The Zinc-Finger Transcription Factor GLI2 Antagonizes Contact Inhibition and Differentiation of Human Epidermal Cells

The zinc-ﬁnger transcription factor GLI2 antagonizes contact inhibition and differentiation of human epidermal cells

Gerhard Regl1, Maria Kasper1, Harald Schnidar1, Thomas Eichberger1, Graham W Neill2, Mohammed S Ikram2, Anthony G Quinn3, Mike P Philpott2, Anna-Maria Frischauf1 and Fritz Aberger*,1

1Institute of Genetics, University of Salzburg, Hellbrunner Strasse 34, A-5020 Salzburg, Austria; 2Center for Cutaneaous Research, Barts and The London Queen Mary’s School of Medicine & Dentistry, University of London, UK; 3Experimental Medicine, AstraZeneca R & D Charnwood, Leicestershire, UK

In stratified epidermis, activation of the Hh/Gli signal portance of Hh signalling in vertebrate embryonic transduction pathwayhas been implicated in the control of development and in the control of cell proliferation is cell proliferation and tumorigenesis. The zinc-finger demonstrated by mutations in key components of the transcription factor Gli2 has been identified as critical pathway, which account for severe congenital malfor- mediator of the Hh signal at the distal end of the pathway, mations and tumour development in man (reviewed in but the molecular mechanisms bywhich Gli2 regulates Goodrich and Scott, 1998; Toftgard, 2000; Mullor et al., cell proliferation or induces epidermal malignancies such 2002; Wetmore, 2003). as basal cell carcinoma are still unclear. Here, we provide Basal cell carcinoma (BCC) of the skin represents one evidence for a role of human GLI2 in antagonizing contact of the most common malignancies in the Western world. inhibition and epidermal differentiation. We show bygene Ligand-independent activation of Hh signalling in expression profiling that activation of the GLI2 oncogene epidermis by mutational inactivation of the Hh-receptor in human keratinocytes activates the transcription of a PTCH, which in the absence of ligand represses the number of genes involved in cell cycle progression such as pathway, or by activating mutations in the Hh-signal E2F1, CCND1, CDC2 and CDC45L, while it represses transducer SMOH has been implicated as the critical genes associated with epidermal differentiation. Analysis eventin BCC development(Johnson et al., 1996; Stone of the proliferative effect of GLI2 revealed that GLI2 is et al., 1996; Xie et al., 1998). Further support for a able to induce G1–S phase progression in contact-inhibited causative role of inappropriate Hh signalling in BCC keratinocytes. Detailed time-course experiments identified has come from studies of transgenic mice expressing Shh E2F1 as earlytranscriptional target of GLI2. Further, we itself or a BCC-derived oncogenic form of SMOH in the show that GLI2 expression in human keratinocytes results basal layer of the epidermis. In either experiment, mice in a marked downregulation of epidermal differentiation developed BCC-like structures, showing that activation markers. The data suggest a role for GLI2 in Hh-induced of Hh-signal transduction in epidermal cells is sufficient epidermal neoplasia byopposing epithelial cell cyclearrest to induce skin tumorigenesis (Oro et al., 1997; Xie et al., signals and epidermal differentiation. 1998). Oncogene (2004) 23, 1263–1274. doi:10.1038/sj.onc.1207240 The zinc-finger transcription factors (TFs) GLI1 and Published online 22 December 2003 GLI2, which act at the very distal end of the Hh pathway, have been identified as putative mediators of Keywords: hedgehog signalling; GLI proteins; keratino- Hh-induced neoplasia, since overexpression of either TF cytes; basal cell carcinoma; epidermal differentiation; in the epidermis of transgenic mice induces various types cell cycle of tumours, some of which show BCC-like features (Grachtchouk et al., 2000; Nilsson et al., 2000; Sheng et al., 2002). Their relative contribution to Hh-induced tumorigenesis is, however, unclear at present. Introduction Although either TF is a potent oncogene in epidermal cells, evidence has accumulated suggesting that GLI2 The hedgehog (Hh)-signal transduction pathway, first rather than GLI1 may represent the primary mediator of identified by genetic analysis of Drosophila embryonic the Hh signal during embryogenesis and tumorigenesis: mutants, plays a critical role in a number of develop- firstly, Gli1 is dispensable for normal development and mental processes, including pattern formation, control for Shh-induced medulloblastoma formation (Park et al., of cell differentiation, proliferation and growth (re- 2000; Weiner et al., 2002), while loss of Gli2 function viewed in Ingham and McMahon, 2001). The im- results in severe developmental anomalies similar to those observed in Shh knockout mice (Ding et al., 1998; *Correspondence: F Aberger; E-mail: [email protected] Matise et al., 1998; Mill et al., 2003). Secondly, removal Received 22 September 2003; accepted 26 September 2003 of Gli2 but not of Gli1 can partially rescue the phenotype GLI2 expression in human epidermal cells G Regl et al 1264 of patched knockoutmice, which suffer from hyperacti- human epidermis. Differences between murine and vation of the Hh pathway (Bai et al., 2002). Further- human skin and the relatively high resistance of mice more, Gli2 has been shown to act upstream of Gli1, since to BCC development prompted us to use a purely removal of Gli2 function decreases levels of Gli1 mRNA human in vitro system to study the effect of GLI2 (Ding et al., 1998; Bai et al., 2002; Mill et al., 2003), and expression on epidermal cells in the absence of paracrine overexpression of GLI2 in epidermal cells results in signals derived from dermal cells. To identify GLI2- induction of GLI1 expression (Regl et al., 2002). regulated genes by DNA-array technology, we intro- While the genetic lesions involved in BCC development duced into the human keratinocyte line HaCaT (Bou- are well characterized, little is known about the down- kamp et al., 1988) a tetracycline-regulated GLI2 stream events leading to tumorigenic conversion of expression system (Figure 2d). This strategy ensures epidermal cells in response to inappropriate Hh signalling. highly reproducible and temporally controlled transgene Recentexperimentsaddressing the mechanism by which expression, which greatly facilitates data analysis of gene Hh signalling controls cell proliferation have shown that expression profiling experiments. The system also allows the pathway can interact with the cell cycle machinery at detailed time-course studies and conditional activation various points. In Drosophila, Hh regulates cell prolifera- of GLI2 in quiescentcells, which is very difficultto tion in the developing eye by activating cyclin D and achieve with retroviral expression systems. cyclin E expression. Analysis of the Drosophila cyclin E We have chosen the spontaneously immortalized, promoter showed that Cubitus interruptus – the Droso- nontumorigenic human keratinocyte line HaCaT as a phila homologue of vertebrate GLI proteins – directly model system, since, although aneuploid, it resembles stimulates cyclin E transcription (Duman-Scheel et al., primary human keratinocytes in that it has retained 2002). In vertebrates, Shh protein stimulates proliferation the capacity to differentiate and even to reconstitute of cerebellar neuronal precursor cells by regulating the stratified epidermis when grafted onto nude mice or used expression of D-type cyclins (Kenney and Rowitch, 2000), in organotypic cultures (Boukamp et al., 1988; Schoop and in human keratinocytes expression of SHH has been et al., 1999). Further, we have shown that with respect to shown to promote epidermal proliferation and oppose target gene expression, HaCaT and primary keratino- p21-induced epithelial cell cycle arrest (Fan and Khavari, cytes respond to GLI expression in a largely identical 1999). Further, loss of Shh or Gli2 function in mice results manner (Regl et al., 2002; data not shown). On the other in a significantdecrease of proliferating cells in the hair hand, the presence of cytogenetic aberrations and the follicle (Mill et al., 2003), and in vitro overexpression of immortalized phenotype of HaCaT cells (Boukamp GLI1 and GLI2 has been shown to stimulate S phase in et al., 1988; Lehman et al., 1993) may limitthe human keratinocytes (Regl et al., 2002). physiological relevance of data on cell cycle regulation. Although these data suggest that the proliferative We, therefore, validated results obtained with HaCaT effectof Shh and Gli proteinson neuronal and cells by using normal human keratinocytes expressing epidermal cells plays a critical role in brain and skin GLI2 via retroviral gene transfer. tumour development of vertebrates, the details of the To analyse the phenotypic changes of human molecular processes involved in Hh-mediated neoplasia keratinocytes in response to GLI2 expression on a remain to be established. molecular level, cDNA from confluent tetracycline- To elucidate the role of GLI2 in epidermal home- inducible GLI2-HaCaT cells (henceforth referred to as ostasis and disease, we analysed the effect of GLI2 tet-GLI2 HaCaT), either treated with tetracycline for expression on the molecular phenotype of human 96 h or untreated, was hybridized to high-density cDNA keratinocytes. Using DNA-array technology, we show arrays containing a set of 2135 sequence-verified EST that GLI2 induces the expression of key regulators of clones spotted in duplicate onto nylon membranes. cell cycle progression, while itrepresses genes associated Tetracycline-treated and -untreated samples were ana- with epidermal differentiation. Detailed analysis of the lysed on a total of four arrays, yielding eight data points proliferation and differentiation properties of GLI2- for each gene. Results of all eight array evaluations were expressing keratinocytes suggests a role of GLI2 in normalized for total signal intensity and used as input antagonizing both cell cycle arrest signals and epidermal data for a two-class unpaired statistical analysis using differentiation. The data provide insight into the significance analysis of microarrays (SAM) software mechanism by which hyperactivation of GLI2 may lead (University of Stanford; see Materials and methods) to tumorigenic conversion of epidermal cells. (Tusher et al., 2001). This yielded a total of 107 differentially expressed genes (Table 2), with 36 genes induced (red label) and 71 genes repressed (green label) by GLI2. The results were comparable to data obtained Results with a pool of four independently isolated tet-GLI2- GLI2 induces regulators of cell cycle progression but HaCaT lines, indicating that inter-clone variability is represses differentiation-associated genes in the human negligible (data not shown). keratinocyte cell line HaCaT Expression of GLI2 led to an increase of mRNA levels of genes involved in cell cycle progression (Table 2, Although GLI2 has been implicated in Hh-induced BCC light-yellow background label) such as CDC2, E2F1, development, little is known about the mechanisms and CCND1, PCNA and CDC45L, while mRNA levels of target genes regulated by this transcription factor in the CDK-inhibitor CDKNA1/p21 were reduced.

