Human GLI2 and GLI1 Are Part of a Positive Feedback Mechanism in Basal Cell Carcinoma

Human GLI2 and GLI1 are part of a positive feedback mechanism in Basal Cell Carcinoma

Gerhard Regl1, Graham W Neill2, Thomas Eichberger1, Maria Kasper1, Mohammed S Ikram2, Josef Koller3, Helmut Hintner3, Anthony G Quinn2, Anna-Maria Frischauf1 and Fritz Aberger*,1

1Institute of Genetics, University of Salzburg, A-5020 Salzburg, Austria; 2Center for Cutaneous Research, St. Bartholomew’s & The Royal London School of Medicine & Dentistry, Queen Mary, University of London, London, UK; 3Department of Dermatology, St. Johann Hospital, A-5020 Salzburg, Austria

Transgenic mouse models have provided evidence that primary event in the formation of BCC (Gailani et al., activation of the zinc-finger transcription factor GLI1 by 1996; Hahn et al., 1996; Johnson et al., 1996). In the Hedgehog (Hh)-signalling is a key step in the initiation absence of HH ligand, PTCH inhibits Hh-target gene of the tumorigenic programme leading to Basal Cell expression, while loss of PTCH activity leads to Carcinoma (BCC). However, the downstream events increased expression of the Hh target genes GLI1 and underlying Hh/GLI-induced BCC development are still PTCH itself (for reviews see Goodrich and Scott, 1998; obscure. Using in vitro model systems to analyse the Hahn et al., 1999; Ingham, 1998; Toftgard, 2000; effect of Hh/GLI-signalling in human keratinocytes, we Villavicencio et al., 2000). Further evidence supporting identified a positive feedback mechanism involving the the importance of activated Hh-signalling in BCC has zinc finger transcription factors GLI1 and GLI2. come from studies of genetic mouse models and skin Expression of GLI1 in human keratinocytes induced grafting experiments: (1) heterozygous ptc+/7 mice the transcriptional activator isoforms GLI2a and GLI2b. develop BCC-like features upon UV-irradiation, though Both isoforms were also shown to be expressed at sporadic BCC formation does not normally occur in elevated levels in 21 BCCs compared to normal skin. mice (Aszterbaum et al., 1999). (2) Human keratinocytes Detailed time course experiments monitoring the tran- expressing Sonic hedgehog (SHH) form BCC-like scriptional response of keratinocytes either to GLI1 or to structures when grafted onto the back of nude mice GLI2 suggest that GLI1 is a direct target of GLI2, while (Fan et al., 1997). (3) Overexpression of mediators of Hh- activation of GLI2 by GLI1 is likely to be indirect. signalling such as SHH, GLI1, Gli2 and an oncogenic Furthermore, expression of either GLI2 or GLI1 led to form of SMOH, in epidermal cells of transgenic mice an increase in DNA-synthesis in confluent human leads to the induction of BCC-like tumours (Fan et al., keratinocytes. Taken together, these results suggest an 1997; Grachtchouk et al., 2000; Nilsson et al., 2000; Oro important role of the positive GLI1-GLI2 feedback loop et al., 1997; Xie et al., 1998). Gli1 and Gli2 are members in Hh-mediated epidermal cell proliferation. of the GLI family of zinc finger transcription factors Oncogene (2002) 21, 5529 – 5539. doi:10.1038/sj.onc. (Ruppert et al., 1988). During embryonic development of 1205748 vertebrates both genes, whose expression is partially overlapping, are transcriptionally activated in response Keywords: Basal Cell Carcinoma; Hedgehog signalling; to Hh-signalling and are able to mediate most of the GLI genes; cell proliferation effects caused by activation of the pathway (reviewed in Matise and Joyner, 1999; Ruiz i Altaba, 1999). GLI1 was originally identified as an oncogene Introduction amplified in glioblastoma. It acts as a transcriptional activator and together with E1A is able to transform Basal Cell Carcinoma (BCC) of the skin represents the primary cells (Kinzler et al., 1987; Ruppert et al., most common tumour in the western world. Genetic 1991). Expression of human GLI1 in basal keratino- studies of the basal cell nevus or Gorlin syndrome, which cytes of transgenic mice results in the development of predisposes patients to the early development of multiple several types of skin tumours, some of which show BCCs, have shown that mutational inactivation of the BCC-like features (Nilsson et al., 2000). Further Hedgehog (Hh)-receptor protein Patched (PTCH1) is the evidence for a critical role of GLI1 in tumorigenesis comes from overexpression studies in frogs, where GLI1 can also induce structures resembling epidermal tumours (Dahmane et al., 1997). *Correspondence: F Aberger, Institute of Genetics, University of Most studies of Gli2 have focused on embryonic Salzburg, Hellbrunner Strasse 34, A-5020 Salzburg, Austria; E-mail: [email protected] development, where it plays a crucial role in neural, Received 22 November 2001; revised 21 May 2002; accepted 7 June lung, and skeletal development (Ding et al., 1998; 2002 Hardcastle et al., 1998; i Altaba, 1998; Matise et al., GLI1 and GLI2 in Basal Cell Carcinoma G Regl et al 5530

Figure 1 Real-time analysis of human keratinocytes expressing GLI1. (a) Representative real-time PCR result showing that GLI2 is strongly induced in GLI1-expressing HEK cells. (b) Location of primer pairs used to distinguish between GLI2a/b and GLI2g/d splice variants as well as endogenous GLI1 (GLI1(endo)) and retrovirally expressed GLI1 (GLI1(rv). (c) mRNA expression of PTCH, endogenous GLI1 (GLI1(endo)), GLI2 and splice variants GLI2a/b in cells overexpressing GLI1(rv) for 24, 48 and 144 h, respectively. (d) Luciferase reporter gene assay showing that GLI2b encodes a potent transcriptional activator. HeLa cells were transfected with a GLI2b, GLI1 or mutant GLI1 expression plasmid (pGLI1mut, control) together with a luciferase reporter plasmid containing 6 Gli binding sites and a lacZ expression plasmid for normalization. Activation of reporter gene expression is expressed as fold induction of luciferase activity compared to control transfected cells. Data represent results from three independent experiments each carried out in duplicate. (e) Analysis of the time course of GLI1 transgene, GLI2a/b and PTCH transcription in HaCaT cells expressing GLI1 under the control of the tetracycline repressor. Upper figure illustrates induction of GLI1 protein expression in response to tetracycline, which was added for the times indicated. Equal amounts of total cellular protein were loaded on each lane. RNA was harvested after 3, 6, 24 and 48 h of tetracycline treatment and subjected to real-time PCR analysis. Note that in (c) and (e) fold induction values are plotted on a log2 scale due to very high induction values. Mean values of six measurements in three independent real-time PCR experiments are shown. The standard deviation for each experiment was below 15%. To exclude amplification of genomic DNA, all samples were also tested without reverse transcriptase treatment prior to PCR amplification. The specificity and quality of the PCR reactions were controlled by direct sequencing of the PCR- amplicons, melting curve analysis and gel electrophoresis. ‘Primer only’ controls, without template were done to ensure the absence of primer dimers. Large ribosomal protein P0 (RPLP0) was used as a reference standard for all analyses to control for the amount of sample material (Martin et al., 2001)

