Flightless-I Governs Cell Fate by Recruiting the SUMO Isopeptidase
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Role of Hox Genes in Regulating Digit Patterning ROCÍO PÉREZ-GÓMEZ, ENDIKA HARO, MARC FERNÁNDEZ-GUERRERO, MARÍA F
Int. J. Dev. Biol. 62: 797-805 (2018) https://doi.org/10.1387/ijdb.180200mr www.intjdevbiol.com Role of Hox genes in regulating digit patterning ROCÍO PÉREZ-GÓMEZ, ENDIKA HARO, MARC FERNÁNDEZ-GUERRERO, MARÍA F. BASTIDA and MARÍA A. ROS* Instituto de Biomedicina y Biotecnología de Cantabria, CSIC–SODERCAN Universidad de Cantabria, Santander, Spain ABSTRACT The distal part of the tetrapod limb, the autopod, is characterized by the presence of digits. The digits display a wide diversity of shapes and number reflecting selection pressure for functional adaptation. Despite extensive study, the different aspects of digit patterning, as well as the factors and mechanisms involved are not completely understood. Here, we review the evidence implicating Hox proteins in digit patterning and the interaction between Hox genes and the Sonic hedgehog/Gli3 pathway, the other major regulator of digit number and identity. Currently, it is well accepted that a self-organizing Turing-type mechanism underlies digit patterning, this being understood as the establishment of an iterative arrangement of digit/interdigit in the hand plate. We also discuss the involvement of 5’ Hox genes in regulating digit spacing in the digital plate and therefore the number of digits formed in this self-organizing system. KEY WORDS: limb development, Hox gene, digit patterning, Shh, Gli3 Introduction and Meyer, 2015). The digits are crucial elements for the function of the limb. They The basic plan of the tetrapod limb includes three distinct can be viewed as serial identical structures arranged along the proximo-distal (PD) segments: the stylopod (arm), the zeugopod antero-posterior (AP) axis of the autopod, thumb to little finger, or (forearm) and the autopod (hand/foot). -
Single Cell Transcriptomics Reveal Temporal Dynamics of Critical Regulators of Germ Cell Fate During Mouse Sex Determination
bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Single cell transcriptomics reveal temporal dynamics of critical regulators of germ 2 cell fate during mouse sex determination 3 Authors: Chloé Mayère1,2, Yasmine Neirijnck1,3, Pauline Sararols1, Chris M Rands1, 4 Isabelle Stévant1,2, Françoise Kühne1, Anne-Amandine Chassot3, Marie-Christine 5 Chaboissier3, Emmanouil T. Dermitzakis1,2, Serge Nef1,2,*. 6 Affiliations: 7 1Department of Genetic Medicine and Development, University of Geneva, 1211 Geneva, 8 Switzerland; 9 2iGE3, Institute of Genetics and Genomics of Geneva, University of Geneva, 1211 10 Geneva, Switzerland; 11 3Université Côte d'Azur, CNRS, Inserm, iBV, France; 12 Lead Contact: 13 *Corresponding Author: Serge Nef, 1 rue Michel-Servet CH-1211 Genève 4, 14 [email protected]. + 41 (0)22 379 51 93 15 Running Title: Single cell transcriptomics of germ cells 1 bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 16 Abbreviations; 17 AGC: Adrenal Germ Cell 18 GC: Germ cell 19 OGC: Ovarian Germ Cell 20 TGC: Testicular Germ Cell 21 scRNA-seq: Single-cell RNA-Sequencing 22 DEG: Differentially Expressed Gene 23 24 25 Keywords: 26 Single-cell RNA-Sequencing (scRNA-seq), sex determination, ovary, testis, gonocytes, 27 oocytes, prospermatogonia, meiosis, gene regulatory network, germ cells, development, 28 RNA splicing 29 2 bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020. -
Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer
Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks, … , Karine Lefort, G. Paolo Dotto J Clin Invest. 2014;124(5):2260-2276. https://doi.org/10.1172/JCI72718. Research Article Oncology Downmodulation or loss-of-function mutations of the gene encoding NOTCH1 are associated with dysfunctional squamous cell differentiation and development of squamous cell carcinoma (SCC) in skin and internal organs. While NOTCH1 receptor activation has been well characterized, little is known about how NOTCH1 gene transcription is regulated. Using bioinformatics and functional screening approaches, we identified several regulators of the NOTCH1 gene in keratinocytes, with the transcription factors DLX5 and EGR3 and estrogen receptor β (ERβ) directly controlling its expression in differentiation. DLX5 and ERG3 are required for RNA polymerase