DOCSLIB.ORG

Placental Failure in Mice Lacking the Homeobox Gene Dlx3

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Placental Failure in Mice Lacking the Homeobox Gene Dlx3 Proc. Natl. Acad. Sci. USA Vol. 96, pp. 162–167, January 1999 Developmental Biology Placental failure in mice lacking the homeobox gene Dlx3 MARIA I. MORASSO*†,ALEXANDER GRINBERG‡,GERTRAUD ROBINSON§,THOMAS D. SARGENT*, AND KATHLEEN A. MAHON¶ *Laboratory of Molecular Genetics, ‡Laboratory of Mammalian Genes and Development, National Institute of Child Health and Human Development, §Laboratory of Genetics and Physiology, National Institute of Diabetes, Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD 20892; and ¶Department of Cell Biology, Baylor College of Medicine, Houston, TX 77030 Communicated by Igor B. Dawid, National Institute of Child Health and Human Development, Bethesda, MD, November 16, 1998 (received for review September 23, 1998) ABSTRACT Dlx3 is a homeodomain transcription factor helix–turn–helix family have been detected in trophoblastic and a member of the vertebrate Distal-less family. Targeted tissues by day 6.5. In Ets2 mutant embryos, both migration and deletion of the mouse Dlx3 gene results in embryonic death differentiation of trophoblast cells are defective, resulting in between day 9.5 and day 10 because of placental defects that embryonic death before day 8.5 of gestation (9). For both alter the development of the labyrinthine layer. In situ hy- Mash-2 and Ets2 mutants, the defects were rescued by tet- bridization reveals that the Dlx3 gene is initially expressed in raploid cell aggregation experiments, reinforcing the conclu- ectoplacental cone cells and chorionic plate, and later in the sion that there is an essential role for these genes during labyrinthine trophoblast of the chorioallantoic placenta, extraembryonic tissue development (7, 9). where major defects are observed in the Dlx3 2y2 embryos. Members of the homeodomain-containing transcription fac- The expression of structural genes, such as 4311 and PL-1, tors have also been reported in the developing placenta: Pem which were used as markers to follow the fate of different (10, 11), and more recently MOX2, MSX2, DLX4 (12, 13), and derivatives of the placenta, was not affected in the Dlx3-null HB24 (12, 14), which were isolated from a third-trimester embryos. However, by day 10.5 of development, expression of human placental library. The paired-like homeobox gene Esx1 the paired-like homeodomain gene Esx1 was strongly down- has been shown to be expressed in the labyrinthine layer (15). regulated in affected placenta tissue, suggesting that Dlx3 is The specific role for these homeodomain proteins in placental required for the maintenance of Esx1 expression, normal development and function is under current investigation, but it placental morphogenesis, and embryonic survival. has been suggested that DLX4 may be important for tropho- blast invasion (13) and HB24 may play a role in trophoblast The development of the placenta begins with the formation of differentiation (14). the specialized epithelial trophoblasts that will give rise to the Dlx3 is part of the Distal-less (16) family of non-Antennapedia ectoplacental cone and chorionic ectoderm. The remainder of homeobox genes, which comprises six members in mice and the cells in the embryo segregate and constitute the inner cell humans (13, 17–20) that are organized as three convergently mass that will form the embryo proper. During implantation transcribed pairs, each closely linked to three of the four mam- in mice, trophoblasts begin to attach to the receptive uterine malian Hox clusters. In the human genome, DLX3 is paired with epithelium, after which the trophectoderm proliferates to form DLX4 (also reported as DLX7 and DLX8) on chromosome 17 the ectoplacental cone, and later the spongiotrophoblast layer. (location 17q21.3; refs. 13, 19, and 20), telomeric to the HOXB The outermost trophoblasts of the ectoplacental cone differ- cluster (19). Dlx3 is expressed throughout development in a series entiate into secondary trophoblast giant cells, which lie in the of structures derived from epithelial mesenchymal interaction periphery of the placenta, forming the interface with maternal such as the teeth, hair follicles, and limb buds (21). Dlx3 is also cells in the decidua (1, 2). The expression of placental lactogen expressed in the differentiated strata of vertebrate epidermis, and (PL) is regulated during trophoblast giant cell differentiation transgenic ectopic expression of this gene in mouse epidermal (3). The 4311 gene is specific for a group of cells of the