Oncogene GLI1 and GLI2 in Basal Cell Carcinoma G Regl et al 5531 1998; Mo et al., 1997; Motoyama et al., 1998; Park et tetracycline-inducible human keratinocyte cell line as in al., 2000). Only recently, it was shown that over- vitro model systems for the analysis of the effects of expression of mouse Gli2 in the basal epidermal layer Hh/GLI-signalling on the gene expression pattern and of transgenic mice induced the formation of BCC-like cellular phenotype of human epidermal cells. tumours (Grachtchouk et al., 2000). We provide evidence for a positive feedback Though much is known about Hh signalling in mechanism between the two putative oncogenes GLI1 Drosophila and murine development, our understand- and GLI2 in human epidermal cells. Expression of ing of the molecular mechanisms and tumorigenic either transcription factor stimulates DNA-synthesis in programs that are activated in response to Hh- confluent human keratinocytes, suggesting that both signalling and GLI-activity in human keratinocytes is factors may induce epidermal cell proliferation. This still very limited. Most studies have been carried out would point to a role of the GLI1 – GLI2 feedback using mouse as a model system to study specific aspects mechanism in tumorigenesis, an interpretation that is of BCC development. Given the considerable differ- further supported by the elevated levels of GLI2 as ences between human and murine skin and the relative well as GLI1 mRNA in BCCs. resistance of wild type mice to BCC development, murine studies alone will only provide a limited insight into the mechanisms by which Hh activation leads to Results BCC. To better understand the downstream effects of Hh/GLI activation in human BCC, we used retro- A highly efficient retroviral expression system (Deng et virally infected primary human keratinocytes and a al., 1997) was used to generate GLI1-expressing and

Table 1 Primer sequences for real-time PCR analysis Gene Forward primer (5’ –3’) Reverse primer (5’ –3’) Amplicon length (bp)

GLI1 GCCGTGTAAAGCTCCAGTGAACACA TCCCACTTTGAGAGGCCCATAGCAAG 200 GLI1 (endo) TCTGGACATACCCCACCTCCCTCTG ACTGCAGCTCCCCCAATTTTTCTGG 191 CLI2 TGGCCGCTTCAGATGACAGATGTTG CGTTAGCCGAATGTCAGCCGTGAAG 200 GLI2a/b GGGTCAACCAGGTGTCCAGCACTGT GATGGAGGGCAGGGTCAAGGAGTTT 194 GLI2g/d TCCCACGGAAAGCACTGGCTTCTCT CAGCCATGTTGCTGATGCCTCATTC 205 c-MYC AACCTCCTCACAGCCCACTGGTCCT CGCCTCTTGACATTCTCCTCGGTGT 205 PTCH TCCTCGTGTGCGCTGTCTTCCTTC CGTCAGAAAGGCCAAAGCAACGTGA 200 Vimentin TACCGGAGACAGGTGCAGTCCCTCA TCACGAAGGTGACGAGCCATTTCCT 191 RPLP0 Martin et al., 2001 Martin et al., 2001 Martin et al., 2001 mGli1 CACCGTGGGAGTAAACAGGCCTTCC CCAGAGCGTTACACACCTGCCCTTC 191 mGli2 TCTACATGCCTTGGGTTGCTGTGGA GAAAGTGTGGAGGCTGCAGGTGGTC 211 mRPLP0 TGCACTCTCGCTTTCTGGAGGGTGT AATGCAGATGGATCAGCCAGGAAGG 193

Table 2 Gene expression in BCC compared to normal human skin BCC ID GLI2 GLI1 PTCH Vimentin c-MYC Type Origin

25 67.28 1861.82 24.78 0.43 0.02 nodular neck 17 27.46 2279.50 38.89 0.66 0.06 nodular head 20 22.00 4193.68 44.04 1.87 0.38 nodular head 38 18.61 128.80 38.51 0.97 0.13 nodular upper arm 32 18.22 591.81 9.08 1.00 0.11 nodular Pool of 3 37 16.14 53.02 19.52 0.18 0.33 nodular back 23 13.70 814.63 52.12 1.20 0.08 nodular head 30 12.32 206.64 22.94 4.45 0.10 nodular thorax 22 9.74 116.48 19.10 1.76 0.08 nodular head 13 9.43 29.58 21.55 0.26 0.41 nodular head 27 8.62 225.03 47.80 1.08 0.11 nodular head 12 8.02 267.43 20.55 0.23 0.10 nodular head 18 7.89 3024.54 26.07 3.95 0.34 nodular head 28 6.69 95.50 24.34 4.02 0.14 nodular thorax 26 6.36 40.45 3.52 2.21 0.13 nodular head 3 5.79 728.90 52.45 0.14 0.02 nodular head 31 5.65 135.96 12.00 0.52 0.04 nodular back 6 5.63 822.86 19.51 0.34 0.03 nodular head 9 3.35 157.53 45.33 0.80 0.12 nodular head 35 2.81 17.82 9.51 0.95 0.06 nodular thorax 5 2.03 92.22 2.32 0.40 0.47 nodular thorax

Values for each gene represent the ratio of mRNA expression of tumour to normal tissue. BCC32 corresponds to a pool of three small nodular BCC isolated from the same patient. Ratios were calculated from the mean value of six real-time PCR measurements obtained from three independent PCR runs with duplicate samples. RPLP0 (Martin et al., 2001) and Cyclophilin E (data not shown) were used as a reference to control for the amount of sample material. The numbers shown refer to normalization with RPLP0. Cyclophilin E as reference gave comparable results

