Prostaglandin E1 Inhibits GLI2 Amplification-Associated Activation of the Hedgehog Pathway and Drug Refractory Tumor Growth

Home , GLI2, Prostaglandin E1, Sulprostone, Travoprost

Author Manuscript Published OnlineFirst on May 5, 2020; DOI: 10.1158/0008-5472.CAN-19-2052 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

1 Prostaglandin E1 Inhibits GLI2 Amplification-Associated

2 Activation of the Hedgehog Pathway and Drug Refractory

3 Tumor Growth

4 Fujia Wu1,2, Chenze Zhang1,2, Chen Zhao1, Hao Wu1,2, Zhaoqian Teng1,2,3, Tao Jiang4,5,6 *,

5 Yu Wang1,2,3 *

6 1. State Key Laboratory of Stem Cell and Reproductive Biology, Institute of Zoology,

7 Chinese Academy of Sciences, Beijing 100101, China

8 2. University of Chinese Academy of Sciences, Beijing 100049, China

9 3. Institute for Stem Cell and Regeneration, Chinese Academy of Sciences, Beijing 100101,

10 China

11 4. Department of Neurosurgery, Beijing TianTan Hospital, Capital Medical University,

12 Beijing 100050, China

13 5. Beijing Neurosurgical Institute, Capital Medical University, Beijing 100050, China

14 6. China National Clinical Research Center for Neurological Diseases, Beijing 100070,

15 China

16 * Corresponding Authors: Yu Wang, State Key Laboratory of Stem Cell and Reproductive

17 Biology, Institute of Zoology, Chinese Academy of Sciences, 1 Beichen West Road, Beijing

18 100101, China. Phone: +86-10-82619461; E-mail: [email protected]; and Tao Jiang,

19 Department of Neurosurgery, Beijing TianTan Hospital, Capital Medical University, Beijing

20 100050, China. Phone: +86-10-59975049; E-mail: [email protected]

21 Current address for Yu Wang: College of Life Sciences and Oceanography, Shenzhen

22 University, Shenzhen, China.

23 Running title: PGE1 inhibits GLI2 activity and drug refractory tumor growth.

24 Conflict of interest statement: The authors declare no potential conflicts of interest.

Page 1 of 29

Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 2020 American Association for Cancer Research. Author Manuscript Published OnlineFirst on May 5, 2020; DOI: 10.1158/0008-5472.CAN-19-2052 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

1 Abstract

2 Aberrant activation of the Hedgehog (HH) signaling pathway underlines the initiation and

3 progression of a multitude of cancers. The effectiveness of the leading drugs vismodegib

4 (GDC-0449) and sonidegib (LDE225), both Smoothened (SMO) antagonists, is compromised

5 by acquisition of mutations that alter pathway components, notably secondary mutations in

6 SMO and amplification of GLI2, a transcriptional mediator at the end of the pathway.

7 Pharmacological blockade of GLI2 activity could ultimately overcome these diversified

8 refractory mechanisms, which would also be effective in a broader spectrum of primary

9 tumors than current SMO antagonists. To this end, we conducted a high-content screen

10 directly analyzing the ciliary translocation of GLI2, a key event for GLI2 activation in HH

11 signal transduction. Several prostaglandin compounds were shown to inhibit accumulation of

12 GLI2 within the primary cilium (PC). In particular, prostaglandin E1 (PGE1), an

13 FDA-approved drug, is a potent GLI2 antagonist that overcame resistance mechanisms of

14 both SMO mutagenesis and GLI2 amplification. Consistent with a role in HH pathway

15 regulation, EP4 receptor localized to the PC. Mechanistically, PGE1 inhibited HH signaling

16 through the EP4 receptor, enhancing cAMP-PKA activity, which promoted phosphorylation

17 and degradation of GLI2 via the ubiquitination pathway. PGE1 also effectively inhibited the

18 growth of drug refractory human medulloblastoma (MB) xenografts. Together, these results

19 identify PGE1 and other prostaglandins as potential templates for complementary therapeutic

20 development to circumvent resistance to current generation SMO antagonists in use in the

21 clinic.

