DOCSLIB.ORG
Explore
Sign Up
Log In
Upload
Search
Home
» Tags
» OR4F5
OR4F5
Supplemental Note Hominoid Fission of Chromosome 14/15 and Role Of
Genetic Variation Across the Human Olfactory Receptor Repertoire Alters Odor Perception
Assembly and Annotation of an Ashkenazi Human Reference Genome
Chr Start End Size Gene Exon 1 69482 69600 118 OR4F5 1 1 877520
A Bedr Way of Genomic Interval Processing Syed Haider1†, Daryl Waggott1†, Emilie Lalonde1,2, Clement Fung1, Fei-Fei Liu2,3 and Paul C
Gnomad Lof Supplement
Us 2018 / 0305689 A1
Data Formats Document Table of Contents
High-Resolution DNA Analysis of Human Embryonic Stem Cell Lines Reveals Culture-Induced Copy Number Changes and Loss of Heterozygosity
Explorations in Olfactory Receptor Structure and Function by Jianghai
{'Ess': 0, 'Noness': 3} True 70007 AAGATCTAAAACTTTACACTAG []
Standard Sequencing Service Data File Formats File Format V2.4 Software V2.4 December 2012
Somatic Mutations
Diverse LEF/TCF Expression in Human Colorectal Cancer Correlates with Altered Wnt-Regulated Transcriptome in a Meta-Analysis of Patient Biopsies
Data Formats Document Table of Contents
Protein Function Prediction from Genome Sequence Based on PFP Algorithm
Research/0018.1
Supplementary Table 7
Top View
Lupus Nephritis Supp Table 7
Gene List and Enhanced Coverage
Ligand-Receptor Interactions Involved in Chemical Senses. Insights From
The Mutational Landscape of Human Olfactory G Protein-Coupled Receptors
WO2012031008A2.Pdf
Expression Pattern and Biological Significance of the Lncrna ST3GAL6-AS1 in Multiple Myeloma
Identification of Candidate Biomarkers and Pathways Associated with Type 1 Diabetes Mellitus Using Bioinformatics Analysis