Oncogene GLI1 and GLI2 in Basal Cell Carcinoma G Regl et al 5532 EGFP-expressing human primary keratinocytes. Using raising the possibility that these isoforms act as DNA arrays hybridized with cDNA from GLI1- transcriptional repressors rather than activators (Sasa- expressing human primary keratinocytes and EGFP- ki et al., 1999). We therefore characterized the isoform expressing control cells (Regl et al., unpublished), we specific pattern of GLI2 expression in both GLI1 found that GLI2 transcription was strongly induced by infected human keratinocytes (Figure 1c) and in BCCs GLI1. Overexpression of mouse Gli2 in epidermal cells (Table 2). We distinguished between the long GLI2a/b of transgenic mice leads to the development of BCC- and the short GLI2g/d splice variants using the primer like structures (Grachtchouk et al., 2000) though pairs shown in Figure 1b and Table 1 for real-time partial functional redundancy of mouse Gli1 and Gli2 PCR analysis. At 24 h p.i. GLI1 expression led to a raises the possibility that Gli2 induces BCC develop- 24.9-fold increase of Gli2a/b mRNA. After 48 h and ment by mimicking the activity of Gli1. The 144 h GLI2a/b mRNA expression was induced 28.6- observation that GLI1 activates expression of GLI2 fold and 210.9-fold, respectively (Figure 1c). At all time in human epidermal cells, however, points to a points the short GLI2 variants g and d were expressed combined activity of both transcriptional regulators only at trace amounts (Ct value 438) in both EGFP in BCC development. We therefore analysed in detail and GLI1 expressing cells, indicating that GLI1 the induction of GLI2 by GLI1, its expression in BCCs induces exclusively the putative transcriptional activa- and its possible function in BCC development. Using tor forms. Using primers to distinguish between the retrovirally infected primary keratinocytes and tetra- GLI2 a and b isoforms we found a ratio of b to a of cycline inducible keratinocyte lines as human model about 3 : 1 (data not shown). GLI2b is more closely systems for Hh/GLI-signalling in BCC we addressed related to mouse GLI2 than the other isoforms the following questions: (1) Is GLI2 an early (Tanimura et al., 1998). transcriptional target of GLI1? (2) Which splice To investigate whether the predominant isoform variants of GLI2 are induced by GLI1? (3) Is GLI2 GLI2b indeed acts as a transcriptional activator we expressed in BCC (4) Does GLI2 control the co-transfected HeLa cells with GLI2b expression transcription of GLI1? (5) What is the effect of plasmid and a GLI-reporter construct containing six GLI1/GLI2 expression on the proliferation of epider- Gli-binding sites upstream of the firefly luciferase mal cells? reporter gene (Dai et al., 1999). GLI2b expression resulted in a 9.8-fold increase in reporter gene activity, suggesting that human GLI2b encodes a strong GLI1 expression in human keratinocytes leads to GLI2 transcriptional activator. Positive control transfection transcription and GLI1 auto-activation with GLI1 expression plasmid led to a 4.2-fold increase We used real-time PCR analysis to quantitatively and in luciferase activity (Figure 1d). The stronger qualitatively analyse the induction of GLI2 in response induction of reporter gene expression by GLI2b to exogenous GLI1. We also addressed the issue of compared to GLI1 contrasts results obtained with GLI1 auto-activation which has been described in mouse Gli2, which, when compared to Gli1, has been amphibians (Dahmane et al., 1997). The primers used shown to be only a weak activator unless the putative for these analyses are shown in Figure 1b and Table 1. N-terminal repressor domain is removed (Sasaki et al., Figure 1a shows a graphical display of a representative 1999). The different efficiency of human and mouse real-time PCR experiment demonstrating activation of Gli2 genes to activate transcription underlines the GLI2 transcription in response to GLI1 expression in necessity of species-specific model systems to study primary human keratinocytes (HEK). As shown in GLI-gene function. Figure 1c, GLI1 expression led to a 24.5-fold increase of Gli2 mRNA levels at 24 h post infection (p.i.). After GLI2 induction is delayed compared to the putative direct 48 h and 144 h p.i. GLI2 mRNA expression was target PTCH induced 28.6-fold and 210.9-fold, respectively. The increase of GLI2 was paralleled by an increase of To analyse in more detail the time course of GLI2 endogenous GLI1 transcript levels (24.8-fold at 24 h p.i, induction in response to GLI1, we genetically modified 26.7-fold at 48 h p.i. and 29.9-fold at 144 h p.i.), the human keratinocyte cell line HaCaT (Boukamp et suggesting auto-activation of GLI1 transcription. al., 1988) such that human GLI1 protein expression PTCH mRNA expression, a direct GLI target used can be regulated in a tetracycline-dependent manner as positive control, was also gradually induced by (Eichberger, unpublished). This system allows the GLI1 (22.9-fold at 24 h p.i., 23.6-fold at 24 h p.i. and analysis of early transcriptional responses to GLI1, 24.8-fold at 144 h p.i.). which should facilitate the identification of candidate direct GLI1 target genes. Western blot analysis of tetracycline-treated cells showed that GLI1 protein was GLI1 induces the GLI2a/b splice variants in human induced in modified HaCaT cells within 3 h of keratinocytes tetracyclin treatment and gradually accumulated over Alternative splicing of GLI2 mRNA can result in a time range of 48 h (Figure 1e, upper image) short isoforms which – based on functional analysis demonstrating precisely controlled induction of GLI1 of protein domains of GLI proteins – lack the expression. Real-time PCR analysis showed that GLI2 putative transactivation domain of human GLI2 mRNA levels were unchanged after 3 h of tetracycline

Oncogene GLI1 and GLI2 in Basal Cell Carcinoma G Regl et al 5533

Figure 2 Analysis of positive feedback mechanisms between GLI1 and GLI2. (a) Real-time PCR analysis of HaCaT cells transfected with human GLI1 (phGLI1) or human GLI2b (phGLI2). Transcripts analysed are shown in brackets. (b) Real-time PCR analysis of mouse C3H10T1/2 fibroblasts transfected with human GLI1 (phGLI1) or human GLI2b (phGLI2) and analysed for the expression of mouse Gli1 (mGli1) and mouse Gli2 (mGli2). (c) C3H10T1/2 cells transfected with human GLI1 (upper left) or human GLI2b (lower left). Dark staining of cells indicates alkaline phosphatase expression due to osteoblast differentiation. Cells transfected with control DNA do not show any staining (upper and lower right image). (d) Quantitative analysis of osteoblast differentiation induced by GLI1 and GLI2b, respectively, expressed as -fold induction of alkaline phosphatase (AP) activity compared to control transfected cells. Results shown in (a), (b) and (d) were calculated from three independent experiments each carried out in duplicate treatment, weakly elevated after 6 h (1.5-fold) but contain variable proportions of dermal components we strongly induced after 24 h (23.1-fold ) and 48 h (27.8- also measured the expression of the dermal marker fold) (Figure 1e). The kinetics of PTCH mRNA vimentin. Vimentin expression was measured in 10 accumulation closely paralleled that of GLI1 protein individual normal skin samples and six preparations (Figure 1e). PTCH mRNA levels increased 2.3-fold with low vimentin expression were pooled and used for after 3 h, 23.1-fold after 6 h, 24.4-fold after 24 h and analysis. The mean ratio of vimentin expression in BCC 26.3-fold after 48 h of tetracyclin treatment. The samples and skin was 1 : 1.3, demonstrating comparable delayed response of GLI2 to GLI1 expression suggests amounts of mesoderm in BCC and normal skin that, in contrast to PTCH, GLI2 is unlikely to be a preparations. Pooling of normal skin was done to direct target of GLI1. In line with this finding we did reduce site-specific and individual variations. Normal not detect any Gli consensus binding sequences in the skin samples with a large proportion of adipose tissue putative GLI2 promoter region (data not shown). were excluded from the analysis. As shown in Table 2, all 21 BCC samples had elevated levels of GLI2 mRNA compared to normal GLI2 is overexpressed in BCCs skin. The increase of GLI2 transcripts in BCCs varied Since GLI1 is highly expressed in BCCs (Bonifas et al., from twofold (BCC5) to 67-fold (BCC25) with an 2001; Dahmane et al., 1997; Ghali et al., 1999; Green et average increase of 10.5-fold as calculated from mean al., 1998) and is able to activate GLI2 transcription, we DCt values (see below for details). Expression of GLI1, analysed GLI2 levels in BCCs and normal skin by real- PTCH and MYC was analysed as controls. Consistent time PCR. We tested a panel of 21 tumour samples for with previous reports (Bonifas et al., 2001; Dahmane et GLI2 mRNA. Since tumour and skin samples may al., 1997; Ghali et al., 1999; Green et al., 1998), GLI1

