Genomic Structure and Functional Control of the Dlx3-7 Bigene Cluster

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Genomic structure and functional control of the Dlx3-7 bigene cluster Kenta Sumiyama*, Steven Q. Irvine*, David W. Stock†, Kenneth M. Weiss‡, Kazuhiko Kawasaki‡, Nobuyoshi Shimizu§, Cooduvalli S. Shashikant¶, Webb Millerʈ, and Frank H. Ruddle*,** *Department of Molecular, Cellular, and Developmental Biology, Yale University, New Haven, CT 06511; †Department of Biology, University of Colorado, Boulder, CO 80309; Departments of ‡Anthropology, ¶Dairy and Animal Science, and ʈComputer Science, Pennsylvania State University, University Park, PA 16802; and §Department of Molecular Biology, Keio University School of Medicine, Tokyo 160, Japan Contributed by Frank H. Ruddle, November, 1, 2001 The Dlx genes are involved in early vertebrate morphogenesis, Dlx3 is expressed in the first and second visceral arches and notably of the head. The six Dlx genes of mammals are arranged fronto-nasal ectoderm at E9.5 (9). Later in development, Dlx3 is in three convergently transcribed bigene clusters. In this study, we also expressed in the external respiratory epithelium of the nares, examine the regulation of the Dlx3-7 cluster of the mouse. We in whisker follicles, taste bud primordia, dental and mammary obtained and sequenced human and mouse P1 clones covering the gland epithelia, apical ectodermal ridge (AER) of limb buds, entire Dlx3-7 cluster. Comparative analysis of the human and genital primordia, and in several additional sites of epithelial- mouse sequences revealed several highly conserved noncoding mesenchymal interaction (8, 9). By the end of embryonic devel- regions within 30 kb of the Dlx3-7-coding regions. These conserved opment, Dlx3 is down-regulated, except in the skin, where it is elements were located both 5؅ of the coding exons of each gene transcribed in stratified epidermis and in the matrix cells of the and in the intergenic region 3؅ of the exons, suggesting that some hair follicles (10). The Dlx3 pattern of expression is different in enhancers might be shared between genes. We also found that the some respects in comparison with the bigene clusters Dlx2–1 and protein sequence of Dlx7 is evolving more rapidly than that of Dlx3. Dlx5–6 in that Dlx3 is not expressed in the central nervous system We conducted a functional study of the 79-kb mouse genomic and is largely expressed in recently acquired structures common clone to locate cis-element activity able to reproduce the endog- to the mammals. Dlx7 has an overlapping expression pattern with enous expression pattern by using transgenic mice. We inserted a the Dlx3 gene in the visceral arches and limb buds before E10.5 lacZ reporter gene into the first exon of the Dlx3 gene by using (ref. 11 and unpublished data). homologous recombination in yeast. Strong lacZ expression in The Dlx genes provide an interesting model for the regulation embryonic (E) stage E9.5 and E10.5 mouse embryos was found in of clustered genes because their arrangement in pairs is the the limb buds and first and second visceral arches, consistent with simplest case of gene clustering. The fact that all of the mam- the endogenous Dlx3 expression pattern. This result shows that malian clusters have the same genomic arrangement suggests the 79-kb region contains the major cis-elements required to direct that the clusters have not undergone extensive rearrangement the endogenous expression of Dlx3 at stage E10.5. To test for since their formation and may help elucidate the fate of cis- enhancer location, we divided the construct in the mid-intergenic regulatory elements after gene duplication. The Dlx3–7 cluster region and injected the Dlx3 gene portion. This shortened frag- is of special interest to us because its expression pattern lacks the ment lacking Dlx7-flanking sequences is able to drive expression in complication of CNS expression. In this report, we provide the limb buds but not in the visceral arches. This observation is detailed information on the structural organization of the Dlx3–7 consistent with a cis-regulatory enhancer-sharing model within the bigene cluster, identify conserved sequence elements in the Dlx bigene cluster. coding and noncoding domains, and by means of functional transgenic analysis test the enhancer activity for Dlx3–7 expres- he mammalian Dlx family consists of six genes with ho- sion control. Tmeoboxes related to that of Drosophila Distal-less (Dll). The mammalian genes take the form of bigene clusters. The paired Materials and Methods genes, termed Dlx2–1, Dlx5–6, and Dlx3–7, are organized in an P1 Artificial Chromosome (PAC) Clones and Sequencing. The clones inverted, convergently transcribed manner (1–3). It has been P1–972 and P1–1490 were isolated from Incyte Genomics (Palo proposed that a single Dlx gene duplicated to form an ancestral Alto, CA) mouse and human PAC libraries, respectively, by PCR inverted bigene cluster during the evolution of the early chor- screening of pooled libraries by using primers for the 3Ј