22 Significance

23 Findings show that PGE1 exhibits pan-inhibition against multiple drug refractory activities

24 for Hedgehog-targeted therapies and elicits significant anti-tumor effects in xenograft models

25 of drug refractory human medulloblastoma mimicking GLI2 amplification.

Page 2 of 29

1 Introduction

2 The evolutionarily conserved HH signaling pathway plays critical roles in embryonic

3 patterning and adult tissue homeostasis (1,2). Hyperactive HH signaling has been linked to a

4 range of malignant tumors through tumor initiation, maintenance of tumor stem/progenitor

5 cells, and support of tumor-stroma interaction (3,4). Therefore, the HH signaling has emerged

6 as a therapeutic target of interest for cancer therapy and intensive efforts have been made to

7 develop targeted pathway antagonists.

8 Mammalian HH signal transduction is controlled by the Patched1 (PTCH1)-mediated

9 suppression of SMO, a seven-pass transmembrane protein which traffics continuously

10 through the primary cilium (PC) (5,6). Inactive SMO failed to regulate the activity state of

11 GLI2, the primary transcription activator of HH pathway, which thus was sequentially

12 phosphorylated by protein kinase A (PKA), glycogen synthase kinase-3β (GSK-3β), and

13 casein kinase 1 (CK1), and trafficked to the proteasome for degradation. On HH ligand (Sonic

14 hedgehog [SHH], Desert hedgehog [DHH], or Indian hedgehog [IHH]) binding to the shared

15 receptor PTCH1, the inhibitory effect on SMO is relieved, enabling SMO ciliary

16 accumulation and activation (5,6). Consequently, GLI2 translocates in activated full-length

17 form from the cilium to the nucleus (7), where it induces orchestrated expression of target

18 genes, including GLI1 and PTCH1.

19 Constitutive HH signaling contributes to tumorigenesis mainly through two types of

20 mechanisms. First, ligand-independent hyperactive pathway activity within the tumor cell

21 drives tumorigenesis in basal cell carcinoma (BCC), the most common cancer in Caucasian

22 population (8), medulloblastoma (MB), the most common childhood brain cancer (9), and

23 rhabdomyosarcoma (RMS) (10). Almost all BCC is initiated by ligand-independent HH

24 activity, most commonly through PTCH1 loss-of-function or SMO gain-of-function mutations

25 (11,12). Similarly, hyperactive HH signaling has emerged as the driver in approximately 30%

26 of MB through ligand-independent mechanisms including inactivating mutations in PTCH1

27 and SUFU, and genomic amplification of GLI2 (13-15). Second, HH pathway activation in

28 surrounding stromal cells has been found to support the growth of tumor cells in a paracrine

29 manner, whereby stromal cells receive HH ligand from tumor cells and secret stimulatory

Page 3 of 29

1 factor in response for tumor progression (16). Such mechanism was documented in a broad

2 range of malignancies, most notably those in blood, pancreas, lung, stomach, colon, and

3 prostate (3). Clinical implications of the paracrine mechanism of action are yet to be clarified

4 as most clinical trials using HH pathway antagonists to treat these cancers did not meet a

5 positive conclusion (4). However, glasdegib was recently approved by the U.S. Food and

6 Drug Administration (FDA) for acute myeloid leukemia (AML), thus highlighting potential

7 expanded use of HH targeted cancer therapy beyond BCC and MB (17).

8 Cyclopamine, a natural compound found in wild corn lily (Veratrum californicum), was

9 identified as the first HH pathway inhibitor directly targeting SMO (18). Since then, many

10 more SMO inhibitors have been developed and several of them, including vismodegib,

11 sonidegib, glasdegib, LY2940680, and BMS-833923, have delivered promising results in

12 preclinical and clinical studies in HH-dependent cancers (3). Both vismodegib and sonidegib

13 have been approved by the U.S. FDA for treatment of advanced BCC (19,20). However,

14 acquired resistance to vismodegib and sonidegib limits their long-term efficacy. Drug

15 resistance can be acquired by genetic aberrations of multiple pathway components including

16 SMO mutations, SUFU mutations, and GLI2 amplifications (21-24). Notably, intra-tumor

17 heterogeneity of those drug refractory mechanisms was identified, further complicating the

18 situation that next generation cancer therapy needs to tackle (21). In addition, current

19 anti-SMO therapies failed to target primary tumors harboring mutations downstream of SMO

20 level (25).