Oncogene GLI1 and GLI2 in Basal Cell Carcinoma G Regl et al 5534 real-time PCR. Consistent with our previous findings in primary keratinocytes and inducible HaCaT lines, overexpression of GLI1 resulted in a 1.6-fold increase in PTCH mRNA levels and a 2.7-fold induction of GLI2 mRNA. Transfection of HaCaT cells with GLI2b resulted in a fivefold increase in GLI1 mRNA levels, suggesting a positive feedback mechanism between GLI1 and GLI2 in human keratinocytes (Figure 2a). Since it is conceivable that this mechanism applies to human cells only, we turned to mouse C3H10T1/2 fibroblasts, which are frequently used to assay Hh-signalling (Kinto et al., 1997). We transfected C3H10T1/2 cells with either human GLI1, GLI2b or control expression plasmids and measured mouse Gli1 Figure 3 Real-time PCR analysis of tetracycline-regulated or mouse Gli2 transcripts by real-time PCR. As shown GLI2b HaCaT cells. GLI2b (His-tagged) expression was induced in Figure 2b expression of human GLI1 in mouse by tetracycline treatment for the time indicated. Induction of fibroblasts led to a 6.5-fold increase of mouse Gli1 GLI1, PTCH and endogenous GLI2 (GLI2endo) transcription mRNA levels and to a 2.1-fold increase of mouse Gli2 in response to GLI2 transgene expression was measured by real- time PCR. Data represent results of three independent experi- mRNA. Overexpression of human GLI2b resulted in a ments, each analysed in duplicate PCR runs. Standard deviation 12.3-fold activation of mouse Gli1 transcription and a was below 20 per cent between all replicate experiments. Large 2.6-fold increase of mouse Gli2 demonstrating conser- ribosomal protein P0 (RPLP0) was used as a reference standard vation of the feedback loop between man and mouse. for all analyses to control for the amount of sample material GLI1 has previously been shown to trigger osteo- (Martin et al., 2001) blast development in C3H10T1/2 cells (Altaba, 1999; Murone et al., 1999). Since GLI2b expression induces the expression of Gli1 in these cells, we asked whether transcription was strongly up-regulated in all BCC GLI2b is also able to induce osteoblast differentiation samples ranging from 18-fold (BCC35) to more than in C3H10T1/2 cells. Figure 2c shows that transfection 4000-fold (BCC20) (on average 270-fold induced) as of C3H10T1/2 cells either with GLI1 or with human was PTCH (2.3-fold (BCC5) to 52.4-fold (BCC3)). GLI2b induced the expression of alkaline phosphatase, MYC was consistently downregulated in all tumours as which specifically marks cells undergoing osteoblast has been described previously by Bonifas et al. (2001). differentiation. Quantitative analysis of alkaline phos- The average mRNA concentration of GLI2 in BCCs phatase induction revealed that GLI2b was more was about 14-fold higher than the level of GLI1 (mean effective than GLI1 in the induction of alkaline DCtGLI2=2.9 versus mean DCtGLI1=6.7, for DCt phosphatase activity (14.9- versus 2.3-fold activation) calculation see Materials and methods section). In (Figure 2d). Since we found that osteoblast differentia- normal skin GLI2 levels were about 360-fold higher tion by SHH-Np treatment is specifically linked to than GLI1 levels (mean DCtGLI2=6.3 versus mean D activation of Gli1 but not of Gli2 expression (data not CtGLI1=14.8). Almost exclusively the long splice shown), the increased activity of alkaline phosphatase variants GLI2a/b were expressed in tumour samples in GLI2b transfected cells is probably due to the at a ratio of about 1 : 1 (data not shown). In a recent stronger induction of endogenous mouse Gli1 by study of Hh-target gene expression in BCCs, GLI2 was GLI2b compared to cells transfected with GLI1 (see not found to be consistently expressed in BCCs at Figure 2b). This is also consistent with our observation levels significantly different from normal skin. Detailed that GLI2b is a stronger transcriptional activator than results were not shown, but the different findings may GLI1 (see Figure 1d). be due to a different method used (RNase protection), and the small number of tumour samples analysed GLI1 is a putative direct target of GLI2 (n=7) (Bonifas et al., 2001). Analysis of the mouse Gli1 promoter revealed the presence of putative Gli binding sites which can be GLI2b activates expression of GLI1 and induces bound by the zinc finger domain of human GLI3 osteoblast differentiation of mouse embryonic fibroblasts protein (Dai et al., 1999), though a biological relevance Genetic studies in mice have shown that Gli2 is of this interaction has not yet been shown. Given the required for normal Gli1 expression levels in the high sequence similarity of the zinc finger DNA- central nervous system (Ding et al., 1998). Combined binding domain of GLI-proteins and the high conserva- with our data on GLI1-mediated induction of GLI2 tion of the putative Gli-binding sites in the murine and this points to a possible feedback loop between GLI1 human GLI1 promoter (G Regl and F Aberger, and GLI2 expression. To test this hypothesis, we unpublished) (Liu et al., 1998) we hypothesized that transiently transfected HaCaT cells with either a GLI1, GLI1 expression may be directly regulated by GLI2. GLI2b or control expression plasmid (pGLI1mut) and If GLI1 were a direct target gene of GLI2, induction analysed transcription of GLI2, PTCH and GLI1 by of GLI2 protein expression should be paralleled by a