end of dates and subsequent duplications gave rise to multiple bigene the Dlx3͞DLX3 homeodomain (3, 12). clusters (4). This hypothesis is based on phylogenetic clustering Nucleotide sequences were primarily determined by using the of Dlx2, 3, 5 to the exclusion of Dlx1, 6, 7. It is likely that the three shotgun method, and unsequenced gaps were filled by primer Dlx clusters underwent duplication together with the Hox gene walking (see ref. 13 for methods). The sequence was confirmed clusters, because Dlx2–1, 5–6, and 3–7 are closely linked to the by comparing a restriction map deduced from genomic sequence Hox D, A, and B clusters, respectively (1, 3, 5). There is a certain with an experimentally constructed restriction map. degree of spatial and temporal expression overlap between the linked Dlx genes around embryonic stage (E) E10.5 (6). Models Cluster Alignments and Sequence Comparisons. Alignments were are proposed to explain this overlapping pattern, including computed with PIPMAKER (14) (available at http:͞͞bio.cse. cis-regulatory sharing between paired genes (7). In this report, we will focus on the Dlx3–7 bigene cluster with the ultimate goal Abbreviations: E, embryonic stage; AER, apical ectodermal ridge; PAC, P1 artificial chro- of testing the shared enhancer hypothesis of bigene expression mosome. control. Data deposition: The sequences reported in this paper have been deposited in the GenBank The mouse Dlx3 gene is first expressed weakly in the rostral database (accession nos. AF452637 and AF452638). ectoderm, anterior to the neural plate during the head fold stage **To whom reprint requests should be addressed. E-mail: [email protected]. (6). Dlx3 is expressed by E8.5 in the ectoplacental cone and The publication costs of this article were defrayed in part by page charge payment. This chorionic plate, developing into a high level of expression by day article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. E10.5 in the labyrinthine layer of the embryonic placenta (8). §1734 solely to indicate this fact. 780–785 ͉ PNAS ͉ January 22, 2002 ͉ vol. 99 ͉ no. 2 www.pnas.org͞cgi͞doi͞10.1073͞pnas.012584999 Downloaded by guest on October 2, 2021 psu.edu͞pipmaker͞). The BLAST 2 sequences program accessed agreement with our earlier studies (3). Thus, we can divide the through the National Center for Biotechnology Information bigene clusters into three domains: an intergenic 3Ј region website (15) was also used for identifying local sequence shared by both genes, a flanking 5Ј upstream region unique to conservation. the Dlx7 gene, and a flanking 5Ј region unique to the Dlx3 gene (Figs. 1 and 2). The intergenic regions measure 17 kb in both Construction of the Mouse Dlx3-lacZ Reporter Gene. The 80-kb insert species. At least 7 kb of sequence upstream of the Dlx3 trans- of the P1–972 was captured into the pPAC-ResQ vector by using lation start site and at least 37 kb upstream of the Dlx7 homologous recombination in yeast (16) to make construct translation start site are captured in both the human and mouse Dlx37-A8. In brief, 50 ng of linearized pPAC-ResQ vector and clones. A close comparison of the human and mouse clones 400 ng of circular PAC P1–972 were cotransformed into yeast showed no other genes in the P1 clones, although several strain Y724 (17). More than 60% of the 200 clones obtained were expressed sequence tag sequences show similarity in the first 20 identified as recombinant by hybridization tests by using the Dlx3 kb upstream of Dlx7. 5Ј upstream region as probe. Yeast genomic DNA from recom- We compared the mouse Dlx3-7 bigene cluster to its human binant clones was isolated by using the PureGene kit (Gentra paralogs, namely, DLX2–1 and DLX5–6 (data not shown). The Systems), transformed into Escherichia coli DH10B cells by general genomic organization is similar among the clusters. All electroporation (16), and checked for rearrangement by restric- show convergent translation, three exons, and 5Ј-flanking and tion analysis. 3Ј-intergenic domains. The DLX2–1 and DLX5–6 intergenic The lacZ reporter gene was inserted in-frame into the first regions both measure 10 kb. Sequence similarities are found only exon of the mouse Dlx3 gene by using another round of homol- in the homeodomains, whereas other coding and noncoding ogous recombination in yeast. A targeting vector (pLZFSV- domains show low sequence conservation. The absence of Dlx3AB) was generated in which a lacZ-Ura3 cassette (18) was sequence similarity in the noncoding domains is interesting, flanked by PCR generated recombinogenic ends (Fig. 4a) from considering the paralogous nature of the bigene clusters and Ј Ј 5 of the Dlx3-coding region [primers KL001 (5 -GGT AAC their overlapping patterns of expression during development. AAC AAA GAG GGT TGA GA-3Ј) and KL 002 (5Ј-GAA Ј GGA GCC GCT CAT GCT-3 )], and portions of exon 1 and the Protein Sequence Comparisons Between Dlx7 and Dlx3.
Recommended publications
  • Single Cell Transcriptomics Reveal Temporal Dynamics of Critical Regulators of Germ Cell Fate During Mouse Sex Determination

