhan district “Enkh Elberel” FGP, 109 Unursaikhan Physician Songinokhairkhan district “Buyant manal” FGP, 110 D. Altantsetseg Physician Songinokhairkhan district Chingeltei district Health 111 S. Tungalag Head Department Chingeltei district Health 112 O. Dashpagma Epidemiologist Department “Tegsh ulzii” FGP, Chingeltei 113 M. Purevdorj Physician district

165 B5265G1 Annual Report – 2007/2008

“Uils negten” FGP, Chingeltei 114 B. Otgonbayar Physician district “Tumenjargalan” FGP, Chingeltei 115 A. Altantsesteg Physician district Khan-Uul district Health 116 E. Buyanmandakh Head Department Khan-Uul district Health 117 I. Oyunchimeg Epidemiologist Department “Enkh titem” FGP, Khan-Uul 118 J. Gungaasuren Physician district “Manal uils” FGP, Khan-Uul 119 G. Tsolmon Physician district “Amin tus” FGP, Khan-Uul 120 D. Tuul Physician district Baganuur district Health 121 B. Soninkhuu Head Department Baganuur district Health 122 Ts. Khandtsoo Epidemiologist Department 123 I. Od “Enerelt ulzii”, Baganuur district Physician 124 L. Bayardorj Bagakhangai district hospital General physician 125 Ch. Dashdolgor Nalaikh district Health Department Head 126 B. Bayarkhuu Nalaikh district Health Department Epidemiologist 127 D. Chuluuntsetseg “Ami erdene”, Nalaikh district Physician 128 B. Selenge Central Department of Intelligence Officer 129 N. Naranbat Capital Department of Intelligence Officer 130 Munkhgerel “Health” studio Head Arkhangai Province Health 131 R. Gandiimaa Deputy Department Arkhangai Province Health 132 B. Enkh-Amgalan Epidemiologist Department Arkhangai Province Emergency 133 D. Rentsendorj Head Department Bayan-Ulgii Province Health 134 Ts. Almaguli Deputy Department Bayan-Ulgii Province Health 135 R. Bolat Epidemiologist Department Bayan-Ulgii Province Emergency 136 Umarget Head Department

166 Cooperative Agreement Implementation

Bayankhongor Province Health 137 D. Byambasuren Deputy Department Bayankhongor Province Health 138 B. Tserenkhand Epidemiologist Department Bayankhongor Province Emergency 139 T. Munkhbaatar Head Department Bulgan Province Health 140 B. Myagmar Deputy Department Bulgan Province Health 141 B. Narantuya Epidemiologist Department Bulgan Province Emergency 142 B. Uuganbayar Head Department Gobi-Altai Province Health 143 G. Ganbold Deputy Department Gobi-Altai Province Health 144 B. Baigalmaa Epidemiologist Department Gobi-Altai Province Emergency 145 Sodnomjamts Head Department Gobisumber Province Health 146 B. Tsetsegmaa Deputy Department Gobisumber Province Health 147 B. Narantsesteg Epidemiologist Department Gobisumber Province Emergency 148 Ch. Amgalantuya Head Department Darkhan-Uul Province Health 149 L. Zolboot Head Department Darkhan-Uul Province Health 150 L. Ulziijargal Epidemiologist Department Darkhan-Uul Province Health Officer in charge of 151 G. Nergui Department FGPs 152 Ts. Bayasgalan Darkhan-Uul Province Hospital General Physician Deputy in charge of 153 Sh. Lkhagvasuren Darkhan-Uul Province Hospital treatment Head of outpatient 154 D. Batmandakh Darkhan-Uul Province Hospital clinic Darkhan-Uul Province Emergency 155 L. Nyamaa Head Department Dornogobi Province Health Sh. Tamara Deputy Department Dornogobi Province Health 156 Ch. Tsetsegmaa Epidemiologist Department 167 B5265G1 Annual Report – 2007/2008

Dornogobi Province Health Officer in charge of 157 Ch. Ariungerel Department FGPs 158 Sh. Dorjpagam Dornogobi Province Hospital General physician Deputy in charge of 159 B. Byambaa Dornogobi Province Hospital treatment 160 B. Nyamgerel Dornogobi Province Hospital Physician Dornogobi Province Emergency 161 S. Jargalsaikhan Head Department Dornod Province Health 162 D. Doljin Head Department Dornod Province Health 163 D. Gereltuya Epidemiologist Department Dornod Province Health Officer in charge of 164 Yo. Oyuntsesteg Department FGPs 165 Sh. Tuya Dornod Province Hospital General Physician Deputy in charge of 166 Ts. Batsuuri Dornod Province Hospital treatment Head of outpatient 167 D. Oyunbileg Dornod Province Hospital clinic Dornod Province Emergency 168 M. Saruul Head Department Dundgobi Province Health 169 M. Bayansan Head Department Dundgobi Province Health 170 D. Tsetsgee Epidemiologist Department Dundgobi Province Emergency 171 Ch. Khureltogoo Head Department Zavkhan Province Health 172 Sh. Battur Deputy Department Zavkhan Province Emergency 173 B. Enkhbayar Head Department Zavkhan Province Health 174 J. Gerelmaa Epidemiologist Department Orkhon Province Health 175 G. Gankhuyag Deputy Department Orkhon Province Health 176 D. Jargal Epidemiologist Department Orkhon Province Health Officer in charge of 177 O. Battsengel Department FGPs 178 L. Minkh-Od Orkhon Province Hospital General physician

168 Cooperative Agreement Implementation

Deputy in charge of 179 S. Zaluukhuu Orkhon Province Hospital treatment Head of outpatient 180 B. Baigalmaa Orkhon Province Hospital clinic Orkhon Province Emergency 181 J. Doljmaa Head Department Uvurkhangai Province Health 182 B. Sayamaa Head Department Uvurkhangai Province Health 183 D. Narantsesteg Epidemiologist Department Uvurkhangai Province Health Officer in charge of 184 B. Chuluuntsesteg Department FGPs 185 S. Enkhbayar Uvurkhangai Province Hospital General physician Deputy in charge of 186 Enkhbaatar Uvurkhangai Province Hospital treatment Head of outpatient 187 Z. Tserenbat Uvurkhangai Province Hospital clinic Uvurkhangai Province Emergency 188 S. Dolgornyam Head Department Umnugobi Province Health 189 O. Jantsankhuu Deputy Department Umnugobi Province Health 190 D. Byambajav Epidemiologist Department Umnugobi Province Emergency 191 O. Sainkhuu Head Department Sukhbaatar Province Health 192 D. Bor Head Department Sukhbaatar Province Health 193 Ts. Gundegmaa Epidemiologist Department Sukhbaatar Province Emergency 194 G. Ankhbayar Head Department Selenge Province Health 195 G. Tugsjargal Deputy Department Selenge Province Health 196 J. Tserendolgor Epidemiologist Department Selenge Province Health Officer in charge of 197 D. Chuluuntsesteg Department FGPs 198 J. Od Selenge Province Hospital Head Deputy in charge of 199 G. Unurjargal Selenge Province Hospital treatment

169 B5265G1 Annual Report – 2007/2008

200 Sh. Dolgormaa Selenge Province Hospital General Physician Selenge Province Emergency 201 M. Surendondov Head Department 202 L. Altantsesteg Tuv Province Health Department Deputy 203 S. Nansalmaa Tuv Province Health Department Epidemiologist Tuv Province Emergency 204 L. Ganbat Head Department 205 D. Dorjgotov Uvs Province Health Department Deputy 206 B. Narantuya Uvs Province Health Department Epidemiologist Uvs Province Emergency 207 D. Ulziit Head Department Khovd Province Health 208 B. Jamsran Head Department Khovd Province Health 209 S. Bat-Ulzii Epidemiologist Department Khovd Province Health 210 M. Dungaamaa Officer in charge Department 211 Myagmarsuren Khovd Province Hospital General physician Deputy in charge of 212 B. Ganzorig Khovd Province Hospital treatment Head of outpatient 213 Ts. Tsagaan Khovd Province Hospital clinic Khovd Province Emergency 214 R. Lkhamkhuu Head Department Khuvsgul Province Health 215 J. Lkhagvasuren Deputy Department Khuvsgul Province Health 216 N. Uranchimeg Epidemiologist Department Khuvsgul Province Emergency 217 Yo. Purevsuren Head Department Khentii Province Health 218 N. Orkhonchimeg Deputy Department Khentii Province Health 219 Kh. Baasan dorj Epidemiologist Department Khentii Province Emergency 220 Sh. Baatartsogt Head Department

170 Cooperative Agreement Implementation

ANNEX 47

Recommendation from NIW2

We, the participants in the Second National Influenza Workshop: o expressing our satisfaction for implementation of the recommendations from the First National Infl uenza Workshop, and o calling related agencies to pay more attention to insuffi cient stocks of antivirals and protective equipments against infl uenza facing increasing challenges of the Pandemic Infl uenza threat RECOMMEND: to strengthen cooperation between Government Agencies and communities, to develop and follow up a plan to implement of “Main directives to control Infl uenza Pandemics and Avian Flu” (hereinafter referred as a Main directives) at the soum, district, province, capital city levels and the related agencies of the Government, to assign for annual budget to implement a “Main directives” starting from 2007 in a budget of central and local Government and also in the pledges for donors` support, to stockpile drugs, bio-preparations, disinfectants and other related equipments and devices needed for infection control in human and animal populations, to reserve additional human resources, drugs, bio-preparations, laboratory kits, ambulance vehicles and its fuel, food supply for patients and mobilized persons and other related supplies at soum, district, province and the capital city level during potentially pandemic infl uenza or avian fl u outbreaks, to expand vaccination of domestic birds and high risk population and to study vaccination effi ciencies, to expand IEC for prevention of human and bird infl uenza, to expand surveillance of Infl uenza virus among migratory birds during their arrival or staying period in Mongolia.

171 B5265G1 Annual Report – 2007/2008

ANNEX 48 Recommendation of STC from NIID, Japan on strengthening of virology laboratory capacity

1. Transportation of clinical specimens within the country should be improved. To make it possible for more frequent clinical sample collection and transport to NIC in NCCD/MoH in UB city, negotiation with public transport systems (parcel delivery companies, bus transport companies, air freight companies, railways, and so on) on frequent services of clinical transport. If possible, involvement of military helicopters in the national project would be helpful to transport clinical specimens and other necessary items frequently and in a timely manner, especially in winter time and in the case of emergency. 2. • Biosafety systems should be improved. Renovation of laboratory rooms in NIC/NCCD is required as soon as possible. • In virus inoculation room, the clean bench should be replaced by a BLS-2 level safety cabinet. For this, some small reconstruction of the facility and provision of a BSL-2 safety cabinet are necessary. A laboratory-level refrigerator and a low-speed centrifuge are also required to prevent possible cross-contamination of the stored specimens and reagents. • In PCR room, similarly, the clean bench should be replaced by another BLS-2 level safety cabinet. In addition, layout of the room should be improved to avoid cross-contamination of amplifi ed DNA into the original specimens. For this, some reconstruction of the room with placing partitions and air ventilation and provision of a BSL-2 safety cabinet are necessary. • A multi-channel DNA sequencer would be necessary to support the existing system in case of increased specimens and emergence of a pandemic. • National Biosafety Regulation and Institutional Biosafety Regulation, as well as relevant SOPs should be in place. Practical exercise on biosafety is recommended. • Additional BSL-3 level laboratory is necessary in NIC laboratory in NCCD, although NCCD has a BSL-3 laboratory in the clinics exclusively for multi-drug resistant TB bacteria. Maintenance of the facility, however, is challenging and this should be discussed. • PPE is constantly provided to all laboratories involved in the virus surveillance systems. 172 Cooperative Agreement Implementation

3. • Training of sequence data analysis (bioinformatics) is recommended. • Data analysis of genome sequences should be established in NIC, regarding signifi cant mutations responsible for antigenicity, receptor binding specifi city, pathogenicity, adaptation to a human-type virus, characterization of pathogenic properties, and drug resistance. Drug-resistance monitoring is especially encouraged. For this, further training and exercise of staff is encouraged. 4. • Three regional laboratories (sub-national laboratories) to be establish • In three sentinel regions where frequent transportation of clinical specimens to NCCD is extremely diffi cult, regional sub-national laboratory functions should be established with a minimum requirement of diagnostic facilities. Based on the regional laboratories, surveillance sentinel clinics would be expanded in the neighboring areas. 5. • Rapid diagnosis system using rapid kits is recommended in sentinel clinics. • Since clinical specimens are collected only once per week or two weeks due to diffi culty of transport and feedback of the results from NIC takes more than three weeks, samples collected are not always useful for the front lines of clinics. Without more frequent and rapid feedback of the diagnostic results, incentive of sentinel clinics for contribution of the surveillance system would be broken. Therefore, rapid diagnostic kits would be introduced to the sentinel clinics to monitor the trend of infl uenza outbreak in a real-time manner. The test would be done for some part, not every case, of ILI and pneumonia cases. Detailed plan should be discussed 6. • Integration of the current national infl uenza surveillance systems to the National Pandemic Preparedness Plan is encouraged. • Workshops, training courses and exercises should be organized repeatedly by inviting ministerial offi cials of Ministries of Health, Agriculture, Education, Economy, Finance and Military as well as representatives from local governments, to share common understandings of seasonal and pandemic infl uenza issues and the national surveillance program and fi nd and fi ll the gaps, all stakeholders should be get together and discuss on these issues.

173 B5265G1 Annual Report – 2007/2008

• Leadership taken by a top government administrator should be necessary to supervise this policy. The mechanism should be established. 7. • Sustainability and progression of the National Infl uenza Surveillance Project should be established. • Since the bilateral project between NCCD/MoH and CDC/DHHS, US will terminate in 2009. It is essential to fi nd solutions (fi nancial support and technical assistance) as soon as possible to sustain and develop the national infl uenza surveillance system after 2009. This issue is critical for the national infl uenza program. 8. • An immunofl uorescent microscopy set is necessary to improve accurate diagnosis and identifi cation of isolated viruses as well as clinical specimens. • Some equipment is required to be in place in NIC laboratory, NCCD. 9. • Small animal experiment facility is encouraged to be established in NCCD • To prepare rabbit antisera against representative virus isolates, which are essential to perform surveillance and detailed investigation of the viruses, facility for small animal experiments would be in place. 10. • Infl uenza surveillance system to be extend to other important infectious diseases • As the national infl uenza surveillance program is successfully in progress, the outcome of this experience and know-how would be applied to other communicable diseases (measles would be the best candidate) in the next steps. 11. • Surveillance systems of measles, rubella and mumps is encouraged to be established and strengthened • National surveillance systems for measles, rubella and mumps should be established based on FGP sentinels. Especially, implementation of national surveillance system for measles is urgently required in response to the WPRO’s goal of measles elimination by 2012. • Diagnostic and data analysis capacities of measles infection would be updated according to WHO recommendations and scientifi c progresses. • To strengthen diagnostic capacities of rubella and mumps infections are also encouraged by technical supports. 174 Cooperative Agreement Implementation

ANNEX 49

Program of the workshop on hospital-based surveillance for medical doctors, September 20, 2006

No Topic Time Responsible person

Dr. L. Enkhbaatar, outreach 1 Registration 8.00-9.00 supervisor

Dr. Ts. Enkhbayar, Deputy 2 Opening 9.00-9.10 director, NCCD National Strategy on Dr. Ts. Enkhbayar, Deputy 3 fighting against of avian and 9.10-10.10 director, NCCD pandemic influenza Current situation on Influenza and its Dr. A. Burmaa, Head of 4 10.10-11.10 surveillance network in Surveillance Dept, NCCD Mongolia

5 Tea /coffee break 11.10-11.25

Character of influenza virus, Dr. B. Darmaa, Head of Virology 6 specimen collection, storage 11.25-12.25 laboratory, NCCD and transportation Dr. L. Dashtseren, Head of Organizing of clinical 7 12.25-13.25 Information technology Dept, surveillance of the influenza NCCD

8 Lunch 13.25-14.00

Pathogenesis, clinical feature, diagnosis, Dr. N. Khorolsuren, Deputy 9 14.00-15.00 treatment, complication and director, NCCD prophylaxis Influenza immunization and Prof. P. Nymadawa, Consultant, 10 15.00-16.00 its efficiency NCCD

11 Discussion 16.00-17.00 Organizers

12 Tea / coffee break

175 B5265G1 Annual Report – 2007/2008

ANNEX 50 Participants’ list of the workshop on hospital-based surveillance for medical doctors of NCCD, September 20, 2006

No Participant’s name Ward / Department Position

1 N. Khorolsuren Administration Dept Deputy Director

2 N. Oyungerel Quality control Dept Epidemiologist

3 G. Tsogmandakh Reanimation ward Head

4 M. Uuganchimeg Reanimation ward Physician

5 N. Otgon Ambulance ward Head

6 M. Jargalsaikhan Ambulance ward Physician

7 S. Undarmaa Respiratory infection ward Head

8 O. Sumiya Respiratory infections ward Physician

9 A. Tsengelbat Brucellosis ward Head

10 S. Erdenechimeg Intestinal ward Head

11 M. Oyungerel Hepatitis ward for children Head

12 A. Sarantsesteg Viral hepatitis ward Head

13 B. Altantsesteg Viral hepatitis ward Physician

14 M. Ariunaa Viral hepatitis ward Physician

15 D. Chimednorov New- and re-emerging infections ward Head

16 O. Enkhjargal New- and re-emerging infections ward Physician

17 O. Baatarkhuu Health Science University Lecturer

18 D. Doljinsuren Multi-drug resistant TB ward Head

19 D. Chuluuntsesteg Pulmonology ward #1 Head

20 D. Namkhai Pulmonology ward #2 Head

21 Ts. Jambaldorj Pulmonology ward #3 Head

22 R. Bolor Pulmonology ward #3 Physician

23 D. Nyamkhishig Pulmonology ward #4 Head

176 Cooperative Agreement Implementation

24 D. Batdelger Outpatient clinic Head

25 D. Gantsesteg Outpatient clinic Physician

26 B. Saruul Outpatient clinic Physician

27 Dolgorsuren Outpatient clinic Physician

28 Kh. Tsedevsuren Outpatient clinic Physician

29 Byambasuren Outpatient clinic Physician

30 Kh. Erdenechimeg Outpatient clinic Senior nurse

31 L. Purevsuren Admission ward Physician

32 L. Oyuntsesteg Statistical Dept Head

33 Ch. Oyunchimeg Nursing Dept Head

34 J. Tumendalai TB surgery ward Head

35 E. Sukhee TB surgery ward Physician

35 R. Batbayar TB surgery ward Physician

36 I. Orkhon Admission Dept Secretary

177 B5265G1 Annual Report – 2007/2008

ANNEX 51 Participants’ list of the workshop on hospital-based surveillance for medical doctors of hospital districts and MCHRC, September 22, 2006