basal cells leads to severe disruption of this tissue as well as ectoplacental cone, suggesting there may be a compartmen- cessation of proliferation and precocious activation of late dif- talization within the trophoblast cells, with 4311 marking the ferentiation markers, such as loricrin and profilaggrin in the basal cells that will form the densely packed spongiotrophoblast layer (22). Recently, the genetic abnormality in the hereditary layer, but not the trophoblast giant cells or the labyrinthine disease tricho-dento-osseous (TDO) syndrome was identified as layer of the placenta (4). a four-nucleotide deletion in the human DLX3 gene, immediately Several transcription factors have been reported to be downstream from the homeodomain coding region (23). This expressed in the chorioallantoic placenta, suggesting a possible syndrome is inherited as an autosomal dominant trait, and it role in the differentiation of this tissue; some examples are the includes abnormalities in the teeth, hair, and facial bones. To zinc finger factor Rex-1 (5), a member of the GATA family, study the function of Dlx3 during development we generated GATA-3 (6), and members of the helix–loop–helix family of Dlx3-null mutant mice by gene targeting. transcription factors Mash-2 (7) and Hxt (8). Mash-2 is an Here we report additional sites of expression of the Dlx3 important regulator of trophoblast proliferation; its expression gene: during placentation in the mouse, Dlx3 is expressed in diminishes as mouse trophoblasts differentiate into giant cells, the ectoplacental cone cells and chorionic plate, and later in and the targeted deletion of the Mash-2 gene results in an placental development in the labyrinthine layer. We also show increase in the number of giant cells at the expense of the that targeted deletion of Dlx3 results in embryonic develop- proliferative population, resulting in a diminished spongiotro- mental arrest around day 9.5–10, associated with a gross failure phoblast layer (7). Transcription factors of the Ets winged of the placenta to undergo proper morphogenesis. The publication costs of this article were defrayed in part by page charge Abbreviations: PL, placental lactogen; ES cells, embryonic stem cells; En, embryonic day n; mGCNF, mouse germ cell nuclear factor. payment. This article must therefore be hereby marked ‘‘advertisement’’ in †To whom reprint requests should be addressed at present address: accordance with 18 U.S.C. §1734 solely to indicate this fact. Laboratory of Skin Biology, Building 6, Room 134, National Institute © 1999 by The National Academy of Sciences 0027-8424y99y96162-6$2.00y0 of Arthritis, Musculoskeletal and Skin Diseases, National Institutes of PNAS is available online at www.pnas.org. Health, Bethesda MD 20892. e-mail: [email protected]. 162 Downloaded by guest on September 23, 2021 Developmental Biology: Morasso et al. Proc. Natl. Acad. Sci. USA 96 (1999) 163 MATERIALS AND METHODS (15), Dlx3 (21), and mouse germ cell nuclear factor (mGCNF) gene (30). Hybridization was performed according to ref. 31. Construction of Targeting Vector. The targeting vector KOyDlx3 (Fig. 1) contains 5.2 kb of Dlx3 genomic sequence from a 129ySv strain in the pPNT vector (24). This vector was RESULTS modified by converting the NotI site into an SfiI site, which was Targeted Mutagenesis of Dlx3. Dlx3-deficient mice were used to linearize the vector before electroporation. The 1.2-kb derived from ES cells in which one Dlx3 allele was disrupted 59 genomic flank was subcloned into the XhoI site in the same 9 (Fig. 1A) as described in Materials and Methods. Two inde- vector. The 4-kb 3 homologous flank was subcloned as an pendently isolated ES cell lines carrying the mutation (Fig. 1B) XbaI fragment into the XbaI site in pPNT. were used to generate chimeric mice that transmitted the Gene Targeting and Generation of Mouse Mutants. Tissue mutated allele to their offspring. Founder chimeras were culture of embryonic stem (ES) cells and conditions for mated, and the progeny were analyzed to determine heterozy- electroporation of the targeting construct have been described gosity. Matings of heterozygous pairs did not generate any live (25). Successful integration events in the R1 line of ES cells (a births of Dlx3 2y2 mice, nor were any null embryos found at gift from A. Nagy, Mount Sinai Hospital, Toronto) were a stage later than E12.5. However, at E9.5 the distribution of isolated by simultaneous selection with G418 (350 mgyml) and 1y1 1y2 2y2 m , , and genotypes (Fig. 1C) showed approxi- ganciclovir (2 M). Homologous recombination events were mately Mendelian ratios (data not