    Single Cell Transcriptomics Reveal Temporal Dynamics of Critical Regulators of Germ Cell Fate During Mouse Sex Determination

    bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Single cell transcriptomics reveal temporal dynamics of critical regulators of germ 2 cell fate during mouse sex determination 3 Authors: Chloé Mayère1,2, Yasmine Neirijnck1,3, Pauline Sararols1, Chris M Rands1, 4 Isabelle Stévant1,2, Françoise Kühne1, Anne-Amandine Chassot3, Marie-Christine 5 Chaboissier3, Emmanouil T. Dermitzakis1,2, Serge Nef1,2,*. 6 Affiliations: 7 1Department of Genetic Medicine and Development, University of Geneva, 1211 Geneva, 8 Switzerland; 9 2iGE3, Institute of Genetics and Genomics of Geneva, University of Geneva, 1211 10 Geneva, Switzerland; 11 3Université Côte d'Azur, CNRS, Inserm, iBV, France; 12 Lead Contact: 13 *Corresponding Author: Serge Nef, 1 rue Michel-Servet CH-1211 Genève 4, 14 [email protected]. + 41 (0)22 379 51 93 15 Running Title: Single cell transcriptomics of germ cells 1 bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 16 Abbreviations; 17 AGC: Adrenal Germ Cell 18 GC: Germ cell 19 OGC: Ovarian Germ Cell 20 TGC: Testicular Germ Cell 21 scRNA-seq: Single-cell RNA-Sequencing 22 DEG: Differentially Expressed Gene 23 24 25 Keywords: 26 Single-cell RNA-Sequencing (scRNA-seq), sex determination, ovary, testis, gonocytes, 27 oocytes, prospermatogonia, meiosis, gene regulatory network, germ cells, development, 28 RNA splicing 29 2 bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020.
  • Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer

    Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer

    Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks, … , Karine Lefort, G. Paolo Dotto J Clin Invest. 2014;124(5):2260-2276. https://doi.org/10.1172/JCI72718. Research Article Oncology Downmodulation or loss-of-function mutations of the gene encoding NOTCH1 are associated with dysfunctional squamous cell differentiation and development of squamous cell carcinoma (SCC) in skin and internal organs. While NOTCH1 receptor activation has been well characterized, little is known about how NOTCH1 gene transcription is regulated. Using bioinformatics and functional screening approaches, we identified several regulators of the NOTCH1 gene in keratinocytes, with the transcription factors DLX5 and EGR3 and estrogen receptor β (ERβ) directly controlling its expression in differentiation. DLX5 and ERG3 are required for RNA polymerase II (PolII) recruitment to the NOTCH1 locus, while ERβ controls NOTCH1 transcription through RNA PolII pause release. Expression of several identified NOTCH1 regulators, including ERβ, is frequently compromised in skin, head and neck, and lung SCCs and SCC-derived cell lines. Furthermore, a keratinocyte ERβ–dependent program of gene expression is subverted in SCCs from various body sites, and there are consistent differences in mutation and gene-expression signatures of head and neck and lung SCCs in female versus male patients. Experimentally increased ERβ expression or treatment with ERβ agonists inhibited proliferation of SCC cells and promoted NOTCH1 expression and squamous differentiation both in vitro and in mouse xenotransplants. Our data identify a link between transcriptional control of NOTCH1 expression and the estrogen response in keratinocytes, with implications for differentiation therapy of squamous cancer. Find the latest version: https://jci.me/72718/pdf Research article Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks,1,2 Paola Ostano,3 Seung-Hee Jo,1,2 Jun Dai,1,2 Spiro Getsios,4 Piotr Dziunycz,5 Günther F.L.
  • The Role of Dlx3 in Gene Regulation in the Mouse Placenta