Participant’s No Organization Position name

Deputy in charge of 1 G. Chimgee MCHRC treatment

2 B. Otgonchimeg MCHRC Epidemiologist

3 Ts. Gantuya MCHRC Statistician

4 D. Turmunkh Pulmonology ward, MCHRC Head

5 M. Baljinnyam Reanimation ward, MCHRC Head

Newborn infants ward, 6 Ch. Altantuya Head MCHRC

7 D. Oyunbaatar Ambulance ward, MCHRC Head

8 B. Bayasgalantai Outpatinet clinic, MCHRC Head

9 Sh. Altantsesteg Respiratory ward, MCHRC Physician

Deputy in charge of 10 S. Tsevelmaa Khan-Uul district hospital treatment

11 J. Myagmar Khan-Uul district hospital Epidemiologist

12 G. Otgon Khan-Uul district hospital Statistician

13 J. Sarantsesteg Khan-Uul district hospital Head of pediatrician ward

Deputy in charge of 14 N. Jantsan Bayanzurkh district hospital treatment

15 J. Khishigt Bayanzurkh district hospital Epidemiologist

16 T. Tsevelmaa Bayanzurkh district hospital Statistician

17 Yo. Altantsesteg Bayanzurkh district hospital Head of pediatrician ward

18 Ya. Nergui Bayanzurkh district hospital Head of reanimation ward

Songinokhairkhan district Deputy in charge of 19 O. Enkhtuya hospital treatment

Songinokhairkhan district 20 A. Delgerbayar Epidemiologist hospital

178 Cooperative Agreement Implementation

Songinokhairkhan district 21 L. Enkhee Statistician hospital

Songinokhairkhan district 22 B. Majigsuren Head of pediatrician ward hospital

Songinokhairkhan district 23 S. Tuvshinjargal Head of internal ward hospital

Deputy in charge of 24 S. Kuma Bayangol district hospital treatment

25 O. Oyunchimeg Bayangol district hospital Epidemiologist

26 B. Irina Bayangol district hospital Statistician

27 B. Shinekhuu Bayangol district hospital Head of internal ward

Deputy in charge of 28 T. Buyanjargal Sukhbaatar district hospital treatment

29 N. Narantungalag Sukhbaatar district hospital Epidemiologist

30 B. Odgerel Sukhbaatar district hospital Statistician

31 G. Oyunchimeg Sukhbaatar district hospital Head of pediatrician ward

Ts. 32 Sukhbaatar district hospital Head of internal ward Tuvshinchimeg

Deputy in charge of 33 B. Gunsmaa Chingeltei district hospital treatment

34 Z. Tsestegmaa Chingeltei district hospital Epidemiologist

35 O. Dashpagma Chingeltei district hospital Statistician

36 N. Tsolmon Chingeltei district hospital Head of reanimation ward

37 D. Khandaasuren Chingeltei district hospital Head of internal ward

38 B. Oyunchimeg Capital Health department Officer in charge

39 I. Orkhon Administration Dept, NCCD Secretary

Finance and Economy Dept, 40 D. Tuul Head NCCD

179 B5265G1 Annual Report – 2007/2008

ANNEX 52 Participants’ list of the on-the-job training for laboratory technicians, November 01, 2006 - February 01, 2007

No Trainer’s name Organization

1 Ch. Lkhagvaa NCCD 2 B. Badamkhand NCCD 3 B. Lkhagvasukh NCCD 4 Sh. Oyuntsesteg CIDNF 5 T. Bolortsesteg NCCD 6 N. Nergui Public Health Institute 7 D. Batmunkh Public Health Institute 8 N. Naranbold NCCD 9 J. Soyolmunkh NCCD 10 G. Enkhtuya NCCD

ANNEX 53 Participants’ list of the on-the-job training for virologists, November 01, 2006 – May 01, 2007

No Trainer’s name Organization

1 Sh. Myagmarsuren NCCD 2 S. Tsatsral NCCD 3 Kh. Tungalag CIDNF 4 U. Unursaikhan CIDNF 5 A. Ariunaa Public Health Institute 6 G. Sarangoo NCCD 7 B. Darmaa NCCD 8 Ts. Naranzul NCCD 9 J. Ulaan NCCD

180 Cooperative Agreement Implementation

ANNEX 54 Program of the training on “ICRT procedures for Adenovirus, RSV and Influenza A, B virus antigen detection” January 19, 2007

No Topic Time Responsible person

Specimen collection, storage Dr. B. Darmaa, MD, 1 and transportation for virological 9.00-10.00 MSc(Med) investigation

Influenza A and B virus antigen Dr. B. Darmaa, MD, 2 detection procedure by using rapid 10.00-11.00 MSc(Med) tests

RS and Adenovirus antigen detection 2 11.00-12.00 Ms. S. Tsatsral procedure by using rapid tests

ANNEX 55 Participants’ list of the training on “ICRT procedures for Adenovirus, RSV and Influenza A, B virus antigen detection” January 19, 2007

No Participant’s name FGP`s name Position

1 G. Zulkhuu Health Science University Lecturer

2 O. Baatarkhuu Health Science University Lecturer

3 A. Burmaa NCCD Epidemiologist

4 L. Enkhbaatar NCCD Outreach manager

5 D. Oyun Sankoll, Sukhbaatar district Nurse

6 L. Shagdarsuren Tegsh ulzii, Chingeltei district Nurse

7 D. Erdenetuya Manal uils, Khan Uul district Nurse

Buyant manal, Songinokhairkhan 8 A. Munkhtsesteg Nurse district

Enkh elberel, Songinokhairkhan 9 B. Tseveen piljee Nurse district

181 B5265G1 Annual Report – 2007/2008

ANNEX 56 Program of the workshop on 4th quarter activities in 2006 for sentinel surveillance sites in the capital city, January and February 2007

Responsible No Topic Time person

1 Registration 8.30-9.00 L. Enkhbaatar

2 Opening 9.00-9.10 P. Nymadawa

Activity of the outpatient clinic-based 3 sentinel surveillance sites and its 9.10-10.10 L. Enkhbaatar development Result of virology investigation and 4 specimen collection procedure in 4th 10.10-11.00 B. Darmaa quarter of 2006

5 Tea / coffee break 11.10-11.30 L. Enkhbaatar

Confirmation of information database of 6 11.30-13.00 L. Enkhbaatar sentinel sites

7 Lunch 13.00-14.00 L. Enkhbaatar

8 Discussion 14.00-16.00 P. Nymadawa

9 Tea / coffee break 16.00-16.30 L. Enkhbaatar

Assessment of 4th quarter activities and 10 16.30-17.30 D. Enkhsaikhan allowance of remuneration to the sites

11 Closing 17.30-18.00 P. Nymadawa

182 Cooperative Agreement Implementation

ANNEX 57 Participants’ list of the workshop on fourth quarter activities in 2006 for FGP - based sentinel surveillance sites in the capital city, January 22, 2007

No Participant’s name FGP`s name Position 1 Sh. Altankhuyag Eruul urkh Head 2 Oyuntuya Eruul urkh Physician 3 Oyuntsesteg Eruul urkh Physician 4 B. Altantuya Eruul urkh Physician 5 Mungunzagas Eruul urkh Nurse 6 Ts. Tonya Amgalan itgekhui Head 7 Ch. Togooch Amgalan itgekhui Physician 8 Bayarmaa Amgalan itgekhui Physician 9 Narantsesteg Amgalan itgekhui Nurse 10 Bolormaa Amgalan itgekhui Nurse 11 Tersaikhan Nasan urt Physician 12 Tserenbaljid Nasan urt Physician 13 Naranduuren Nasan urt Nurse 14 Tsetsegmaa Nasan urt Nurse 15 Oyunsuren Nasan urt Nurse 16 D. Narantsesteg Enkh titem Head 17 J. Gungaasuren Enkh titem Physician 18 D. Sergelen Enkh titem Physician 19 T. Munkhtsesteg Enkh titem Nurse 20 L. Oyuntuya Enkh titem Nurse 21 D. Tuul Amin tus Head 22 Ts. Altantsesteg Amin tus Physician 23 Enkhjargal Amin tus Nurse 24 E. Amgalansuren Amin tus Nurse 25 G. Altantsesteg Amin tus Nurse 26 S. Sarantuya Manal uils Head 27 B. Otgonkhuu Manal uils Physician

183 B5265G1 Annual Report – 2007/2008

28 D. Mendjargal Manal uils Nurse 29 L. Oyuntsesteg Manal uils Nurse 30 G. Ganchimeg Shijid dug Head 31 Khishigt Shijid dug Physician 32 Ganjargal Shijid dug Nurse 33 Ganchimeg Shijid dug Nurse 34 M. Purevdorj Tegsh ulzii Head 35 D. Tsestegsaikhan Tegsh ulzii Physician 36 A. Oyungerel Tegsh ulzii Physician 37 Ts. Nyamaa Tegsh ulzii Physician 38 Erdenesuren Tegsh ulzii Nurse 39 B. Otgonbayar Uils negten Head 40 R. Nyamsuren Uils negten Physician 41 Dorjkhand Uils negten Physician 42 Khandsuren Uils negten Nurse 43 Baigalmaa Uils negten Nurse 44 J. Lkhagbasuren Shar degd Head 45 O. Gantumur Shar degd Physician 46 N. Oyuntsesteg Shar degd Physician 47 G. Lkhagvasuren Shar degd Physician 48 Munkhjargal Shar degd Nurse 49 A. Tsend-Ayush Itgel ugtakh Head 50 Ch. Budjav Itgel ugtakh Physician 51 N. Otgonbayar Itgel ugtakh Physician 52 Gantulga Itgel ugtakh Nurse 53 Purev Itgel ugtakh Nurse 54 D. Munkhjargal Gurvansanchir Physician 55 D. Nergui Gurvansanchir Physician 56 Bayarsaikhan Gurvansanchir Physician 57 Sainbayar Gurvansanchir Physician 58 Oyungerel Gurvansanchir Nurse 59 S. Norjmaa Unu achit Head

184 Cooperative Agreement Implementation

60 I. Sugarsuren Unu achit Physician 61 Suvdaa Unu achit Physician 62 L. Jurnai Unu achit Physician 63 Otgonbayar Unu achit Nurse 64 Ch. Unursaikhan Enkh elberel Head 65 S. Bolormaa Enkh elberel Physician 66 D. Altantsesteg Buyant manal Head 67 A. Tugssaikhan Buyant manal Physician 68 O. Udvaltsesteg Buyant manal Physician 69 Ya. Bolor Buyant manal Physician 70 Enkhtsesteg Buyant manal Nurse 71 T. Goyochimeg Enkhsunder Head 72 D. Palam Enkhsunder Physician 73 Ts. Munkhtsesteg Enkhsunder Physician 74 S. Ochirsaikhan Enkhsunder Nurse 75 G. Tserendolgor Enkhsunder Nurse 76 S. Selenge Sankoll Head 77 D. Ganchimeg Sankoll Physician 78 D. Oyun Sankoll Nurse 79 Oyunsuren Sankoll Nurse 80 B. Tserenpil Sankoll Nurse 81 D. Tsestegmaa Tegsh mend Head 82 S. Enkhjargal Tegsh mend Physician 83 S. Enkhmaa Tegsh mend Physician 84 G. Davgadulam Tegsh mend Nurse 85 Ts. Chuluuntsesteg Ami erdene Head 86 Norjmaa Ami erdene Nurse 87 S. Tsestegmaa Ami erdene Nurse 88 Ts. Enkhtuya Ami erdene Nurse 89 I. Od Enerelt ulzii Head 90 Narantuya Enerelt ulzii Physician 91 Oyunsuren Enerelt ulzii Nurse 92 Badamtsesteg Enerelt ulzii Nurse 185 B5265G1 Annual Report – 2007/2008

ANNEX 58 Participants’ list of the workshop on 4th quarter activities in 2006 for hospital-based sentinel surveillance sites in the capital city, February 06, 2007

No Participant’s name Organization Position

1 N. Jantsan Bayanzurkh district hospital Head 2 P. Erdenetsesteg Bayanzurkh district hospital Quality manager Head, internal medicine 3 Ya. Nergui Bayanzurkh district hospital ward 4 Ts. Songinosuren Bayanzurkh district hospital Assistant statistician 5 J. Khishigt Bayanzurkh district hospital Epidemiologist Deputy in charge of 6 T. Buyanjargal Sukhbaatar district hospital treatment 7 E. Narantungalag Sukhbaatar district hospital Epidemiologist 8 B. Odgerel Sukhbaatar district hospital Nurse 9 N. Khajidsuren Sukhbaatar district hospital Head, Admission ward

Physician, 10 Kh. Purevsuren Sukhbaatar district hospital Otorhinolaryngologist

11 G. Tserendolgor Khan-Uul district hospital Quality manager

Senior physician of pediatric 12 D. Surenjav Khan-Uul district hospital ward 13 G. Otgon Khan-Uul district hospital Assistant statistician 14 S. Nyamdawaa Khan-Uul district hospital Admission ward, nurse NCCD, Chronic hepatitis 15 G. Tsestegmaa Head ward NCCD, Zoonosis and 16 A. Tsengelbat Head brucellosis ward NCCD, New- and re- 17 N. Otgon Head emerging infections ward 18 G. Tungalag NCCD Senior nurse NCCD, Acute hepatitis 19 B. Altantsesteg Head ward for adults 20 D. Delgermaa NCCD Physician 21 M. Naljirmaa NCCD Senior nurse

186 Cooperative Agreement Implementation

NCCD, Tuberculosis ward 22 P. Nyamkhishig Head for children 23 D. Otgonlkhagva NCCD Senior nurse 24 A. Sarantsesteg NCCD, 6th ward Head 25 D. Batdelger NCCD, outpatient clinic Head 26 D. Amartuvshin NCCD, TB clinic Senior nurse NCCD, Respiratory 27 S. Undarmaa Head infection ward 28 N. Oyungerel NCCD Epidemiologist 29 L. Dolgorsuren NCCD, outpatient clinic Physician NCCD, Acute hepatitis 30 D. Surenkhorloo Head ward for child 31 B. Enkhbayar NCCD Senior nurse 32 J. Densmaa NCCD Senior nurse 33 Sh. Narantuya NCCD Senior nurse 34 D. Bolortuya NCCD Nurse 35 G. Odgerel NCCD Senior nurse 36 J. Munkhjargal NCCD Senior nurse 37 S. Oyungerel NCCD Epidemiologist 38 Z. Tserennadmid NCCD Senior nurse 39 B. Davaasuren NCCD Senior nurse 40 D. Urantsesteg NCCD Physician 41 M. Uuganchimeg NCCD, Reanimation ward Head 42 J. Tumendalai NCCD, TB clinic Consultant 43 Ts. Jambaldorj NCCD, TB clinic Head Deputy in charge of 44 M. Oyungerel NCCD treatment 45 D. Tuul NCCD Accountant 46 S. Erdenechimeg NCCD, Intestinal ward Head 47 E. Tuya NCCD Quality manager 48 E. Sukh NCCD, TB surgey Head 49 D. Batbayar NCCD, TB surgey Physician Ts. 50 NCCD, TB surgey Physician Rentsenmyagmar

187 B5265G1 Annual Report – 2007/2008

51 D. Namkhai NCCD, TB clinic Head 52 L. Oyuntsesteg NCCD Statistician Deputy in charge of 53 S. Kuma Bayangol district hospital treatment 54 A. Oyuntsesteg Bayangol district hospital Epidemiologist 55 L. Narantuya Bayangol district hospital Assistant statistician Head, internal medicine 56 B. Shinekhuu Bayangol district hospital ward 57 D. Batzaya Bayangol district hospital Assistant doctor Deputy in charge of 58 M. Enkhtuya Chingeltei district hospital treatment 59 Ch. Battsesteg Chingeltei district hospital Epidemiologist 60 J. Bolortuya Chingeltei district hospital Physician, admission ward Head, Internal medicine 61 G. Narantsesteg Chingeltei district hospital ward Songinokhairkhan district Deputy in charge of 62 O. Enkhtuya hospital treatment Songinokhairkhan district 63 A. Delgerbayar Epidemiologist hospital Songinokhairkhan district 64 L. Enkhee Clinical statistician hospital Songinokhairkhan district 65 O. Chuluuntsesteg Nurse, Pediatric ward hospital Physician, inernal medicine 66 Ts. Altantuya MCHRC ward 67 B. Bayasgalantai MCHRC Head, Pediatric clinic 68 Sh. Altantsesteg MCHRC Physician, Pediatric clinic Physician, Reanimation 69 D. Turmunkh MCHRC ward 70 D. Oyunbaatar MCHRC Head, admission ward 71 G. Chimgee MCHRC Director in charge of clinic 72 Kh. Naranchimeg MCHRC Statistician 73 T. Gantuya MCHRC Head, Informatic Dept 74 B. Altanchimeg MCHRC Physician