II (PolII) recruitment to the NOTCH1 locus, while ERβ controls NOTCH1 transcription through RNA PolII pause release. Expression of several identified NOTCH1 regulators, including ERβ, is frequently compromised in skin, head and neck, and lung SCCs and SCC-derived cell lines. Furthermore, a keratinocyte ERβ–dependent program of gene expression is subverted in SCCs from various body sites, and there are consistent differences in mutation and gene-expression signatures of head and neck and lung SCCs in female versus male patients. Experimentally increased ERβ expression or treatment with ERβ agonists inhibited proliferation of SCC cells and promoted NOTCH1 expression and squamous differentiation both in vitro and in mouse xenotransplants. Our data identify a link between transcriptional control of NOTCH1 expression and the estrogen response in keratinocytes, with implications for differentiation therapy of squamous cancer. Find the latest version: https://jci.me/72718/pdf Research article Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks,1,2 Paola Ostano,3 Seung-Hee Jo,1,2 Jun Dai,1,2 Spiro Getsios,4 Piotr Dziunycz,5 Günther F.L. -
The Role of Dlx3 in Gene Regulation in the Mouse Placenta
The role of Dlx3 in gene regulation in the mouse placenta by Li Han This thesis/dissertation document has been electronically approved by the following individuals: Roberson,Mark Stephen (Chairperson) Wolfner,Mariana Federica (Minor Member) Cohen,Paula (Field Appointed Minor Member) Weiss,Robert S. (Field Appointed Minor Member) THE ROLE OF DLX3 IN GENE REGULATION IN THE MOUSE PLACENTA A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy by Li Han August 2010 © 2010 Li Han THE ROLE OF DLX3 IN GENE REGULATION IN THE MOUSE PLACENTA Li Han, Ph. D. Cornell University 2010 Distal-less 3 (Dlx3) is a homeodomain containing transcription factor that is required for the normal development of the mouse placenta. Moreover in human trophoblasts, DLX3 appears to be a necessary transcriptional regulator of the glycoprotein hormone α subunit gene, a protein subunit of placental-derived chorionic gonadotropin. The aim of my studies described here was to determine the role of Dlx3 in gene regulation within the placenta. My studies initially sought to determine if Dlx3 could interact physically with other transcriptional regulators in placental trophoblast cells and how these protein- protein interactions might influence Dlx3-dependent gene expression. Yeast two- hybrid screens provide evidence that mothers against decapentaplegic homolog 6 (SMAD6) was a binding partner for DLX3. SMAD6 was found to be expressed and nuclear localized in placental trophoblasts and interacted directly with DLX3. Structure-function analysis revealed that this interaction occurred within a DLX3 domain that overlapped the homeobox, a key domain necessary for DLX3 DNA binding. -
Gabriel Dover)
Dear Mr Darwin (Gabriel Dover) Home | Intro | About | Feedback | Prev | Next | Search Steele: Lamarck's Was Signature Darwin Wrong? Molecular Drive: the Third Force in evolution Geneticist Gabriel Dover claims that there is a third force in evolution: 'Molecular Drive' beside natural selection and neutral drift. Molecular drive is operationally distinct from natural selection and neutral drift. According to Dover it explains biological phenomena, such as the 700 copies of a ribosomal RNA gene and the origin of the 173 legs of the centipede, which natural selection and neutral drift alone cannot explain. by Gert Korthof version 1.3 24 Mar 2001 Were Darwin and Mendel both wrong? Molecular Drive is, according to Dover, an important factor in evolution, because it shapes the genomes and forms of organisms. Therefore Neo-Darwinism is incomplete without Molecular Drive. It is no wonder that the spread of novel genes was ascribed to natural selection, because it was the only known process that could promote the spread of novel genes. Dover doesn't reject the existence of natural selection but points out cases where natural selection clearly fails as a mechanism. Molecular drive is a non-Darwinian mechanism because it is independent of selection. We certainly need forces in evolution, since natural selection itself is not a force. It is the passive outcome of other processes. It is not an active process, notwithstanding its name. Natural selection as an explanation is too powerful for its own good. Molecular drive is non-Mendelian because some DNA segments are multiplied disproportional. In Mendelian genetics genes are present in just two copies (one on the maternal and one on the paternal chromosome). -