    The Role of Dlx3 in Gene Regulation in the Mouse Placenta

    The role of Dlx3 in gene regulation in the mouse placenta by Li Han This thesis/dissertation document has been electronically approved by the following individuals: Roberson,Mark Stephen (Chairperson) Wolfner,Mariana Federica (Minor Member) Cohen,Paula (Field Appointed Minor Member) Weiss,Robert S. (Field Appointed Minor Member) THE ROLE OF DLX3 IN GENE REGULATION IN THE MOUSE PLACENTA A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy by Li Han August 2010 © 2010 Li Han THE ROLE OF DLX3 IN GENE REGULATION IN THE MOUSE PLACENTA Li Han, Ph. D. Cornell University 2010 Distal-less 3 (Dlx3) is a homeodomain containing transcription factor that is required for the normal development of the mouse placenta. Moreover in human trophoblasts, DLX3 appears to be a necessary transcriptional regulator of the glycoprotein hormone α subunit gene, a protein subunit of placental-derived chorionic gonadotropin. The aim of my studies described here was to determine the role of Dlx3 in gene regulation within the placenta. My studies initially sought to determine if Dlx3 could interact physically with other transcriptional regulators in placental trophoblast cells and how these protein- protein interactions might influence Dlx3-dependent gene expression. Yeast two- hybrid screens provide evidence that mothers against decapentaplegic homolog 6 (SMAD6) was a binding partner for DLX3. SMAD6 was found to be expressed and nuclear localized in placental trophoblasts and interacted directly with DLX3. Structure-function analysis revealed that this interaction occurred within a DLX3 domain that overlapped the homeobox, a key domain necessary for DLX3 DNA binding.
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
  • FARE2021WINNERS Sorted by Institute

    FARE2021WINNERS Sorted by Institute

    FARE2021WINNERS Sorted By Institute Swati Shah Postdoctoral Fellow CC Radiology/Imaging/PET and Neuroimaging Characterization of CNS involvement in Ebola-Infected Macaques using Magnetic Resonance Imaging, 18F-FDG PET and Immunohistology The Ebola (EBOV) virus outbreak in Western Africa resulted in residual neurologic abnormalities in survivors. Many case studies detected EBOV in the CSF, suggesting that the neurologic sequelae in survivors is related to viral presence. In the periphery, EBOV infects endothelial cells and triggers a “cytokine stormâ€. However, it is unclear whether a similar process occurs in the brain, with secondary neuroinflammation, neuronal loss and blood-brain barrier (BBB) compromise, eventually leading to lasting neurological damage. We have used in vivo imaging and post-necropsy immunostaining to elucidate the CNS pathophysiology in Rhesus macaques infected with EBOV (Makona). Whole brain MRI with T1 relaxometry (pre- and post-contrast) and FDG-PET were performed to monitor the progression of disease in two cohorts of EBOV infected macaques from baseline to terminal endpoint (day 5-6). Post-necropsy, multiplex fluorescence immunohistochemical (MF-IHC) staining for various cellular markers in the thalamus and brainstem was performed. Serial blood and CSF samples were collected to assess disease progression. The linear mixed effect model was used for statistical analysis. Post-infection, we first detected EBOV in the serum (day 3) and CSF (day 4) with dramatic increases until euthanasia. The standard uptake values of FDG-PET relative to whole brain uptake (SUVr) in the midbrain, pons, and thalamus increased significantly over time (p<0.01) and positively correlated with blood viremia (p≤0.01).
  • Chronodentistry: the Role & Potential of Molecular Clocks in Oral Medicine