188 Cooperative Agreement Implementation

ANNEX 59 Program of the meeting with pathologists, June 29, 2007

Responsible No Topic Time person 1 Registration 08.30-09.00 L. Enkhbaatar 2 Opening 09.00-09.15 P. Nymadawa Influenza virus: structure and antigenic 3 09.15-10.00 B. Darmaa evoluation 4 Pathogenesis of influenza 10.00-10.45 P. Nymadawa 5 Tea / coffee break 10.45-11.15 S. Tsatsral 6 Clinical feature of influenza 11.15-12.00 N. Khorolsuren Pneumonia caused by influenza: 7 12.00-12.45 E. Bayarmaa pathological diagnose 8 Lunch 12.45-14.00 - 9 Prroject introduction 14.00-14.45 L. Enkhbaatar Influenza epidemiology in Mongolia: 10 14.45-15.30 A. Burmaa 2004-2007 11 Tea / coffee break 15.30-16.00 S. Tsatsral 12 Discussion 16.00-17.00 P. Nymadawa

189 B5265G1 Annual Report – 2007/2008

ANNEX 60 Participants’ list of the meeting with pathologists from the Center of Pathology, MoH June 29, 2007

Participant’s No Organization Position name

1 Ch. Batsaikhan Center of Pathology Head 2 B. Oyun-Erdene Center of Pathology Manager 3 E. Undarmaa Center of Pathology Pathologist 4 B. Bolortuya Center of Pathology Pathologist 5 Ts. Batbold Center of Pathology Pathologist 6 B. Uranchimeg MCHRC Head of the ward 7 B. Nina MCHRC Pathologist 8 Ch. Enkhtuul MCHRC Pathologist 9 Uzlii-Orshikh MCHRC Pathologist 10 Pagamdulam MCHRC Pathologist 11 B. Suvd State Clinical Hospital #3 Head of the ward 12 Enkhchuluun State Clinical Hospital #3 Pathologist 13 Kh. Gerel National Oncology Center Head of the ward 14 L. Choijookhuu National Oncology Center Pathologist 15 L. Galtsog State Clinical Hospital #2 Pathologist 16 Batjil Military hospital Head of the ward 17 Tserendolgor Railway hospital Pathologist 18 E. Bayarmaa Health Science University Lecturer 19 D. Enkhsaikhan NCCD Project manager “Development of Influenza 20 L. Enkhbaatar Outreach supervisor surveillance network” project, NCCD 21 B. Darmaa Virology laboratory, NCCD Head 22 N. Khorolsuren Health Science University Lecturer 23 A. Burmaa Infectious Diseases Surveillance Dept Head 24 B. Enkhtuya Infectious Diseases Surveillance Dept Epidemiologist 25 L. Dashtseren Infectious Diseases Surveillance Dept Epidemiologist 26 R. Tuul Virology laboratory, NCCD Virologist 27 O. Baatarkhuu Health Science University Lecturer 28 G. Zulkhuu Health Science University Lecturer 29 S. Tsatsral Virology laboratory, NCCD Virologist

190 Cooperative Agreement Implementation

ANNEX 61 Program of the workshop on first quarter activities in 2007 for sentinel surveillance sites in the capital city, 02 July 2007

Responsible No Topic Time person

1 Registration 8.30-9.00 L. Enkhbaatar

2 Opening 9.00-9.10 P. Nymadawa

Brief report of the activities of outpatient 3 clinic-based sentinel surveillance sites and 9.10-10.10 L. Enkhbaatar their database Result of virology investigation and 4 specimen collection procedure in 1st quarter 10.10-11.10 B. Darmaa of 2007

5 Tea / coffee break 11.10-11.30 L. Enkhbaatar

6 Discussion 11.30-12.30 L. Enkhbaatar

7 Lunch 12.30-13.30 L. Enkhbaatar

Assessment of 1st quarter activities of 2007 8 13.30-14.30 P. Nymadawa and allowance of remuneration to the sites

10 Discussion 14.30-16.30 D. Enkhsaikhan

11 Tea / coffee break 16.30-16.40 L. Enkhbaatar

12 Closing 16.40-16.50 P. Nymadawa

191 B5265G1 Annual Report – 2007/2008

ANNEX 62 Participants’ list of the workshop on first quarter activities in 2007 for sentinel surveillance sites in the capital city, 02 July 2007

No Participant’s name FGP`s name Position 1 Sh. Altankhuyag Eruul urkh Head 2 E. Baigalmaa Eruul urkh Physician 3 J. Narantsesteg Eruul urkh Physician 4 B. Altantuya Eruul urkh Physician 5 Batsaikhan Eruul urkh Nurse 6 Ts. Tonya Amgalan itgekhui Head 7 S. Bayarmaa Amgalan itgekhui Physician 8 Ulziisaikhan Amgalan itgekhui Physician 9 Narantsesteg Amgalan itgekhui Nurse 10 Bolormaa Amgalan itgekhui Nurse 11 Ch. Tserennadmid Nasan urt Head 12 Tersaikhan Nasan urt Physician 13 Sarantuya Nasan urt Physician 14 Kh. Oyunbileg Nasan urt Nurse 15 L. Tserenbaljid Nasan urt Nurse 16 D. Narantsesteg Enkh titem Head 17 J. Gungaasuren Enkh titem Physician 18 D. Sergelen Enkh titem Physician 19 T. Munkhtsesteg Enkh titem Nurse 20 L. Oyuntuya Enkh titem Nurse 21 D. Tuul Amin tus Head 22 Ts. Altantsesteg Amin tus Physician 23 D. Erdenechimeg Amin tus Physician 24 E. Amgalansuren Amin tus Nurse 25 G. Altantsesteg Amin tus Nurse 26 S. Sarantuya Manal uils Head 27 Enkhtuya Manal uils Physician

192 Cooperative Agreement Implementation

28 D. Mendjargal Manal uils Nurse 29 L. Oyuntsesteg Manal uils Nurse 30 D. Erdenetiya Manal uils Nurse 31 G. Ganchimeg Shijid dug Head 32 J. Altantuul Shijid dug Physician 33 Byambasuren Shijid dug Nurse 34 Ganchimeg Shijid dug Nurse 35 Uranchimeg Shijid dug Nurse 36 M. Purevdorj Tegsh ulzii Head 37 D. Tsestegsaikhan Tegsh ulzii Physician 38 A. Oyungereldari Tegsh ulzii Physician 39 Ts. Nyamaa Tegsh ulzii Physician 40 Shagdarsuren Tegsh ulzii Nurse 41 B. Otgonbayar Uils negten Head 42 R. Nyamsuren Uils negten Physician 43 S. Sarannyam Uils negten Physician 44 Ts. Dorjkhand Uils negten Nurse 45 D. Baigalmaa Uils negten Nurse 46 J. Lkhagbasuren Shar degd Head 47 O. Gantumur Shar degd Physician 48 Maam Shar degd Physician 49 G. Lkhagvasuren Shar degd Physician 50 Munkhjargal Shar degd Physician 51 A. Tsend-Ayush Itgel ugtakh Head 52 Ch. Budjav Itgel ugtakh Physician 53 N. Otgonbayar Itgel ugtakh Physician 54 Gantuya Itgel ugtakh Nurse 55 Erdenechimeg Itgel ugtakh Nurse 56 Khishigsuren Gurvansanchir Physician 57 Tsogtbayar Gurvansanchir Physician 58 Bayarsaikhan Gurvansanchir Physician 59 Sainbayar Gurvansanchir Physician

193 B5265G1 Annual Report – 2007/2008

60 Oyungerel Gurvansanchir Nurse 61 S. Norjmaa Unu achit Head 62 I. Sugarsuren Unu achit Physician 63 U. Tsengel Unu achit Physician 64 L. Jurnai Unu achit Physician 65 Suvdaa Unu achit Nurse 66 Ch. Unursaikhan Enkh elberel Head 67 S. Bolormaa Enkh elberel Physician 68 T. Byambasuren Enkh elberel Physician 69 G. Tseveenpiljee Enkh elberel Nurse 70 J. Adiyasuren Enkh elberel Nurse 71 D. Altantsesteg Buyant manal Head 72 A. Tugssain Buyant manal Physician 73 O. Udvaltsesteg Buyant manal Physician 74 Ya. Bolor Buyant manal Physician 75 Saranchimeg Buyant manal Physician 76 T. Goyochimeg Enkhsunder Head 77 D. Palam Enkhsunder Physician 78 Ts. Munkhchimeg Enkhsunder Physician 79 S. Ochirsaikhan Enkhsunder Nurse 80 G. Tserendolgor Enkhsunder Nurse 81 S. Selenge Sankoll Head 82 D. Ganchimeg Sankoll Physician 83 D. Oyun Sankoll Nurse 84 T. Oyungerel Sankoll Nurse 85 B. Tserenpil Sankoll Nurse 86 D. Tsestegmaa Tegsh mend Head 87 S. Enkhjargal Tegsh mend Physician 88 S. Enkhmaa Tegsh mend Physician 89 Tungalar Tegsh mend Physician 90 G. Davgadulam Tegsh mend Nurse 91 Sh. Baasaikhuu Ami erdene Head

194 Cooperative Agreement Implementation

92 Ts. Chuluuntsesteg Ami erdene Physician 93 S. Tsestegmaa Ami erdene Physician 94 Ts. Enkhtuya Ami erdene Physician 95 Norjmaa Ami erdene Nurse 96 I. Od Enerelt ulzii Head 97 E. Uugantsesteg Enerelt ulzii Physician 98 R. Ganchimeg Enerelt ulzii Nurse 99 Ts. Bat-Erdene Enerelt ulzii Nurse 100 G. Chimgee MCHRC Deputy dorector 101 B. Otgonchimeg MCHRC Epidemiologist Newborn infants ward, 102 Ch. Altantuya Head MCHRC 103 B. Bayasgalantai Outpatients clinic, MCHRC Head Respiratory diseases ward, 104 Sh. Altantsesteg Head MCHRC 105 D. Turmunkh Pulmonology ward, MCHRC Head 106 D. Oyunbaatar Emergency ward, MCHRC Head 107 Kh. Naranchimeg Statistical dept, MCHRC Statistician 108 T. Gantuya Statistical dept, MCHRC Statistician 109 M. Baljinnyam Reanimation ward, MCHRC Head Deputy in charge of 110 S. Tsevelmaa Khan-Uul district hospital treatment Manager in charge of 111 G. Tserendolgor Khan-Uul district hospital quality 112 G. Otgon Khan-Uul district hospital Statistician Head of children 113 D. Surenjav Khan-Uul district hospital ward Nurse of admission 114 S. Nyamdavaa Khan-Uul district hospital ward Deputy in charge of 115 N. Jantsan Bayanzurkh district hospital treatment 116 L. Radnaatseren Bayanzurkh district hospital Epidemiologist 117 T. Tsevelmaa Bayanzurkh district hospital Statistician Head of children 118 P. Erdenetsesteg Bayanzurkh district hospital ward

195 B5265G1 Annual Report – 2007/2008

Head of reanimation 119 U. Tuul Bayanzurkh district hospital ward Songinokhairkhan district Deputy in charge of 120 O. Enkhtuya hospital treatment Songinokhairkhan district 121 A. Delgerbayar Epidemiologist hospital Songinokhairkhan district 122 L. Enkhee Statistician hospital Songinokhairkhan district Head of children 123 B. Majigsuren hospital ward Songinokhairkhan district Head of internal 124 S. Tuvshinjargal hospital medicine ward Head of internal 125 B. Shinekhuu Bayangol district hospital medicine ward 126 D. Batzaya Bayangol district hospital Nurse 127 N. Enkhjargal Bayangol district hospital Nurse 128 Munkhbaldan Bayangol district hospital Physician 129 L. Narantuya Bayangol district hospital Assistant statistician Deputy in charge of 130 Chimegee Sukhbaatar district hospital treatment 131 N. Narantungalag Sukhbaatar district hospital Epidemiologist 132 B. Odgerel Sukhbaatar district hospital Statistician Head of children 133 G. Oyunchimeg Sukhbaatar district hospital ward Head of internal 134 Ts. Tuvshinchimeg Sukhbaatar district hospital medicine ward Deputy in charge of 135 N. Enkhtuya Chingeltei district hospital treatment 136 Bold Chingeltei district hospital Epidemiologist 137 Z. Tsetsegmaa Chingeltei district hospital Statistician 138 D. Khandsuren Chingeltei district hospital Physician 139 J. Bolortuya Chingeltei district hospital Physician Deputy director in 140 M. Oyungerel NCCD charge of medical care and service 141 N. Khorolsuren NCCD Consultant 142 O. Baatarkhuu NCCD Consultant

196 Cooperative Agreement Implementation

143 G. Zulkhuu NCCD Consultant 144 L. Oyuntsesteg NCCD Physician 145 E. Tuya NCCD Quality manager 146 Ts. Narantsesteg NCCD Statistician 147 O. Marya NCCD Assistant statistician 148 S. Oyungerel NCCD Epidemiologist 149 Ts. Bold-Erdene NCCD Assistant doctor 150 L. Dolgorsuren NCCD Physician 151 Ayush NCCD Assistant doctor 152 R. Bolor NCCD Physician 153 Sh. Naljirmaa NCCD Assistant doctor 154 Punsalmaa NCCD Assistant doctor 155 Enkhbayar NCCD Assistant doctor 156 Sarantsesteg NCCD Assistant doctor 157 Odgerel NCCD Assistant doctor 158 Munkhjargal NCCD Assistant doctor 159 Tserennadmid NCCD Assistant doctor 160 Tungalag NCCD Assistant doctor 161 Narantuya NCCD Assistant doctor 162 Densmaa NCCD Assistant doctor 163 Erdenebileg NCCD Physician 164 Amartuvshin NCCD Assistant doctor 165 D. Otgonlkhagva NCCD Assistant doctor 166 D. Batdelger NCCD Physician 167 A. Sarantsesteg NCCD Physician 168 B. Altantsesteg NCCD Physician 169 D. Surenkhorloo NCCD Physician 170 M. Uuganchimeg NCCD Physician 171 Delgermaa NCCD Physician 172 G. Tsestegmaa NCCD Physician 173 S. Ariunaa NCCD Physician 174 Badamkhand NCCD Physician

197 B5265G1 Annual Report – 2007/2008

ANNEX 63 Equipment and devices supplied to IST Epidemiology and Management group in 2006/2007 season

No Descriptio n Quantity Total price

1 Canon LBP 2900 printer 2 387.5

2 2 Recharge of printer toners 13 142.8

3. Flash disk 7 247.9

4 Personal computer 2 1 497.6

5 Desk 4 480

6 Printer toners 15 892

7 Stationary cost 367.2

8 Calculator 3 19.2

9 Notebook computer 2 3 263.8

10 Computer service 3 113.4

11 UPS APC 3000 VA 1 1 175.9

12 BNT-600A /P/ UPS 1 65.6

13 Gazz-GUH 2.OL /air purifier/ 2 59.7

14 Oil heater 2 99.2

TOTA L 8 811.8

198 Cooperative Agreement Implementation

ANNEX 64 Laboratory and office equipment received in VL/NCCD in the fiscal year of 2006/2007 office equipment:

No Description Quantity Total price 1 Notebook computer 1 1 599.6 2 Drinking water machine 1 87.2 3 Canon LBP 2900 printer 1 139.6 5 Flash disk 2 42.6 6 Personal computer 1 587.4 7 Desk 3 417.6 8 BNT-600A /P/ UPS 1 65.6 9 UPS 1 38.4 10 Switch 8 port 1 21.3 11 HP Color Laserjet 1600 1 415.5 12 Gazz-GUH 2.OL /air purifier/ 1 29.8 13 Oil heater 1 49.6 TOTAL 3 494.2

Laboratory equipment:

No Description Quantity Total price 1 Truck 4 444.8 2 Applied Biosystems 3130 x 1 Genetic Analyzer 1 150 000 3 7500 Fast Real Time PCR system 1 52 000 4 Thermometer 2 51.3 5 Quarz light 2 42.7 6 Flask (25 ml) 600 1 026.5 7 Gel Photo Document System 230 V 1 15 219.4 8 Akira minibar (refrigerator) 1 96.1 9 Refrigerator for laboratory use, 243 L, Frestech 2 1 112 10 Refrigerator for laboratory use, 186 L, Frestech 1 579.9 11 Emergency care box 3 89.8 TOTAL 220 662.5

199 B5265G1 Annual Report – 2007/2008

ANNEX 65 Laboratory reagents and other consumables received in VL/NCCD in the fiscal year of 2006/2007

No Description unit Quantity Total price

1 Tube stand pcs 50 205.3

2 “Right Choice” Adenovirus strip 1x25 40 3 600

3 “Right Choice” RSV strip 1x25 40 5 010

TPP culture plates, 24 well, flat 4 1x 125 5 2 750 bottom, individually wrapped

Anti human IgM (μ-chain specific)- EITC antibody produced in goat, 5 0.5 ML 2 341.46 Affinity isolated antibody, Buffered aquareous solution