shown). Morphological identified by Southern blotting and PCR of DNA purified by 2y2 y defects were already evident in E9.5 embryos, such as proteinase K digestion followed by extraction with phenol swelling of the pericardium indicating a disturbance of fluid chloroform. The hybridization probes and the predicted sizes balance across the yolk sac and an accumulation of blood in the of fragments generated by the endogenous and targeted alleles embryo (Fig. 1D). At this stage in normal embryogenesis, the in Southern blotting are shown in Fig. 1B. Recombination was Dlx3 gene has been reported to be expressed only in the first 9 detected at the 5 end by digesting the DNA with Asp718 and and second branchial arches (21). No gross abnormality was 9 hybridizing the blot with the 5 probe (280-bp SmaI–BamHI observed in this tissue by visual inspection of the E9.5 mutant fragment). The normal allele generated a 2.8-kb band and the embryos, which is reasonable because the expression of Dlx3 9 disrupted allele a 6.5-kb band.
Load more

Recommended publications
  • Single Cell Transcriptomics Reveal Temporal Dynamics of Critical Regulators of Germ Cell Fate During Mouse Sex Determination
    bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Single cell transcriptomics reveal temporal dynamics of critical regulators of germ 2 cell fate during mouse sex determination 3 Authors: Chloé Mayère1,2, Yasmine Neirijnck1,3, Pauline Sararols1, Chris M Rands1, 4 Isabelle Stévant1,2, Françoise Kühne1, Anne-Amandine Chassot3, Marie-Christine 5 Chaboissier3, Emmanouil T. Dermitzakis1,2, Serge Nef1,2,*. 6 Affiliations: 7 1Department of Genetic Medicine and Development, University of Geneva, 1211 Geneva, 8 Switzerland; 9 2iGE3, Institute of Genetics and Genomics of Geneva, University of Geneva, 1211 10 Geneva, Switzerland; 11 3Université Côte d'Azur, CNRS, Inserm, iBV, France; 12 Lead Contact: 13 *Corresponding Author: Serge Nef, 1 rue Michel-Servet CH-1211 Genève 4, 14 [email protected]. + 41 (0)22 379 51 93 15 Running Title: Single cell transcriptomics of germ cells 1 bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 16 Abbreviations; 17 AGC: Adrenal Germ Cell 18 GC: Germ cell 19 OGC: Ovarian Germ Cell 20 TGC: Testicular Germ Cell 21 scRNA-seq: Single-cell RNA-Sequencing 22 DEG: Differentially Expressed Gene 23 24 25 Keywords: 26 Single-cell RNA-Sequencing (scRNA-seq), sex determination, ovary, testis, gonocytes, 27 oocytes, prospermatogonia, meiosis, gene regulatory network, germ cells, development, 28 RNA splicing 29 2 bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020.
    [Show full text]
  • Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer
    Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks, … , Karine Lefort, G. Paolo Dotto J Clin Invest. 2014;124(5):2260-2276. https://doi.org/10.1172/JCI72718. Research Article Oncology Downmodulation or loss-of-function mutations of the gene encoding NOTCH1 are associated with dysfunctional squamous cell differentiation and development of squamous cell carcinoma (SCC) in skin and internal organs. While NOTCH1 receptor activation has been well characterized, little is known about how NOTCH1 gene transcription is regulated. Using bioinformatics and functional screening approaches, we identified several regulators of the NOTCH1 gene in keratinocytes, with the transcription factors DLX5 and EGR3 and estrogen receptor β (ERβ) directly controlling its expression in differentiation. DLX5 and ERG3 are required for RNA polymerase II (PolII) recruitment to the NOTCH1 locus, while ERβ controls NOTCH1 transcription through RNA PolII pause release. Expression of several identified NOTCH1 regulators, including ERβ, is frequently compromised in skin, head and neck, and lung SCCs and SCC-derived cell lines. Furthermore, a keratinocyte ERβ–dependent program of gene expression is subverted in SCCs from various body sites, and there are consistent differences in mutation and gene-expression signatures of head and neck and lung SCCs in female versus male patients. Experimentally increased ERβ expression or treatment with ERβ agonists inhibited proliferation of SCC cells and promoted NOTCH1 expression and squamous differentiation both in vitro and in mouse xenotransplants. Our data identify a link between transcriptional control of NOTCH1 expression and the estrogen response in keratinocytes, with implications for differentiation therapy of squamous cancer. Find the latest version: https://jci.me/72718/pdf Research article Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks,1,2 Paola Ostano,3 Seung-Hee Jo,1,2 Jun Dai,1,2 Spiro Getsios,4 Piotr Dziunycz,5 Günther F.L.