Oncogene GLI1 and GLI2 in Basal Cell Carcinoma G Regl et al 5535

Figure 4 Analysis of BrdU-incorporation as indicator of cellular proliferation of confluent human keratinocytes in response to GLI1 and GLI2b, respectively. (a – d) Fluorescence microscopy analysis of tet-inducible GLI1 (a-b) and GLI2b (c – d) HaCaT cell lines either untreated (a, c) or treated with tetracycline (b,d). BrdU-incorporation was detected with anti-BrdU-FITC labelled antibodies. Cells were counter-stained with DAPI. (e – f) Flow-cytometry analysis of tet-inducible GLI1 (e) and GLI2b (f) HaCaT cells. DNA-synthesis is expressed as percentage of BrdU positive cells. In total, 10 000 cells were counted in each experiment. Data represent results of three independent experiments each carried out in duplicate. tet: tetracycline; bar: 20 mm simultaneous increase in GLI1 mRNA levels. We GLI2 mRNA levels was only observed after 6 h of therefore constructed a HaCaT cell line expressing tetracycline treatment (Figure 3), suggesting that GLI2 His-tagged GLI2b in a tetracycline-regulated manner. activation does not involve direct autoactivation. In The transcriptional response of GLI1 to GLI2b was contrast, the rapid transcriptional response of GLI1 to measured by real-time PCR. Increased levels of GLI2b GLI2 suggests that GLI1 is likely to be directly protein were first detectable by Western blot analysis regulated by GLI2. after 2 h of tetracycline treatment (data not shown). Immediately following detectable GLI2b protein GLI1 and GLI2 stimulate DNA-synthesis of confluent expression, GLI1 mRNA levels started to rise (1.8- human keratinocytes fold after 2 h; 4.8-fold after 2.5 h; 6.2-fold after 3 h; 6.4-fold after 6 h and 9.5-fold after 12 h (Figure 3)). Expression of GLI1 and mouse Gli2 in the epidermis Transcriptional activation of the direct GLI-target of transgenic mice has been shown to induce BCC PTCH was first detectable after 2.5 h of treatment development. Furthermore, in murine neural cells (1.8-fold induction). Unlike GLI1 and PTCH, levels of stimulation of cell proliferation by Hh-signalling is endogenous GLI2, as assayed by using primers specific associated with an increase in Gli1 expression, to the 3’ UTR of the endogenous GLI2 mRNA, were suggesting that Gli1 mediates the proliferative effect unchanged at early time points. A clear increase of of Hh-signalling (Dahmane et al., 2001; Grachtchouk

Oncogene GLI1 and GLI2 in Basal Cell Carcinoma G Regl et al 5536 et al., 2000; Nilsson et al., 2000). To analyse whether between GLI2 and GLI1 mRNA levels, nor did we human GLI proteins play a role in the control of find a correlation between GLI1 and the mRNA levels human keratinocyte proliferation, we expressed either of the direct GLI target PTCH. GLI1 protein has GLI1 or GLI2 in tetracycline-inducible HaCaT cells previously been shown to be localized mainly in the and determined the incorporation of BrdU as an cytoplasm of BCC tumour cells (Ghali et al., 1999; indicator of cell proliferation. Expression of GLI1 and Dahmane et al., 1997) raising the possibility that the GLI2, respectively, was induced for 65 h by tetracy- biological activity of GLI1 is also regulated by cline addition and DNA-synthesis was measured either mechanisms controlling its subcellular localization. at 60% confluence or at 48 h post confluence. BrdU- The disparity between GLI1, GLI2 and PTCH mRNA positive cells in tetracycline-treated and untreated levels in tumours may thus be due to variable amounts samples were quantified by flow-cytometry (Figure of nuclear/cytoplasmic GLI1 protein in the tumour 4e,f) or analysed by fluorescence microscopy (Figure samples analysed. 4a – d). While at sub-confluence we did not find any Induction of GLI2 expression by GLI1 is of significant differences in BrdU-incorporation between particular interest since mouse Gli2 has recently been GLI1 or GLI2 expressing cells and controls (data not shown to induce BCC development when expressed shown), expression of either GLI-gene induced a under the control of the bovine Keratin 5 promoter twofold increase in BrdU-incorporation in post (Grachtchouk et al., 2000). The tumorigenic effect of confluent keratinocytes as determined by flow Gli2, however, may be explained by considerable cytometry (Figure 4e,f). Together with the positive functional redundancy of Gli1 and Gli2. Mice lacking feedback mechanism described, these results suggest functional Gli2 protein display severe developmental that the activity of GLI1 and/or GLI2 increases malformations, which can be rescued by knock-in of proliferation of epidermal cells, probably by opposing Gli1 into the Gli2 locus, demonstrating that Gli1 can epithelial cell cycle arrest of keratinocytes, an effect compensate for the absence of Gli2 protein (Bai and that has also been shown to be caused by SHH- Joyner, 2001). Our results demonstrating the existence expression in confluent primary keratinocytes (Fan and of a positive feedback mechanism between GLI1 and Khavari, 1999). GLI2 argue for a role of both transcription factors in mediating the oncogenic effect of activated Hh- signalling in human epidermis. Thus, a possible Discussion scenario in the formation of BCC is the activation of GLI1 by inactivating mutations in PTCH followed by The Hedgehog (Hh) signal transduction pathway plays the induction of GLI2. Alternatively, activation of Hh- a pivotal role in a number of vertebrate and signalling may first lead to the induction of GLI2 invertebrate developmental processes such as cell type expression which then activates GLI1 expression. This specification, pattern formation and regulation of cell hypothesis is consistent with our observation that proliferation. Inappropriate activation of this pathway human GLI2 is a potent activator of GLI1 transcrip- can lead to developmental defects as well as to the tion in both the human keratinocyte cell line HaCaT formation of tumours such as medulloblastomas, and in mouse C3H10T1/2 fibroblasts. Irrespective of rhabdomyosarcomas and BCCs (Goodrich and Scott, the sequence of GLI gene activation, our data provide 1998; Ruiz i Altaba, 1999; Toftgard, 2000). evidence for a positive feedback mechanism between Numerous studies in Drosophila and vertebrates have GLI1 and GLI2 in BCC development. This feedback provided convincing evidence that GLI genes act as loop may be required for the activation and main- key mediators of Hh-signalling in the nucleus. Studies tenance of an oncogenic gene expression pattern in in murine systems have provided evidence that GLI1 human epidermis, which is not initiated in normal skin acts as a major tumour-inducing factor in BCC due to the absence of GLI1 expression. The inability of development (Nilsson et al., 2000), though major GLI2 to activate GLI1 in normal skin may be due to differences between murine and human skin tissue the requirement for (an) additional factor(s) present in may limit the relevance of murine model systems to BCC only. Alternatively, post-translational processing human neoplasia. To fully understand the role of GLI1 of GLI2 in normal skin may result in the generation of in the development of BCCs, additional functional inactive GLI2 activator or even repressor forms, a studies are necessary in a purely human system. hypothesis that is supported by expression studies of murine and amphibian Gli2 function in mouse and Drosophila (Aza-Blanc et al., 2000; Sasaki et al., 1999). Positive feedback mechanism of GLI1 and GLI2 in human Once high-affinity antibodies against GLI2 become epidermal cells available, in vivo analysis of GLI2 protein expression Using primary human keratinocytes expressing GLI1 will allow to address the role of protein processing in as a model system to identify Hh-target genes with the context of skin tumorigenesis. relevance to BCC formation, we found that GLI2 expression was highly elevated in response to GLI1. In GLI1 is a putative direct target gene of GLI2 addition, we showed that GLI2 mRNA is consistently expressed in BCCs at elevated levels compared to Analysis of the mouse Gli1 promoter revealed the normal skin. We found, however, no clear correlation presence of eight putative Gli-binding sites and it was