6 Qiagen one step RT-PCR kit (100) 5 4 777.5

7 Dialysis Tubing Cellulose membrane 100 ft 1 244.02

8 Dialysis Tubing Closures 1x10 2 380.52

9 DMEM (1x) High glucose 10x500ml 8 1 430.4

10 HEPES 6x100 ml 3 900

11 Bovine Albumin Fraction V solution 100 ml 40 1 478.4

12 Ribonuclease inhibitor 5 514

13 FBS USA, EA-Q 100 ml 10 1 700

14 Penicyllin-Streptomycin, liquid 100 ml 10 225

15 QIAamp Viral RNA Mini kit (50) 4 1 000

16 Glycerol 500 ml 5 289.5

Transportation cost for items No9 to 17 550 No16

18 Sigma centrifuge tube 15 ml, sterile 1x50 20 2 000

19 Sigma centrifuge tube 50 ml, sterile 1x25 20 2 800

20 Sigma Nunc cryo tube 1.8 ml 1x50 40 1 200

200 Cooperative Agreement Implementation

21 Quidel Flu A+B test 1x25 30 9 000

22 AsiaLion Rapid Flu A + B 1x25 10 1 000

23 RT-PCR kit (100) kit 5 4 777.5

24 Laboratory supply (073/03) 1 364.5

25 TPP culture plates, 24 well 1 000 4 360

26 Embryonated eggs pcs 600 205.3

27 Syringe filter pcs 1 000 1 500

28 RDE (II) 5 x 20 ml box 4 2 300

29 0.5-10 μl filter tips, 96 pcs 100 2 100

30 2-20 μl filter tips, 96 pcs 100 1 800

31 5-200 μl filter tips, 96 pcs 100 1 800

32 5-800 μl filter tips, 96 pcs 100 1 300

33 8 channel 20-200 μl pipette pcs 3 3 396

34 12 channel 20-200 μl pipette pcs 3 3 888

35 QIAamp Viral RNA Mini Kit 50 15 5 100

36 QIAGEN Onestep RT-PCR kit 100 20 18 600

37 Small Spin Columns 24 40 8 400

Costar® 96-well cell culture plates 38 10 /pkg 10 3 900 (case of 50)

Necessary devices for installation of 39 1 292.8 Genetic Analyzer

40 Qianti Tect Probe RT-PCR kit 200 10 12 100

Dulbecco’s Modified Eagle’s Medium 41 10 2 000 – high glucose HEPES Modification

Sodium Azide BioChemika Ultra 42 2 140 TM99.5% (T)

43 Thimerosal TM97% (HPLC) 1 1 350

DHI D3 DFA kit for detection of 44 kit 1 1 100 respiratory viruses

45 ReadyCells R-Mix box 1 178

201 B5265G1 Annual Report – 2007/2008

46 ReadyCells R-Mix Rinse Buffer bottle 1 34

47 ReadyCells R-Mix Refeed Medium bottle 1 62

UTM with flexible nasopharengeal 48 case 1 216 appilcator

49 Heating block pcs 1 800

50 Effendorf tube 1.5 ml pcs 4 000 205.3

51 Vacuum tube w/gel pcs 500 106.9

52 Gloves, small size 1 x 50 5 34.2

53 Gloves, medium size 1 x 50 10 68.4

54 Virkon-disinfectant pcs 5 128.3

55 Pipette tip 1x1 000 10 427.7

56 Cell culture plates, 96 well 1x100 5 1 443

57 Laboratory menzurk pcs 1 10.2

Embryonated egg for cultivation of 58 pcs 9 000 307.9 influenza virus

59 Primers pcs 67 2 559

Embryonated egg for antigen 60 pcs 400 119.7 preparation

61 Sterile cotton swab pcs 5 000 898.2

62 Agarose gel pcs 1 299.4

63 Glass marker pcs 100 17.1

64 Parafilm pcs 1 17.1

65 Pergament paper pcs 1 17.1

66 Aliminum paper pcs 5 21.3

67 Tissue pcs 20 12.8

TOTAL 132 153.8

202 Cooperative Agreement Implementation

ANNEX 66. Program of the Third National Influenza Workshop (NIW3) October 11-12, 2007

Topic Time Responsible person October 11, 2007, Thursday Registration 08:30-09:00 Organizers Chairpersons: Ass.Prof. B.Batsereedene, MD, PhD, State Secretary, MoH, Opening Session 09:00-09:45 Dr. D.Nyamkhuu, MD, PhD Director-General, NCCD; Head, National Influenza Center (NIC) Opening Speech and Dr. D.Nyamkhuu, MD, PhD Introduction of the Guests 09:00-09:10 Director-General, NCCD; Head, National Influenza Center (NIC) Dr D.Tuya, PhD, Member, Parliament of Mongolia, Inaugural Speech 09:10-09:20 Minister of Health, Government of Mongolia Mr. B. Goldbeck Greeting 09:20-9:30 US Embassy in Mongolia Mr R. Hagan, Greeting 09:30-09:40 WHO Representative in Mongolia Dr. T. Kasai, GISN and NICs Role in Regional Adviser (RA), Communicable 09.40-10.20 IPP Disease Surveillance and Response, WHO WPRO Announcements and Photo 10:20-10:30 Participants Session

Tea/Coffee Break 10:30-10:50

Moderators: Dr. M.Altankhuu, MD, PhD Deputy Director, NCCD; Plenary Session I 10:50-13:00 Dr T.Kasai, Regional Adviser, Communicable Disease Surveillance and Response, WHO WPRO Dr (Mrs) A. Burmaa, MD, Surveillance Human influenza situation Division, NCCD, in Mongolia in the last 10.50-11.30 Dr (Mrs) B.Darmaa, MD, Virology three seasons Laboratory, NCCD

203 B5265G1 Annual Report – 2007/2008

Influenza Surveillance and Dr (Mrs) T.Tursky, CDC, USA Pandemic Preparedness: 11.30-12.00 Experiences of USA

Influenza Surveillance in the People’s Republic of 12:20-13:00 Dr Yuelong Shu, MD, PhD, CDC, PRC China (PRC) Lunch 13:00-14:00 Moderators: Dr (Ms) Ts.Bujin, MD, MPH, Director, Health Policy and Plenary Session II 14:00-16:00 Coordination, MoH, Mr. Y. Mazumder, UNICEF, Ulaanbaatar Implementation status of the Mongolian Mr Ch.Batchuluun, Government Resolution 14.00-14.45 Deputy Head, National Emergency and Plan on “Control and Management Agency, Mongolia (NEMA) prevention of influenza pandemics” Prof. P. Nymadawa, MD, PhD, Influenza vaccination: DSc(Med), worldwide and in 14.45-15.30 President, Mongolian Academy of Mongolia Medical Sciences

Knowledge and attitude of the population to 15.30-16.00 Dr M. Altankhuu, MD, PhD NCCD influenza pandemics and avian influenza

Tea/Coffee Break 16:00-16:30

Moderators: Prof. P.Nymadawa, MD, PhD, DSc(Med), MAMS, Plenary Session III 16:30-18:00 Dr T. Turski, CDC, USA “Fatal Contact: Avian Influenza in America” USA Feature Film Show and Discussions on October 12, 2007, Friday

Moderators: Dr. R. Oyungerel, MD, PhD(Med), Scientific Secretary, NCCD Dr. L. Dapeng, MD, PhD(Med), WHO, Plenary Session IV 9.00-11.00 UB WHO’s 4 year’s plan on Influenza surveillance Dr. T. Kasai, RA, WHO WPRO 204 Cooperative Agreement Implementation

Tea/Coffee Break 11.00-11.30

Moderators: Dr (Mrs) D.Narangerel, MD, MPH, MoH TABLE TOP EXERCISE Dr Ts. Enkhbayar, MD, First Deputy OF PANDEMIC 11.30-13.30 Director, NCCD, PREPAREDNESS Dr (Mrs) A.Burma, MD, NCCD, ASSESSMENT Dr (Ms) D.Sodbayar, MD, NCCD, Dr (Mrs) D.Oyuntsetseg, MD, NEMA, Dr. P. Cox, WHO, STC

Lunch 13:30-14:30

Moderators: Dr (Mrs) D.Narangerel, MD, MPH, MoH Plenary Session IV 14:30-17:00 Dr Ts. Enkhbayar, MD, NCCD, Dr (Mrs) D.Oyuntsesteg, MD, NEMA Dr. P. Cox, WHO, STC Discussion on the Table Top Exsersice

Tea/Coffee Break 17:00-17:30

Moderators: Dr(Ms) Ts.Bujin, MD, MPH, MoH, Closing Session 17:30-18:00 Mr Ch.Batchuluun, NEMA Discussion and adoption of the NIW3 Recommendations

205 B5265G1 Annual Report – 2007/2008

ANNEX 67 Participants list of the NIW3, October 11-12, 2007

Organization ¹ Title Participant’s name 1 Minister of Health D. Tuya 2 State secretary B. Batsereedene

3 Head of Policy planning Department Ts. Bujin

4 Deputy of Medical care Department I. Bat-Erdene Ministry of Health Officer in charge, finance and 5 D. Otgonbaatar economy Division Senior officer, Policy planning 6 D. Narangerel Division 7 Officer in charge of laboratory Ya. Amarjargal 8 Medical officer L. Dapeng 9 CSR officer Ë. ªëçèé-Îðøèõ WHO 10 Short term consultant from WPRO Ò. Kasai 11 Short term consultant from WPRO P. Cox 12 Officer in affair B. Goldbeck 13 Ýäèéí çàñàã, õóäàëäààíû çºâëºõ P. Herman

USA Embassy in 14 Ýìíýëãèéí õýëòñèéí äàðãà E. Drummind Mongolia 15 Ýìíýëãèéí õýëòñèéí àæèëòàí D. Batsuvd 16 ESTH officer G. Batzaya 17 USAID, project staff Ts. Oyunbileg CDC, USA 18 Health scientist, Influenza branch T. Theresa 19 Head of National Influenza Center Y. Shu CDC, China Officer in charge of International 20 X. Li Cooperation 21 Coordinator Y. Mazumder UNICEF 22 Assistant project officer Ts. Undarmaa 23 Head P. Dash

National 24 Chief of the Division Ch. Batchuluun Emergency 25 Chief of the Dept N. Delgermaa Management Agency 26 Officer D. Oyuntsetseg 27 Officer D. Turbat 206 Cooperative Agreement Implementation

28 Head S. Tsogtbaatar 29 Secretary L.Tserensonom Emergency Management Dept 30 Ts. Nergui (EMD) of the Bayangol district 31 EMD of the Bayanzurkh district À. Batmunkh

Capital Emergency 32 EMD of the Khan-Uul district Ch. Tumurkhuyag Management 33 EMD of the Chingeltei district À. Natsagdorj Department EMD of the Songinokhairkhan 34 À. Dugardorj district 35 EMD of the Baganuur district S. Tsendsuren Yo. 36 EMD of the Sukhbaatar district Amarbayasgalan 37 EMD of the Bagakhangai district J. Erdenebayar 38 Head, Veterinary Division D. Orgil Chief, State Central Laboratory of 39 L. Sodnomdarjaa Veterinary and Hygiene 40 Officer in charge Ts. Pirevkhuu Ministry of Food Scientist, Veterinary Research 41 J. Bekh-Ochir and Agriculture Institute Expert, State Central Laboratory of 42 D. Batchuluun Veterinary and Hygiene Expert, State Central Laboratory of 43 S. Sugar Veterinary and Hygiene 44 Head, Health Inspection Division D. Oyunchimeg Drug and biopreparation inspection 45 D. Selenge Division State Professional Head, Epidemiology inspection Agency 46 A. Buzmaa Division 47 Senior inspector on border control Ts. Bumaa 48 Border control inspector T. Tumurbaatar Capital 49 Division director G. Galsanpuntsag Professional Inspection Agency 50 Senior inspector Ch. Irjee 51 Head, Communicable Disease Dept Ya. Dagvadorj HealthnScience 52 Lecturer G. Zulkhuu University 53 Lecturer N. Khorolsuren

207 B5265G1 Annual Report – 2007/2008

54 Director D. Otgonbaatar NCIDNF 55 Deputy director D. Tserennorov 56 Deputy director D. Ganbold 57 Mongolian National TV Correspondent 58 MN 25 TV D. Galsanjargal Mass media 59 Mongolain National Radio Yu. Gantumur 60 Today newspaper E. Enkhmaa 61 Director General D. Nyamkhuu 62 Deputy director L. Dashdorj 63 Acting deputy director M. Oyungeel Consultant in surveillance and 64 N. Tsend research 65 Head, TB surveilance dept D. Khandaasuren 66 Head, Outpaient clinic N. Batdelger 67 Head, Immunization Dept G. Surenkhand 68 Head, Quality assurance Dept E. Tuya 69 Consultant P. Nymadawa 70 First deputy director Ts. Enkhabayar 71 Scientfic secretary R. Oyungerel 72 Head, Economic and supply dept D. Tuul

NCCD 73 Head, United laboratory dept M. Altankhuu Officer in charge of International 74 U. Buyandelger Cooperation 75 Project manager D. Sodbayar 76 Outreach manager L. Enkhbaatar Head, ID surveillance and research 77 A. Burmaa Dept 78 Respiratory team, epidemiologist B. Enkhtuya 79 Respiratory team, epidemiologist D. Baigalimaa 80 Respiratory team, epidemiologist Ch. Urtnasan 81 Intestinal team, epidemiologist B. Ariungerel 82 Hepatitis team, epidemiologist E. Gereltsetseg Information Technology team, 83 L. Dashtseren epidemiologist 84 Virology laboratory doctor R. Tuul

208 Cooperative Agreement Implementation

85 Virology laboratory doctor B. Darmaa 86 Virology laboratory virologist D. Enkhsaikhan 87 Virology laboratory virologist S. Tsatsral 88 Virology laboratory virologist Ts. Naranzul NCCD Information Technology team, data 89 B. Munkhbayar manager Information Technology team, 90 B.Gantsooj epidemiologist 91 Influenza project S.Ganbaatar NCHD 92 Officer V. Garmaa MCHRC 93 Deputy director G. Chimgee 94 Director J. Oyunbileg 95 Scientist S. Tsoodol PHI 96 Head, Virology laboratory P. Suvd 97 Doctor, Bio preparation industry Sainchimeg

Border Control 98 Head A. Baatartsogt Department 99 Head, Veterinary Division R. Bud

Mongolian 100 Scientific secretary B. Burmaa Academy of Science 101 Referent D. Enh-Amgalan

Vansemberuu 102 Member of Professional Committee Sh. Bold NGO Emergency Center 103 Deputy S. Ariunbolor Railway hospital 104 Head N. Byambasuren Bio preparation 105 Head, Virology section D. Boldbaatar industry Capital Health 106 Epidemiologist D. Oyunchimeg Department Intelligence Officer in charge of communicable 107 D. Selenge Department diseases Inspection Division of Railway 108 Head B. Tagtaa Managmeent Department Cout Medicine 109 Quality manager N. Oyun-Erdene Department

209 B5265G1 Annual Report – 2007/2008

Head, Provincial Health 110 B. Davgasumberel Department

Head, Provincial Emergency 111 D. Renchindorj Arkhangai Management Branch province 112 Epidemiologist N. Baasan

Head, Provincial Veterinary 113 S. Erdenechimeg Department

Head, Provincial Emergency 114 J. Umirbek Management Branch

Head, Provincial Health 115 A. Batai Bayan-Ulgii Department province 116 Epidemiologist R. Bolot

Head, Provincial Veterinary 117 B. Nurgulan Department

Head, Provincial Emergency 118 T. Munkhbaatar Management Branch

Head, Provincial Health 119 D. Algaa Bayankhongor Department province 120 Epidemiologist B. Tserenkhand

Head, Provincial Veterinary 121 S. Erdene Department

Head, Provincial Emergency 122 D. Uuganbayar Management Branch

Head, Provincial Health 123 B. Myagmar Department Bulgan province Officer in charge of environmental 124 S. Tsendsuren health

Head, Provincial Veterinary 125 L. Tsengelmaa Department

Head, Provincial Emergency 126 N. Sodnomjamts Management Branch Gobi-Altai 127 Epidemiologist B. Baigalimaa province Head, Provincial Veterinary 128 P. Zoljargal Department

210 Cooperative Agreement Implementation

Head, Provincial Emergency 129 Ch. Amgalantuya Management Branch Head, Provincial Health 130 B. Tsetsegmaa Gobi-Sumber Department province 131 Epidemiologist S. Narantsetseg Head, Provincial Veterinary 132 S. Amarbat Department Head, Provincial Emergency 133 Sh. Lhagvasuren Management Branch Deputy head, Provincial Health 134 Ts. Nergui Department Darkhan-Uul province 135 Head, RCDT Ts. Bayasgalan Head, Provincial Veterinary 136 H. Havsamed Department 137 Head, Provincial hospital Ts. Bayasgalan Head, Provincial Emergency 138 S. Jargalsaihan Management Branch Head, Provincial Health 139 G. Enkhtsetseg Department Dorno-Gobi province 140 Head, Provincial hospital Sh. Dorjpagma 141 Epidemiologist Ch. Tsetsegmaa Head, Provincial Veterinary 142 Ts. Dorj Department Head, Provincial Emergency 143 Ch. Batsuuri Management Branch Head, Provincial Health 144 D. Doljin Department Dornod province 145 Head, Provincial hospital Ts. Ganbat 146 Epidemiologist N. Yanjmaa Head, Provincial Veterinary 147 B. Jadamba Department Head, Provincial Emergency 148 Ch. Huuhentogoo Management Branch Head, Provincial Health 149 Ts. Enkhsaihan Dund-Gobi Department province 150 Epidemiologist D. Tsetsgee Head, Provincial Veterinary 151 D. Munkhjargal Department

211 B5265G1 Annual Report – 2007/2008

Head, Provincial Emergency 152 D. Enkhbayar Management Branch

Head, Provincial Health 153 Sh. Battur Department Zavkhan province 154 Epidemiologist D. Gerelmaa

Head, Provincial Veterinary 155 D. Mendbileg Department

Head, Provincial Emergency 156 S. Zaluukhuu Management Branch

Head, Provincial Health 157 G. Gankhuyag Department Orkhon province 158 Epidemiologist Ts. Oyunbal

Head, Provincial Veterinary 159 M. Munkhmagnai Department

Head, Provincial Emergency 160 T. Enkhbaatar Management Branch

Head, Provincial Health 161 Ts. Ankhtuya Department Uvurkhangai province 162 Head, RCDT R. Dulamsuren

163 Epidemiologist D. Narantsetseg

Head, Provincial Veterinary 164 B. Dolgorsuren Department

Head, Provincial Health 165 D. Oyunsuren Department Umnugobi 166 Epidemiologist B. Byambajav province Head, Provincial Veterinary 167 T. Baatar Department

Head, Provincial Emergency 168 G. Ankhbayar Management Branch

Head, Provincial Health 169 Ya. Garmaa Sukhbaatar Department province 170 Epidemiologist Ts. Gundegmaa