Oncogene GLI2 expression in human epidermal cells G Regl et al 1265 In addition, genes known to be expressed either at the array analysis. The higher fold-change values elevated (PTCH, TNC, MMP2) or decreased (MYC, measured by real-time RT–PCR compared to the array ITGA6, BPAG1, LAMB3) levels in BCC compared to approach is a common phenomenon and is likely to be normal skin (pink background label) (Savoia et al., due to lower background signals in the PCR-based 1993; Tuominen et al., 1997; Chopra et al., 1998; Varani approach. et al., 2000; Bonifas et al., 2001; Regl et al., 2002) were appropriately regulated in tet-GLI2 HaCaT cells. GLI2 fails to induce G1–S progression in the absence We also found upregulation of interleukin-6 (IL6), a of growth factors cytokine that has been shown to enhance the tumor- igenicity of BCC (Jee et al., 2001). Having shown that GLI2 expression in human epider- To gain more insight into the biological processes mal cells leads to a strong increase in transcript levels of regulated by GLI2 in human keratinocytes, we system- key regulators of proliferation such as E2F1, CDC2 or atically screened various gene annotation and literature CCND1, we next asked whether GLI2 has a stimulatory databases for expression data and possible functions of effect on cell cycle progression of keratinocytes inde- GLI2-regulated genes in epidermal cells (light-blue pendent of the presence of growth factors. background). We found that a number of genes It has been well established that exposure of repressed by GLI2 had previously been shown to be nondividing cells to mitogenic stimuli such as growth expressed in differentiating or terminally differentiated factors stimulates cell proliferation by increasing the keratinocytes of the cornified envelope (PI3 (also known levels of D-type cyclins, which can bind to and activate as elavin), SPRRA2, CSTA, UGCG) (Zettergren et al., cyclin-dependentkinases such as CDK4 and CDK6. 1984; Steinert and Marekov, 1995; Takahashi et al., Active cyclin D/CDK complexes phosphorylate the 1997; Watanabe et al., 1998) or to be involved in retinoblastoma gene product Rb, which in its unpho- promoting keratinocyte differentiation including DLX3 sphorylated state binds to and inhibits E2F proteins. (Morasso et al., 1996), the vitamin D receptor VDR Upon Rb phosphorylation, active E2F plays a central (reviewed in Bikle et al., 2001), the Notch ligand JAG1 role in inducing the expression of S-phase genes and (Nickoloff et al., 2002) and the proto-oncogene JUNB thus in promoting G1–S phase progression (for reviews (Welter et al., 1995; Rutberg et al., 1996; Medvedev see Harbour and Dean, 2000; Sherr, 2000). et al., 1999). By contrast, GLI2 expression led to To analyse whether GLI2 expression affects G1–S increased mRNA levels of integrin beta1 (ITGB1), a phase progression in the absence of growth factors, tet- marker of undifferentiated keratinocytes in the basal GLI2 HaCaT cells were firstgrown to30% confluency, layer of the epidermis (Jones et al., 1995). starved overnight in low-serum (0.2%) medium without tetracycline and then cultured for 48 h either in the presence or absence of tetracycline. As positive control, Verification of array data by real-time RT–PCR analysis starved cells were grown for 48 h in medium comple- The results obtained by DNA-array analysis were mented with 10% fetal bovine serum (FBS). The confirmed by real-time RT–PCR analysis of a selection number of cells in G1 or S/G2 phase was subsequently of 18 genes either activated or repressed by GLI2. As determined by flow cytometry. As shown in Figure 2a, shown in Figure 1, all 18 genes tested were found GLI2 expression did not lead to an increase in the differentially expressed according to results from number of cells in S/G2 phase compared to controls (34.4 and 33.8%, respectively), suggesting that in the absence of additional mitogenic signals GLI2 is unable to induce exit from Go/G1 arrest and re-entry into the cell cycle. By contrast, addition of 10% FBS to starved cells led to re-entry into the cell cycle as shown by the marked increase of cells in S/G2 phase (62.9%). To investigate whether the inability of GLI2 to induce G1–S phase progression is due to a failure of GLI2 to activate cell cycle genes in starved cells, we analysed the changes in mRNA levels of cell cycle regulators in response to GLI2. To verify that GLI2 is appropriately activated and fully functional in starved cells, we analysed the mRNA induction of the known direct Gli-target gene PTCH as a control. PTCH transcription was induced by GLI2 to levels comparable to those observed in cells grown in complete medium (data not Figure 1 Verification of DNA-array data by real-time RT–PCR shown), indicating that GLI2 protein expression and analysis. Note that the fold change of mRNA levels in response to activity is not altered by serum withdrawal. Figure 2b GLI2 has been plotted on a log 2 scale, due to high induction/ repression levels of certain GLI2-regulated genes (e.g. PTCH shows that treatment of starved tet-GLI2 HaCaT cells (log 2) ¼ 4.4 means that PTCH mRNA levels increased 21.1-fold in with tetracycline for 48 h does moderately increase the response to GLI2 expression) mRNA levels of genes involved in G1–S or S–M phase

