DOCSLIB.ORG

The Zinc-Finger Transcription Factor GLI2 Antagonizes Contact Inhibition and Differentiation of Human Epidermal Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Zinc-Finger Transcription Factor GLI2 Antagonizes Contact Inhibition and Differentiation of Human Epidermal Cells Oncogene (2004) 23, 1263–1274 & 2004 Nature Publishing Group All rights reserved 0950-9232/04 $25.00 www.nature.com/onc The zinc-finger transcription factor GLI2 antagonizes contact inhibition and differentiation of human epidermal cells Gerhard Regl1, Maria Kasper1, Harald Schnidar1, Thomas Eichberger1, Graham W Neill2, Mohammed S Ikram2, Anthony G Quinn3, Mike P Philpott2, Anna-Maria Frischauf1 and Fritz Aberger*,1 1Institute of Genetics, University of Salzburg, Hellbrunner Strasse 34, A-5020 Salzburg, Austria; 2Center for Cutaneaous Research, Barts and The London Queen Mary’s School of Medicine & Dentistry, University of London, UK; 3Experimental Medicine, AstraZeneca R & D Charnwood, Leicestershire, UK In stratified epidermis, activation of the Hh/Gli signal portance of Hh signalling in vertebrate embryonic transduction pathwayhas been implicated in the control of development and in the control of cell proliferation is cell proliferation and tumorigenesis. The zinc-finger demonstrated by mutations in key components of the transcription factor Gli2 has been identified as critical pathway, which account for severe congenital malfor- mediator of the Hh signal at the distal end of the pathway, mations and tumour development in man (reviewed in but the molecular mechanisms bywhich Gli2 regulates Goodrich and Scott, 1998; Toftgard, 2000; Mullor et al., cell proliferation or induces epidermal malignancies such 2002; Wetmore, 2003). as basal cell carcinoma are still unclear. Here, we provide Basal cell carcinoma (BCC) of the skin represents one evidence for a role of human GLI2 in antagonizing contact of the most common malignancies in the Western world. inhibition and epidermal differentiation. We show bygene Ligand-independent activation of Hh signalling in expression profiling that activation of the GLI2 oncogene epidermis by mutational inactivation of the Hh-receptor in human keratinocytes activates the transcription of a PTCH, which in the absence of ligand represses the number of genes involved in cell cycle progression such as pathway, or by activating mutations in the Hh-signal E2F1, CCND1, CDC2 and CDC45L, while it represses transducer SMOH has been implicated as the critical genes associated with epidermal differentiation. Analysis eventin BCC development(Johnson et al., 1996; Stone of the proliferative effect of GLI2 revealed that GLI2 is et al., 1996; Xie et al., 1998). Further support for a able to induce G1–S phase progression in contact-inhibited causative role of inappropriate Hh signalling in BCC keratinocytes. Detailed time-course experiments identified has come from studies of transgenic mice expressing Shh E2F1 as earlytranscriptional target of GLI2. Further, we itself or a BCC-derived oncogenic form of SMOH in the show that GLI2 expression in human keratinocytes results basal layer of the epidermis. In either experiment, mice in a marked downregulation of epidermal differentiation developed BCC-like structures, showing that activation markers. The data suggest a role for GLI2 in Hh-induced of Hh-signal transduction in epidermal cells is sufficient epidermal neoplasia byopposing epithelial cell cyclearrest to induce skin tumorigenesis (Oro et al., 1997; Xie et al., signals and epidermal differentiation. 1998). Oncogene (2004) 23, 1263–1274. doi:10.1038/sj.onc.1207240 The zinc-finger transcription factors (TFs) GLI1 and Published online 22 December 2003 GLI2, which act at the very distal end of the Hh pathway, have been identified as putative mediators of Keywords: hedgehog signalling; GLI proteins; keratino- Hh-induced neoplasia, since overexpression of either TF cytes; basal cell carcinoma; epidermal differentiation; in the epidermis of transgenic mice induces various types cell cycle of tumours, some of which show BCC-like features (Grachtchouk et al., 2000; Nilsson et al., 2000; Sheng et al., 2002). Their relative contribution to Hh-induced tumorigenesis is, however, unclear at present. Introduction Although either TF is a potent oncogene in epidermal cells, evidence has accumulated suggesting that GLI2 The hedgehog (Hh)-signal transduction pathway, first rather than GLI1 may represent the primary mediator of identified by genetic analysis of Drosophila embryonic the Hh signal during embryogenesis and tumorigenesis: mutants, plays a critical role in a number