    Chronodentistry: the Role & Potential of Molecular Clocks in Oral Medicine

    Janjić and Agis BMC Oral Health (2019) 19:32 https://doi.org/10.1186/s12903-019-0720-x REVIEW Open Access Chronodentistry: the role & potential of molecular clocks in oral medicine Klara Janjić1,2 and Hermann Agis1,2* Abstract Molecular clocks help organisms to adapt important physiological functions to periodically changing conditions in the environment. These include the adaption of the 24 h sleep-wake rhythm to changes of day and night. The circadian clock is known to act as a key regulator in processes of health and disease in different organs. The knowledge on the circadian clock led to the development of chronopharmacology and chronotherapy. These fields aim to investigate how efficiency of medication and therapies can be improved based on circadian clock mechanisms. In this review we aim to highlight the role of the circadian clock in oral tissues and its potential in the different fields of dentistry including oral and maxillofacial surgery, restorative dentistry, endodontics, periodontics and orthodontics to trigger the evolving field of chronodentistry. Keywords: Circadian clock, Molecular clock, Dentistry, Chronopharmacology, Oral surgery, Conservative dentistry, Endodontology, Periodontology Background the circadian clock governs synchronization of various As part of evolution, the adaption to environmental physiological processes as an output to the environmen- changes contributes fundamentally to prevail in natural tal changes. The inputs are transmitted to the central selection. Hence this ability is an important feature of a circadian clock in the brain [4] that controls healthy organism. Teeth play a major role in satisfying cell-autonomous peripheral circadian clocks in different the basic human need of food uptake.
  • Genetic Network During Neural Crest Induction: from Cell Specification to Cell Survival

    Genetic Network During Neural Crest Induction: from Cell Specification to Cell Survival

    Seminars in Cell & Developmental Biology 16 (2005) 647–654 Review Genetic network during neural crest induction: From cell specification to cell survival a a a,b,c, Ben Steventon , Carlos Carmona-Fontaine , Roberto Mayor ∗ a Department of Anatomy and Developmental Biology, University College London, Gower Street, London WC1E 6BT, UK b Millennium Nucleus in Developmental Biology, Universidad de Chile, Chile c Fundaci´on Ciencia Para la Vida, Chile Available online 5 August 2005 Abstract The concerted action of extracellular signals such as BMP, Wnt, FGF, RA and Notch activate a genetic program required to transform a na¨ıve ectodermal cell into a neural crest cell. In this review we will analyze the extracellular signals and the network of transcription factors that are required for this transformation. We will propose the division of this complex network of factors in two main steps: an initial cell specification step followed by a maintenance or cell survival step. © 2005 Elsevier Ltd. All rights reserved. Keywords: Neural crest; Genetic cascade; Cell survival; Wnt; FGF; BMP; Retinoic acid Contents 1. Introduction ........................................................................................................ 647 2. Extracellular Cell Signalling during neural crest induction............................................................... 648 3. Early genetic network involved in Cell Specification of the neural crest ................................................... 649 4. Specific neural crest genes involved in Cell Survival ...................................................................
  • The Role of Epigenomics in Osteoporosis and Osteoporotic Vertebral Fracture

    The Role of Epigenomics in Osteoporosis and Osteoporotic Vertebral Fracture

    International Journal of Molecular Sciences Review The Role of Epigenomics in Osteoporosis and Osteoporotic Vertebral Fracture Kyoung-Tae Kim 1,2 , Young-Seok Lee 1,3 and Inbo Han 4,* 1 Department of Neurosurgery, School of Medicine, Kyungpook National University, Daegu 41944, Korea; [email protected] (K.-T.K.); [email protected] (Y.-S.L.) 2 Department of Neurosurgery, Kyungpook National University Hospital, Daegu 41944, Korea 3 Department of Neurosurgery, Kyungpook National University Chilgok Hospital, Daegu 41944, Korea 4 Department of Neurosurgery, CHA University School of medicine, CHA Bundang Medical Center, Seongnam-si, Gyeonggi-do 13496, Korea * Correspondence: [email protected]; Tel.: +82-31-780-1924; Fax: +82-31-780-5269 Received: 6 November 2020; Accepted: 8 December 2020; Published: 11 December 2020 Abstract: Osteoporosis is a complex multifactorial condition of the musculoskeletal system. Osteoporosis and osteoporotic vertebral fracture (OVF) are associated with high medical costs and can lead to poor quality of life. Genetic factors are important in determining bone mass and structure, as well as any predisposition for bone degradation and OVF. However, genetic factors are not enough to explain osteoporosis development and OVF occurrence. Epigenetics describes a mechanism for controlling gene expression and cellular processes without altering DNA sequences. The main mechanisms in epigenetics are DNA methylation, histone modifications, and non-coding RNAs (ncRNAs). Recently, alterations in epigenetic mechanisms and their activity have been associated with osteoporosis and OVF. Here, we review emerging evidence that epigenetics contributes to the machinery that can alter DNA structure, gene expression, and cellular differentiation during physiological and pathological bone remodeling.
  • DLX Genes: Roles in Development and Cancer