Oncogene GLI2 expression in human epidermal cells G Regl et al 1266

Figure 2 GLI2 fails to induce G1 exit in starved HaCaT cells. (a) tet-GLI2 HaCaT cells were starved overnight and subsequently cultured for 48 h either in the presence (48 h þ tet) or absence (48 h Àtet) of tetracycline or in the presence of 10% FBS (48 h þ FBS) as positive control. The percentage of cells in G1 or S/G2 phase was analysed by ﬂow cytometry. (b) Real-time RT–PCR analysis of mRNA levels of cell cycle regulators in GLI2-expressing HaCaT cells. Fold mRNA increase is expressed as the ratio of the mRNA level of a gene in tetracycline-treated to its mRNA level in untreated cells. (c) Western blot analysis of the Rb phosphorylation state in starved tet-inducible GLI2 HaCaT cells. After starving, cells were cultured for another 24 or 48 h either in the presence (24 h þ tet; 48 h þ tet) or absence (24 h Àtet; 48 h Àtet) of tetracycline. (d) Western blot analysis of tet-GLI2 HaCaT cells showing GLI2 protein expression in response to various times of tetracycline treatment ( þ )

progression such as E2F1 (4.9-fold), CCNA2 (3.9-fold), GLI2 induces re-entry into S phase in contact-inhibited CDC45L (6.1-fold), CCNB1 (2.7-fold), CKS1B (2.7- human epidermal cells fold) and CDC2 (3.2-fold). Normal cells grown in vitro undergo cell cycle arrestas We also measured changes in the mRNA levels of D- soon as they reach confluency, a process frequently and E-type cyclins, since at least some of these have been suppressed in tumorigenic cells. described as putative direct targets of Hh/Gli signalling To analyse whether the GLI2 oncogene can antag- (Duman-Scheel et al., 2002; Yoon et al., 2002) As shown in Figure 2b, expression of GLI2 in starved keratino- onize contact inhibition of human keratinocytes, tet- GLI2 HaCaT cells were grown in complete media to cytes did not significantly change the mRNA levels of confluency and cultured for another 36 h (t 0) without D-type (CCND1,2,3) and E-type cyclins (CCNE1,2,3: ¼ data not shown). tetracycline to induce efficient contact inhibition. To test whether GLI2 is able to abrogate contact inhibition and Since D-type cyclins are involved in the phosphoryla- induce re-entry into the cell cycle, contact-inhibited cells tion-mediated inactivation of Rb protein, the failure of were cultured for another 48 h either in the presence or GLI2 to induce G1–S progression in starved cells may absence of tetracycline. Re-entry into the cell cycle was be due to insufficient phosphorylation of Rb protein. To subsequently analysed by bromodeoxyuridine (BrdU) test this hypothesis, we analysed Rb phosphorylation incorporation assays. Two independently isolated tet- using antibodies that distinguish between active (hypo- GLI2 HaCaT lines (#28 and #31) were analysed to phosphorylated, pRb) and inactive (hyperphosphory- exclude clone-specific effects. As shown in Figure 3, only lated, ppRb) Rb protein (Harbour and Dean, 2000). a small proportion of cells showed S-phase activity at When starved cells were cultured for 24 or 48 h in the 36 h postconfluency ( t ¼ 0 h) (Figure 3a and d (0 h), absence of tetracycline, only one distinct band corre- 9.2% of clone #28, 8.7% of clone #31). Confluent sponding to active Rb (pRb) was detected, indicating cultures grown for another 48 h in the absence of efficient cell cycle arrest. Activation of GLI2 expression tetracycline showed a similar percentage of BrdU- for 24 or 48 h led to a moderate increase of inactive positive cells (Figure 3b and d, #28: 8.1%; #31: 8.2%), ppRb, but active pRb was still the predominant form, while expression of GLI2 by tetracycline treatment suggesting that Rb protein is not efficiently inactivated (Figure 3c and d) caused a threefold increase of the in starved GLI2-expressing cells (Figure 2c). number of cells in S phase (#28: 24.5%, #31: 24.5%),

Oncogene GLI2 expression in human epidermal cells G Regl et al 1267

Figure 3 GLI2 induces reentry into G1–S phase in contact-inhibited keratinocytes. (a–d): Analysis of cell cycle activity of contact- inhibited HaCaT cells in response to GLI2. BrdU incorporation was analysed as an indicator of G1–S phase progression. (a) Contact- inhibited tet-GLI2 HaCaT cells at 36 h post conﬂuency (t ¼ 0 h) grown in the absence of tet (Àtet). (b–c) Contact-inhibited tet-GLI2 HaCaT cells grown for another 48 h either in the absence (b) or presence (c) of tetracycline. Note the marked increase of BrdU-positive cells in response to GLI2 expression (48 h, þ tet). (d) Quantitative analysis of two independently isolated tet-GLI2 HaCaT lines (#28, #31) cultured as in (a–c). Data represent the mean value calculated from triplicate experiments with 2000 cells counted in each replicate. (e) Real-time RT–PCR analysis of cell cycle regulators in contact-inhibited HaCaT cells expressing GLI2 for 6, 24 or 48 h. Note the rapid increase of E2F1 and decrease of CDKN1A mRNA levels. (f) Western blot analysis showing the Rb phosphorylation state in contact-inhibited tet-GLI2 HaCaT cells, grown for 24 or 48 h either in the presence or absence of tetracycline. Note that in GLI2-expressing cells (24 h þ tet; 48 h þ tet) only the inactive, hyperphosphorylated form of Rb (ppRb) is detected. (g) Real-time RT– PCR analysis of cell cycle regulators in contact-inhibited primary keratinocytes expressing GLI2. To induce contact inhibition, primary human keratinocytes were transduced with GLI2 or EGFP-control retrovirus, grown to conﬂuency and cultured for another 24 h either in the absence (prim. KC) or presence of Ca2 þ (prim. KC (Ca2 þ )). Fold mRNA induction values represent the ratio of mRNA levels in GLI2-expressing to mRNA levels in EGFP-expressing control cells

showing that GLI2 can antagonize contact inhibition CDKN1A repressed fourfold already after 6 h of and induce re-entry into the cell cycle. tetracycline treatment. Strong activation of other To relate the proliferative phenotype of GLI2- GLI2-regulated cell cycle genes was observed only after expressing keratinocytes to changes in gene expression 24 and 48 h following tetracycline addition, suggesting and to identify early transcriptional changes in response that changes in E2F1 and CDKN1A mRNA levels to GLI2, we performed time-course studies of the representearly eventsin GLI2-induced G1–S progres- mRNA levels of GLI2-regulated cell cycle genes. As sion. As in starved cells, mRNA levels of the suggested shown in Figure 3e, mRNA levels of E2F1 were elevated directGLI targetCCND2 (Yoon et al., 2002) were threefold and those of the CDK-inhibitor p21/ unchanged at all time points.