    [Show full text]
  • The Role of Dlx3 in Gene Regulation in the Mouse Placenta
    The role of Dlx3 in gene regulation in the mouse placenta by Li Han This thesis/dissertation document has been electronically approved by the following individuals: Roberson,Mark Stephen (Chairperson) Wolfner,Mariana Federica (Minor Member) Cohen,Paula (Field Appointed Minor Member) Weiss,Robert S. (Field Appointed Minor Member) THE ROLE OF DLX3 IN GENE REGULATION IN THE MOUSE PLACENTA A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy by Li Han August 2010 © 2010 Li Han THE ROLE OF DLX3 IN GENE REGULATION IN THE MOUSE PLACENTA Li Han, Ph. D. Cornell University 2010 Distal-less 3 (Dlx3) is a homeodomain containing transcription factor that is required for the normal development of the mouse placenta. Moreover in human trophoblasts, DLX3 appears to be a necessary transcriptional regulator of the glycoprotein hormone α subunit gene, a protein subunit of placental-derived chorionic gonadotropin. The aim of my studies described here was to determine the role of Dlx3 in gene regulation within the placenta. My studies initially sought to determine if Dlx3 could interact physically with other transcriptional regulators in placental trophoblast cells and how these protein- protein interactions might influence Dlx3-dependent gene expression. Yeast two- hybrid screens provide evidence that mothers against decapentaplegic homolog 6 (SMAD6) was a binding partner for DLX3. SMAD6 was found to be expressed and nuclear localized in placental trophoblasts and interacted directly with DLX3. Structure-function analysis revealed that this interaction occurred within a DLX3 domain that overlapped the homeobox, a key domain necessary for DLX3 DNA binding.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • FARE2021WINNERS Sorted by Institute
    FARE2021WINNERS Sorted By Institute Swati Shah Postdoctoral Fellow CC Radiology/Imaging/PET and Neuroimaging Characterization of CNS involvement in Ebola-Infected Macaques using Magnetic Resonance Imaging, 18F-FDG PET and Immunohistology The Ebola (EBOV) virus outbreak in Western Africa resulted in residual neurologic abnormalities in survivors. Many case studies detected EBOV in the CSF, suggesting that the neurologic sequelae in survivors is related to viral presence. In the periphery, EBOV infects endothelial cells and triggers a “cytokine stormâ€. However, it is unclear whether a similar process occurs in the brain, with secondary neuroinflammation, neuronal loss and blood-brain barrier (BBB) compromise, eventually leading to lasting neurological damage. We have used in vivo imaging and post-necropsy immunostaining to elucidate the CNS pathophysiology in Rhesus macaques infected with EBOV (Makona). Whole brain MRI with T1 relaxometry (pre- and post-contrast) and FDG-PET were performed to monitor the progression of disease in two cohorts of EBOV infected macaques from baseline to terminal endpoint (day 5-6). Post-necropsy, multiplex fluorescence immunohistochemical (MF-IHC) staining for various cellular markers in the thalamus and brainstem was performed. Serial blood and CSF samples were collected to assess disease progression. The linear mixed effect model was used for statistical analysis. Post-infection, we first detected EBOV in the serum (day 3) and CSF (day 4) with dramatic increases until euthanasia. The standard uptake values of FDG-PET relative to whole brain uptake (SUVr) in the midbrain, pons, and thalamus increased significantly over time (p<0.01) and positively correlated with blood viremia (p≤0.01).