of develop- firstly, Gli1 is dispensable for normal development and mental processes, including pattern formation, control for Shh-induced medulloblastoma formation (Park et al., of cell differentiation, proliferation and growth (re- 2000; Weiner et al., 2002), while loss of Gli2 function viewed in Ingham and McMahon, 2001). The im- results in severe developmental anomalies similar to those observed in Shh knockout mice (Ding et al., 1998; *Correspondence: F Aberger; E-mail: [email protected] Matise et al., 1998; Mill et al., 2003). Secondly, removal Received 22 September 2003; accepted 26 September 2003 of Gli2 but not of Gli1 can partially rescue the phenotype GLI2 expression in human epidermal cells G Regl et al 1264 of patched knockoutmice, which suffer from hyperacti- human epidermis. Differences between murine and vation of the Hh pathway (Bai et al., 2002). Further- human skin and the relatively high resistance of mice more, Gli2 has been shown to act upstream of Gli1, since to BCC development prompted us to use a purely removal of Gli2 function decreases levels of Gli1 mRNA human in vitro system to study the effect of GLI2 (Ding et al., 1998; Bai et al., 2002; Mill et al., 2003), and expression on epidermal cells in the absence of paracrine overexpression of GLI2 in epidermal cells results in signals derived from dermal cells. To identify GLI2- induction of GLI1 expression (Regl et al., 2002). regulated genes by DNA-array technology, we intro- While the genetic lesions involved in BCC development duced into the human keratinocyte line HaCaT (Bou- are well characterized, little is known about the down- kamp et al., 1988) a tetracycline-regulated GLI2 stream events leading to tumorigenic conversion of expression system (Figure 2d). This strategy ensures epidermal cells in response to inappropriate Hh signalling. highly reproducible and temporally controlled transgene Recentexperimentsaddressing the mechanism by which expression, which greatly facilitates data analysis of gene Hh signalling controls cell proliferation have shown that expression profiling experiments. The system also allows the pathway can interact with the cell cycle machinery at detailed time-course studies and conditional activation various points. In Drosophila, Hh regulates cell prolifera- of GLI2 in quiescentcells, which is very difficultto tion in the developing eye by activating cyclin D and achieve with retroviral expression systems. cyclin E expression. Analysis of the Drosophila cyclin E We have chosen the spontaneously immortalized, promoter showed that Cubitus interruptus – the Droso- nontumorigenic human keratinocyte line HaCaT as a phila homologue of vertebrate GLI proteins – directly model system, since, although aneuploid, it resembles stimulates cyclin E transcription (Duman-Scheel et al., primary human keratinocytes in that it has retained 2002). In vertebrates, Shh protein stimulates proliferation the capacity to differentiate and even to reconstitute of cerebellar neuronal precursor cells by regulating the stratified epidermis when grafted onto nude mice or used expression of D-type cyclins (Kenney and Rowitch, 2000), in organotypic cultures (Boukamp et al., 1988; Schoop and in human keratinocytes expression of SHH has been et al., 1999). Further, we have shown that with respect to shown to promote epidermal proliferation and oppose target gene expression, HaCaT and primary keratino- p21-induced epithelial cell cycle arrest (Fan and Khavari, cytes respond to GLI expression in a largely identical 1999). Further, loss of Shh or Gli2 function in mice results manner (Regl et al., 2002; data not shown). On the other in a significantdecrease of proliferating cells in the hair hand, the presence of cytogenetic aberrations and the follicle (Mill et al., 2003), and in vitro overexpression of immortalized phenotype of HaCaT cells (Boukamp GLI1 and GLI2 has been shown to stimulate S phase in et al., 1988; Lehman et al., 1993) may limitthe human keratinocytes (Regl et al., 2002). physiological relevance of data on cell cycle regulation. Although these data suggest that the proliferative We, therefore, validated results obtained with HaCaT effectof Shh and Gli proteinson neuronal and cells by using normal human keratinocytes expressing epidermal cells plays a critical role in brain and skin GLI2 via retroviral gene transfer. tumour development of vertebrates, the details of the To analyse the phenotypic changes of human molecular processes involved in Hh-mediated neoplasia keratinocytes in response to GLI2 expression on a remain to be established. molecular level, cDNA from confluent tetracycline- To elucidate the role of GLI2 in epidermal home- inducible GLI2-HaCaT cells (henceforth referred to as ostasis and disease, we analysed the effect of GLI2 tet-GLI2 HaCaT), either treated with tetracycline for expression on the molecular phenotype of human 96 h or untreated, was hybridized to high-density cDNA keratinocytes. Using DNA-array technology, we show arrays containing a set of 2135 sequence-verified EST that GLI2 induces the expression of key regulators of clones spotted in duplicate onto nylon membranes. cell cycle progression, while itrepresses genes associated Tetracycline-treated