Head, Provincial Veterinary 171 J. Odser Department

212 Cooperative Agreement Implementation

Head, Provincial Emergency 172 M. Surendondov Management Branch

Head, Provincial Health 173 B. Tserendolgor Department Selenghe province 174 Head, Provincial hospital J. Od

175 Epidemiologist J. Tserendolgor

Head, Provincial Veterinary 176 L. Munkhdelger Department

Head, Provincial Emergency 177 T. Ganbat Management Branch

Head, Provincial Health 178 D. Ochirbat Tuv province Department 179 Epidemiologist S. Nansalmaa

Head, Provincial Veterinary 180 R. Mungunhaich Department

Head, Provincial Emergency 181 D. Chuluunbaatar Management Branch

Uvs province Head, Provincial Health 182 B. Jiidee Department

183 Epidemiologist N. Oyun

Head, Provincial Emergency 184 N. Buyantur Management Branch

Head, Provincial Health 185 B. Jamsran Department Khovd province 186 Head, RCDT P. Erveehei

187 Epidemiologist S. Bat-Ulzii

Head, Provincial Veterinary 188 D. Tulganyam Department

Head, Provincial Health 189 S. Narantuya Department

Head, Provincial Emergency 190 Yo. Purevsuren Khuvsgul province Management Branch 191 Officer, Local Gpvernal Department G. Dolgormaa

Head, Provincial Veterinary 192 B. Ganhuyag Department

213 B5265G1 Annual Report – 2007/2008

Head, Provincial Emergency 193 D. Batjargal Management Branch Head, Provincial Health 194 D. Batjargal Khenii province Department 195 Epidemiologist D. Baasandorj Head, Provincial Veterinary 196 N. Ankhbayar Department 197 Head, District Health Department B. Puntsag Bayanzurkh 198 Epidemiologist B. Oyunchimeg district 199 General physician, district hospital N. Jantsan 200 Head, District Health Department S. Tuul 201 Epidemiologist O. Oyunchimeg Bayangol district Deputy head, District Health 202 U. Batjargal Department 203 Head, District Health Department O. Byamba Sukhbaatar 204 Epidemiologist D. Erdenechimeg district 205 General physician, district hospital M. Chimgee 206 Head, District Health Department A. Erdenetuya Songinokhairkhan 207 Epidemiologist S. Narantuya district 208 General physician, district hospital T. Galsantseden

209 Head, District Health Department S. Tungalag Chingeltei district 210 Epidemiologist N. Bolor 211 General physician, district hospital Ts. Lhagva 212 Head, District Health Department E. Buyanmandah Khan-Uul district 213 Epidemiologist I. Oyunchimeg 214 General physician, district hospital D. Baast 215 Head, District Health Department A. Ochirsuren Baganuur district 216 Epidemiologist Ts. Handtsoo 217 General physician, district hospital G. Baatarhuu 218 Head, District Health Department Ts. Dashdolgor Nalaikh district 219 Epidemiologist N. Tegshjargal 220 General physician, district hospital B. Oyunchimeg

214 Cooperative Agreement Implementation

ANNEX 68 Recommendation from NIW3

We, the participants of NIW3: - Noting our satisfaction for the realization of the recommendations of NIW2, - Expressing our concern over unmet needs of antivirals, biopreparations, and personnel protecting devices and unsatisfactory attraction of civil society to pandemic preparedness in the conditions of ever increasing danger of infl uenza pandemics, - Stressing the necessities for strengthening of collaboration of concerned Government institutions, private sector and community in the fi ght against infl uenza pandemics, recommend: 1. to organize assessment of the realization of program for realization of the “Directive for prevention and control of avian influenza and human influenza pandemics” approved by the Government resolution of 110/2006 at the soum, aimag and country levels and of the concerned Government agencies, 2. to develop a National “Rapid Containment Plan” in case of Influenza pandemics and other emerging public health event, 3. to increase stepwise coverage by seasonal influenza vaccination on the budget financing of population strata of professional and public risks, like health professionals, 4. to calculate the financial, medical and social resources needed for control of influenza pandemics and inform openly business people, civil society and donors encouraging them actively participate in it, 5. to expand the laboratory-based surveillance of human influenza and influenza-like illnesses covering whole territory of the country, 6. to extend studies on influenza virus ecology and epidemiology, 7. to extend the researches on genetics and drug resistance of influenza virus strains isolated in Mongolia, 8. to carefully follow the international developments on early detection of human influenza pandemics, rapid containment of it and pandemic preparedness activities and strengthen cooperation on it with countries of the world, especially with the neighboring countries.

215 B5265G1 Annual Report – 2007/2008

ANNEX 69. Program of the workshop on second and third quarter activities in 2007 for sentinel surveillance sites in the capital city, October 18, 2007

No Topic Time Responsible person

1 Registration 8.30 – 9.00 Dr. L. Enkhbaatar 2 Opening speech 9.00 – 9.10 Prof. P. Nymadawa Human inflieuena situation in UB in 3 9.10 – 9.40 Dr. B. Darmaa 2006/2007 4 Influenza clinical survey in 2007 9.40 – 10.10 Dr. N. Khorolsuren Estimation of virus isolation and 5 specimen collection 10.10 – 11.10 Dr. D. Sodbayar in second and third quarters of 2007 6 Tea/Coffee break 11.10 – 11.30 Dr. L. Enkhbaatar 7 Pandemic Influenza containment 11.0 – 12.30 Dr. A. Burmaa 8 Lunch 12.30 – 13.30 Dr. L. Enkhbaatar Pneumococcal surveillance project and 9 13.30 – 14.00 Dr. M. Altankhuu its relation with influenza surveilance “Fatal Contact: Avian Influenza in America” 10 14.00 – 16.30 Prof. P. Nymadawa USA Feature Film Show and Discussions on 11 Closing 16.30 - 16.40 Prof. P. Nymadawa 12 Tea/Coffee break 16.40 – 17.00 Dr. L. Enkhbaatar Allowance of 2007 II and II quarter 13 17.00 – 17.30 Dr. D. Sodbayar remunerations to ISSSs

216 Cooperative Agreement Implementation

ANNEX 70. Participants’ list of the workshop on second and third quarter activities in 2007 for sentinel surveillance sites in the capital city, October 18, 2007

No Participant’s name Organization Title 1. T. Chimgee MCHRC Deputy director in charge of tratment 2. B. Otgonchimeg MCHRC Epidemiologist 3. Ts. Gantuya MCHRC Statistician doctor 4. D. Turmunh MCHRC Head, pulmonology ward 5. M. Baljin-nyam MCHRC Head, intensive care unit 6. Ch. Altantuya MCHRC Head, neonatal ward 7. D. Oyunbaatar MCHRC Head, admission and emergency ward 8. B. Bayasgalantai MCHRC Head, outpatient clinic 9. Sh. Altantsetseg MCHRC Physician, respiratory infection ward 10. S. Tsevelmaa KhUD hospital Deputy head in charge of treatment 11. J. Myagmar KhUD hospital Epidemiologist 12. G. Otgon KhUD hospital Statistician 13. J. Sarantsetseg KhUD hospital Head, pediatric ward 14. N. Jantsan BZD hospital Deputy head in charge of treatment 15. Radnaatseren BZD hospital Epidemiologist 16. T. Tsevelmaa BZD hospital Statistician 17. Yo. Altantsetseg BZD hospital Head, pediatric ward 18. Ya. Nergui BZD hospital Head, intensive care unit 19. O. Enhtuya SKhD hospital Deputy head in charge of treatment 20. A. Delgerbayar SKhD hospital Epidemiologist 21. L. Enhee SKhD hospital Statistician 22. B. Majigsuren SKhD hospital Head, pediatric ward 23. S. Tuvshinjargal SKhD hospital Head, internal medicine ward 24. B. Shinehuu BGD hospital Head, internal medicine ward 25. O. Oyunchimeg BGD hospital Epidemiologist 26. B. Irina BGD hospital Statistician 27. B. Tulga BGD hospital Deputy head in charge of treatment 28. T. Buyanjargal SBD hospital Deputy head in charge of treatment

217 B5265G1 Annual Report – 2007/2008

29. N. Narantungalag SBD hospital Epidemiologist 30. B. Odgerel SBD hospital Statistician 31. G. Oyunchimeg SBD hospital Head, pediatric ward 32. Ts. Tuvshinchimeg SBD hospital Head, internal medicine ward 33. Bolor ChD hospital Physician,internal medicine ward 34. Z. Tsetsegmaa ChD hospital Statistician 35. Baljin-nyam ChD hospital Epidemiologist 36. N. Tsolmon ChD hospital Head, intensive care unit 37. D. Handaasuren ChD hospital Physician, internal medicine ward 38. Sh. Altanhuyag Eruul-urh FGP Leader 39. E. Baigalmaa Eruul-urh FGP Physician 40. J. Narantsetseg Eruul-urh FGP Physician 41. B. Altanhuyag Eruul-urh FGP Physician 42. D. Batsaihan Eruul-urh FGP Nurse 43. S. Bayarmaa Amgalan itgehui Leader FGP Amgalan itgehui 44. Ts. Tonya Physician FGP Amgalan itgehui 45. S. Sarantuya Nurse FGP Amgalan itgehui 46. G. Bolormaa Nurse FGP Amgalan itgehui 47. Narantsetseg Nurse FGP 48. Ch. Tserennadmid Nasan-urt FGP Leader 49. B. Tersaihan Nasan-urt FGP Physician 50. B. Oyunbileg Nasan-urt FGP Nurse 51. L. Tserenbaljid Nasan-urt FGP Nurse 52. L. Oyunsuren Nasan-urt FGP Nurse 53. D. Narantsetseg Enh titem FGP Leader 54. A. Uyanga Enh titem FGP Physician 55. B. Sainzaya Enh titem FGP Physician 56. T. Munhtsetseg Enh titem FGP Nurse 57. L. Oyuntuya Enh titem FGP Nurse 58. D. Tuul Amin tus FGP Leader 59. D. Erdenechimeg Amin tus FGP Physician 60. D. Altantsetseg Amin tus FGP Physician

218 Cooperative Agreement Implementation

61. E. Amgalansuren Amin tus FGP Nurse 62. G. Altantsetseg Amin tus FGP Nurse 63. S. Sarantuya Manal uils FGP Leader 64. M. Lhagvajargal Manal uils FGP Physician 65. D. Mendjargal Manal uils FGP Nurse 66. L. Oyuntsetseg Manal uils FGP Nurse 67. D. Erdenetuya Manal uils FGP Nurse 68. G. Ganchimeg Shijid dug FGP Leader 69. Ts. Enhmunh Shijid dug FGP Physician 70. Uranchimeg Shijid dug FGP Nurse 71. Ganchimeg Shijid dug FGP Nurse 72. M. Purevdorj Tegsh-ulzii FGP Leader 73. Ts. Nyamaa Tegsh-ulzii FGP Physician 74. D. Tsetsegsaihan Tegsh-ulzii FGP Physician 75. A. Oyungerel Tegsh-ulzii FGP Physician 76. L. Shagdarsuren Tegsh-ulzii FGP Nurse 77. B. Otgonbayar Uils negten FGP Leader 78. R. Nyamsuren Uils negten FGP Physician 79. Orlomsuren Uils negten FGP Nurse 80. Ts. Dorjhand Uils negten FGP Nurse 81. S. Sarannyam Uils negten FGP Physician 82. J. Lhagvasuren Shar degd FGP Leader 83. Bayarmaa Shar degd FGP Physician 84. Tuvshin Shar degd FGP Physician 85. G. Lhagvasuren Shar degd FGP Physician 86. Munhjargal Shar degd FGP Physician 87. A. Tsend-Ayush Itgel ugtakh FGP Leader 88. Ch. Budjav Itgel ugtakh FGP Physician 89. Ariunaa Itgel ugtakh FGP Physician 90. D. Gantuya Itgel ugtakh FGP Nurse 91. Erdenechimeg Itgel ugtakh FGP Nurse 92. Hishgee Gurvansanchir FGP Leader 93. Uranbayar Gurvansanchir FGP Nurse 94. Oyungerel Gurvansanchir FGP Physician 95. Gantuya Gurvansanchir FGP Physician

219 B5265G1 Annual Report – 2007/2008

96. Uranbayar Gurvansanchir FGP Nurse 97. S. Norjmaa Unu-Achit FGP Leader 98. I. Sugarsuren Unu-Achit FGP Physician 99. U. Tsengel Unu-Achit FGP Physician 100. L. Jurnai Unu-Achit FGP Physician 101. Suvdaa Unu-Achit FGP Nurse 102. Ch. Unursaihan Enh-elberel FGP Leader 103. Batnaran Enh-elberel FGP Physician 104. Enhnaran Enh-elberel FGP Physician 105. Bolormaa Enh-elberel FGP Physician 106. Tsienpil Enh-elberel FGP Nurse 107. D. Altantsetseg Buyant-manal FGP Leader 108. A. Tugssain Buyant-manal FGP Physician 109. O. Udvaltsetseg Buyant-manal FGP Physician 110. Ya. Bolor Buyant-manal FGP Physician 111. Munhtsetseg Buyant-manal FGP Nurse 112. D. Palam Enhsunder FGP Leader 113. Ts. Munhchimeg Enhsunder FGP Physician 114. Tudevdorj Enhsunder FGP Physician 115. S. Ochirsaihan Enhsunder FGP Nurse 116. Bolor Enhsunder FGP Nurse 117. S. Selenge Sankoll FGP Leader 118. Tuvshinjargal Sankoll FGP Physician 119. D. Ganchimeg Sankoll FGP Physician 120. T. Oyungerel Sankoll FGP Nurse 121. Undram Sankoll FGP Physician 122. D. Tsetsegmaa Tegsh mend FGP Leader 123. S. Enhjargal Tegsh mend FGP Physician 124. Ts. Uyanga Tegsh mend FGP Physician 125. D. Chuluuntsetseg Ami-erdene FGP Leader 126. S. Tsetsegmaa Ami-erdene FGP Nurse 127. Ts. Enhtuya Ami-erdene FGP Physician 128. Ganchimeg Ami-erdene FGP Physician 129. I. Od Enerelt-Ulzii FGP Leader 130. D. Bat-tsetseg Enerelt-Ulzii FGP Nurse

220 Cooperative Agreement Implementation

131. V. Oyunsuren Enerelt-Ulzii FGP Nurse 132. T. Narantuya Enerelt-Ulzii FGP Physician Deputy director in charge of 133. N. Khorolsuren NCCD treatment 134. E. Tuya NCCD Head, Quality assurance department 135. N. Oyungerel NCCD Epidemiologist 136. G. Tsolmandakh NCCD Head, intensive care unit 137. N. Otgon NCCD Head, emergency ward 138. S. Undarmaa NCCD Head, respiratory infection ward 139. A. Tsengelbat NCCD Head, brucellosis ward 140. S. Erdenechimeg NCCD Head, intestinal ward 141. M. Oyungerel NCCD Head, pediatric hepatitis ward 142. B. Altantsetseg NCCD Physician, hepatitis ward 143. A. Sarantsetseg NCCD Head, hepatitis ward 144. D. Chimednorov NCCD Head, re-emerging infection ward 145. S. Ariunaa NCCD Physician 146. O. Baatarkhuu NCCD Lecturer, HSUM 147. D. Doljinsuren NCCD Head, multi-drug resistant TB ward 148. D. Chuluntsetseg NCCD Head, pulmonology ward -1 149. D. Namkhai NCCD Head, pulmonology ward -2 150. Ts. Jambaldoj NCCD Head, pulmonology ward -3 151. D. Nyamkhishig NCCD Head, pulmonology ward -4 152. D. Batdelger NCCD Head, outpatient clinic 153. O. Sumiya NCCD Physician, respiratory infection ward Physician, re-emerging infection 154. O. Enkhjargal NCCD ward 155. M. Uuganchimeg NCCD Physician, intensive care unit 156. L. Purevsuren NCCD Physician, emergency ward 157. D. Gantsetseg NCCD Physician, outpatient clinic 158. B. Saruul NCCD Physician, outpatient clinic 159. Dolgorsuren NCCD Physician, outpatient clinic 160. Kh. Erdenechimeg NCCD Nurse, outpatient clinic 161. L. Oyuntsetseg NCCD Head, Statistician department 162. Ch. Oyunchimeg NCCD Head, nursing department

221 B5265G1 Annual Report – 2007/2008

ANNEX 71. Program of the workshop on fourh quarter activities in 2007 for sentinel surveillance sites in the capital city, January 16, 2008

No Topic Time Responsible person

Ms. S. Tsatsral 1 Registration 13.00 – 13.20 Ms. U. Naranchimeg 2 Opening speech 13.20 – 13.30 Prof. P. Nymadawa 3 Human inflieuena situation 13.30 – 13.50 Dr. A. Burmaa 4 Virology surveillance 13.50 – 14.10 Dr. B. Darmaa 5 ISSS assessment result in 2007/2008 14.10 – 14.30 Dr. L. Enkhbaatar Estimation of virus isolation and 6 specimen collection 14.30 – 14.50 Dr. D. Sodbayar in 4th quarter of 2007 Outpaient-based sentinel surveillance site 7 14.50 – 15.00 Dr. M. Altankhuyag activity in UB city Inpaient-based sentinel surveillance site 8 15.00 – 15.10 Dr. N. Jantsan activity Ms. S. Tsatsral Tea/Coffee break and introduction with 9 15.10 – 16.00 Ms. U. poster presentation Naranchimeg Clinical survey result done in acute 10 pneumonia morbidity cases hospitalized 16.00 – 16.20 Dr. N. Khorolsuren in Songinokhairkhan district hospital Ongoing surveillance on pneumococcal 11 16.20 – 16.40 Dr. M. Altankhuu disease Ongoing surveillance on meningococcal 12 16.40 – 17.00 Dr. S. Naryad infections and is control measures 13 Discussion 17.00 – 17.30 Prof. P. Nymadawa 14 Remuniraton allowance 17.30 – 18.30 Mrs. D. Tuul