    [Show full text]
  • MOCHI Enables Discovery of Heterogeneous Interactome Modules in 3D Nucleome
    Downloaded from genome.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press MOCHI enables discovery of heterogeneous interactome modules in 3D nucleome Dechao Tian1,# , Ruochi Zhang1,# , Yang Zhang1, Xiaopeng Zhu1, and Jian Ma1,* 1Computational Biology Department, School of Computer Science, Carnegie Mellon University, Pittsburgh, PA 15213, USA #These two authors contributed equally *Correspondence: [email protected] Contact To whom correspondence should be addressed: Jian Ma School of Computer Science Carnegie Mellon University 7705 Gates-Hillman Complex 5000 Forbes Avenue Pittsburgh, PA 15213 Phone: +1 (412) 268-2776 Email: [email protected] 1 Downloaded from genome.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press Abstract The composition of the cell nucleus is highly heterogeneous, with different constituents forming complex interactomes. However, the global patterns of these interwoven heterogeneous interactomes remain poorly understood. Here we focus on two different interactomes, chromatin interaction network and gene regulatory network, as a proof-of-principle, to identify heterogeneous interactome modules (HIMs), each of which represents a cluster of gene loci that are in spatial contact more frequently than expected and that are regulated by the same group of transcription factors. HIM integrates transcription factor binding and 3D genome structure to reflect “transcriptional niche” in the nucleus. We develop a new algorithm MOCHI to facilitate the discovery of HIMs based on network motif clustering in heterogeneous interactomes. By applying MOCHI to five different cell types, we found that HIMs have strong spatial preference within the nucleus and exhibit distinct functional properties. Through integrative analysis, this work demonstrates the utility of MOCHI to identify HIMs, which may provide new perspectives on the interplay between transcriptional regulation and 3D genome organization.
    [Show full text]
  • Chronodentistry: the Role & Potential of Molecular Clocks in Oral Medicine
    Janjić and Agis BMC Oral Health (2019) 19:32 https://doi.org/10.1186/s12903-019-0720-x REVIEW Open Access Chronodentistry: the role & potential of molecular clocks in oral medicine Klara Janjić1,2 and Hermann Agis1,2* Abstract Molecular clocks help organisms to adapt important physiological functions to periodically changing conditions in the environment. These include the adaption of the 24 h sleep-wake rhythm to changes of day and night. The circadian clock is known to act as a key regulator in processes of health and disease in different organs. The knowledge on the circadian clock led to the development of chronopharmacology and chronotherapy. These fields aim to investigate how efficiency of medication and therapies can be improved based on circadian clock mechanisms. In this review we aim to highlight the role of the circadian clock in oral tissues and its potential in the different fields of dentistry including oral and maxillofacial surgery, restorative dentistry, endodontics, periodontics and orthodontics to trigger the evolving field of chronodentistry. Keywords: Circadian clock, Molecular clock, Dentistry, Chronopharmacology, Oral surgery, Conservative dentistry, Endodontology, Periodontology Background the circadian clock governs synchronization of various As part of evolution, the adaption to environmental physiological processes as an output to the environmen- changes contributes fundamentally to prevail in natural tal changes. The inputs are transmitted to the central selection. Hence this ability is an important feature of a circadian clock in the brain [4] that controls healthy organism. Teeth play a major role in satisfying cell-autonomous peripheral circadian clocks in different the basic human need of food uptake.
    [Show full text]
  • Genetic Network During Neural Crest Induction: from Cell Specification to Cell Survival
    Seminars in Cell & Developmental Biology 16 (2005) 647–654 Review Genetic network during neural crest induction: From cell specification to cell survival a a a,b,c, Ben Steventon , Carlos Carmona-Fontaine , Roberto Mayor ∗ a Department of Anatomy and Developmental Biology, University College London, Gower Street, London WC1E 6BT, UK b Millennium Nucleus in Developmental Biology, Universidad de Chile, Chile c Fundaci´on Ciencia Para la Vida, Chile Available online 5 August 2005 Abstract The concerted action of extracellular signals such as BMP, Wnt, FGF, RA and Notch activate a genetic program required to transform a na¨ıve ectodermal cell into a neural crest cell. In this review we will analyze the extracellular signals and the network of transcription factors that are required for this transformation. We will propose the division of this complex network of factors in two main steps: an initial cell specification step followed by a maintenance or cell survival step. © 2005 Elsevier Ltd. All rights reserved. Keywords: Neural crest; Genetic cascade; Cell survival; Wnt; FGF; BMP; Retinoic acid Contents 1. Introduction ........................................................................................................ 647 2. Extracellular Cell Signalling during neural crest induction............................................................... 648 3. Early genetic network involved in Cell Specification of the neural crest ................................................... 649 4. Specific neural crest genes involved in Cell Survival ...................................................................