Load more

Recommended publications
  • Hedgehog Signaling Is Evolutionarily Conserved Cilium-Independent
    Downloaded from genesdev.cshlp.org on August 14, 2009 - Published by Cold Spring Harbor Laboratory Press Cilium-independent regulation of Gli protein function by Sufu in Hedgehog signaling is evolutionarily conserved Miao-Hsueh Chen, Christopher W. Wilson, Ya-Jun Li, et al. Genes Dev. 2009 23: 1910-1928 Access the most recent version at doi:10.1101/gad.1794109 Supplemental http://genesdev.cshlp.org/content/suppl/2009/07/23/23.16.1910.DC1.html Material References This article cites 97 articles, 47 of which can be accessed free at: http://genesdev.cshlp.org/content/23/16/1910.full.html#ref-list-1 Email alerting Receive free email alerts when new articles cite this article - sign up in the box at the service top right corner of the article or click here To subscribe to Genes & Development go to: http://genesdev.cshlp.org/subscriptions Copyright © 2009 by Cold Spring Harbor Laboratory Press Downloaded from genesdev.cshlp.org on August 14, 2009 - Published by Cold Spring Harbor Laboratory Press Cilium-independent regulation of Gli protein function by Sufu in Hedgehog signaling is evolutionarily conserved Miao-Hsueh Chen,1,3 Christopher W. Wilson,1,3 Ya-Jun Li,1 Kelvin King Lo Law,2 Chi-Sheng Lu,1 Rhodora Gacayan,1 Xiaoyun Zhang,2 Chi-chung Hui,2 and Pao-Tien Chuang1,4 1Cardiovascular Research Institute, University of California at San Francisco, San Francisco, California 94158, USA; 2Program in Developmental and Stem Cell Biology, The Hospital for Sick Children, and Department of Molecular Genetics, University of Toronto, Toronto, Ontario M5G 1L7, Canada A central question in Hedgehog (Hh) signaling is how evolutionarily conserved components of the pathway might use the primary cilium in mammals but not fly.
    [Show full text]
  • Gli Transcription Factors Mediate the Oncogenic Transformation of Prostate Basal Cells Induced by a Kras-Androgen Receptor Axis*
    crossmark THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 291, NO. 49, pp. 25749–25760, December 2, 2016 © 2016 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A. Gli Transcription Factors Mediate the Oncogenic Transformation of Prostate Basal Cells Induced by a Kras-Androgen Receptor Axis*□S Received for publication, August 12, 2016, and in revised form, September 28, 2016 Published, JBC Papers in Press, October 19, 2016, DOI 10.1074/jbc.M116.753129 Meng Wu‡, Lishann Ingram‡, Ezequiel J. Tolosa§, Renzo E. Vera§, Qianjin Li‡, Sungjin Kim‡, Yongjie Ma‡, Demetri D. Spyropoulos¶, Zanna Beharryʈ, Jiaoti Huang**, Martin E. Fernandez-Zapico§, and Houjian Cai‡1 From the ‡Department of Pharmaceutical and Biomedical Sciences, College of Pharmacy, University of Georgia, Athens, Georgia 30602, the §Schulze Center for Novel Therapeutics, Division of Oncology Research, Mayo Clinic, Rochester, Minnesota 55905, the ¶Department of Pathology and Laboratory Medicine, Medical University of South Carolina, Charleston, South Carolina 29425, the ʈDepartment of Chemistry and Physics, Florida Gulf Coast University, Fort Myers, Florida 33965, and the **Department of Pathology, School of Medicine, Duke University, Durham, North Carolina 27710 Edited by Eric Fearon Although the differentiation of oncogenically transformed cer progression has been characterized with multiple stages, 2 basal progenitor cells is one of the key steps in prostate tumori- including benign, prostatic intraepithelial neoplasia (PIN), Downloaded from genesis, the mechanisms mediating this cellular process are still invasive adenocarcinoma, and metastatic cancer (2). Numerous ؉ largely unknown. Here we demonstrate that an expanded p63 oncogenic driver genes, including loss of tumor suppressors, ؉ and CK5 basal/progenitor cell population, induced by the con- overexpression, and/or activation of oncogenes, have been comitant activation of oncogenic Kras(G12D) and androgen identified based on genetic analysis of clinical prostate tumors.