21 The emergence of multiple drug resistance mechanisms associated with current SMO

22 antagonists and lack of therapies targeting HH pathway downstream of SMO level has

23 prompted our investigations into alternative approaches. From a perspective of pathway

24 epistasis, we reasoned that targeting hyperactive GLI2, the central transcription activator of

25 the pathway, would potentially deliver more effective therapeutic interventions that may

26 pan-inhibit various drug refractory mechanisms. Herein, we reported the discovery of a

27 number of prostaglandins in a high content screening for small molecules inhibiting GLI2

28 ciliary accumulation. We demonstrated that prostaglandin E1 (PGE1), an approved drug as a

29 representative among the class, delivered cross-inhibitory activities against drug refractory

30 SMO-mutants and overexpressing GLI2. Mechanistic investigations revealed that PGE1 acts Page 4 of 29

1 through E-prostanoid receptor 4 (EP4), which localizes to the PC, to elevate cAMP-PKA

2 signaling, thus leading to phosphorylation and subsequent ubiquitination primed degradation

3 of GLI2. Furthermore, PGE1 effectively inhibits drug refractory tumor growth of

4 GLI2-overexpressing MB xenografts. In summary, our study identified prostaglandins as

5 potential source of drug repurposing opportunities, which are capable of overcoming multiple

6 drug resistance mechanisms associated with current generation SMO inhibitors and targeting

7 MB with broader molecular spectrum. In addition, the findings provide novel mechanistic

8 insights furthering understanding of HH pathway modulation.

9 Materials and Methods

10 Cell lines

11 NIH/3T3, HEK293T, Cos7, DAOY, MCF-7 cells were obtained from ATCC. NIH/3T3 cells

12 were cultured in DMEM supplemented with 10% (v/v) calf serum. HEK293T and Cos7 cells

13 were cultured in DMEM supplemented with 10% (v/v) fetal bovine serum, DAOY cells were

14 cultured in MEM supplemented with 10% (v/v) fetal bovine serum. MCF-7 cells were

15 cultured in MEM supplemented with 10% (v/v) fetal bovine serum and 0.01 mg/ml human

16 recombinant insulin. 3T3/ARL13B::tagRFPT and 3T3/ARL13B::tagRFPT/EGFP::GLI2

17 stable cell lines were generated via lentiviral infection of NIH/3T3 cells. The 3T3/GLI-luc

18 cell line was created for GLI-luciferase reporter assays via two rounds of infections using

19 lentiviral particles harboring a GLI-responsive firefly luciferase reporter and a constitutive

20 renilla luciferase expression construct respectively. Subclones overexpressing GLI2 or

21 SMO-WT or SMO-D473H or SMO-W535L in 3T3/GLI-luc cells were generated. DAOY cell

22 lines that overexpress SMO-D473H or GLI2 were also generated via lentiviral delivery.

23 Med-113FH and Med-314FH tumor cells were obtained from the brain tumor resource lab

24 (http://www.btrl.org). The passaging of Med-113FH and Med-314FH tumor cells were

25 through serial transplantation into the cerebellum of immune-compromised mice. All cell

26 lines were confirmed as Mycoplasma negative using the Mycoplasma PCR Detection Kit

27 (HD01-0105, HD BIOSCIENCES). All primary cell lines were directly obtained from a

28 public depository or from a commercial supplier and not additionally authenticated. Cellular

29 experiments were performed within 10 passages after thawing. Page 5 of 29

1 Compound reagents

2 Chemical libraries used in our screening include the Prestwick Chemical Library (Prestwick

3 Chemical), the Spectrum Collection (Microsource Discovery Systems), the Library of

4 Pharmacologically Active Compounds (LOPAC, Sigma), FDA-approved Drug Library

5 (Topscience), and customized in-house compound libraries. Cyclopamine, sulprostone,

6 butaprost were purchased from Sigma. SAG was purchased from Millipore. Vismodegib and

7 forskolin were purchased from Selleck. All prostaglandins except sulprostone and butaprost

8 were purchased from Cayman Chemical. SHH-N conditioned medium was collected as

9 previously described (26), and its control medium was collected from wild-type Cos7 cells.