Oncogene GLI2 expression in human epidermal cells G Regl et al 1268 We then asked whether re-entry of contact-inhibited GLI2-expressing keratinocytes into the cell cycle is accompanied by efﬁcient inactivation of Rb protein. Tet-GLI2 HaCaT cells were contact inhibited for 36 h and then grown for another 24 or 48 h either in the presence or absence of tetracycline. The phosphorylation state of Rb protein was subsequently analysed as described above. As shown in Figure 3f, only active hypophosphorylated pRb protein was present in contact-inhibited HaCaT cells grown in the absence of tetracycline, while expression of GLI2 led to efﬁcient hyperphosphorylation and inactivation of Rb, respectively. Next, we validated these results by analysing the expression of G1–S and G2–M phase progression genes in contact-inhibited primary human keratinocytes. Similar to HaCaT cells, expression of GLI2 in contact- inhibited primary keratinocytes (prim. KC) led to an increase of CCNA2, CDC2 and CCNB1 mRNA levels, while levels of CCND2 were largely unchanged (Figure 3g). Notably, treatment of GLI2-expressing contact-inhibited primary cells with 1 mM calcium (prim. KC (Ca2 þ )), a potent growth arrest and epidermal differentiation signal, was unable to abrogate the proliferative activity of GLI2. Under these condi- tions, the effect of GLI2 on growth-arrested keratinocytes was even enhanced compared to untreated contact-inhibited cells (prim. KC) as can be seen by the stronger increase of E2F2, CCND1 and CCNB1 Figure 4 GLI2 represses epidermal marker gene expression in mRNA levels. Again CCND2 mRNA levels were only HaCaT and primary human keratinocytes. (a) Real-time RT–PCR analysis of epidermal differentiation markers and the basal cell very weakly induced by GLI2. Together, these results marker ITGB1 in response to GLI2 expression in tet-inducible suggest that GLI2 opposes contact inhibition of HaCaT cells. (b) mRNA levels of epidermal differentiation markers epidermal cells by promoting G1–S and G2–M phase in primary human keratinocytes transduced with a GLI2-expres- progression. sing retrovirus (SIN-GLI2-EGFP). As reference, primary keratinocytes were transduced with EGFP-expressing retrovirus

GLI2 represses expression of epidermal differentiation genes on the differentiation of epidermal cells was confirmed The results of gene expression profiling revealed that a by retroviral expression of GLI2 in primary human considerable number of genes repressed by GLI2 are keratinocytes. As in tet-GLI2 HaCaT cells, expression normally expressed in differentiating or differentiated of GLI2 in primary human keratinocytes led to down- keratinocytes. This suggested that GLI2 may be able to regulation of mRNA levels of KRT10 (10.5-fold suppress epidermal differentiation. To analyse whether repressed), SPRR2A (3.6-fold repressed), the terminal GLI2 antagonizes keratinocyte differentiation, tet-GLI2 differentiation marker Loricrin (LOR) (2.9-fold re- HaCaT cells were grown to confluency in high-calcium pressed) and IVL (2.5-fold repressed) (Figure 4b). The medium (1.2 mM Ca2 þ ) – a condition that increases the weaker repressive effectof GLI2 observed in primary expression of epidermal differentiation markers (Gar- cells compared to HaCaT cells is likely to be due to the ach-Jehoshua et al., 1998) – and then treated with lower GLI2 expression level achieved by the retroviral tetracycline to induce GLI2 expression for 6, 24 or 48 h. expression system (data not shown). As indicator of cell differentiation, the mRNA levels of early (Keratin 1 and 10 (KRT1 and KRT10)) and late epidermal differentiation markers (Involucrin (IVL) and Discussion small proline rich protein 2A (SPRR2A)) and of the basal cell/stem cell marker beta 1 integrin (ITGB1) were Control of epidermal gene expression by the human measured by real-time RT–PCR and compared to oncogene GLI2 uninduced control cells. As shown in Figure 4a, expression of GLI2 dramatically reduced the mRNA levels of The development and maintenance of stratified epider- all differentiation markers analysed. In contrast, the mis requires a precise balance between cell proliferation amountof ITGB1 mRNA increased in response to and differentiation, which is controlled by reciprocal GLI2 (2.6-fold after 24 h and 3.6-fold after 48 h of paracrine signalling events involving epidermal and tetracycline treatment). The repressive activity of GLI2 underlying dermal cells (Werner and Smola, 2001).

Oncogene GLI2 expression in human epidermal cells G Regl et al 1269 The complexity of these signalling processes makes it effectof Shh proteinon cerebellar granular precursor difficult to study cell-autonomous effects of a given gene cells (CGPC). Although treatment of CGPC with Shh in vivo. Using a purely human model system to analyse induces proliferation and D-type cyclin expression in the on a molecular level the phenotypic changes of presence of growth factors, it fails to induce G1–S keratinocytes in response to GLI2 expression in the progression in starved CGPC, suggesting that additional absence of any dermal signals, we have shown that GLI2 mitogenic signals are required for Hh/Gli-induced activates genes involved in cell cycle progression, while it proliferation (Kenney and Rowitch, 2000). In the represses differentiation-associated genes. Further, ex- epidermis, such a signal may be required for activation pression of molecular BCC markers such as PTCH, of the PDGF-receptor alpha (PDGFRA), since inhibi- TNC, MYC or BPAG1 was appropriately regulated in tion of PDGFRA signalling in a Ptc À/À murine BCC our experimental system. These results demonstrate the cell line significantly reduces cell proliferation (Xie et al., relevance of our in vitro model system to Hh/Gli- 2001). induced gene expression patterns in BCC. GLI2 represses epidermal differentiation Regulation of G1–S phase progression by GLI2 In addition to the proliferative effect on contact- Taking advantage of our inducible GLI2 expression inhibited keratinocytes, we have uncovered a role of system, we have shown that GLI2 promotes G1–S GLI2 in opposing differentiation of human keratino- progression in contact-inhibited keratinocytes. Notably, cytes, as evidenced by the strong repression of epidermal GLI2 does not simply delay the onset of contact differentiation markers in GLI2-expressing HaCaT and inhibition but induces quiescent cells to re-enter the cell primary human keratinocytes. Although these data are cycle. Detailed time-course studies of GLI2 target gene based on in vitro expression systems, it is noteworthy expression in contact-inhibited keratinocytes suggest that in vivo human GLI2 is predominantly expressed in that transcriptional activation of E2F1 and repression of regions of normal skin and BCC, where undifferentiated CDKN1A/p21 are early responses to GLI2 expression. and/or (hyper)proliferating epidermal cells are located Compared to E2F1, whose overexpression has been (Ikram et al., submitted). shown to induce G1–S progression and DNA replica- The strong repressive effect of GLI2 on the expression tion (Arata et al., 2000), the induction of CCNA2, of a number of genes – an effectthatis notobserved by CDC2, CDC45L and CCNE transcription was clearly expression of GLI1 (Eichberger et al., in preparation) – delayed. Since all of these genes have been shown to be points to the existence of a GLI2 repressor form which, direct targets of E2F proteins (Ohtani et al., 1995; Helin, like the Drosophila Gli homologue Cubitus interruptus, 1998; Arata et al., 2000; Muller et al., 2001; Ren et al., may be generated by proteolytic processing of GLI2 2002), their induction in GLI2-expressing cells is likely full-length protein (Aza-Blanc et al., 1997). Murine Gli2 to be the consequence of increased levels of active E2F has been shown to contain a putative N-terminal protein that has been relieved from inhibition by Rb. repressor domain, since removal of this domain converts Analysis of homozygous mutant Gli2 mice has Gli2 from a weak into a strong transcriptional activator revealed a role of murine Gli2 in the activation of D- (Sasaki et al., 1999). In contrast, however, human GLI2 type cyclin expression in epidermal cells (Mill et al., lacks this domain, which may explain the strong 2003). A possible direct role of Gli proteins in regulating activator function of full-length GLI2 protein (Regl D-type cyclins has also been suggested by the presence et al., 2002) and also pointtodifferentmodes of Gli2 of a putative Gli-binding site in the human CCND2 processing in murine and human epidermis. promoter that can be bound by recombinant GLI Taken together, the results presented here suggest a protein in vitro (Yoon et al., 2002). In our studies, model, where GLI2 plays a dual role as activator of however, expression of GLI2 in cultured human keratinocyte proliferation and repressor of epidermal keratinocytes did not lead to significantly elevated differentiation. In normal skin, both functions may be mRNA levels of CCND2. Whether the inability of implicated in the maintenance of epidermal homeostasis, GLI2 to induce CCND2 expression is due to the in vitro while in state of disease, hyperactivation of GLI2 system used or due to cell type-specific effects remains to function by inappropriate Hh signalling may distort be addressed in further studies. this balance leading to epidermal neoplasia. A detailed In contrast to its proliferative effect in contact- understanding of the oncogenic processes governed by inhibited keratinocytes, GLI2 failed to induce re-entry GLI2 will be a major future aim and involve the into the cell cycle in starved keratinocytes. This is likely identification and functional analysis of direct target to be due to the failure of GLI2 to cause sufficient genes in human epidermis. inhibition of Rb function, which would be required for E2F1 protein to become fully active. Indeed, activation of E2F target genes in starved keratinocytes is much Materials and methods weaker compared to contact-inhibited cells, where Rb protein is inhibited efficiently by GLI2 expression Cell culture and retroviral infection of keratinocytes (Harbour and Dean, 2000; Sherr, 2000). Our results The T-REx system (Invitrogen) was used to generate tet-GLI2 obtained with starved GLI2-expressing human kerati- HaCaT lines expressing N-terminally His-tagged GLI2 under nocytes are consistent with studies of the mitogenic the control of the tetracycline repressor. GLI2 expression was