    [Show full text]
  • Single Cell Transcriptomics Reveal Temporal Dynamics of Critical Regulators of Germ Cell Fate During Mouse Sex Determination
    bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Single cell transcriptomics reveal temporal dynamics of critical regulators of germ 2 cell fate during mouse sex determination 3 Authors: Chloé Mayère1,2, Yasmine Neirijnck1,3, Pauline Sararols1, Chris M Rands1, 4 Isabelle Stévant1,2, Françoise Kühne1, Anne-Amandine Chassot3, Marie-Christine 5 Chaboissier3, Emmanouil T. Dermitzakis1,2, Serge Nef1,2,*. 6 Affiliations: 7 1Department of Genetic Medicine and Development, University of Geneva, 1211 Geneva, 8 Switzerland; 9 2iGE3, Institute of Genetics and Genomics of Geneva, University of Geneva, 1211 10 Geneva, Switzerland; 11 3Université Côte d'Azur, CNRS, Inserm, iBV, France; 12 Lead Contact: 13 *Corresponding Author: Serge Nef, 1 rue Michel-Servet CH-1211 Genève 4, 14 [email protected]. + 41 (0)22 379 51 93 15 Running Title: Single cell transcriptomics of germ cells 1 bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 16 Abbreviations; 17 AGC: Adrenal Germ Cell 18 GC: Germ cell 19 OGC: Ovarian Germ Cell 20 TGC: Testicular Germ Cell 21 scRNA-seq: Single-cell RNA-Sequencing 22 DEG: Differentially Expressed Gene 23 24 25 Keywords: 26 Single-cell RNA-Sequencing (scRNA-seq), sex determination, ovary, testis, gonocytes, 27 oocytes, prospermatogonia, meiosis, gene regulatory network, germ cells, development, 28 RNA splicing 29 2 bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020.
    [Show full text]
  • Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer
    Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks, … , Karine Lefort, G. Paolo Dotto J Clin Invest. 2014;124(5):2260-2276. https://doi.org/10.1172/JCI72718. Research Article Oncology Downmodulation or loss-of-function mutations of the gene encoding NOTCH1 are associated with dysfunctional squamous cell differentiation and development of squamous cell carcinoma (SCC) in skin and internal organs. While NOTCH1 receptor activation has been well characterized, little is known about how NOTCH1 gene transcription is regulated. Using bioinformatics and functional screening approaches, we identified several regulators of the NOTCH1 gene in keratinocytes, with the transcription factors DLX5 and EGR3 and estrogen receptor β (ERβ) directly controlling its expression in differentiation. DLX5 and ERG3 are required for RNA polymerase II (PolII) recruitment to the NOTCH1 locus, while ERβ controls NOTCH1 transcription through RNA PolII pause release. Expression of several identified NOTCH1 regulators, including ERβ, is frequently compromised in skin, head and neck, and lung SCCs and SCC-derived cell lines. Furthermore, a keratinocyte ERβ–dependent program of gene expression is subverted in SCCs from various body sites, and there are consistent differences in mutation and gene-expression signatures of head and neck and lung SCCs in female versus male patients. Experimentally increased ERβ expression or treatment with ERβ agonists inhibited proliferation of SCC cells and promoted NOTCH1 expression and squamous differentiation both in vitro and in mouse xenotransplants. Our data identify a link between transcriptional control of NOTCH1 expression and the estrogen response in keratinocytes, with implications for differentiation therapy of squamous cancer. Find the latest version: https://jci.me/72718/pdf Research article Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks,1,2 Paola Ostano,3 Seung-Hee Jo,1,2 Jun Dai,1,2 Spiro Getsios,4 Piotr Dziunycz,5 Günther F.L.