    DLX Genes: Roles in Development and Cancer

    cancers Review DLX Genes: Roles in Development and Cancer Yinfei Tan 1,* and Joseph R. Testa 1,2,* 1 Genomics Facility, Fox Chase Cancer Center, Philadelphia, PA 19111, USA 2 Cancer Signaling and Epigenetics Program, Fox Chase Cancer Center, Philadelphia, PA 19111, USA * Correspondence: [email protected] (Y.T.); [email protected] (J.R.T.) Simple Summary: DLX homeobox family genes encode transcription factors that have indispensable roles in embryonic and postnatal development. These genes are critically linked to the morphogene- sis of craniofacial structures, branchial arches, forebrain, and sensory organs. DLX genes are also involved in postnatal homeostasis, particularly hematopoiesis and, when dysregulated, oncogen- esis. DLX1/2, DLX3/4, and DLX5/6 exist as bigenes on different chromosomes, sharing intergenic enhancers between gene pairs, which allows orchestrated spatiotemporal expression. Genomic alterations of human DLX gene enhancers or coding sequences result in congenital disorders such as split-hand/foot malformation. Aberrant postnatal expression of DLX genes is associated with hematological malignancies, including leukemias and lymphomas. In several mouse models of T-cell lymphoma, Dlx5 has been shown to act as an oncogene by cooperating with activated Akt, Notch1/3, and/or Wnt to drive tumor formation. In humans, DLX5 is aberrantly expressed in lung and ovarian carcinomas and holds promise as a therapeutic target. Abstract: Homeobox genes control body patterning and cell-fate decisions during development. The homeobox genes consist of many families, only some of which have been investigated regarding a possible role in tumorigenesis. Dysregulation of HOX family genes have been widely implicated in cancer etiology.
  • Dlx1 and Dlx2 Function Is Necessary for Terminal Differentiation And

    Dlx1 and Dlx2 Function Is Necessary for Terminal Differentiation And

    Research article 311 Dlx1 and Dlx2 function is necessary for terminal differentiation and survival of late-born retinal ganglion cells in the developing mouse retina Jimmy de Melo1, Guoyan Du2,3, Mario Fonseca2,3, Leigh-Anne Gillespie3, William J. Turk3, John L. R. Rubenstein4 and David D. Eisenstat1,2,3,5,* 1Department of Human Anatomy and Cell Science, University of Manitoba, Winnipeg, Manitoba, R3E 3J7, Canada 2Department of Pediatrics and Child Health, University of Manitoba, Winnipeg, Manitoba, R3A 1S1, Canada 3Manitoba Institute of Cell Biology, Cancer Care Manitoba, Winnipeg, Manitoba, R3E 0V9, Canada 4Department of Psychiatry, University of California, San Francisco, CA 94143, USA 5Department of Ophthalmology, University of Manitoba, Winnipeg, Manitoba, R3E 0V9, Canada *Author for correspondence (e-mail: [email protected]) Accepted 3 November 2004 Development 132, 311-322 Published by The Company of Biologists 2005 doi:10.1242/dev.01560 Summary Dlx homeobox genes, the vertebrate homologs of Distal- Ectopic expression of Crx, the cone and rod photoreceptor less, play important roles in the development of the homeobox gene, in the GCL and neuroblastic layers of the vertebrate forebrain, craniofacial structures and limbs. mutants may signify altered cell fate of uncommitted RGC Members of the Dlx gene family are also expressed in progenitors. However, amacrine and horizontal cell retinal ganglion cells (RGC), amacrine and horizontal cells differentiation is relatively unaffected in the Dlx1/2 null of the developing and postnatal retina. Expression begins retina. Herein, we propose a model whereby early-born at embryonic day 12.5 and is maintained until late RGCs are Dlx1 and Dlx2 independent, but Dlx function is embryogenesis for Dlx1, while Dlx2 expression extends to necessary for terminal differentiation of late-born RGC adulthood.
  • Placental Failure in Mice Lacking the Homeobox Gene Dlx3