Oncogene GLI1 and GLI2 in Basal Cell Carcinoma G Regl et al 5537 shown that in vitro GLI3 is able to bind to and found by immunological detection of N-terminally His- stimulate gene expression from these cis-regulatory tagged GLI2b. This suggests that full-length GLI2b – sequences (Dai et al., 1999). However, the in vivo the isoform most closely related to mouse Gli2 relevance of this interaction remains to be established. (Tanimura et al., 1998) – functions as an activator Based on the high conservation of the zinc finger DNA (unpublished data). The stronger transcriptional activa- binding domain of GLI proteins, it is also conceivable tion by human GLI2b is further supported by our that GLI2 can bind to the human GLI1 promoter, transfection experiments using HaCaT or mouse rendering GLI1 a direct target of GLI2. Using a embryonic fibroblasts. In all cases, expression of precisely regulatable human keratinocyte expression GLI2b had a more pronounced effect than GLI1 system we provided evidence that GLI1 is likely to either on target gene activation or induction of represent a direct target of GLI2. This is consistent osteoblast differentiation as determined by quantitative with the presence of highly conserved putative Gli- analysis of alkaline phophatase induction in mouse binding sites in the human GLI1 promoter. In contrast, embryonic fibroblasts. These species-specific differences GLI2 is unlikely to be a direct GLI target, since of GLI-gene activity suggest the use of well defined activation of GLI2 expression by GLI1 as well as GLI2 non-heterologous assay systems for future functional itself is significantly slower than activation of the direct analysis of GLI-genes in a given biological context. GLI-target PTCH (Shin et al., 1999). This is further supported by in silico analysis of the putative human GLI1 and GLI2b have a stimulatory effect on epidermal GLI2 promoter, which failed to identify any consensus cell proliferation Gli-binding sites (G Regl and F Aberger, unpublished data). Stratified epithelium displays a balance between prolif- Activation of GLI2 by GLI1 is likely to be context eration and cell cycle arrest. Distortion of such a dependent. Mice ectopically expressing Gli1 in the balance can be associated with tumorigenesis, including neural tube do not show any alterations of the Gli2 BCC development. Activation of Hh-signalling in expression pattern (Hynes et al., 1997). Similarily, epidermal cells causes hyperplasia, though the molecular overexpression of Gli1 does not induce the expression mechanisms of Hh-mediated tumour formation are still of Gli2 in animal cap explants of Xenopus. In contrast, poorly defined. Recently, it was shown that expression injection of human GLI1 into frog embryos results in of SHH in primary keratinocytes can overcome the the formation of skin tumours, which express Gli2 epithelial growth arrest of cells. The opposing effect on mRNA (Mullor et al., 2001). Interestingly, homozygous cell cycle arrest by SHH expression was characterized by Gli1 knock-out mice are phenotypically normal, an increase of cell proliferation of confluent cells treated suggesting that Gli2 expression does not strictly depend with calcium to induce differentiation (Fan and on functional Gli1 protein. More likely, Gli2 is able to Khavari, 1999). Whether the increase of proliferation compensate for the lack of active Gli1 protein (Park et of SHH-expressing cells is mediated by GLI-genes has al., 2000). Our experiments with mouse C3H10T1/2 not yet been shown. Our results suggest that the cells show that human GLI1 expression leads to an opposing effect of Hh-signalling on epithelial growth increase in Gli2 mRNA levels but up to now, there is no arrest may result from the activation of the positive clear evidence for a role of mouse Gli1 in the activation feedback mechanism between GLI1 and GLI2, since of Gli2 in mouse. Analysis of Gli2 expression in Gli1- expression of either transcriptional regulator in human induced BCCs from mouse would be important to keratinocytes significantly increased the number of cells clarify the role of mouse Gli1 in the regulation of Gli2. in S phase in confluent cultures. Activation of GLI1 in response to GLI2 expression Taken together, these findings suggest a model of is consistent with the finding that Gli2 deficient mice BCC development where inactivation of PTCH in express Gli1 mRNA at reduced levels (Ding et al., human epidermis leads to activation of GLI1-GLI2 1998). Also, Gli2 expression in mouse epidermis feedback signalling, which causes or promotes epithelial induces the development of BCCs expressing Gli1 neoplasia by perturbing the balance of cell proliferation (Grachtchouk et al., 2000). These data suggest a and growth arrest. Phenotypic analysis of cells lacking conserved function of Gli2 in the regulation of Gli1 either GLI1, GLI2 or a combination of both as well as expression. This is, however, likely to be a cell-type identification and functional analysis of GLI1 and specific or context dependent effect, since the expres- GLI2 target genes in human keratinocytes will be sion domains of Gli1 and Gli2 are only partially required to reveal the detailed molecular mechanisms overlapping. Our data also suggest that the function of underlying tumorigenic conversion of epidermal cells vertebrate Gli2 has not been completely conserved, triggered by inappropriate Hh/GLI-signalling. since, unlike human GLI2b, Xenopus Gli2 is unable to induce osteoblast differentiation in C3H10T1/2 cells (Altaba, 1999). In addition, the potent activator Materials and methods function of GLI2b in our Gli-reporter assays contrasts with previous results on mouse Gli2, which was shown Retroviral infection of keratinocytes, cell culture and cell to be only a weak transcriptional activator, unless the transfections putative N-terminal repressor domain is deleted (Sasaki To generate a retroviral bicistronic GLI1-EGFP expression et al., 1999). No evidence for processing of GLI2b was construct, the pIRES2-EGFP plasmid (Clontech) was