222 Cooperative Agreement Implementation

ANNEX 72 Participants’ list of the workshop on fourh quarter activities in 2007 for sentinel surveillance sites in the capital city, January 16, 2008

No Particiapmt’s name Organization Title 1. P. Delgermaa NCCD Physician 2. D. Ichinhorloo NCCD Nurse 3. Ts. Ariunjargal NCCD Nurse 4. B. Sumiya NCCD Nurse 5. J. Ulaan NCCD Physician 6. B. Khorolsuren NCCD Nurse 7. G. Odgerel NCCD Doctor assistant 8. T. Uranbileg NCCD Nurse 9. T. Urantugs NCCD Nurse 10. N. Sugar NCCD Nurse 11. I. Nandintsetseg NCCD Nurse 12. V. Davaahuu NCCD Physician 13. B. Gansaihan NCCD Physician 14. N. Batchimeg NCCD Nurse 15. D. Buyant NCCD Nurse 16. M. Tunsag NCCD Physician 17. J. Densmaa NCCD Doctor assistant 18. Ts. Chinbayar NCCD Physician 19. Sh. Naljirmaa NCCD Nurse 20. D. Buted NCCD Doctor assistant 21. B. Munhzul NCCD Physician 22. D. Dolgormaa NCCD Nurse 23. D. Erdenetsetseg NCCD Nurse 24. D. Doljinsuren NCCD Physician 25. D. Haliun NCCD Nurse 26. Suglegmaa NCCD Nurse 27. Sh. Tuya NCCD Physician 28. S. Oyungerel NCCD Physician 29. L. Oyuntsetseg NCCD Physician 30. Ts. Narantsetseg NCCD Satistician assistant 31. Sh. Altanhuyag Eruul urkh FGP Leader

223 B5265G1 Annual Report – 2007/2008

32. E. Baigalmaa Eruul urkh FGP Physician 33. J. Oyuntsetseg Eruul urkh FGP Physician 34. S. Chuluunchimeg Eruul urkh FGP Nurse 35. Narantsetseg Eruul urkh FGP Nurse 36. S.Bajrmaa Amgalan itgehui FGP Leader 37. Ts.Tonya Amgalan itgehui FGP Physician 38. G. Bolormaa Amgalan itgehui FGP Nurse 39. L. Narantsetseg Amgalan itgehui FGP Nurse 40. Ch. Tserennadmid Nasan-urt FGP Leader 41. Naranchimeg Nasan-urt FGP Nurse 42. B.Tersaihan Nasan-urt FGP Physician 43. S.Badam Nasan-urt FGP Physician 44. B. Oyunbileg Nasan-urt FGP Nurse 45. D. Narantseseg Enh titem FGP Leader 46. T.Munkhtsetseg Enh titem FGP Nurse 47. L.Ojuntuya Enh titem FGP Nurse 48. T. Munhtsetseg Enh titem FGP Nurse 49. D. Tuul Amin tus FGP Leader 50. E. Amgalansuren Amin tus FGP Nurse 51. D. Altantsetseg Amin tus FGP Physician 52. Enkhjargal Amin tus FGP Nurse 53. G. Altantsetseg Amin tus FGP Nurse 54. S. Sarantuya Manal uils FGP Leader 55. Mendjargal Manal uils FGP Nurse 56. Erdenetuya Manal uils FGP Nurse 57. Otgonhuu Manal uils FGP Physician 58. Oyuntsetseg Manal uils FGP Nurse 59. Ganchimeg Shijid dug FGP Leader 60. Tsetsegsuren Shijid dug FGP Physician 61. Byambasuren Shijid dug FGP Nurse 62. Gereltuya Shijid dug FGP Nurse 63. Tserendolgor Shijid dug FGP Physician 64. M. Purevdorj Tegsh mend FGP Leader 65. S.Enkhjarag Tegsh mend FGP Physician 66. Munhtulga Tegsh mend FGP Physician

224 Cooperative Agreement Implementation

67. Erdenesuren Tegsh mend FGP Physician 68. Oyungerel Tegsh mend FGP Physician 69. B. Otgonbayar Uils negten FGP Leader 70. R.Nyamsuren Uils negten FGP Physician 71. T.Khandsuren Uils negten FGP Nurse 72. Ts.Dorjhand Uils negten FGP Nurse 73. Baigalmaa Uils negten FGP Nurse 74. J. Lhagvasuren Shar degd FGP Leader 75. G. Lhagvasuren Shar degd FGP Physician 76. D.Maamaa Shar degd FGP Nurse 77. M.Munhjargal Shar degd FGP Nurse 78. O. Gantumur Shar degd FGP Physician 79. A. Tsend-Ayush Itgel ugtah FGP Leader 80. D.Otgonbayar Itgel ugtah FGP Physician 81. Ch.Budjav Itgel ugtah FGP Physician 82. H.Purev Itgel ugtah FGP Nurse 83. D.Gantuya Itgel ugtah FGP Nurse 84. T.Hishigsuren Gurvansanchir FGP Physician 85. Munhjargal Gurvansanchir FGP Physician 86. O.Oyungerel Gurvansanchir FGP Nurse 87. Ts.Bajrsaiahn Gurvansanchir FGP Nurse 88. Gantuya Gurvansanchir FGP Nurse 89. S. Norjmaa Unu-Achit FGP Leader 90. Ch.Udval Unu-Achit FGP Nurse 91. N.Otgonbayar Unu-Achit FGP Nurse 92. N.Sugarsuren Unu-Achit FGP Physician 93. U.Tsengel Unu-Achit FGP Physician 94. Ch. Unursaihan Enh-elberel FGP Leader 95. L.Bolor Enh-elberel FGP Nurse 96. Gantulga Enh-elberel FGP Nurse 97. Dash Enh-elberel FGP Physician 98. D. Altantsetseg Buyant-manal FGP Leader 99. A. Tugs sain Buyant-manal FGP Physician 100. O. Udvaltsetseg Buyant-manal FGP Physician 101. Bolor Buyant-manal FGP Physician 102. D. Palam Enh sunder FGP Leader 103. S. Purevdorj Enh sunder FGP Physician 104. Munhchimeg Enh sunder FGP Physician

225 B5265G1 Annual Report – 2007/2008

105. Tsetsgee Enh sunder FGP Physician 106. Munguntsetseg Enh sunder FGP Nurse 107. S. Selenge Sankoll FGP Leader 108. D.Oyun Sankoll FGP Physician 109. D. Ganchimeg Sankoll FGP Physician 110. Ts.Oyungerel Sankoll FGP Physician 111. B.Tserenpil Sankoll FGP Nurse 112. Taivanjargal Sankoll FGP Nurse 113. D. Tsetsegmaa Tegsh mend FGP Leader 114. S.Enhmaa Tegsh mend FGP Physician 115. Oyunsuren Tegsh mend FGP Physician 116. G.Davaadulam Tegsh mend FGP Nurse 117. P.Tungalag Tegsh mend FGP Physician 118. D.Chuluuntsetseg Ami-erdene FGP Leader 119. Munhtuya Ami-erdene FGP Nurse 120. S.Tsetsegmaa Ami-erdene FGP Nurse 121. Ts.Enkhtuya Ami-erdene FGP Nurse 122. I. Od Enerelt-ulzii FGP Leader 123. R.Gantsetseg Enerelt-ulzii FGP Physician 124. L.Enhtsetseg Enerelt-ulzii FGP Nurse 125. B.Ojuntsetseg Enerelt-ulzii FGP Nurse Narny dush FGP, 126. Chuluuntsetseg Leader UV 127. Munkhtsetseg Eruul zon FGP, DO Leader Deputy director in charge of 128. T. Chimgee MCHRC tratment 129. B. Otgonchimeg MCHRC Epidemiologist 130. Ts. Gantuya MCHRC Statistician doctor 131. Gerelmaa MCHRC Physician, pulmonology ward 132. M. Baljin-nyam MCHRC Head, intensive care unit 133. Ch. Altantuya MCHRC Head, neonatal ward 134. Batsolongo MCHRC Physician, emergency ward 135. B. Bayasgalantai MCHRC Head, outpatient clinic Physician, respiratory infection 136. Sh. Altantsetseg MCHRC ward Physician, respiratory infection 137. Kh. Naranchimeg MCHRC ward Physician, respiratory infection 138. Solongo MCHRC ward

226 Cooperative Agreement Implementation

Physician, respiratory infection 139. Ganchimeg MCHRC ward Deputy head in charge of treat- 140. S. Tsevelmaa KhUD hospital ment 141. Zoljargal KhUD hospital Epidemiologist 142. G. Otgon KhUD hospital Statistician 143. J. Sarantsetseg KhUD hospital Head, pediatric ward 144. S. Nyamadawa KhUD hospital Nurse Deputy head in charge of treat- 145. N. Jantsan BZD hospital ment 146. Radnaatseren BZD hospital Epidemiologist 147. Suger BZD hospital Statistician 148. Erdenetsetseg BZD hospital Head, pediatric ward 149. Tuul BZD hospital Head, intensive care unit Deputy head in charge of treat- 150. O. Enhtuya SKhD hospital ment 151. A. Delgerbayar SKhD hospital Epidemiologist 152. L. Enhee SKhD hospital Statistician 153. B. Majigsuren SKhD hospital Head, pediatric ward 154. S. Tuvshinjargal SKhD hospital Head, internal medicine ward 155. B. Shinehuu BGD hospital Head, internal medicine ward 156. O. Oyunchimeg BGD hospital Epidemiologist 157. B. Irina BGD hospital Statistician Deputy head in charge of treat- 158. Kuma BGD hospital ment 159. D. Batzaya BGD hospital Physician Deputy head in charge of treat- 160. T. Buyanjargal SBD hospital ment 161. N. Narantungalag SBD hospital Epidemiologist 162. B. Odgerel SBD hospital Statistician 163. G. Oyunchimeg SBD hospital Head, pediatric ward 164. Ts. Tuvshinchimeg SBD hospital Head, internal medicine ward Deputy head in charge of treat- 165. Enkhtuya ChD hospital ment Physician,internal medicine 166. Bolortuya ChD hospital ward 167. Z. Tsetsegmaa ChD hospital Statistician 168. O. Dashpagma ChD hospital Epidemiologist 169. Tserenlkham ChD hospital Physician, intensive care unit

227 B5265G1 Annual Report – 2007/2008

ANNEX 73. ISSS assessment results of the capital city, 2007

Grade No City district Site’s title Score 5432 1 “Eruul urkh” FGP 155 + 2 “Amgalan itgekhui” FGP 80 + Bayanzurkh district 3 “Nasan Urt” FGP 75 + 4 District hospital 155 + 5 “Amin tus” FGP 115 + 6 “Enkh titem” FGP 60 + Khan-Uul district 7 “Manal uils” FGP 135 + 8 District hospital 125 9 “Sijid dug” FGP 80 + 10 “Tegsh Ulzii” FGP 165 + Chingeltei district 11 “Uils negten” FGP 153 + 12 District hospital - 5 + 13 “Shar degd” FGP 110 + 14 “Itgel ugtakh” FGP 120 + Bayangol district 15 “Gurvan sanchir” FGP 70 + 16 District hospital 15 + 17 “Unu achit” FGP 75 + 18Songino- “Enkh elberel” FGP 95 + 19khairkhan district “Buyant manal” FGP 85 + 20 District hospital 95 + 21 “Enkh sunder” FGP 95 + 22 “Sankoll” FGP 75 + Sukhbaatar district 23 “Tegsh mend” FGP 110 + 24 District hospital 100 +

25 Nalaikh district “Ami erdene” FGP 75 +

26 Baganuur district Enerelt ulzii’ FGP 170 +

228 Cooperative Agreement Implementation

ANNEX 74. ISSS assessment results of the provinces, 2007

Grade No Province Site’s titleScore 5432 1 Zuvlukh bag 135 + 2 Nomt bag 155 + 3Selenge Khadah khui 160 + 4 Emnekh bag 120 + 5 Provincial hospital 130 + 6 Goyo mend 150 + 7 Misheelt mana 140 + 8Dornogobi Agatova 155 + 9 Rail way 125 + 10 Provincial hospital 150 + 11 Asralt uils 155 + 12 Dornyn ireedui 154 + 13 Myangan jargalan 75 + 14Dornod Tseene tsetseg 85 + 15 Eruul zon 115 + 16 Yagaan tseene 145 + 17 Provincial hospital 45 + 18 Narny dush 95 + 19 Uyan setgel 110 + 20Uvurkhangai Enkhiin khurd 130 + 21 Tushig dulguun 65 + 22 Provincial hospital 95 + 23 Bugat 160 + 24 Buyant 140 + 25 Baatarkhairkhan 165 + Khovd 26 Jargalant 160 + 27 Rashaant 155 + 28 Provincial hospital 125 +

229 B5265G1 Annual Report – 2007/2008

29 Munkhsunder 150 + 30 Tsagaan agi 165 + 31 Uchralt bayar 145 + 32Orkhon Munkhiin gegee 125 + 33 Elberelt uils 150 + 34 Uils badrakh 145 + 35 Niitsel 135 + 36 Achlalt nar 155 + 37 Ankhny och 100 + 38 Mendbulag 140 + 39Orkhon Khos chagnuur 100 + 40 Itgeliin erel 155 + 41 Gerelt mandakh 80 + 42 Provincial hospital 115 + 43 Gos khot 165 + 44 Enerelt naran 105 + 45 Gereltei 80 + Darkhan-Uul 46 Amin kholboo 135 + 47 Tuvshin kholboo 130 + 48 Provincial hospital 110 +

230 Cooperative Agreement Implementation

ANNEX 75. Program of the workshop on IPPP national assessment, April 15-17, 2008

¹ Activity Time Responsible

April 15, 2008 - Tuesday

11.00- Prof. T. Altantsetseg, MD, PhD(Med), 1 Opening speech 11.10 Director-General, NCCD, Mongolia Briefly about IPPP 11.10- Dr. Theresa Turski, MPH, 2 assessment 11.30 Health Scientist, CDC, USA Introduction participants, Prof. P. Nymadawa, MD, PhD, DSc(Med), 11.30- 3 and Housekeeping Project director, “Development of 12.00 announcement Influnza Surveillance Network” 12.00- 4 Lunch Dr. L. Enkhbaatar 13.00 Prof. P. Nymadawa, MD, PhD, DSc(Med), Discussion on IPPP Project director, “Development of 13.00- 5 assessment Influnza Surveillance Network”, 15.30 (Capability 1-2) Dr. D. Oyuntsesteg, NEMA Dr. M. Altankhuu, NCCD 15.30- 6 Tea / coffee break Dr. L. Enkhbaatar 15.45 Prof. P. Nymadawa, MD, PhD, DSc(Med), Project director, “Development of Discussion on IPPP Influnza Surveillance Network”, 15.45- 7 assessment Dr. N. Naranbat, NCCD 17.45 Capability 3-4) Dr. L. Dashtseren, NCCD Dr. V. Garmaa, NCHD Ms. P. Bolor, UNICEF Prof. P. Nymadawa, MD, PhD, DSc(Med), 17.45- 8 Wrap up of the day Project director, “Development of 18.00 Influnza Surveillance Network”

April 16, 2008 - Wednesday

Prof. P. Nymadawa, MD, PhD, DSc(Med), Discussion on IPPP Project director, “Development of 09.00- 9 assessment Influnza Surveillance Network”, 11.00 (Capability 5-6) Dr. B. Darmaa, NCCD Dr. A. Burmaa, NCCD 11.00- 10 Tea / coffee break Dr. L. Enkhbaatar 11.15 231 B5265G1 Annual Report – 2007/2008

Prof. P. Nymadawa, MD, PhD, DSc(Med), Discussion on IPPP Project director, “Development of 11.15- 11 assessment Influnza Surveillance Network”, 13.00 (Capability 7-8) Dr. L. Dashtseren, NCCD Dr. B. Darmaa, NCCD 13.00- 12 Lunch Dr. L. Enkhbaatar 14.00 Prof. P. Nymadawa, MD, PhD, DSc(Med), Discussion on IPPP Project director, “Development of 14.00- 13 assessment Influnza Surveillance Network”, 15.30 (Capability 9-10) Dr. D. Oyuntsetseg, NEMA Dr. D. Tserennorov, NCIDNF

15.30- 14 Tea / coffee break Dr. L. Enkhbaatar 15.45

Prof. P. Nymadawa, MD, PhD, DSc(Med), Discussion on IPPP Project director, “Development of 15.45- 15 assessment Influnza Surveillance Network”, 16.45 (Capability 11-12) Dr. D. Narangerel, MoH Dr. M. Tsolmon, NCCD Prof. P. Nymadawa, MD, PhD, DSc(Med), 16.45- 16 Wrap up of the day Project director, “Development of 17.00 Influnza Surveillance Network”

April 17, 2008 - Thursday

Prof. P. Nymadawa, MD, PhD, DSc(Med), IPPP assessment 09.00- 17 Project director, “Development of workshop wrap up 11.00 Influnza Surveillance Network”

11.00- 18 Tea / coffee break Dr. L. Enkhbaatar 11.15

IPPP assessment 11.15- Dr. Theresa Turski, MPH, 19 workshop wrap up 12.45 Health Scientist, CDC, USA

13.00- 20 Lunch Dr. L. Enkhbaatar 14.00

232 Cooperative Agreement Implementation

ANNEX 76. Participants’ list of the workshop on IPPP national assessment, April 7, 2008

Nî Name Agency / title 1 Theresa Turski CDC, USA Health scientist 2 G. Macdonald CDC, USA Health scientist 3 D. Garcia CDC, USA Project manager 4 P. Nymadawa Influenza project, PI 5 D. Sodbayar Influenza project manager 6 T. Altantsetseg NCCD, Head 7 N. Naranbat NCCD, Deputy head 8 D. Narnazul NCCD, Chief Surveill/ Dept 9 M. Altankhuu NCCD, Chief, Lab Dept 10 A. Burmaa NCCD, Infl/Surv/ epidemiologist 11 Ì. Tsolmon NCCD, Chief, Nosocomial infection section 12 B. Darmaa NCCD, Chief, Virology lab