    [Show full text]
  • The Role of Dlx3 in Gene Regulation in the Mouse Placenta
    The role of Dlx3 in gene regulation in the mouse placenta by Li Han This thesis/dissertation document has been electronically approved by the following individuals: Roberson,Mark Stephen (Chairperson) Wolfner,Mariana Federica (Minor Member) Cohen,Paula (Field Appointed Minor Member) Weiss,Robert S. (Field Appointed Minor Member) THE ROLE OF DLX3 IN GENE REGULATION IN THE MOUSE PLACENTA A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy by Li Han August 2010 © 2010 Li Han THE ROLE OF DLX3 IN GENE REGULATION IN THE MOUSE PLACENTA Li Han, Ph. D. Cornell University 2010 Distal-less 3 (Dlx3) is a homeodomain containing transcription factor that is required for the normal development of the mouse placenta. Moreover in human trophoblasts, DLX3 appears to be a necessary transcriptional regulator of the glycoprotein hormone α subunit gene, a protein subunit of placental-derived chorionic gonadotropin. The aim of my studies described here was to determine the role of Dlx3 in gene regulation within the placenta. My studies initially sought to determine if Dlx3 could interact physically with other transcriptional regulators in placental trophoblast cells and how these protein- protein interactions might influence Dlx3-dependent gene expression. Yeast two- hybrid screens provide evidence that mothers against decapentaplegic homolog 6 (SMAD6) was a binding partner for DLX3. SMAD6 was found to be expressed and nuclear localized in placental trophoblasts and interacted directly with DLX3. Structure-function analysis revealed that this interaction occurred within a DLX3 domain that overlapped the homeobox, a key domain necessary for DLX3 DNA binding.
    [Show full text]
  • Non-Canonical Activation of Hedgehog in Prostate Cancer Cells Mediated by the Interaction of Transcriptionally Active Androgen Receptor Proteins with Gli3
    Oncogene (2018) 37:2313–2325 https://doi.org/10.1038/s41388-017-0098-7 ARTICLE Non-canonical activation of hedgehog in prostate cancer cells mediated by the interaction of transcriptionally active androgen receptor proteins with Gli3 1 1,2 2 1 1 1 2,3 Na Li ● Sarah Truong ● Mannan Nouri ● Jackson Moore ● Nader Al Nakouzi ● Amy Anne Lubik ● Ralph Buttyan Received: 19 July 2017 / Revised: 18 October 2017 / Accepted: 29 November 2017 / Published online: 12 February 2018 © The Author(s) 2018. This article is published with open access Abstract Hedgehog (Hh) is an oncogenic signaling pathway that regulates the activity of Gli transcription factors. Canonical Hh is a Smoothened-(Smo-) driven process that alters the post-translational processing of Gli2/Gli3 proteins. Though evidence supports a role for Gli action in prostate cancer (PCa) cell growth and progression, there is little indication that Smo is involved. Here we describe a non-canonical means for activation of Gli transcription in PCa cells mediated by the binding of transcriptionally-active androgen receptors (ARs) to Gli3. Androgens stimulated reporter expression from a Gli-dependent promoter in a variety of AR + PCa cells and this activity was suppressed by an anti-androgen, Enz, or by AR knockdown. 1234567890();,: Androgens also upregulated expression of endogenous Gli-dependent genes. This activity was associated with increased intranuclear binding of Gli3 to AR that was antagonized by Enz. Fine mapping of the AR binding domain on Gli2 showed that AR recognizes the Gli protein processing domain (PPD) in the C-terminus. Mutations in the arginine-/serine repeat elements of the Gli2 PPD involved in phosphorylation and ubiquitinylation blocked the binding to AR.