Oncogene GLI1 and GLI2 in Basal Cell Carcinoma G Regl et al 5538 modified by cloning an adapter containing a SalI site into the platereader (Tecan). Samples were normalized for beta- vector AseI site to create pI2E-A. GLI1 coding cDNA was galactosidase activity, which was determined by absorbance amplified by PCR with the sense primer 5’-gacagagtgtcgaca- measurement at 405 nm following a 1 h incubation of lysed caccct-3’ and antisense primer 5’-gattccctactcttttaggca-3’ and samples in staining buffer containing 0.65 mg/ml o-nitrophe- after digestion with SalI was cloned into pI2E-A at the XhoI/ nyl-b-D-galacto-pyranoside. SmaI sites creating pI2E-A-GLI1. The construct was verified GLI1/GLI2 induced luciferase activity was measured with by DNA sequencing. The retroviral vector SIN-IP-GFP (gift a Lucy I luminometer (Anthos) using a commercial luciferase from P Khavari) was digested with XhoI/NotI to excise the assay system (Promega). Results were normalized for CMV-GFP sequence (SIN-IP). pI2E-A-Gli1 was digested expression of lacZ, which was co-transfected with the with SalI/NotI to isolate the CMV-Gli1-IRES-EGFP reporter plasmid, GLI- and control constructs. All constructs sequence and cloned into SIN-IP creating SIN-Gli1-EGFP. (GLI1, GLI1mut (control), GLI2b and LacZ) were cloned Amphotropic retrovirus was produced as previously into pcDNA3.1zeo(+) expression vector (Invitrogen). described (Deng et al., 1997) except that the more efficient Phoenix packaging cell line was used. Primary human RNA isolation and Real-Time PCR analysis keratinocytes were isolated and infected as previously described (Deng et al., 1997; Rheinwald and Green, 1975) BCC and normal skin were snap frozen after surgical except that cells were plated at a density of 0.5 – 1.06106 cells removal and stored at 7708C until used. Total RNA was per 10 cm dish in Defined Keratinocyte-SFM (Invitrogen) isolated with TRI-Reagent (Molecular Research Center, Inc.) 16 – 18 h prior to infection. Cells were harvested at the time followed by further purification using the High Pure RNA points indicated, washed once in low calcium PBS, and the Isolation Kit (Boehringer Mannheim), which includes a pellets snap frozen in liquid nitrogen. DNase treatment to remove genomic DNA. Total RNA The T-REx system (Invitrogen) was used to generate from primary keratinocytes, HaCaT cells and mouse double-stable HaCaT lines expressing GLI1 or GLI2b under C3H10T1/2 cells was isolated using the High Pure RNA the control of the tetracycline repressor. Transgene expression Isolation Kit. RNA quality and quantity were assayed on a was induced by culturing the cells in Dulbecco’s Modified Bioanalyzer 2100 (Agilent). cDNA was synthesized with Medium (DMEM, high glucose, Life Technologies) contain- SuperScript II (Rnase H7) reverse transcriptase (GibcoBRL) ing 10% fetal calf serum (FCS) and 1 mg/l tetracycline according to the manufacturer’s instructions. Real-time PCR (Invitrogen). HaCaT and C3H10T1/2 were grown in HEPES- analysis was done on a Rotorgene 2000 (Corbett Research) buffered DMEM (pH 7.2), containing 10% FCS, 100 mg/l using SYBR Green PCR Mix (PE-Biosystems). Primer streptomycin and 62.5 mg/l penicillin at 378C. Cells were sequences used for real-time analysis are shown in Table 1. transfected using SuperFect (Qiagen), according to the Induction values (x) were calculated using the following manufacturer’s instructions. formula: x=27DDCt, where Ct represents the mean threshold For transfection studies full-length human GLI1 or GLI2b cycle of all replicate analyses of a given gene and DCt was cloned into pcDNA3.1zeo(+) expression vector (Invitro- represents the difference between the Ct values of the gene in gen). The control plasmid (pGLI1mut (control)) was question (target) and the Ct value of the reference gene constructed by deleting an N-terminal 1658 bp fragment (RPLP0 or Cyclophilin E). DDCt is the difference between the including the DNA binding domain with HindIII-KpnI DCt values of the samples for each target (e.g. DCt for GLI2 followed by blunt-ending and religation. Cells were harvested in tumour) and the mean DCt of the calibrator (e.g. DCt for for RNA isolation 24 – 48 h post transfection. GLI2 in normal skin).

Western blot analysis, alkaline phosphatase staining and BrdU labelling and flow cytometry luciferase reporter assays To study indicators of cellular proliferation tetracycline- Western blot analysis of GLI1 protein expression in regulated GLI1 and GLI2 HaCaT cells, respectively, were tetracyclin-regulated HaCaT cells was done according to grown for 65 h either in the presence or absence of 1 mg/ml standard procedures using a polyclonal goat anti-GLI1 tetracycline (Invitrogen). Bromodeoxyuridine (BrdU)-incor- antibody (C-18, Santa Cruz Biotechnology) and a secondary poration was either determined at 60% confluence or 48 h rabbit anti-goat IgG coupled with horse-radish peroxidase post confluence using the FLUOS in situ cell proliferation kit (Amersham Pharmacia Biotech) followed by ECL detection (Boehringer Mannheim). Cells were incubated for 90 min in (Amersham Pharmacia Biotech). the presence of BrdU before detection with Fluorescein- For alkaline phosphatase staining transfected C3H10T1/2 labelled anti-BrdU antibody. Flow-cytometry was performed cells were grown for 24 h in DMEM containing 10% FCS, on a FACSCalibur (Becton Dickenson) and data were washed twice in phosphate buffered saline and fixed in analysed with CellQuest software (Becton Dickenson). methanol/acetone (50%/50%). Alkaline phosphatase activity Microscopic imaging was done on an Olympus IX 70 was visualised by incubating cells in BCIP/NBT (Boehringer microscope equipped with a SPOT CCD-camera (Diagnostic Mannheim/Roche). The staining reaction was stopped by Instruments Inc.). rinsing the cells with phosphate buffered saline. For quantitative measurement of alkaline phosphatase induction C3H10T1/2 cells were seeded into 6-well plates at 20% confluence 24 h before transfection. Cells were transfected Acknowledgements with GLI-expression constructs together with lacZ expression We thank Dr Ken Kinzler for the gift of GLI1 plasmid, Dr plasmid for data normalization. Cells were harvested 24 h Paul Khavari for Sin-IP-GFP plasmid, Dr David Marko- post transfection in 100 ml of lysis buffer (50 mM Tris-HCl, vitz for providing human GLI2b expression plasmid, Dr pH 7.5; 1 mM MgCl2; 0.15% NP-40). Alkaline phosphatase Gary Nolan for the permission to use the Phoenix activity of each cleared lysate was analysed in 96-well packaging cell line and Dr Norbert Fusenig for providing microtiter plates using an alkaline phosphatase detection kit the HaCaT cell line. We are particularly grateful to Dr (Sigma). Absorbance was measured at 405 nm with a Spectra Harald Esterbauer for his advice and discussions about

Oncogene GLI1 and GLI2 in Basal Cell Carcinoma G Regl et al 5539 real-time PCR analysis and to Dr Emberger for histo- supported by FWF grant P14227-MOB (Austria), and the pathological analysis of BCC samples. This work was Medical Research Council (UK).