13 L. Dashtseren NCCD, Epidemiologist

14 G. Tsetsegmaa NCCD, Physician 15 D. Oyuntsetseg NEMA, Senior officer, Secretary of NCC 16 D. Narangerel MoH, Senior officer 17 D. Tserennorov NCIDNF, Deputy director 18 V. Garmaa NCHD, Officer 19 P. Bolortuya MoFA, Officer 20 Sh. Munkhtur MoFA, Officer 21 S. Sugar Cent Vetere / Lab, Virologist 22 Ts. Erdene-Ochir CVL, Virologist 23 P. Bolor UNICEF, Officer 24 V. Surenchimeg UNICEF, Specialist 25 L. Ulzii-Orshikh WHO, Officer 26 D. Otgonbaatar MoH, deputy, Finance Div

27 D. Oyunchimeg SPIA, Chief, Health Insp Div

28 A. Enkhtuya SPIA, Epidemiologist

29 D. Enkhtsetseg Red Cross Society, officer

30 Rachel Stonecipher Peace Corps

233 B5265G1 Annual Report – 2007/2008

ANNEX 77. IPPP national assessment, April 2008

Level of Overall Level Capability Indicator Capability for of Capability Indicator Status of Plan 2 Dissemination 2 1.75 1 Exercises 2 Coordination and Resources for Country Planning 1 Plan (Coordination) 1 Coordination and Resources for 1 Plan (Resources) Collaboration between Human 1 and Animal Health 2 Research Priorities 1 Research and Use Environment of Support for 1.00 of Findings for 1 Pandemic Influenza Research and Use of Findings Preparedness Use of Data to Inform Decisions for Pandemic Influenza 1 Preparedness Status of Implementation of 2 Communications Plan

3 Messaging 3 2.25 Communications Dissemination 2

Staffing 2

Operational Status 0

Epidemiologists and Field 4 2 Epidemiologists 1.25 Epidemiologic Quality of Public Health 1 Capability Epidemiologists

Training 2

234 Cooperative Agreement Implementation

National Influenza Laboratory 1 Network

Bio-safety Level (BSL) and 5 2 Routine Testing of Specimens 1.75 Laboratory Capability Methods 2

Participation in WHO System 2

Integration of Virologic and 2 Epidemiologic Surveillance 6 Data Publication 3 2.50 Routine Influenza Surveillance Timeliness 2

Case Definitions 3

Awareness of Need to Report 2 7 Rumor Reporting 0 National Respiratory 1.25 Disease Surveillance Cross-Notification 1 and Reporting Timeliness 2

Human Resources for Outbreak 1 Response

8 Logistical Resources for Outbreak 0 Response 1.00 Outbreak Response Exercises or Response 1

Activation of Team 2

Availability of Antivirals 0

9 Storage Facilities 1 0.25 Resources for Containment Exercises and Practice 0

Distribution of Materials 0

235 B5265G1 Annual Report – 2007/2008

Social Distancing 2 10 Critical Infrastructure 0 Community-based 1.50 Interventions to Voluntary Isolation and 1 Prevent the Spread of Quarantine Influenza Percent of Districts with Plan 3

Standards of Infection Control by 2 Level of Health Care System

11 Human Resources 2 1.75 Infection Control Logistical Resources 1

Institutionalization of Infection 2 Control Efforts

Surge Capacity – Human 0 Resources

Surge Capacity – Physical 0 Facilities 12 0 Surge Capacity – Equipment 0 0.50 Health Sector Pandemic Response Surge Capacity – Clinical 2 Management Guidelines

Surge Capacity – Care of 0 Deceased

236 Cooperative Agreement Implementation

ANNEX 78. Program of the workshop on first quarter activities in 2008 for sentinel surveillance sites in the capital city, May 2, 2008

No Topic Time Responsible person

1 Registration 13.30 – 13.50 Dr. L. Enkhbaatar

2 Opening speech 13.50 – 14.00 Prof. P. Nymadawa

Result of virus isolation and 3 specimen collection 14.00 – 14.30 Dr. B. Darmaa in the first quarter of 2008 Model IPPP at family clinic 5 14.30 – 15.00 Dr. R. Oyungerel level

6 Tea/Coffee break 15.00 – 15.30 Dr. L. Enkhbaatar

ISSS estimation of virus isolation and 7 15.30 – 16.00 Dr. D. Sodbayar specimen collection in 1st quarter of 2008 Dr. D. Sodbayar 8 Discussion 16.00 - 16.30 Dr. B. Darmaa Dr. L. Enkhbaatar

9 Closing 16.30 – 16.40 Dr. L. Enkhbaatar

10 Remuniraton allowance 16.40 – 17.40 Dr. D. Sodbayar

11 Tea/Coffee break 16.40 – 17.40 Dr. L. Enkhbaatar

237 B5265G1 Annual Report – 2007/2008

ANNEX 79. Participants’ list of the workshop on first quarter activities in 2008 for sentinel surveillance sites in the capital city, May 2, 2008

No Particiapmt’s name Organization Title

Deputy director in charge of 1. T. Chimgee MCHRC tratment 2. B. Otgonchimeg MCHRC Nurse 3. Ts. Gantuya MCHRC Statistician doctor Physician, respiratory infection 4. Kh. Naranchimeg MCHRC ward 5. Munkhkhishig MCHRC Outpatinet clinic 6. N. Naranzul MCHRC Nursing department 7. B. Khandaa MCHRC Statistician 8. Riza MCHRC Statistician 9. Sh. Altantsetseg MCHRC Head, Pediatric ward 10. Oyunbaatar MCHRC Physician Deputy head in charge of 11. S. Tsevelmaa KhUD hospital treatment 12. D. Surenjav KhUD hospital Head, pediatric ward 13. G. Tserendolgor KhUD hospital Quality manager 14. Munkhtsetseg KhUD hospital Statistician assistant 15. Nymadawaa KhUD hospital Nurse, admission ward Deputy head in charge of 16. N. Jantsan BZD hospital treatment 17. Radnaatseren BZD hospital Epidemiologist 18. Tsevelmaa BZD hospital Statistician 19. Erdenetsetseg BZD hospital Quality manager 20. Baigali BZD hospital Head, pediatric ward Deputy head in charge of 21. O. Enhtuya SKhD hospital treatment 22. A. Delgerbayar SKhD hospital Epidemiologist 23. B. Purevjav SKhD hospital Statistician 24. B. Majigsuren SKhD hospital Head, pediatric ward 25. O. Chuluuntsetseg SKhD hospital Nurse 26. B. Shinehuu BGD hospital Epidemiologist

238 Cooperative Agreement Implementation

27. L.Sodonjargal BGD hospital Nurse 28. Narantya BGD hospital Statistician Deputy head in charge of 29. Kuma BGD hospital treatment 30. D. Batzaya BGD hospital Nurse Deputy head in charge of 31. T. Buyanjargal SBD hospital treatment 32. N. Narantungalag SBD hospital Epidemiologist 33. J.Saikhangerel SBD hospital Statistician 34. Oyuntstseg SBD hospital Epidemiologist Deputy head in charge of 35. Enkhtuya ChD hospital treatment 36. Bolortuya ChD hospital Epidemiologist 37. Z. Tsetsegmaa ChD hospital Statistician Physician,internal medicine 38. Khandaasuren ChD hospital ward 39. Ts. Lkhagva ChD hospital Head, intensive care unit 40. Sh. Altanhuyag Eruul urh FGP Leader 41. E. Baigalmaa Eruul urh FGP Physician 42. Altantuya Eruul urh FGP Physician 43. J. Oyunsetseg Eruul urh FGP Nurse 44. J. Narantsetseg Eruul urh FGP Nurse 45. Ts. Tonya Amgalan itgehui FGP Physician 46. Bumaa Amgalan itgehui FGP Nurse 47. Bolormaa Amgalan itgehui FGP Leader 48. A. Dolgormaa Amgalan itgehui FGP Nurse 49. B. Sarantuya Amgalan itgehui FGP Nurse 50. Ch. Tseren nadmid Nasan urt FGP Leader 51. M. Enhtuya Nasan urt FGP Physician 52. L. Tserenbaljid Nasan urt FGP Nurse 53. B. Oyunbileg Nasan urt FGP Nurse 54. D. Amarjargal Nasan urt FGP Nurse 55. D. Narantsetseg Enh titem FGP Leader 56. L. Oyuntuya Enh titem FGP Physician 57. Myagmarsuren Enh titem FGP Nurse 58. T. Munhtsetseg Enh titem FGP Nurse 59. Javzanorlom Enh titem FGP Nurse 60. D. Tuul Amin tus FGP Leader

239 B5265G1 Annual Report – 2007/2008

61. Amchlansuren Amin tus FGP Physician 62. D. Dolgorsuren Amin tus FGP Nurse 63. E. Amgalansuren Amin tus FGP Nurse 64. Sh.Tsatsaral Amin tus FGP Nurse 65. B. Sarantuya Manal uils FGP Leader 66. B. Otgonhuu Manal uils FGP Physician 67. D.Mendjargal Manal uils FGP Nurse 68. D. Erdenetuya Manal uils FGP Nurse 69. L.Ojuntsetseg Manal uils FGP Nurse 70. Ganchimeg Shijid dug FGP Leader 71. Uranchimeg Shijid dug FGP Physician 72. Hishigt Shijid dug FGP Physician 73. Unurjargal Shijid dug FGP Nurse 74. Ganjargal Shijid dug FGP Nurse 75. M. Purevdorj Tegsh mend FGP Leader 76. Shagdarsuren Tegsh mend FGP Physician 77. Nyamaa Tegsh mend FGP Physician 78. Oyungerel Tegsh mend FGP Nurse 79. Amarzaya Tegsh mend FGP Physician 80. B. Otgonbayar Uils negten FGP Leader 81. Dorjhand Uils negten FGP Nurse 82. Sarannyam Uils negten FGP Physician 83. D.Baigalmaa Uils negten FGP Nurse 84. Javzanorlom Uils negten FGP Nurse 85. J. Lhagvasuren Shar degd FGP Leader 86. O. Gantumur Shar degd FGP Nurse 87. M. Munhjargal Shar degd FGP Physician 88. G. Lhagvasuren Shar degd FGP Physician 89. I. Oyuntsetseg Shar degd FGP Nurse 90. A. Tsend-Ayush Itgel ugtakh FGP Leader 91. H. Purev Itgel ugtakh FGP Physician 92. Ch. Bud Itgel ugtakh FGP Physician 93. D. Erdenechimeg Itgel ugtakh FGP Nurse 94. D. Gantuya Itgel ugtakh FGP Nurse 95. D. Munhjargal Gurvan sanchir FGP Leader 96. B. Nomin-erdene Gurvan sanchir FGP Physician 97. Munhtuya Gurvan sanchir FGP Nurse 240 Cooperative Agreement Implementation

98. G. Sainbayar Gurvan sanchir FGP Nurse 99. Uugantsetseg Gurvan sanchir FGP Nurse 100. S. Norjmaa Unu-Achit FGP Leader 101. N.Sugarsuren Unu-Achit FGP Physician 102. Tsengel Unu-Achit FGP Physician 103. U.Tumenjargal Unu-Achit FGP Nurse 104. U. Tumee Unu-Achit FGP Nurse 105. Ch. Unursaihan Enh-elberel FGP Leader 106. G.Enkhtuya Enh-elberel FGP Physician 107. L.Tsetsegee Enh-elberel FGP Nurse 108. Ts.Munkhtsetseg Enh-elberel FGP Physician 109. Suvd Enh-elberel FGP Nurse 110. D. Altantsetseg Buyant-manal FGP Leader 111. O. Udvaltsetseg Buyant-manal FGP Physician 112. A. Munhtsetseg Buyant-manal FGP Nurse 113. M. Undarmaa Buyant-manal FGP Physician 114. Ch.Saruulchimeg Buyant-manal FGP Nurse 115. Munhchimeg Enh sunder FGP Physician 116. Enhtuya Enh sunder FGP Physician 117. G.Tserendolgor Enh sunder FGP Nurse 118. Turbat Enh sunder FGP Physician 119. L.Tsetsegee Enh sunder FGP Nurse 120. S. Selenge Sankoll FGP Leader 121. Undram Sankoll FGP Nurse 122. B.Tserenpil Sankoll FGP Nurse 123. Taivanjargal Sankoll FGP Nurse 124. D. Oyun Sankoll FGP Physician 125. D. Tsetsegmaa Tegsh mend FGP Leader 126. G.Davaadulam Tegsh mend FGP Nurse 127. D.Batotgon Tegsh mend FGP Nurse 128. Enkhjargal Tegsh mend FGP Physician 129. Tungalag Tegsh mend FGP Physician 130. Chuluuntsetseg Ami-erdene FGP Leader 131. Ganchimeg Ami-erdene FGP Physician 132. Enkhtuya Ami-erdene FGP Physician 133. Dolgorsuren Ami-erdene FGP Nurse

241 B5265G1 Annual Report – 2007/2008

ANNEX 80. Program of the workshop for TTX moderators on IPPP sub-national assessment, September 29, 2008

¹ Topic Time Responsible Opening (workshop objective, its expected result, 1 11.00-11.10 Prof. P. Nymadawa general issue of TTX organizaton, moderotaor and group scheduleèé) Sub-national (provincial and district) 2 11.10-13.00 Prof. P. Nymadawa level assessment on IPPP 3 Lunch 13.00-14.00 Dr. L. Enkhbaatar 4 IPPP planning at FGP level (discussion) 14.00-15.30 Dr. R. Oyungerel 5 Wrap up 15.30-16.00 Prof. P. Nymadawa

ANNEX 81. Participants’ list of the workshop for TTX moderators on IPPP sub-national assessment, September 29, 2008

No Particiapmt’s name Organization Title 1. P. Nymadawa NCCD, Project team PI and Project director 2. D. Sodbayar NCCD, Project team Project manager 3. Ts. Rentsenmaygmar NCCD Deputy director 4. Ch. Munkhtsetseg NCCD Head, national surveillance unit 5. L. Dashtseren NCCD Senior epidmiologist 6. N. Khorolsuren HSUM, Project team Lecturer, head of clinical team 7. R. Oyungerel HSUM Lecurer 8. L. Enkhbaatar NCCD, Project team Outreach supervisor 9. A. Burmaa NCCD, Project team Head, epidemiology team 10. D. Tserennorov NCIDNF Deputy diector 11. WHO country office in L. Ulzii-Oshikh CRS fficer Mongolia 12. M. Altankhuyag “Healthy family” FGP Leader 13. D. Oyuntsetseg NEMA Health officer

242 Cooperative Agreement Implementation

ANNEX 82. Equipment and Devices supplied to IST Epidemiology& Management group in 2007/2008 season

No Barimt No Description Quantity Total price, USD

1. 005 Computer and UPS 1 833 310

2. 005 UPS 1 81 558

3. 18 Printer cartridge 4 274 000

4. 65 Paper 5 box 90 000

5. 79 Paper 5 box 90 000

6. 80 Printer cartridge 2 143 000

7. 80 Stationary cost for January 2008 146 200

8. 85 PC mouse 1 15 000

9. 88 Laptop 1 1 540.00

10. 97 Printer cartridge 2 174 900

11. 105 Digital photo camera 1 219 900

12. 120 Printer cartridge 1 87 375

13. 121 Paper 5 box 83 000

14.