Homeobox Gene Expression Profile in Human Hematopoietic Multipotent
Leukemia (2003) 17, 1157–1163 & 2003 Nature Publishing Group All rights reserved 0887-6924/03 $25.00 www.nature.com/leu Homeobox gene expression profile in human hematopoietic multipotent stem cells and T-cell progenitors: implications for human T-cell development T Taghon1, K Thys1, M De Smedt1, F Weerkamp2, FJT Staal2, J Plum1 and G Leclercq1 1Department of Clinical Chemistry, Microbiology and Immunology, Ghent University Hospital, Ghent, Belgium; and 2Department of Immunology, Erasmus Medical Center, Rotterdam, The Netherlands Class I homeobox (HOX) genes comprise a large family of implicated in this transformation proces.14 The HOX-C locus transcription factors that have been implicated in normal and has been primarily implicated in lymphomas.15 malignant hematopoiesis. However, data on their expression or function during T-cell development is limited. Using degener- Hematopoietic cells are derived from stem cells that reside in ated RT-PCR and Affymetrix microarray analysis, we analyzed fetal liver (FL) in the embryo and in the adult bone marrow the expression pattern of this gene family in human multipotent (ABM), which have the unique ability to self-renew and thereby stem cells from fetal liver (FL) and adult bone marrow (ABM), provide a life-long supply of blood cells. T lymphocytes are a and in T-cell progenitors from child thymus. We show that FL specific type of hematopoietic cells that play a major role in the and ABM stem cells are similar in terms of HOX gene immune system. They develop through a well-defined order of expression, but significant differences were observed between differentiation steps in the thymus.16 Several transcription these two cell types and child thymocytes. -
Análise Integrativa De Perfis Transcricionais De Pacientes Com
UNIVERSIDADE DE SÃO PAULO FACULDADE DE MEDICINA DE RIBEIRÃO PRETO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Ribeirão Preto – 2012 ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Tese apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para obtenção do título de Doutor em Ciências. Área de Concentração: Genética Orientador: Prof. Dr. Eduardo Antonio Donadi Co-orientador: Prof. Dr. Geraldo A. S. Passos Ribeirão Preto – 2012 AUTORIZO A REPRODUÇÃO E DIVULGAÇÃO TOTAL OU PARCIAL DESTE TRABALHO, POR QUALQUER MEIO CONVENCIONAL OU ELETRÔNICO, PARA FINS DE ESTUDO E PESQUISA, DESDE QUE CITADA A FONTE. FICHA CATALOGRÁFICA Evangelista, Adriane Feijó Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. Ribeirão Preto, 2012 192p. Tese de Doutorado apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo. Área de Concentração: Genética. Orientador: Donadi, Eduardo Antonio Co-orientador: Passos, Geraldo A. 1. Expressão gênica – microarrays 2. Análise bioinformática por module maps 3. Diabetes mellitus tipo 1 4. Diabetes mellitus tipo 2 5. Diabetes mellitus gestacional FOLHA DE APROVAÇÃO ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. -
Hox Gene Variation and Evolution
news and views annually degasses about 1 gigatonne (109 not nitrate exhaustion. on the microbial algae. The growth perfor- tonnes) of CO2 (ref. 3), equivalent to 20 per Yet the paradox persists. Virtually all phy- mance of the diatoms is all the more surpris- cent of current anthropogenic output. The toplankton species, including the picoplank- ing as nitrate reduction requires energy regression lines and intercepts of dissolved ton, are able to use nitrate; indeed, phyto- and the mediating enzyme contains iron. inorganic carbon, silicate and nitrate con- plankton other than diatoms routinely Indeed, why diatoms can be so much more centrations, measured in the upper 200 m of exhaust nitrate in the surface waters of the efficient than the other algae despite the the EUZ, indicate that silicate availability non-HNLC ocean. So why does this not hap- nitrate handicap needs to be explained. regulates both carbon and nitrate uptake pen in the EUZ and other low-silicate HNLC Balancing pelagic ecosystem budgets is and fate. The slope of the highly significant regions? Differences in grazing pressure still an art because we know so little about the 5 regression between nitrate and silicate is 1, have been proposed as an explanation . One abilities and predilections of the organisms8 which coincides with the known require- widely held view is that the small algae of the and their interactions with one another5. ment of these two elements by diatoms. The microbial loop are kept in check by heavy Whatever the outcome of studies on the lim- intercept represents the excess nitrate (about grazing pressure, whereas diatoms, because iting factors in the various HNLC regions 4 mmol m–3) that confers HNLC status on of their larger size (and possibly also the pro- and their subsystems, the status of diatoms as the EUZ. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Supplementary Materials
Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine -
Progress in the Discovery of Small Molecule Modulators of Desumoylation
Curr. Issues Mol. Biol. (2020) 35: 17-34. Progress in the Discovery of Small Molecule Modulators of DeSUMOylation Shiyao Chen, Duoling Dong, Weixiang Xin and Huchen Zhou* School of Pharmacy, Shanghai Jiao Tong University, Shanghai, China. *Correspondence: [email protected] htps://doi.org/10.21775/cimb.035.017 Abstract protein–protein interactions, gene transcription, SUMOylation and DeSUMOylation are reversible genome integrity, and DNA replication and repair protein post-translational modifcation (PTM) (Wilkinson and Henley, 2010; Vierstra, 2012; processes involving small ubiquitin-like modifer Bailey et al., 2016). In 1995, Meluh and Koshland (SUMO) proteins. Tese processes have indis- (1995) identifed Smt3 in Saccharomyces cerevi- pensable roles in various cellular processes, such siae, which is the earliest report within this fled. as subcellular localization, gene transcription, and Two years later, based on the sequence similarity DNA replication and repair. Over the past decade, between ubiquitin and a new 11.5-kDa protein, increasing atention has been given to SUMO- ubiquitin/SMT3, the name SUMO was formally related pathways as potential therapeutic targets. proposed for the frst time (Mahajan et al., 1997). Te Sentrin/SUMO-specifc protease (SENP), Although SUMO modifcation is closely which is responsible for deSUMOylation, has related to the progression of various diseases, such been proposed as a potential therapeutic target as cancers and cardiac disorders, it has aroused in the treatment of cancers and cardiac disorders. increasing atention as a potential therapeutic target Unfortunately, no SENP inhibitor has yet reached in recent years, especially concerning the Sentrin/ clinical trials. In this review, we focus on advances SUMO-specifc protease (SENP), which is the key in the development of SENP inhibitors in the past regulator of deSUMOylation. -
University of California, Merced
UNIVERSITY OF CALIFORNIA, MERCED SUMOylation is a regulator of regional cell fate and genomic integrity in planarians by Manish Thiruvalluvan A dissertation submitted in satisfaction of the requirements for the degree Doctor of Philosophy in Quantitative and Systems Biology Committee in Charge: Professor Kirk Jensen, Chair Professor Jennifer Manilay, Member Professor Anna Beaudin, Member Professor Néstor J. Oviedo, Advisor 2018 i Copyright Manish Thiruvalluvan, 2018 All rights reserved ii The dissertation of Manish Thiruvalluvan is approved, and it is acceptable in quality and form for publication on microfilm and electronically: Jennifer Manilay Anna Beaudin Kirk Jensen, Chair University of California, Merced 2018 iii TABLE OF CONTENTS vi. List of figures vii. List of abbreviations viii. Acknowledgements ix. Curriculum vitae xii. Abstract 1. Introduction 1.1. Regional signals influence cell fate decisions in health and disease 1.2. SUMOylation – a type of posttranslational modification 1.3. The planarian model Schmidtea mediterranea 1.4. Research summary 2. Materials and Methods 2.1. Materials 2.1.1. Organisms 2.1.2. Selection of primers and cloning 2.1.3. Antibodies, enzymes and other reagents 2.1.4. Solutions and buffers 2.2. Methods 2.2.1. Planarian husbandry 2.2.2. Identification of orthologs and phylogenetic analysis 2.2.3. PCR amplification and gel electrophoresis 2.2.4. Planarian Amputation 2.2.5. Irradiation 2.2.6. RNAi by bacteria feeding 2.2.7. Fixation protocols 2.2.8. RNA extraction 2.2.9. Planarian cell dissociation 2.2.10. Immunocytochemistry 2.2.11. RNA probe synthesis 2.2.12. In situ hybridization 2.2.13.