Oncogene GLI2 expression in human epidermal cells G Regl et al 1270 induced by adding 1 mg/l tetracycline (Invitrogen) to the cell transcriptase (Invitrogen), according to the manufacturer’s culture medium (high-glucose Dulbecco’s modified Eagle’s instructions. Real-time RT–PCR analysis was performed on a medium (Life Technologies) supplemented with 10% FBS, Rotorgene 2000 (Corbett Research) using iQTM SYBR Green 100 mg/l streptomycin and 62.5 mg/l penicillin). Real-time RT– Supermix (BIORAD). Real-time primer sequences are shown PCR analysis of independently isolated tet-GLI2 HaCaT lines in Table 1 or have been published previously (Regl et al., showed that addition of tetracycline increased GLI2 mRNA to 2002). Absence of genomic DNA was ensured by omitting levels comparable to those in BCC samples (data not shown), reverse transcriptase during cDNA synthesis. The specificity suggesting that the inducible system is suitable to simulate and quality of the PCR reactions was controlled by direct in vitro GLI gene expression in diseased skin. Further, it sequencing of the PCR amplicons, melting curve analysis and indicates that the system does not produce unphysiological gel electrophoresis. ‘Primer-only’ controls were done to ensure transgene expression levels, which otherwise may result in the absence of primer dimers. Large ribosomal protein P0 unspecific results due to cytotoxicity or other stress responses. (RPLP0) was used as a reference standard for all analyses to To generate the retroviral bicistronic GLI2-EGFP expres- control for the amount of sample material (Martin et al., sion construct, N-terminally His-tagged GLI2 was cloned into 2001). Real-time analysis using cyclophilin E as reference pI2E-A, a modified version of the pIRES2-EGFP plasmid standard gave comparable results (data not shown). (Clontech) (Regl et al., 2002). PI2E-A-GLI2 was digested with SalI and NotI to excise CMV-GLI2-IRES-EGFP. The Gene expression profiling resulting fragment was cloned into XhoI–NotI-digested retroviral SIN-IP plasmid (gift from Prof. P Khavari) to create A nonredundantsetof 2135 sequence-verified EST clones SIN-GLI2-EGFP. Amphotropic retrovirus was produced as selected from the human UniGem V2.0 library (Incyte previously described (Deng et al., 1997) except that the more Genomics Inc.) and the RZPD Unigene clone collection efficientPhoenix packaging cell line was used. Primary human (http://www.rzpd.de) was PCR-amplified and spotted in keratinocytes were isolated and infected as previously de- duplicate on nylon membranes (Hybond N þ , Amersham scribed (Rheinwald and Green, 1975; Deng et al., 1997) except Biosciences) using a MicroGridII spotting robot (BioRobotics, that cells were plated at a density of 0.5–1.0 Â 106 cells per UK). cDNA labelling and array hybidizations were carried out 10 cm dish in defined keratinocyte-SFM (Invitrogen) 16–18 h as described previously (Aberger et al., 2001). In brief, 15 mg prior to infection. total RNA from each sample was reverse transcribed with SuperscriptII (Rnase H À) reverse transcriptase (Invitrogen) in the presence of 70 mCi alpha-[33P]dCTP (3000 Ci/mmol, Amer- RNA isolation and real-time RT–PCR analysis sham Biosciences). Labelled cDNA was purified with GFX Total RNA of HaCaT cells and primary human keratinocytes DNA purification columns (Amersham Biosciences). Arrays was isolated using TRI reagent (Molecular Resarch Center) were hybridized for 36 h at68 1C in 10 ml hybridization buffer followed by LiCl precipitation. RNA used for real-time RT– (5 Â SSC, 5 Â Denhard’s, 1% SDS) and washed for 20 min at PCR analysis was further purified with the High Pure RNA 601C once in 2 Â SSC/0.1% SDS, and twice in 0.2 Â SSC/0.1% Isolation Kit (Roche) to remove any genomic contaminations. SDS. Filters were exposed for 4 days and scanned with a BAS- cDNA was synthesized with Superscript II (Rnase HÀ) reverse 1800II (Fuji) phosphoimager. Images were analysed using the

Table 1 Real time RT–PCR primer sequences Forward primer (50–30) Reverse primer (50–30) Amplicon length (bp)