10 Imaging assay

11 3T3/ARL13B::tagRFPT/EGFP::GLI2 cells were plated onto 384-well imaging plate

12 pre-coated with 0.1% gelatin (Sigma) at 1×104 cells/well in 50 μl of media. After cells reached

13 confluence (1-2 days), test compounds were added in 0.5% calf serum medium for 24 hours

14 in the presence of SHH-N, and then cells were fixed with 4% paraformaldehyde and stained

15 with Hoechst 33342 (H3570, Invitrogen) for imaging. Cells were imaged using Operetta High

16 Content Screening System (PerkinElmer) with a 40× high NA objective. The Harmony 4.1

17 software (PerkinElmer) was used for high content screening data management and image

18 quantification. The identical microscopic setting and input parameters were performed

19 throughout the imaging assay.

20 GLI-luciferase reporter assay

21 As for the wild-type NIH/3T3 cells for examining HH signaling activity, cells were plated at

22 2×104 cells/well into 96-well assay plates and transfected the next day using Fugene HD

23 (E2311, Promega) with a p8×GLIBS-firefly luciferase plasmid (27), a constitutive renilla

24 luciferase plasmid, and other DNA plasmids as indicated. After cells reached confluency in

25 about 1 day, culture was switched to 0.5% calf serum medium and incubated for 36 hours

26 with other reagents as indicated. For stable reporter cell lines, 3T3/GLI-luc or its derivatives

27 were cultured in 96-well assay plates. Upon confluence, cells were treated with reagents in

28 0.5% calf serum medium as indicated for 36 hours. Then the firefly and renilla luciferase

29 activities were read sequentially by Luminescence Counter (PerkinElmer). The renilla

30 luciferase signal was used to normalize the firefly luciferase signal. Page 6 of 29

1 CRE-luciferase reporter assay

2 HEK293T cells were seeded in 96-well assay plates and co-transfected with pGL4-CRE

3 firefly luciferase construct and a constitutive renilla luciferase construct. 24 hours after

4 transfection, cells were treated with compounds as indicated and incubated for another 36

5 hours before being processed for reading luciferase signals using Luminescence Counter

6 (PerkinElmer). The firefly luciferase signal was normalized by renilla luciferase signal.

7 GLI2 overexpression

8 The pCEFL-3×Flag-Gli2 (Gli2-WT) plasmid was generated by replacing 3× HA in plasmid

9 pCEFL-3×HA-Gli2 (37671, Addgene) with 3×Flag. Site mutations were introduced into the

10 Gli2-WT vector to generate pCEFL-3×Flag-Gli2 ΔPKA (Gli2 ΔPKA) plasmid and pCEFL-3×

11 Flag-Gli2 ΔGSK-3β (Gli2 ΔGSK-3β) plasmid, whose mutated phosphorylation sites have

12 been described as previously(28). Transfection was performed in NIH/3T3 cells using Fugene

13 HD (E2311, Promega) according to the manufacturer’s instructions. Transfected cells were

14 treated with compounds in 0.5% calf serum for 36 hours before collecting the samples for

15 examination.

16 Reverse transcription PCR (RT-PCR)

17 Total RNA was isolated from cultured cells or snap-frozen tumors using the TRIzol Reagent

18 (15596018, Thermo Fisher Scientific). Each RNA sample was treated with DNase I (AM1907,

19 Thermo Fisher Scientific) at 37°C for 30 minutes to remove any contaminating genomic DNA

20 and then used as a template for cDNA synthesis with the GoScript cDNA Synthesis Kit

21 (Promega) according to the manufacturer’s instructions. The High-Fidelity KOD-Plus-Neo

22 (KOD-401, TOYOBO) was used for PCR amplification to determine gene expression.

23 Primers for analyzing EP genes expression in mouse NIH/3T3 and human DAOY cells were

24 listed in Supplementary Table S1.