    [Show full text]
  • The Role of Epigenomics in Osteoporosis and Osteoporotic Vertebral Fracture
    International Journal of Molecular Sciences Review The Role of Epigenomics in Osteoporosis and Osteoporotic Vertebral Fracture Kyoung-Tae Kim 1,2 , Young-Seok Lee 1,3 and Inbo Han 4,* 1 Department of Neurosurgery, School of Medicine, Kyungpook National University, Daegu 41944, Korea; [email protected] (K.-T.K.); [email protected] (Y.-S.L.) 2 Department of Neurosurgery, Kyungpook National University Hospital, Daegu 41944, Korea 3 Department of Neurosurgery, Kyungpook National University Chilgok Hospital, Daegu 41944, Korea 4 Department of Neurosurgery, CHA University School of medicine, CHA Bundang Medical Center, Seongnam-si, Gyeonggi-do 13496, Korea * Correspondence: [email protected]; Tel.: +82-31-780-1924; Fax: +82-31-780-5269 Received: 6 November 2020; Accepted: 8 December 2020; Published: 11 December 2020 Abstract: Osteoporosis is a complex multifactorial condition of the musculoskeletal system. Osteoporosis and osteoporotic vertebral fracture (OVF) are associated with high medical costs and can lead to poor quality of life. Genetic factors are important in determining bone mass and structure, as well as any predisposition for bone degradation and OVF. However, genetic factors are not enough to explain osteoporosis development and OVF occurrence. Epigenetics describes a mechanism for controlling gene expression and cellular processes without altering DNA sequences. The main mechanisms in epigenetics are DNA methylation, histone modifications, and non-coding RNAs (ncRNAs). Recently, alterations in epigenetic mechanisms and their activity have been associated with osteoporosis and OVF. Here, we review emerging evidence that epigenetics contributes to the machinery that can alter DNA structure, gene expression, and cellular differentiation during physiological and pathological bone remodeling.
    [Show full text]
  • DLX Genes: Roles in Development and Cancer
    cancers Review DLX Genes: Roles in Development and Cancer Yinfei Tan 1,* and Joseph R. Testa 1,2,* 1 Genomics Facility, Fox Chase Cancer Center, Philadelphia, PA 19111, USA 2 Cancer Signaling and Epigenetics Program, Fox Chase Cancer Center, Philadelphia, PA 19111, USA * Correspondence: [email protected] (Y.T.); [email protected] (J.R.T.) Simple Summary: DLX homeobox family genes encode transcription factors that have indispensable roles in embryonic and postnatal development. These genes are critically linked to the morphogene- sis of craniofacial structures, branchial arches, forebrain, and sensory organs. DLX genes are also involved in postnatal homeostasis, particularly hematopoiesis and, when dysregulated, oncogen- esis. DLX1/2, DLX3/4, and DLX5/6 exist as bigenes on different chromosomes, sharing intergenic enhancers between gene pairs, which allows orchestrated spatiotemporal expression. Genomic alterations of human DLX gene enhancers or coding sequences result in congenital disorders such as split-hand/foot malformation. Aberrant postnatal expression of DLX genes is associated with hematological malignancies, including leukemias and lymphomas. In several mouse models of T-cell lymphoma, Dlx5 has been shown to act as an oncogene by cooperating with activated Akt, Notch1/3, and/or Wnt to drive tumor formation. In humans, DLX5 is aberrantly expressed in lung and ovarian carcinomas and holds promise as a therapeutic target. Abstract: Homeobox genes control body patterning and cell-fate decisions during development. The homeobox genes consist of many families, only some of which have been investigated regarding a possible role in tumorigenesis. Dysregulation of HOX family genes have been widely implicated in cancer etiology.