KRT1 AGGTCGATTTGTCCCAGCCTTACCG ATGTCATGTGGGTGGTGGTCACTGC 198 KRT10 TGGAAGCCTCCTTGGCAGAAACAGA CCTCTCCTTCTAGCAGGCTGCGGTA 204 IVL GCACCTGGAACAGCAGGAAAAGCAC GTGGGCAGGGCTGGTTGAATGTCT 180 LOR GGCGAAGGAGTTGGAGGTGTTTTCC AGGCACTGGGGTTGGGAGGTAGTTG 187 CDNK1A CTGGAAGGGGAAGGGACACACAAGA AGGAAGGTCGCTGGACGATTTGAGG 219 CCNE1 CGCCTGCTCCACGTTCTCTTCTGTC ACTGGTGTCTGGAGGTGGCTGGTGT 201 CCNA2 GGCGCTCCAAGAGGACCAGGAGAATA CACATGAATGGTGAACGCAGGCTGT 238 CCNB1 TGCCCCTGCAGAAGAAGACCTGTGT TGTTTCCAGTGACTTCCCGACCCAGT 197 CCND1 CACCTAGCAAGCTGCCGAACCAAAA TCACGACAGACAAAGCGTCCCTCAA 222 CCND2 AGAACACCCCATGCGTGCTGAGAG ATGTGTGCCCCTGACCTGGCTGATA 219 CCND3 AAGCCCAAGGGATCTGGTCCTACCC GGGCGTTCAAAAGGAATGCTGGTGT 197 CDC45L TGTCTTTGATGGAGAGCCCCGAGAA TACAGGAAAGGCCCCTGGGAGATGA 199 CKS1B ACCACCATAGCCCAGCCAGATGAGT ACCACACATACAACACCCGGCAGAA 197 CDC2 TCAGGATTTTCAGAGCTTTGGGCACTC GCCATTTTGCCAGAAATTCGTTTGG 202 E2F1 CTGAGCAAGCCAGGAAGGGAAGGAG CGCAGAGATGGACTCATGCACACAC 201 E2F2 TGAAGGAGCTGATGAACACGGAGCA CTGTCGGGCACTTCCAGTCTCGTCT 205 ITGB1 GACAAATTACCCCAGCCGGTCCAAC GGCCAATAAGAACAATTCCAGCAACCA 205 DLX5 TCGGCTTCCTATGGCAAAGCTCTCA ATTCTCACCTCGGGCTCGGTCACT 200 DLX3 GAAGGTCCGAAAGCCGCGTACAATCT CGGCACCTCCCCGTTCTTGTAGAGTT 200 IL1R2 GTGGCCCTGGAAGATGCTGGCTATT TGCCGGTTCCCAGAAACACCTTACA 208 FOXE1 CATCTTGGATGCTGCCCTGCGTATT CCAGCACGTCCTGCTCAAAAGTTCA 195 FST TCACCTACTCCAGTGCCTGCCACCT GGCACAGCTCATCACAGAGGGAACA 189 CTSL AACTGTGGGGCCCATTTCTGTTGCT CCCCATTCTTCACCCCAGCTGTTCT 201 EDN1 TCTGGACATACCCCACCTCCCTCTG ACTGCAGCTCCCCCAATTTTTCTGG 191 TNC TCCATGGCCTACCACAATGGCAGAT GATTGAGTGTTCGTGGCCCTTCCAG 201 SPRRA2 CCACCTCAGCAGTGCCAGCAGAAAT CTGTGCATCCATGGAAGGCTTTGGT 189 PI3 TTGATCGTGGTGGTGTTCCTCATCG CCTTTGACTGGCTCTTGCGCTTTGA 182 PCNA CTCATCAACGAGGCCTGCTGGGATA TGCCGGCGCATTTTAGTATTTTGGA 187 JUNB TGGAGGACAAGGTGAAGACGCTCAA TAAAGGGGCAGGGGACGTTCAGAAG 176

Oncogene GLI2 expression in human epidermal cells G Regl et al 1271 AIDA Metrix suite (Raytest). Data were normalized for total BrdU incorporation assays and flow cytometry analysis signal intensity and statisically analysed using SAM software BrdU incorporation assays were performed with the FLUOS (University of Stanford; Tusher et al., 2001). For SAM in situ cell proliferation kit (Roche). Cells were incubated for analysis, the delta value was set to represent a minimal false 90 min in the presence of BrdU before detection with detection rate (FDR) of 0.17%. The stringency was further flourescein-labelled anti-BrdU antibody. Microscopic imaging increased by setting the fold-change parameter to 1.8, such was carried outon an Olympus IX 70 microscope equipped that only those genes were called significant that showed at with a SPOT CCD-camera (Diagnostic Instruments Inc.). least a 1.8-fold induction or repression in response to GLI2 Flow cytometry analysis was performed on a FACSCalibur expression. Furthermore, only if both duplicates were called (Becton Dickenson) and data were analysed with CellQuest significant by SAM, the gene was considered differentially software (Becton Dickenson). expressed and included in Table 2.

Table 2 Gene expression of human epidermal cells in response to GLI2 (SAM output) HUGO gene name (www.gene.ucl.ac.uk) Gen Bank acc. no. d-score dup1 Fold induction dup1 d-score dup 2 Fold induction dup 2

FST M19481 12.11 13.64 10.38 14.42 FOXE1 U89995 10.63 7.19 9.47 7.39 IL1R2 X59770 12.83 6.83 10.96 7.10 TNC X56160 16.89 6.83 16.68 6.96 CDC2 Y00272 15.66 4.35 11.75 4.59 TGFBI R79474 12.55 3.63 7.84 3.15 SERPINB2 M31551 12.25 3.38 7.72 3.15 EDN1 J05008 14.39 3.24 11.33 3.50 CDC45L AF053074 17.03 2.99 11.18 2.64 MEOX1 AA424258 10.99 2.88 9.14 2.89 COL5A2 Y14690 16.88 2.84 16.48 2.87 CKS1B AI033892 15.75 2.77 10.39 2.68 DKFZp58 6C1817 AI057445 8.68 2.70 8.28 3.13 MMP2 M55593 12.11 2.62 9.27 2.90 PCNA AA843679 13.49 2.53 8.81 2.82 ADD3 D67031 12.68 2.52 7.41 2.36 CTSL AW024755 13.74 2.47 9.48 2.34 TGFA X70340 13.08 2.40 12.69 2.13 IL6 M54894 12 2.37 8.23 2.40 PTCH U43148 7.19 2.31 5.78 2.32 CCL17 D43767 14.26 2.30 8.52 2.35 CCND1 X59798 9.74 2.21 4.94 2.05 MAD2L1 AJ000186 12.44 2.20 10.03 1.92 BRD2 AA576562 16.25 2.17 14.19 2.06 CAMK1 L41816 18.12 2.11 10.93 2.17 CDC7L1 AF0155 92 10.66 2.06 10.66 2.06 SPG20 AB011182 5.12 2.06 4.87 1.98 FEN1 X76771 18.98 2.05 13.71 2.04 E2F1 U47677 3.32 2.01 5.67 1.96 CNTN2 X68274 4.46 1.96 4.36 1.84 HSPA4 AB023420 9.35 1.93 7.14 2.11 ITGB1 X07979 6.84 1.92 5.94 1.85 ILF3 AF007140 7.76 1.92 7.52 1.87 PPP1CB X80910 9.08 1.88 5.7 2.06 FGF13 AF100143 8.31 1.87 3.69 1.98 CLK2 L29218 9.76 1.85 9.26 1.83

HUGO gene name (www.gene.ucl.ac.uk) GenBank acc.no. d-score dup 1 Fold repression dup1 d-score dup 2 Fold repression dup2

MMP13 AA604390 10.54 25.66 11.16 33.33 CLECSF2 X96719 24.90 21.12 20.54 21.02 VAV3 AI339783 44.51 14.35 37.11 15.88 PI3 D13156 24.09 12.18 18.58 11.19 HPGD L76465 28.62 9.52 25.80 10.42 MMP10 X07820 23.87 9.04 21.76 7.73 CSTA AI680589 25.71 8.85 17.33 10.68 BPAG1 M69225 26.96 8.49 21.13 7.67 JUNB M29039 9.39 8.29 5.41 6.91 unknown1 AI951765 7.78 6.00 6.64 5.27 UGT1A U89508 30.46 5.74 18.42 5.22 SPRR2A M21302 3.77 5.58 3.77 5.58 HPGD R31834 44.34 5.35 28.89 4.67 ARHH Z35227 16.57 5.11 16.45 5.72 HLA-DRA H52596 26.58 4.76 17.37 4.54 MMP10 X07820 5.76 4.67 4.36 4.28 LUM AL036211 10.36 4.50 9.41 3.82