25 Quantitative real-time PCR (qRT-PCR)

26 A 1/10 dilution of cDNA was used as a template with a SYBR Green-based PCR Master Mix

27 (11201ES08, YEASEN, Shanghai, China) on a Roche@480 Real-Time PCR System. The

28 relative expression levels of mRNAs were calculated using 2 – ΔΔCt. Glyceraldehyde-3-

29 phosphate dehydrogenase (Gapdh) was used as internal reference. The primer sequences used

30 to quantify HH target genes are listed in Supplementary Table S1. Page 7 of 29

1 Western blot analysis

2 Cells were lysed in RIPA buffer (C1053, APPLYGEN, Beijing, China) supplemented with 1

3 tablet of protease and phosphatase inhibitors (A32961, Thermo Fisher Scientific) per 10 ml

4 RIPA. Equal amounts of cell lysates were separated by SDS-PAGE and then transferred to

5 polyvinylidene fluoride (PVDF) membranes. Subsequently, the membranes were blocked in 5%

6 non-fat milk or 5% BSA in TBST buffer at room temperature for 2 hours and then incubated

7 overnight at 4°C in blocking solution with the primary antibodies. After incubation overnight,

8 membranes were washed 3 times per 10 minutes in TBST buffer, then incubated in 1:5000

9 diluted horseradish peroxidase (HRP)-labeled secondary antibodies (ZSBIO, Beijing, China)

10 at room temperature for 1 hour, washed for 3 times every 15 minutes with TBST buffer, and

11 then detected with chemiluminescent reagents (32106, Thermo Fisher Scientific). As for

12 detecting phosphorylation state of CREB, the blot on PVDF membrane was first developed

13 with anti-p-CREB primary antibody (9198, Cell Signaling Technology), then the same

14 membrane was stripped and re-probed for total CREB protein with anti-CREB primary

15 antibody (9197, Cell Signaling Technology) and then with anti-β-Actin (ab8226, Abcam) as

16 an internal control. The stripping procedure was as following. The membrane was incubated

17 with western blot stripping buffer (BE6224, EASYBIO, Beijing, China) for 30 min at room

18 temperature in shaking motion and then washed 3 times per 10 minutes in TBST buffer. Other

19 primary antibodies used in our study include mouse anti-GLI1 (2643, Cell Signaling

20 Technology), Goat anti-GLI2 (AF3635, R&D), Sheep anti-GLI2 (AF3526, R&D), mouse

21 anti-EP4 (sc-55596, Santa Cruz).

22 RNA interference

23 For gene knockdown, the following shRNA plasmids: shEP4-1 (targeting sequence:

24 5’-GTACTGTTTCTGGACCCTTAT-3’) and shEP4-2 (targeting sequence: 5’-CAGTAAAG

25 CAATAGAGAAGAT-3’), scrambled shRNA (targeting sequence: 5’-AACGTGATTTATGTC

26 ACCAGA-3’) were constructed and used in transfection studies. The transfection of shRNA

27 plasmids was performed using Lipofectamine 2000 (11668019, Invitrogen) according to the

28 manufacturer’s protocol.

29 EP4 knockout via CRISPR-Cas9 approach

30 EP4 Genomic mutations were generated by CRISPR-Cas9 mediated genomic editing. Single Page 8 of 29

1 guide RNAs targeting murine EP4 genome was designed through the sgRNA design tool

2 (https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design). Genome editing

3 efficiency was examined through the Tide tool (https://tide.deskgen.com) and the selected

4 sequence is: GGCGGCGTAGGCCGTTACGT. The annealed guide RNA oligos were inserted

5 into a lentiviral plasmid digested by the BsmBI restriction enzyme. Genotyping were

6 determined by sequencing PCR products amplified by the following primers: EP4 forward:

7 TCTGTGCCATGAGCATCGAG; EP4 reverse: TCAGGACTTAGAAGGAAAAC. The PCR

8 products with double peaks were then inserted into a pEASY-Blunt Zero Cloning Vector

9 (CB501-01, TransGen Biotech, Beijing, China) and sent for Sanger sequencing to verify the

10 sequence of each allele.