243 B5265G1 Annual Report – 2007/2008

ANNEX 83. Laboratory and office equipment received in VL/NCCD in the fiscal year of 2007/2008

Barimt Total price, No Description Quantity No USD 1. 006 Laboratory balance 1 100 000 2. PC with LCD screen for installation of 1 725 500 33 digital microscopy 3. Table for installation of digital 1 174 800 33 microscopy 4. 051 Laboratory shelf 1 350 000 5. 85 Printer cartridge 1 60 000 6. 85 PC mouse 1 15 000 7. 120 Printer cartridge (colorous) 1 100 999 8. 121 Printer cartridge 2 134 000 9. 134 Mini refrigerator 2 379 800 10. 134 Thermometer 2 13 600 11. 134 Electric cord 4 73 798

244 Cooperative Agreement Implementation

ANNEX 84. Laboratory reagents and other consumables received in VL/NCCD in the fiscal year of 2007/2008 Total price, No Description Quantity USD 1. 002/04 50 100.00 2. DHI D3 DFA kit for detection of respiratory viruses 25 kit 27 500.00 3. ReadyCells R-Mix (box of 24 vials) 100 box 17 800.00 4. ReadyCells R-Mix Rinse Buffer (75 ml) 50 bttl 1 700.00 5. ReadyCells R-Mix Refeed Medium (100 ml) 50 bttl 3 100.00 6. Disinfectant 4 bttl 120 000 7. Prepayment for Aglag Med order, 2007 IV 123 809.00 8. Water purification system EASYPure ® RoDi 1 7,180 9. EASYpure RoDi start up kit 1 739 10. EASYpure RoDi cartridge kit 3 1,212 11. Wall mounting bracket 1 556 12. External booster pump RoDi 1 1,062 13. Pre-filtration accessory for turbid water 1 579 14. Final filter for Deionzation System 5 810 Thermo Scientific Revco ® UltimaTM II Ultra-Low 15. 1 24,314 Chest Freezers. Inventory Racks for Thermo Scientific Revco ® Upright 16. 1 329 Freezers Nunc ® CryoTube ® Starfooted Cryogenic Vials with 17. 40 1,800 external thread; 1.8 mL. 18. BOX F/CRYO-VIAL 100 VIAL 10/PK, Vial size 1-2 ml 5 745 19. Nunc TM Thermanox ® Coverslip 2 802 20. Thin-wall 8-tube strips, 0.2 mL. 20 2,720 21. 8-strip caps for thin-wall 8-PCR tube strip. 20 840 Cellulose Nitrate (CN) Filter Units; 150 mL, 0.20 μm Pore 22. 10 1,460 Size. Disposable Sterile Filter Units; membrane, plain, CN; 23. 10 2,960 capacity, 500mL; pore size, 0.2μ. 24. Sigma Hanna pH Meter model HI 9024. 1 835 Corning ® cell culture flask, 25 cm2, canted neck, plug seal 25. 2 2,374 cap, sterile. 245 B5265G1 Annual Report – 2007/2008

Corning ® cell culture flask, 75 cm2, canted neck, plug seal 26. 10 4,910 cap, sterile. Corning ® cell culture flask, 150 cm2, canted neck, plug 27. 5 2,065 seal cap, sterile. Nunc 96-Well Microplates, well shape, round; well 28. 18 8,100 volume, 0.3mL, (case of 60) TPP culture plates 96-well, flat bottom, pkg of individually 29. 8 6,960 wrapped Cole-Parmer ® Serological Pipettes, sterile, individually 30. 5 690 wrapped, 2.0 mL, standard tip style. Cole-Parmer ® Serological Pipettes, Individually 31. 20 2,140 Wrapped, 5.0 mL, Standard Tip Style. Cole-Parmer ® Serological Pipettes, Individually 32. 30 2,910 Wrapped, 10.0 mL, Standard Tip Style EW-13000-39 33. 60 6,240 PIPET SHRT 25ML IND WRP 100/PK 34. Pyrex ® Brand 1000 Griffin Low-Form Beaker, 50 mL. 1 80 35. Pyrex ® Brand 1000 Griffin Low-Form Beaker, 100 mL. 1 84 36. Beaker, Griffin low-form, Pyrex ® Brand 1000, 250 mL. 1 82 37. Pyrex ® Brand 1000 Griffin Low-Form Beaker, 400 mL. 1 97 38. Pyrex ® Brand 1000 Griffin Low-Form Beaker, 800 mL. 2 168 39. Pyrex ® Brand 1000 Griffin Low-Form Beaker, 1000 mL. 2 194 40. Economy sample bottle; 500 mL 1 328 41. Economy sample bottle; 1L 1 404 42. Cylinder, 50 ml, Class A, tolerance ± 0,25 ml 5 655 43. Cylinder, 100 ml, Class A, tolerance ±0,40 ml 5 650 44. Cylinder, 500 ml, Class A, tolerance ±1.3 ml 5 855 45. Cylinder, 1000 ml, Class A, tolerance ± 3 ml 5 945 46. Foam Laboratory Brush Set 5 210 47. Pyrexplus ® Brand 65340 flask; 250 mL. 1 655 48. Pyrexplus ® Brand 65340 flask; 500 mL. 1 288 49. Pyrexplus ® Brand 65340 flask; 1000 mL. 1 616 50. Tygon ® vacuum tubing, 3/8”ID x 7/8”OD, 10 ft/pack 2 304 51. Pyrex ® Brand 4980 flask; 2000 mL, graduated. 5 210 52. Modular stainless steel drying rack, 32 assorted color pegs 1 852 TwistitTM black rubber stopper, size 6, the stoppers as either 53. 264 a solid, two-hole.

246 Cooperative Agreement Implementation

TwistitTM black rubber stopper, size 7, the stoppers as either 54. 264 a solid, two-hole. TwistitTM black rubber stopper, size 8, the stoppers as either 55. 264 a solid, two-hole. 56. High-purity silicone stopper, size 7 2 76 57. High-purity silicone stopper, size 8 1 38 58. High-purity silicone stopper, size 10 10 290 Dulbecco’s Modified Eagle Medium (D-MEM) high 59. glucose (1X), liquid, with L-glutamine, without sodium 8 1,016 pyruvate 60. HEPES Buffer Solution (1 M) 5 620 61. Bovine Albumin Fraction V Solution (7.5%) 40 6,480 62. Trypsin-EDTA (0.05% Trypsin, with EDTA 4Na) (1X) 10 320 63. Fetal Bovine Serum, ES Cell-Qualified (US) 40 6,840 Gentamicin Reagent Solution 64. 1 308 (10 mg/ml), liquid Penicillin-Streptomycin, liquid Contains 10,000 units of 65. 10 1,260 penicillin and 10,000 ug of streptomycin. RNaseOUT™ Recombinant Ribonuclease Inhibitor, 5000 66. 10 4,450 units 67. 100 bp DNA Ladder. For Determining 100 bp Differences 3 990 Receptor Destroying Enzyme Kit (RDE), 20ml x 5 68. 5 3,710 (Lyophilized). 69. Glycerol for molecular biology, ≥99% 10 2,700 Dialysis tubing cellulose membrane avg. flat width 33 mm 70. 3 810 (1.3 in.) Magnetic weighted tubing closures; max gripping width, 71. 4 344 35mm Amphotericin B solution 72. sterile-filtered, 250 μg/mL in deionized water, cell culture 5 1,050 tested 73. Embryonated egg 1 807 1 084 200 74. Liquid nitrogen 1 ballon 100 000 75. Carbohydrate gaz 1 ballon 37 000 76. Pipette tips 4 pkg 100 000 77. Prepayment for Gyals order, 2008 I 88 401.00 $ 78. Adjustable-Volume Pipettor, Eppendorf, 0.1-2.5 ul 3 840 79. Adjustable-Volume Pipettor, Eppendorf, 0.5-10 ul 3 840

247 B5265G1 Annual Report – 2007/2008

80. Adjustable-Volume Pipettor, Eppendorf 2-20 ul 3 810 81. Adjustable-Volume Pipettor, Eppendorf, 10-100 ul 3 810 82. Adjustable-Volume Pipettor, Eppendorf, 20-200 ul 3 810 83. Adjustable-Volume Pipettor, Eppendorf, 100-1000 ul 3 810 Filter Pipette Tips, 0.2-10 ul, package of 10 racks of 96 84. 10 1,600 each, sterile Filter Pipette Tips, 30 ul, package of 10 racks of 96 each, 85. 10 1,300 sterile Filter Pipette Tips, 100 ul, package of 10 racks of 96 each, 86. 10 1,300 sterile Filter Pipette Tips, 200 ul, package of 10 racks of 96 each, 87. 10 1,300 sterile Filter Pipette Tips, 1000 ul, package of 10 racks of 96 each, 88. 10 1,650 sterile 89. Eppendorf Pippette tips, 2.5 ul, pkg of 10 racks of 96 5 375 90. Eppendorf Pippette tips, 20 ul, pkg of 10 racks of 96 5 350 91. Eppendorf Pippette tips, 200 ul, pkg of 10 racks of 96 5 325 92. Eppendorf Pippette tips, 1000 ul, pkg of 10 racks of 96 5 300 93. L-550 Table Top Centrifuge 1 2,800 94. Rotor for microwell plate 6 96 well plates, GL-21MC 1 765 Haier, China (US and German shareholders). Class II, Type A2, Biosafety Cabinet. Air inlet and outlet utilize 99.99% efficient HEPA filters. EBM (Germany) fan, AAF (USA) filter with 99.99% efficient utilization, front glass balancer suspension prevents leaking, 6mm anti ultraviolet radiation toughened front glass, work area is stainless steel, circular art filtration for complete washing, stainless steel water faucet, anti burst and splash receptable, Audible 95. 1 7,800 alarm system signals cabinet operational readiness and warns of motor/blower failure or exhaust blockage, exterior is chemically resistant polyurethane enamel, 220-240V and 50/60Hz power requirement, solid-state air speed controller, exterior dimensions 1360x780x2200, interior dimensions 1200x610x680, UV light is optional higher than 30W, drip-proof duplex electrical outlet, 9ft cord, optional cabinet stand. Model No: DW-86L286, Volume: 286 L, Temp: -10 ~ -86 C, Precision: 1 C, Volage: 220-240V, 50 Hz, Exter. Dim: 96. 1 9,900 875x915x1638 mm, Inter. Dim: 515x595x908 mm, Net Weight: 270 kg, Gross Weight: 300 kg, Warranty: 1 year 97. 125 Strips with 8 PCR tubes 4 400 98. 125 strips with 8 PCR optical caps 10 400 248 Cooperative Agreement Implementation

99. Centi-Sep Spin Columns 100 5 3,225 100. Centi-Sep 8 well strips (12) 10 3,700 101. Glass Slides 75x25 mm and are 1 mm thick; 50 per pack 14 308 Cover Glass 22x40mm and 0.13-0.17mm thick; 100 per 102. 242 pack 103. 96 well Si PCR plate Mat 1x5 mat/ Box 10 240 104. 96 Well PCR Plate (0.2ml; 50pkg 10 3,650 105. 96 Well PCR Plate (0.2ml; 40pkg 12 2,100 106. 96 Well PCR Plate (0.2ml; 40pkg 5 825 107. PCR Tube Sealing Film (Roll for x100) 5 700 PCR Tube Single Sealing Films DSMO 108. 5 925 Resistant (x100) 109. 40Lx 22W, 0.25mm deep (100 per pack) 2 660 N1-F, 5’ TTGCTTGGTCAGCAAGTGCA 3’, 110. 125 50 mM N1-R, 5’ TCTGTCCATCCATTAGGATCC 3’, 111. 125 50 mM N2-F, 5’ ATGGTCCAGCTCAAGTTGTCA 3 ‘ 112. 125 50 mM N2-R, 5’ TCCAGTTATGTGTGCTCAGG 3’ 113. 125 50 mM 114. AccuPower RT/PCR Premix (96) 5 1,900 EXOSap-IT/ Exonuclase I: Recombinant, SAP: Pandalus 115. 2 900 borealis 116. 3130 POP-7 Performance Polymer 3.5 ml 3 960 117. 3130 xl 10x Genetic Analysis Buffer with EDTA 25 ml 5 800 118. BigDye terminator 3.1 Cycle sequencing kit 100 rxns 5 8,250 119. BigDye terminator 3.1 Sequencing buffer 28 ml 5 8,000 120. BigDye x Terminator purification kit 20 ml 4 12,200 FLUAM-1F (100 mM) 5’- 121. 125 AAGACCAATCCTGTCACCTCTGA-3’ FLUAM-2F (100 mM) 5’- 122. 125 CATTGGGATCTTGCACTTGATATT-3’ FLUAM-1R (100 mM) 5’- 123. 125 CAAAGCGTCTACGCTGCAGTCC-3’ FLUAM-2R (100 mM) 5’- 124. 125 AAACCGTATTTAAGGCGAC GATAA-3’

249 B5265G1 Annual Report – 2007/2008

TaqMan probe FLUAM-1P (5 mM) 5’-(FAM)- 125. 1 240 TTTGTGTTCACGCTCACCGT-(TAMRA)-3’ TaqMan probe FLUAM-2P (5 mM) 5’-(FAM)- 126. 1 360 TGGATTCTTGATCGTCTTTTCTTCAAATGCA-(TAMRA)-3’ Forward primer H1-247f (100 mM) 5’- 127. 125 AACATGTTACCCAGGGCATTTCGC-3’ Reverse primer H1-361r (100 mM) 5’- 128. 125 GTGGTTGGGCCATGAGCTTTCTTT-3’ TaqMan probe H1-278p (10mM) 5’-(VIC)- 129. GAGGAACTGAGGGAGCAATTGAGTTCAG- 1 330 (TAMRA)-3’ Forward primer H3-293f (100 mM) 5’- 130. 125 ACCCTCAGTGTGATGGCTTCCAAA-3’ Reverse primer H3-400r (100 mM) 5’- 131. 125 TAAGGGAGGCATAATCCGGCACAT-3’ TaqMan probe H3-384p (10mM) 5’-(FAM)- 132. 1 310 ACGCAGCAAAGCCTACAGCAACTGTT-(TAMRA)-3’ Forward primer H5-266F (100 mM) 5’- 133. 125 TGCCGGAATGGTCTTACATAGTG-3’ Forward primer H5-1615F (100 mM) 5’- 134. 125 GTGGCGAGCTCCCTAGCA-3’ Reverse primer H5-347R (100 mM) 5’- 135. 125 TCTTCATAGTCATTGAAATCCCCTG-3’ Reverse primer H5-1695R (100 mM) 5’- 136. 125 TCTGCATTGTAACGACCCATTG-3’ TaqMan probe H5-290P (5 mM) 5’- 137. (FAM)-AGAAGGCCAATCCAGTCAATGA 1 360 CCTCTGTTA-(TAMRA)-3’ TaqMan probe H5-1634P (5 mM) 5’- 138. (FAM)-TGGCAATCATGGTAGCT 1 370 GGTCTATCCTTATGG-(TAMRA)-3’ 139. RSVAB F, 5’ GTCTTACAGCCGTGATTAGG 3’ 1 25 140. RSVAB R, 5’ GGGCTTTCTTTGGTTACTTC 3’ 1 25 141. RSVA F, 5’ GATGTTACGGTGGGGAGTCT 3’ 1 25 142. RSVA R, 5’ GTACACTGTAGTTAATCACA 3’ 1 25 143. RSVB F, 5’ AATGCTAAGATGGGGAGTTC 3’ 1 25 144. RSVB R, 5’ GAAATTGAGTTAATGACAGC 3’ 1 25 145. PIP2 F, 5’ AACAATCTGCTGCAGCATTT 3’ 1 25 146. PIP2 R, 5’ ATGTCAGACAATGGGCAAAT 3’ 1 25 147. CMV IgG ELISA kit 96 tests, 2 190 250 Cooperative Agreement Implementation

148. CMV IgM ELISA kit 96 tests, 2 190 149. Herpes (1) IgG ELISA kit 96 tests 2 190 150. Herpes (1) IgM ELISA kit 96 tests 2 190 151. Herpes (2) IgG ELISA kit 96 tests 2 190 152. Herpes (2) IgM ELISA kit 96 tests 2 190 H1N1 NA-F673-694 5’- 153. 125 AGAACACARGAGTCTGAATGTG-3’; 100mM H1N1 NA-R843-862 5’- 154. 125 CTGTGCCAGTGTCTGGGTAA-3’; 100 mM FAM-275Y-H1N1-F812-827 5’-FAM- 155. 1 240 CACCCAMTTTTTATTA-MGB-3’; 100 mM VIC-H275-H1N1-F812-8275’-VIC- 156. 1 240 CACCCAMTTTTCATTA-MGB-3’; 100mM 157. Payment for Aglag Med order, 2007 I 35 679.00 500 disposable connectors for use with QIAamp spin 158. 10 2,010.0 columns on luer connectors Vacuum manifold for processing 1–24 spin columns: 159. includes QIAvac 24 Plus Vacuum Manifold, Luer Plugs, 1 340.0 Quick Couplings System to connect vacuum manifold with vacuum pump: 160. includes Tray, Waste Bottles, Tubing, Couplings, Valve, 1 1,160.0 Gauge, 24 VacValves 161. 4 DyeEx 96 Plates; 4 Collection Plates, 48-Well 5 2,725.0 162. 24 DyeEx 96 Plates; 4 Collection Plates, 48-Well 5 14,425.0 Invitrogen Super Script ™ lll OneStep RT-PCR system 163. 10 8,190.0 with Platinum® Taq DNA Polymerase Kit (100) For 100 reactions: QIAGEN OneStep RT-PCR Enzyme 164. Mix, 5x QIAGEN OneStep RT-PCR Buffer, dNTP Mix, 3 2,520.0 5x Q-Solution, RNase-free water For 50 RNA preps: 50 QIAamp Mini Spin Columns, 165. 3 1,020.0 Carrier RNA, Collection Tubes (2 ml), RNase-free Buffers 50 MinElute Spin Columns, Buffers, Collection Tubes (2 166. 5 850.0 ml) 167. 50 DyeEx Spin Columns, Collection Tubes (2 ml) 5 1,305.0 For 250 DNA preps: 250 QIAamp Mini Spin Columns, 168. QIAGEN Proteinase K, Reagents, Buffers, Collection 1 8390.0 Tubes (2 ml) 3 x 1.7 ml Taq PCR Master Mix‡ containing 250 units Taq 169. 1 260.0 DNA Polymerase total, 3 x 1.7 ml distilled water 170. Prepayment for Gyals order, 2008 Aug 57 000. 00 251 B5265G1 Annual Report – 2007/2008

CTT GTG CTT TGT GTC GGC RTG YAA YGA YTT 171. 150 YTC WG GGT GCT CAC TAG GAG GTC YCT RTT RTA RTC 172. 150 YTC CCA 173. CTT GTG CTT TGT GTC GGC 1 30 174. GGT GCT CAC TAG GAG GTC 1 30 175. CAA TAC GGC ATT TGG ACT TGA ACT GTA TG 1 40 176. CGG TAC CYT TGT RCG CCT G 1 30 GCG GAA CCG ACT ACT TTG GGT GTC CGT GTT 177. 150 TC CCC ATG TCA GTC AGC GCA TCI GGI ARI TTC 178. 150 CAI YAC CAI CC 179. R-Mix ReadyCells (box of 24 vials ) 200 35600 180. R-Mix ReadyCells, Refeed medium (100ml) 36 2232 181. R-Mix ReadyCells, Rinse buffer (75ml) 30 1020 182. DHI D3 DFA Respiratory virus screening kit 80 88000 183. D3 IFA Enterovirus ID kit 40 41600 184. R-Mix ReadyCells Cluster Plate, 48 well/48 fill 50 25000 185. 8 well identification slide with blotters (100) 10 1000 Micro cover glass 24×60mm, thickness .1 0.12-0.17mm, 186. № 8 800 200Pcs 187. Acetone 15 750 188. Pipette tips 4 pkg 250 000 189. Effndorf tube 0.5 ml 2 pkg 150 000 190. Effndorf tube 0.2 ml 2 pkg 150 000 191. Laboraory gloves 10 box 80 000

252