Oncogene GLI2 expression in human epidermal cells G Regl et al 1272 Table 2 Continued HUGO gene name (www.gene.ucl.ac.uk) GenBank acc.no. d-score dup 1 Fold induction dup 1 d-score dup 2 Fold induction dup 2 IGFBP3 M31159 - 15.50 4.49 - 15.20 4.69 CEACAM6 AI677998 - 21.96 4.47 - 20.16 4.80 LAMB3 U17760 - 15.76 4.39 - 15.37 4.65 ITGA6 X53586 - 37.37 4.10 - 28.90 3.90 ABCA1 AA902925 - 14.77 4.02 - 9.46 3.85 BMP1 U50330 - 20.86 3.68 - 19.68 3.61 MAZ AA100060 - 29.54 3.63 - 24.98 3.60 IFNGR1 J03143 - 7.12 3.58 - 4.54 3.63 IFITM1 J04164 - 18.91 3.35 - 15.91 3.67 LINK-GEFII NM_016339 - 16.80 3.35 - 13.22 2.79 unknown U55984 - 50.99 3.18 - 30.91 3.22 HLA-E NM_005516 - 14.90 2.96 - 11.76 3.18 FZD6 AB012911 - 7.74 2.94 - 5.86 2.83 BMP7 X51801 - 12.52 2.93 - 10.96 3.17 CCNG2 AI271688 - 12.22 2.66 - 11.28 2.67 TIMP3 D45917 - 13.07 2.65 - 10.68 2.97 H2BFQ AI016731 - 22.97 2.63 - 14.58 2.52 JAG1 AI570156 - 12.37 2.61 - 9.24 2.65 HLA-E H73887 - 14.85 2.59 - 11.16 2.58 NPY2R U42766 - 13.89 2.53 - 13.74 2.86 CDKNA1 AA481474 - 8.22 2.53 - 7.88 2.64 AKAP4 AF072756 - 9.91 2.50 - 8.38 2.52 MAPK6 X80692 - 7.87 2.43 - 7.02 2.74 SYTL2 AI823970 - 4.49 2.41 - 4.40 2.25 RORC U16997 - 17.69 2.36 - 14.32 2.57 MSX2 AI138926 - 12.94 2.33 - 11.57 2.79 EGFR H80438 - 7.43 2.26 - 6.22 2.21 UGCG AI075195 - 7.37 2.25 - 6.85 2.22 RNASE3 X16545 - 7.89 2.23 - 6.53 2.25 VDR AA283122 - 4.07 2.23 - 7.61 2.75 ATP10B AB018258 - 15.53 2.21 - 6.68 2.21 VIPR1 U67784 - 11.12 2.20 - 10.34 2.17 EFNA1 M57730 - 13.44 2.20 - 11.20 2.17 ISGF3 M87503 - 6.84 2.14 - 6.35 2.18 unknown2 AF035315 - 5.95 2.06 - 4.99 2.05 MSX2 D14970 - 8.43 2.05 - 8.23 1.96 PRKACA X07767 - 5.49 2.04 - 4.52 2.09 CEACAM7 C06062 - 8.61 2.03 - 6.85 1.84 PTEN U96180 - 6.93 2.02 - 4.27 1.85 EFEMP1 U03877 - 7.78 2.02 - 6.43 2.09 CDL1 AA044407 - 9.78 1.99 - 7.15 2.04 MYC NM_002467 - 11.27 1.96 - 9.08 2.00 DLX3 AI080000 - 6.94 1.95 - 4.47 2.45 ATP9A AA620508 - 9.70 1.94 - 6.29 1.86 unknown3 AA102395 - 9.50 1.93 - 8.80 2.09 DLX5 AI826186 - 7.51 0.53 - 5.12 2.03 IL13 X69079 - 13.97 1.91 - 10.35 2.00 unknown4 R70850 - 6.18 1.88 - 5.29 1.88 TOB1 D38305 - 7.16 1.88 - 6.66 1.91 KIAA0155 D63875 - 5.30 1.88 - 4.97 1.84 MAP3K4 AI299943 - 9.70 1.88 - 6.63 1.88 BLVRA AA031931 - 6.42 1.85 - 3.96 2.31 BCL6 AI954940 - 16.20 1.84 - 9.54 1.93 KIAA0546 AB011118 - 5.67 1.83 -z5.27 1.90

SAM output was sorted by fold induction /repression values. Gene names represent approved gene symbols according to the HUGO Gene Nomenclature Committee (www.gene.ucl.ac.uk/ nomenclature /). Genes named unknown represent Incyte EST sequences, which do not show any signi“cant match with annotated nucleotide sequences in the GenBank /GenPept databases. The d-score for each duplicate spot (dup1 and dup2) represents the difference of the average expression levels for each gene in the induced and unindu ced state, divided by the standar d deviation of repeat experiments (Tusher et al., 2001)

Western blot analysis jugated antibody (Amersham Biosciences). Proteins were visualized with ECL detection system (Amersham Bio- N-terminally His-tagged GLI2 protein was detected with a sciences). monoclonal peroxidase HRP-conjugated anti-polyhistidine antibody (HIS-1, Sigma-Aldrich). Hypo- and hyperphosphorylated Rb protein (pRb and ppRb) was detected using Acknowledgements a monoclonal mouse anti-human Rb antibody (G3-245, BD We are grateful to Sabine Siller for excellent technical Biosciences) and a secondary sheep anti-mouse HRP-con- assistance, to Drs Harald Esterbauer and Alexandra Kaser

Oncogene GLI2 expression in human epidermal cells G Regl et al 1273 for critical reading of the manuscript and to Prof. Helmut Gesundheit’, the Stiftungs- und Foerderungsgesellschaft of the Hintner for supply with tumour and normal skin material. University of Salzburg and by an EMBO short-term fellowship This work was supported by FWF project P14227 (Austria), to TE. the University of Salzburg Schwerpunkt ‘Biomedizin und