References

Altaba AR. (1999). Development, 126, 3205 – 3216. Kinzler KW, Bigner SH, Bigner DD, Trent JM, Law ML, Aszterbaum M, Epstein J, Oro A, Douglas V, LeBoit PE, O’Brien SJ, Wong AJ and Vogelstein B. (1987). Science, Scott MP and Epstein Jr EH. (1999). Nat. Med., 5, 1285 – 236, 70 – 73. 1291. Liu CZ, Yang JT, Yoon JW, Villavicencio E, Pfendler K, Aza-BlancP,LinHY,RuiziAltabaAandKornbergTB. Walterhouse D and Iannaccone P. (1998). Gene, 209, 1– (2000). Development, 127, 4293 – 4301. 11. Bai CB and Joyner AL. (2001). Development, 128, 5161 – Martin KJ, Graner E, Li Y, Price LM, Kritzman BM, 5172. Fournier MV, Rhei E and Pardee AB. (2001). Proc. Natl. Bonifas JM, Pennypacker S, Chuang PT, McMahon AP, Acad. Sci. USA, 98, 2646 – 2651. Williams M, Rosenthal A, De Sauvage FJ and Epstein Jr Matise MP, Epstein DJ, Park HL, Platt KA and Joyner AL. EH. (2001). J. Invest. Dermatol., 116, 739 – 742. (1998). Development, 125, 2759 – 2770. Boukamp P, Petrussevska RT, Breitkreutz D, Hornung J, Matise MP and Joyner AL. (1999). Oncogene, 18, 7852 – Markham A and Fusenig NE. (1988). J. Cell. Biol., 106, 7859. 761 – 771. Mo R, Freer AM, Zinyk DL, Crackower MA, Michaud J, Dahmane N, Lee J, Robins P, Heller P and Ruiz i Altaba A. Heng HH, Chik KW, Shi XM, Tsui LC, Cheng SH, Joyner (1997). Nature, 389, 876 – 881. AL and Hui C. (1997). Development, 124, 113 – 123. Dahmane N, Sanchez P, Gitton Y, Palma V, Sun T, Beyna Motoyama J, Liu J, Mo R, Ding Q, Post M and Hui CC. M, Weiner H and Ruiz i Altaba A. (2001). Development, (1998). Nat. Genet., 20, 54 – 57. 128, 5201 – 5212. Mullor JL, Dahmane N, Sun T and Ruiz i Altaba A. (2001). Dai P, Akimaru H, Tanaka Y, Maekawa T, Nakafuku M and Curr. Biol., 11, 769 – 773. Ishii S. (1999). J. Biol. Chem., 274, 8143 – 8152. Murone M, Rosenthal A and de Sauvage FJ. (1999). Curr. Deng H, Lin Q and Khavari PA. (1997). Nat. Biotechnol., 15, Biol., 9, 76 – 84. 1388 – 1391. Nilsson M, Unden AB, Krause D, Malmqwist U, Raza K, Ding Q, Motoyama J, Gasca S, Mo R, Sasaki H, Rossant J Zaphiropoulos PG and Toftgard R. (2000). Proc. Natl. and Hui CC. (1998). Development, 125, 2533 – 2543. Acad. Sci. USA, 97, 3438 – 3443. Fan H and Khavari PA. (1999). J. Cell. Biol., 147, 71 – 76. Oro AE, Higgins KM, Hu Z, Bonifas JM, Epstein Jr EH and Fan H, Oro AE, Scott MP and Khavari PA. (1997). Nat. Scott MP. (1997). Science, 276, 817 – 821. Med., 3, 788 – 792. ParkHL,BaiC,PlattKA,MatiseMP,BeeghlyA,HuiCC, Gailani MR, Stahle-Backdahl M, Leffell DJ, Glynn M, Nakashima M and Joyner AL. (2000). Development, 127, Zaphiropoulos PG, Pressman C, Unden AB, Dean M, 1593 – 1605. Brash DE, Bale AE and Toftgard R. (1996). Nat. Genet., Rheinwald JG and Green H. (1975). Cell, 6, 331 – 343. 14, 78 – 81. Ruiz i Altaba A. (1999). Trends Genet., 15, 418 – 425. GhaliL,WongST,GreenJ,TidmanNandQuinnAG. Ruppert JM, Kinzler KW, Wong AJ, Bigner SH, Kao FT, (1999). J. Invest. Dermatol., 113, 595 – 599. Law ML, Seuanez HN, O’Brien SJ and Vogelstein B. Goodrich LV and Scott MP. (1998). Neuron, 21, 1243 – 1257. (1988). Mol. Cell. Biol., 8, 3104 – 3113. Grachtchouk M, Mo R, Yu S, Zhang X, Sasaki H, Hui CC Ruppert JM, Vogelstein B and Kinzler KW. (1991). Mol. and Dlugosz AA. (2000). Nat. Genet., 24, 216 – 217. Cell. Biol., 11, 1724 – 1728. Green J, Leigh IM, Poulsom R and Quinn AG. (1998). Br. J. Sasaki H, Nishizaki Y, Hui C, Nakafuku M and Kondoh H. Dermatol., 139, 911 – 915. (1999). Development, 126, 3915 – 3924. Hahn H, Christiansen J, Wicking C, Zaphiropoulos PG, Shin SH, Kogerman P, Lindstrom E, Toftgard R and Chidambaram A, Gerrard B, Vorechovsky I, Bale AE, Biesecker LG. (1999). Proc. Natl. Acad. Sci. USA, 96, Toftgard R, Dean M and Wainwright B. (1996). J. Biol. 2880 – 2884. Chem., 271, 12125 – 12128. Tanimura A, Dan S and Yoshida M. (1998). J. Virol., 72, Hahn H, Wojnowski L, Miller G and Zimmer A. (1999). J. 3958 – 3964. Mol. Med., 77, 459 – 468. Toftgard R. (2000). Cell Mol. Life Sci., 57, 1720 – 1731. Hardcastle Z, Mo R, Hui CC and Sharpe PT. (1998). Villavicencio EH, Walterhouse DO and Iannaccone PM. Development, 125, 2803 – 2811. (2000). Am.J.Hum.Genet.,67, 1047 – 1054. Hynes M, Stone DM, Dowd M, Pitts-Meek S, Goddard A, Xie J, Murone M, Luoh SM, Ryan A, Gu Q, Zhang C, Gurney A and Rosenthal A. (1997). Neuron, 19, 15 – 26. Bonifas JM, Lam CW, Hynes M, Goddard A, Rosenthal i Altaba AR. (1998). Development, 125, 2203 – 2212. A, Epstein Jr EH and de Sauvage FJ. (1998). Nature, 391, Ingham PW. (1998). EMBO J., 17, 3505 – 3511. 90 – 92. Johnson RL, Rothman AL, Xie J, Goodrich LV, Bare JW, BonifasJM,QuinnAG,MyersRM,CoxDR,EpsteinJr EH and Scott MP. (1996). Science, 272, 1668 – 1671. Kinto N, Iwamoto M, Enomoto-Iwamoto M, Noji S, Ohuchi H, Yoshioka H, Kataoka H, Wada Y, Yuhao G, Takahashi HE, Yoshiki S and Yamaguchi A. (1997). FEBS. Lett., 404, 319 – 323.

Oncogene