    Placental Failure in Mice Lacking the Homeobox Gene Dlx3

    Proc. Natl. Acad. Sci. USA Vol. 96, pp. 162–167, January 1999 Developmental Biology Placental failure in mice lacking the homeobox gene Dlx3 MARIA I. MORASSO*†,ALEXANDER GRINBERG‡,GERTRAUD ROBINSON§,THOMAS D. SARGENT*, AND KATHLEEN A. MAHON¶ *Laboratory of Molecular Genetics, ‡Laboratory of Mammalian Genes and Development, National Institute of Child Health and Human Development, §Laboratory of Genetics and Physiology, National Institute of Diabetes, Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD 20892; and ¶Department of Cell Biology, Baylor College of Medicine, Houston, TX 77030 Communicated by Igor B. Dawid, National Institute of Child Health and Human Development, Bethesda, MD, November 16, 1998 (received for review September 23, 1998) ABSTRACT Dlx3 is a homeodomain transcription factor helix–turn–helix family have been detected in trophoblastic and a member of the vertebrate Distal-less family. Targeted tissues by day 6.5. In Ets2 mutant embryos, both migration and deletion of the mouse Dlx3 gene results in embryonic death differentiation of trophoblast cells are defective, resulting in between day 9.5 and day 10 because of placental defects that embryonic death before day 8.5 of gestation (9). For both alter the development of the labyrinthine layer. In situ hy- Mash-2 and Ets2 mutants, the defects were rescued by tet- bridization reveals that the Dlx3 gene is initially expressed in raploid cell aggregation experiments, reinforcing the conclu- ectoplacental cone cells and chorionic plate, and later in the sion that there is an essential role for these genes during labyrinthine trophoblast of the chorioallantoic placenta, extraembryonic tissue development (7, 9).
  • The Zinc-Finger Transcription Factor GLI2 Antagonizes Contact Inhibition and Differentiation of Human Epidermal Cells

    The Zinc-Finger Transcription Factor GLI2 Antagonizes Contact Inhibition and Differentiation of Human Epidermal Cells

    Oncogene (2004) 23, 1263–1274 & 2004 Nature Publishing Group All rights reserved 0950-9232/04 $25.00 www.nature.com/onc The zinc-finger transcription factor GLI2 antagonizes contact inhibition and differentiation of human epidermal cells Gerhard Regl1, Maria Kasper1, Harald Schnidar1, Thomas Eichberger1, Graham W Neill2, Mohammed S Ikram2, Anthony G Quinn3, Mike P Philpott2, Anna-Maria Frischauf1 and Fritz Aberger*,1 1Institute of Genetics, University of Salzburg, Hellbrunner Strasse 34, A-5020 Salzburg, Austria; 2Center for Cutaneaous Research, Barts and The London Queen Mary’s School of Medicine & Dentistry, University of London, UK; 3Experimental Medicine, AstraZeneca R & D Charnwood, Leicestershire, UK In stratified epidermis, activation of the Hh/Gli signal portance of Hh signalling in vertebrate embryonic transduction pathwayhas been implicated in the control of development and in the control of cell proliferation is cell proliferation and tumorigenesis. The zinc-finger demonstrated by mutations in key components of the transcription factor Gli2 has been identified as critical pathway, which account for severe congenital malfor- mediator of the Hh signal at the distal end of the pathway, mations and tumour development in man (reviewed in but the molecular mechanisms bywhich Gli2 regulates Goodrich and Scott, 1998; Toftgard, 2000; Mullor et al., cell proliferation or induces epidermal malignancies such 2002; Wetmore, 2003). as basal cell carcinoma are still unclear. Here, we provide Basal cell carcinoma (BCC) of the skin represents one