    [Show full text]
  • Genomic Structure and Functional Control of the Dlx3-7 Bigene Cluster
    Genomic structure and functional control of the Dlx3-7 bigene cluster Kenta Sumiyama*, Steven Q. Irvine*, David W. Stock†, Kenneth M. Weiss‡, Kazuhiko Kawasaki‡, Nobuyoshi Shimizu§, Cooduvalli S. Shashikant¶, Webb Millerʈ, and Frank H. Ruddle*,** *Department of Molecular, Cellular, and Developmental Biology, Yale University, New Haven, CT 06511; †Department of Biology, University of Colorado, Boulder, CO 80309; Departments of ‡Anthropology, ¶Dairy and Animal Science, and ʈComputer Science, Pennsylvania State University, University Park, PA 16802; and §Department of Molecular Biology, Keio University School of Medicine, Tokyo 160, Japan Contributed by Frank H. Ruddle, November, 1, 2001 The Dlx genes are involved in early vertebrate morphogenesis, Dlx3 is expressed in the first and second visceral arches and notably of the head. The six Dlx genes of mammals are arranged fronto-nasal ectoderm at E9.5 (9). Later in development, Dlx3 is in three convergently transcribed bigene clusters. In this study, we also expressed in the external respiratory epithelium of the nares, examine the regulation of the Dlx3-7 cluster of the mouse. We in whisker follicles, taste bud primordia, dental and mammary obtained and sequenced human and mouse P1 clones covering the gland epithelia, apical ectodermal ridge (AER) of limb buds, entire Dlx3-7 cluster. Comparative analysis of the human and genital primordia, and in several additional sites of epithelial- mouse sequences revealed several highly conserved noncoding mesenchymal interaction (8, 9). By the end of embryonic devel- regions within 30 kb of the Dlx3-7-coding regions. These conserved opment, Dlx3 is down-regulated, except in the skin, where it is elements were located both 5؅ of the coding exons of each gene transcribed in stratified epidermis and in the matrix cells of the and in the intergenic region 3؅ of the exons, suggesting that some hair follicles (10).
    [Show full text]
  • Dlx1 and Dlx2 Function Is Necessary for Terminal Differentiation And
    Research article 311 Dlx1 and Dlx2 function is necessary for terminal differentiation and survival of late-born retinal ganglion cells in the developing mouse retina Jimmy de Melo1, Guoyan Du2,3, Mario Fonseca2,3, Leigh-Anne Gillespie3, William J. Turk3, John L. R. Rubenstein4 and David D. Eisenstat1,2,3,5,* 1Department of Human Anatomy and Cell Science, University of Manitoba, Winnipeg, Manitoba, R3E 3J7, Canada 2Department of Pediatrics and Child Health, University of Manitoba, Winnipeg, Manitoba, R3A 1S1, Canada 3Manitoba Institute of Cell Biology, Cancer Care Manitoba, Winnipeg, Manitoba, R3E 0V9, Canada 4Department of Psychiatry, University of California, San Francisco, CA 94143, USA 5Department of Ophthalmology, University of Manitoba, Winnipeg, Manitoba, R3E 0V9, Canada *Author for correspondence (e-mail: [email protected]) Accepted 3 November 2004 Development 132, 311-322 Published by The Company of Biologists 2005 doi:10.1242/dev.01560 Summary Dlx homeobox genes, the vertebrate homologs of Distal- Ectopic expression of Crx, the cone and rod photoreceptor less, play important roles in the development of the homeobox gene, in the GCL and neuroblastic layers of the vertebrate forebrain, craniofacial structures and limbs. mutants may signify altered cell fate of uncommitted RGC Members of the Dlx gene family are also expressed in progenitors. However, amacrine and horizontal cell retinal ganglion cells (RGC), amacrine and horizontal cells differentiation is relatively unaffected in the Dlx1/2 null of the developing and postnatal retina. Expression begins retina. Herein, we propose a model whereby early-born at embryonic day 12.5 and is maintained until late RGCs are Dlx1 and Dlx2 independent, but Dlx function is embryogenesis for Dlx1, while Dlx2 expression extends to necessary for terminal differentiation of late-born RGC adulthood.
    [Show full text]