    [Show full text]
  • Tamoxifen Resistance: Emerging Molecular Targets
    International Journal of Molecular Sciences Review Tamoxifen Resistance: Emerging Molecular Targets Milena Rondón-Lagos 1,*,†, Victoria E. Villegas 2,3,*,†, Nelson Rangel 1,2,3, Magda Carolina Sánchez 2 and Peter G. Zaphiropoulos 4 1 Department of Medical Sciences, University of Turin, Turin 10126, Italy; [email protected] 2 Faculty of Natural Sciences and Mathematics, Universidad del Rosario, Bogotá 11001000, Colombia; [email protected] 3 Doctoral Program in Biomedical Sciences, Universidad del Rosario, Bogotá 11001000, Colombia 4 Department of Biosciences and Nutrition, Karolinska Institutet, Huddinge 14183, Sweden; [email protected] * Correspondence: [email protected] (M.R.-L.); [email protected] (V.E.V.); Tel.: +39-01-1633-4127 (ext. 4388) (M.R.-L.); +57-1-297-0200 (ext. 4029) (V.E.V.); Fax: +39-01-1663-5267 (M.R.-L.); +57-1-297-0200 (V.E.V.) † These authors contributed equally to this work. Academic Editor: William Chi-shing Cho Received: 5 July 2016; Accepted: 16 August 2016; Published: 19 August 2016 Abstract: 17β-Estradiol (E2) plays a pivotal role in the development and progression of breast cancer. As a result, blockade of the E2 signal through either tamoxifen (TAM) or aromatase inhibitors is an important therapeutic strategy to treat or prevent estrogen receptor (ER) positive breast cancer. However, resistance to TAM is the major obstacle in endocrine therapy. This resistance occurs either de novo or is acquired after an initial beneficial response. The underlying mechanisms for TAM resistance are probably multifactorial and remain largely unknown. Considering that breast cancer is a very heterogeneous disease and patients respond differently to treatment, the molecular analysis of TAM’s biological activity could provide the necessary framework to understand the complex effects of this drug in target cells.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • GLI2 but Not GLI1/GLI3 Plays a Central Role in the Induction of Malignant Phenotype of Gallbladder Cancer
    ONCOLOGY REPORTS 45: 997-1010, 2021 GLI2 but not GLI1/GLI3 plays a central role in the induction of malignant phenotype of gallbladder cancer SHU ICHIMIYA1, HIDEYA ONISHI1, SHINJIRO NAGAO1, SATOKO KOGA1, KUKIKO SAKIHAMA2, KAZUNORI NAKAYAMA1, AKIKO FUJIMURA3, YASUHIRO OYAMA4, AKIRA IMAIZUMI1, YOSHINAO ODA2 and MASAFUMI NAKAMURA4 Departments of 1Cancer Therapy and Research, 2Anatomical Pathology, 3Otorhinolaryngology and 4Surgery and Oncology, Graduate School of Medical Sciences, Kyushu University, Fukuoka 812‑8582, Japan Received August 10, 2020; Accepted December 7, 2020 DOI: 10.3892/or.2021.7947 Abstract. We previously reported that Hedgehog (Hh) signal Introduction was enhanced in gallbladder cancer (GBC) and was involved in the induction of malignant phenotype of GBC. In recent Gallbladder cancer (GBC) is the seventh most common gastro- years, therapeutics that target Hh signaling have focused on intestinal carcinoma and accounts for 1.2% of all cancer cases molecules downstream of smoothened (SMO). The three tran- and 1.7% of all cancer-related deaths (1). GBC develops from scription factors in the Hh signal pathway, glioma-associated metaplasia to dysplasia to carcinoma in situ and then to invasive oncogene homolog 1 (GLI1), GLI2, and GLI3, function down- carcinoma over 5‑15 years (2). During this time, GBC exhibits stream of SMO, but their biological role in GBC remains few characteristic symptoms, and numerous cases have already unclear. In the present study, the biological significance of developed into locally advanced or metastasized cancer by the GLI1, GLI2, and GLI3 were analyzed with the aim of devel- time of diagnosis. Gemcitabine (GEM), cisplatin (CDDP), and oping novel treatments for GBC.
    [Show full text]
  • Distinct Activities of Gli1 and Gli2 in the Absence of Ift88 and the Primary Cilia
    Journal of Developmental Biology Article Distinct Activities of Gli1 and Gli2 in the Absence of Ift88 and the Primary Cilia Yuan Wang 1,2,†, Huiqing Zeng 1,† and Aimin Liu 1,* 1 Department of Biology, Eberly College of Sciences, Center for Cellular Dynamics, Huck Institute of Life Science, The Penn State University, University Park, PA 16802, USA; [email protected] (Y.W.); [email protected] (H.Z.) 2 Department of Occupational Health, School of Public Health, China Medical University, No.77 Puhe Road, Shenyang North New Area, Shenyang 110122, China * Correspondence: [email protected]; Tel.: +1-814-865-7043 † These authors contributed equally to this work. Received: 2 November 2018; Accepted: 16 February 2019; Published: 19 February 2019 Abstract: The primary cilia play essential roles in Hh-dependent Gli2 activation and Gli3 proteolytic processing in mammals. However, the roles of the cilia in Gli1 activation remain unresolved due to the loss of Gli1 transcription in cilia mutant embryos, and the inability to address this question by overexpression in cultured cells. Here, we address the roles of the cilia in Gli1 activation by expressing Gli1 from the Gli2 locus in mouse embryos. We find that the maximal activation of Gli1 depends on the cilia, but partial activation of Gli1 by Smo-mediated Hh signaling exists in the absence of the cilia. Combined with reduced Gli3 repressors, this partial activation of Gli1 leads to dorsal expansion of V3 interneuron and motor neuron domains in the absence of the cilia. Moreover, expressing Gli1 from the Gli2 locus in the presence of reduced Sufu has no recognizable impact on neural tube patterning, suggesting an imbalance between the dosages of Gli and Sufu does not explain the extra Gli1 activity.