References

Aberger F, Costa-Pereira AP, Schlaak JF, Williams TM, Muller H, Bracken AP, Vernell R, Moroni MC, Christians F, O’Shaughnessy RF, Hollaus G, Kerr IM and Frischauf AM. Grassilli E, Prosperini E, Vigo E, Oliner JD and Helin K. (2001). Genomics, 77, 50–57. (2001). Genes Dev., 15, 267–285. Arata Y, Fujita M, Ohtani K, Kijima S and Kato JY. (2000). Mullor JL, Sanchez P and Altaba AR. (2002). Trends Cell J. Biol. Chem., 275, 6337–6345. Biol., 12, 562–569. Aza-Blanc P, Ramirez-Weber FA, LagetMP, SchwartzC and Nickoloff BJ, Qin JZ, Chaturvedi V, Denning MF, Bonish B Kornberg TB. (1997). Cell, 89, 1043–1053. and Miele L. (2002). Cell Death Differ., 9, 842–855. Bai CB, Auerbach W, Lee JS, Stephen D and Joyner AL. Nilsson M, Unden AB, Krause D, MalmqwistU, Raza K, (2002). Development, 129, 4753–4761. Zaphiropoulos PG and Toftgard R. (2000). Proc. Natl. Bikle DD, Ng D, Tu CL, Oda Y and Xie Z. (2001). Mol. Cell. Acad. Sci. USA, 97, 3438–3443. Endocrinol., 177, 161–171. Ohtani K, DeGregori J and Nevins JR. (1995). Proc. Natl. Bonifas JM, Pennypacker S, Chuang PT, McMahon AP, Acad. Sci. USA, 92, 12146–12150. Williams M, Rosenthal A, De Sauvage FJ and Epstein Jr Oro AE, Higgins KM, Hu Z, Bonifas JM, Epstein Jr EH and EH. (2001). J. Invest. Dermatol., 116, 739–742. Scott MP. (1997). Science, 276, 817–821. Boukamp P, Petrussevska RT, Breitkreutz D, Hornung J, Park HL, Bai C, Platt KA, Matise MP, Beeghly A, Hui CC, Markham A and Fusenig NE. (1988). J. Cell Biol., 106, Nakashima M and Joyner AL. (2000). Development, 127, 761–771. 1593–1605. Chopra A, Maitra B and Korman NJ. (1998). J. Invest. Regl G, Neill GW, Eichberger T, Kasper M, Ikram MS, Koller Dermatol., 110, 52–56. J, Hintner H, Quinn AG, Frischauf AM and Aberger F. Deng H, Lin Q and Khavari PA. (1997). Nat. Biotechnol., 15, (2002). Oncogene, 21, 5529–5539. 1388–1391. Ren B, Cam H, Takahashi Y, VolkertT, Terragni J, Young Ding Q, Motoyama J, Gasca S, Mo R, Sasaki H, Rossant J RA and DynlachtBD. (2002). Genes Dev., 16, 245–256. and Hui CC. (1998). Development, 125, 2533–2543. Rheinwald JG and Green H. (1975). Cell, 6, 331–343. Duman-Scheel M, Weng L, Xin S and Du W. (2002). Nature, Rutberg SE, Saez E, Glick A, Dlugosz AA, Spiegelman BM 417, 299–304. and Yuspa SH. (1996). Oncogene, 13, 167–176. Fan H and Khavari PA. (1999). J. Cell Biol., 147, 71–76. Sasaki H, Nishizaki Y, Hui C, Nakafuku M and Kondoh H. Garach-Jehoshua O, Ravid A, Liberman UA, Reichrath J, (1999). Development, 126, 3915–3924. Glaser T and Koren R. (1998). Br. J. Dermatol., 139, Savoia P, Trusolino L, Pepino E, Cremona O and Marchisio 950–957. PC. (1993). J. Invest. Dermatol., 101, 352–358. Goodrich LV and Scott MP. (1998). Neuron, 21, 1243–1257. Schoop VM, Mirancea N and Fusenig NE. (1999). J. Invest. Grachtchouk M, Mo R, Yu S, Zhang X, Sasaki H, Hui CC Dermatol., 112, 343–353. and Dlugosz AA. (2000). Nat. Genet., 24, 216–217. Sheng H, Goich S, Wang A, Grachtchouk M, Lowe L, Mo R, Harbour JW and Dean DC. (2000). Genes Dev., 14, Lin K, de Sauvage FJ, Sasaki H, Hui CC and Dlugosz AA. 2393–2409. (2002). Cancer Res., 62, 5308–5316. Helin K. (1998). Curr. Opin. Genet. Dev., 8, 28–35. Sherr CJ. (2000). Cancer Res., 60, 3689–3695. Ingham PW and McMahon AP. (2001). Genes Dev., 15, Steinert PM and Marekov LN. (1995). J. Biol. Chem., 270, 3059–3087. 17702–17711. Jee SH, Shen SC, Chiu HC, Tsai WL and Kuo ML. (2001). Stone DM, Hynes M, Armanini M, Swanson TA, Gu Q, Oncogene, 20, 198–208. Johnson RL, Scott MP, Pennica D, Goddard A, Phillips H, Johnson RL, Rothman AL, Xie J, Goodrich LV, Bare JW, Noll M, Hooper JE, de Sauvage F and Rosenthal A. (1996). Bonifas JM, Quinn AG, Myers RM, Cox DR, Epstein Jr EH Nature, 384, 129–134. and Scott MP. (1996). Science, 272, 1668–1671. Takahashi H, Kinouchi M, Wuepper KD and Iizuka H. Jones PH, Harper S and Watt FM. (1995). Cell, 80, 83–93. (1997). J. Invest. Dermatol., 108, 843–847. Kenney AM and Rowitch DH. (2000). Mol. Cell. Biol., 20, Toftgard R. (2000). Cell. Mol. Life Sci., 57, 1720–1731. 9055–9067. Tuominen H, Pollanen R and Kallioinen M. (1997). J. Cutan. Lehman TA, Modali R, Boukamp P, Stanek J, Bennett WP, Pathol., 24, 590–596. Welsh JA, Metcalf RA, Stampfer MR, Fusenig N and Tusher VG, Tibshirani R and Chu G. (2001). Proc. Natl. Acad. Rogan EM et al. (1993). Carcinogenesis, 14, 833–839. Sci. USA, 98, 5116–5121. Martin KJ, Graner E, Li Y, Price LM, Kritzman BM, Varani J, Hattori Y, Chi Y, Schmidt T, Perone P, Zeigler ME, Fournier MV, Rhei E and Pardee AB. (2001). Proc. Natl. Fader DJ and Johnson TM. (2000). Br. J. Cancer, 82, Acad. Sci. USA, 98, 2646–2651. 657–665. Matise MP, Epstein DJ, Park HL, Platt KA and Joyner AL. Watanabe R, Wu K, Paul P, Marks DL, Kobayashi T, (1998). Development, 125, 2759–2770. Pittelkow MR and Pagano RE. (1998). J. Biol. Chem., 273, Medvedev A, Saunders NA, Matsuura H, Chistokhina A and 9651–9655. Jetten AM. (1999). J. Biol. Chem., 274, 3887–3896. Weiner HL, BakstR, HurlbertMS, Ruggiero J, Ahn E, Lee Mill P, Mo R, Fu H, Grachtchouk M, Kim PC, Dlugosz AA WS, Stephen D, Zagzag D, Joyner AL and Turnbull DH. and Hui CC. (2003). Genes Dev., 17, 282–294. (2002). Cancer Res., 62, 6385–6389. Morasso MI, Markova NG and SargentTD. (1996). J. Cell Welter JF, Crish JF, Agarwal C and Eckert RL. (1995). J. Biol. Biol., 135, 1879–1887. Chem., 270, 12614–12622.

Oncogene GLI2 expression in human epidermal cells G Regl et al 1274 Werner S and Smola H. (2001). Trends Cell Biol., 11, 143–146. Epstein Jr EH and de Sauvage FJ. (1998). Nature, 391, Wetmore C. (2003). Curr. Opin. Genet. Dev., 13, 34–42. 90–92. Xie J, Aszterbaum M, Zhang X, Bonifas JM, Zachary C, Yoon JW, Kita Y, Frank DJ, Majewski RR, Konicek BA, Epstein E and McCormick F. (2001). Proc. Natl. Acad. Sci. Nobrega MA, Jacob H, Walterhouse D and Iannaccone P. USA, 98, 9255–9259. (2002). J. Biol. Chem., 277, 5548–5555. Xie J, Murone M, Luoh SM, Ryan A, Gu Q, Zhang C, Zettergren JG, Peterson LL and Wuepper KD. (1984). Proc. Bonifas JM, Lam CW, Hynes M, Goddard A, Rosenthal A, Natl. Acad. Sci. USA, 81, 238–242.

Oncogene