    [Show full text]
  • FARE2021WINNERS Sorted by Institute
    FARE2021WINNERS Sorted By Institute Swati Shah Postdoctoral Fellow CC Radiology/Imaging/PET and Neuroimaging Characterization of CNS involvement in Ebola-Infected Macaques using Magnetic Resonance Imaging, 18F-FDG PET and Immunohistology The Ebola (EBOV) virus outbreak in Western Africa resulted in residual neurologic abnormalities in survivors. Many case studies detected EBOV in the CSF, suggesting that the neurologic sequelae in survivors is related to viral presence. In the periphery, EBOV infects endothelial cells and triggers a “cytokine stormâ€. However, it is unclear whether a similar process occurs in the brain, with secondary neuroinflammation, neuronal loss and blood-brain barrier (BBB) compromise, eventually leading to lasting neurological damage. We have used in vivo imaging and post-necropsy immunostaining to elucidate the CNS pathophysiology in Rhesus macaques infected with EBOV (Makona). Whole brain MRI with T1 relaxometry (pre- and post-contrast) and FDG-PET were performed to monitor the progression of disease in two cohorts of EBOV infected macaques from baseline to terminal endpoint (day 5-6). Post-necropsy, multiplex fluorescence immunohistochemical (MF-IHC) staining for various cellular markers in the thalamus and brainstem was performed. Serial blood and CSF samples were collected to assess disease progression. The linear mixed effect model was used for statistical analysis. Post-infection, we first detected EBOV in the serum (day 3) and CSF (day 4) with dramatic increases until euthanasia. The standard uptake values of FDG-PET relative to whole brain uptake (SUVr) in the midbrain, pons, and thalamus increased significantly over time (p<0.01) and positively correlated with blood viremia (p≤0.01).
    [Show full text]
  • Hedgehog Signalling in the Tumourigenesis and Metastasis of Osteosarcoma, and Its Potential Value in the Clinical Therapy Of
    Yao et al. Cell Death and Disease (2018) 9:701 DOI 10.1038/s41419-018-0647-1 Cell Death & Disease REVIEW ARTICLE Open Access Hedgehog signalling in the tumourigenesis and metastasis of osteosarcoma, and its potential value in the clinical therapy of osteosarcoma Zhihong Yao1,LeiHan1, Yongbin Chen2,FeiHe3,BinSun3, Santosh kamar1, Ya Zhang1,YihaoYang1, Cao Wang1 and Zuozhang Yang1 Abstract The Hedgehog (Hh) signalling pathway is involved in cell differentiation, growth and tissue polarity. This pathway is also involved in the progression and invasion of various human cancers. Osteosarcoma, a subtype of bone cancer, is commonly seen in children and adolescents. Typically, pulmonary osteosarcoma metastases are especially difficult to control. In the present paper, we summarise recent studies on the regulation of osteosarcoma progression and metastasis by downregulating Hh signalling. We also summarise the crosstalk between the Hh pathway and other cancer-related pathways in the tumourigenesis of various cancers. We further summarise and highlight the therapeutic value of potential inhibitors of Hh signalling in the clinical therapy of human cancers. 1234567890():,; 1234567890():,; Facts Open questions ● The Hh pathway regulates the progression of ● How does the Hh pathway regulate the tumourigenic osteosarcoma. progression and invasion of human osteosarcoma? ● The Hh pathway is involved in the metastasis of ● How does the Hh pathway interact with other osteosarcoma into other organs, such as the lungs. cancer-related pathways in the progression and ● The Hh pathway crosstalks with other cancer-related metastasis of cancers? pathways in the tumourigenesis of cancers. ● Could the Hh pathway be used as a target or ● The therapeutic value of the Hh pathway in the biomarker in clinical therapy for human clinical therapy of osteosarcoma is summarised.
    [Show full text]