11 Immunofluorescence

12 3T3/ARL13B::tagRFPT cells were plated onto coverslips in 24-well plates (20,000 cells /well)

13 and maintained in DMEM supplemented with 10% (v/v) calf serum until reaching confluency,

14 at which time the culture medium was switched to 0.5% calf serum medium for 24 hours.

15 After that, cells were fixed in 4% paraformaldehyde for 30 minutes, permeabilized in 0.3%

16 triton-X 100 for 15 minutes, blocked in 2% BSA plus 0.3% Triton-X for 1 hour and then

17 incubated overnight at 4°C with mouse monoclonal anti-EP4 antibody (sc-55596, Santa Cruz,

18 1:200 dilution). After incubation overnight, cells were washed 3 times every 10 minutes,

19 followed by the incubation with a secondary antibody, Alexa Fluor 488 goat against mouse

20 IgG (H+L) (A-11001, Thermo Fisher Scientific, 1:500 dilution), at room temperature for 1

21 hour, then washed additional 3 times every 10 minutes. Cells were finally stained with

22 Hoechst 33342 (H3570, Invitrogen) and washed, after which the coverslips were mounted and

23 samples were imaged. Images were collected using a Zeiss LSM 780 confocal microscope

24 with a 63× oil objective, and were processed with ZEN software (Zeiss).

25 Immunoprecipitation

26 For examining GLI2 ubiquitination, HEK293T cells were transiently transfected with DNA

27 constructed as indicated, and treated with or without PGE1 for 36 hours, all samples were

28 treated with 10 μM MG-132, a proteasome inhibitor, for 6 hours before collection. Cells were

29 collected and lysed in lysis buffer plus protease and phosphatase inhibitors (A32961, Thermo

30 Fisher Scientific) for 50 minutes on a rotor at 4°C. After 12,000 g centrifugation for 15 Page 9 of 29

1 minutes, the lysates were immunoprecipitated with 2 μg specific antibody overnight at 4°C,

2 and 30 μl Protein A/G PLUS-Agarose (SC-2003，Santa Cruz) were washed and then added for

3 an additional 3 hours. Thereafter, the precipitants were washed five times with lysis buffer,

4 and the samples were boiled with loading buffer for 5 minutes and analyzed by

5 immunoblotting to examine GLI2 ubiquitination. Antibodies against FLAG (F1804, Clone

6 M2, Sigma) and HA (ab9110，Abcam) were used to examine GLI2 ubiquitination.

7 For examining GLI2 phosphorylation, HEK293T cells were transiently transfected with

8 DNA constructed as indicated. 36 hours after treatment with or without PGE1, cells were

9 collected and processed for immunoprecipitation assay following the above procedures. Then

10 the samples were analyzed by immunoblotting to examine GLI2 phosphorylation, Antibodies

11 against FLAG (F1804, Clone M2, Sigma) and phospho-(Ser/Thr) PKA substrate (9621, Cell

12 Signaling Technology) were used to examine GLI2 phosphorylation.

13 Cell viability assays

14 Cells were plated at 3,000 cells per well in 96-well plates and treated with drugs as indicated

15 for 72 hours. The CCK-8 reagent (B34302, Biomake) was directly added into the plate at

16 10μl/well and incubated at 37°C for 4 hours. Cell viability was assessed using a PerkinElmer

17 plate reader.

18 Patient-derived orthotopic xenograft experiments

19 The patient-derived orthotopic xenograft experiments were approved by the Institutional

20 Animal Care and Use Committee of Institute of Zoology, Chinese Academy of Sciences, and

21 conducted according to institutional guidelines. The surgery of orthotopic xenograft

22 experiments was carried out in 6-7-week-old NOD-PrkdcscidIL2rgtm1/Bcgen mice

23 (BIOCYTOGEN, Beijing, China) following anesthetized by i.p. injection of 400 mg/kg

24 2,2,2-Tribromoethanol (T1420, TCI). The head of mouse was properly placed in a stereotaxic

25 apparatus in a sterile environment and then a small incision was made starting between the

26 ears and ending near the back of the skull using a sterile scalpel. Then, a 0.8 mm diameter

27 burr hole is placed in the calvarium using a hand held microdrill (78001, RWD Life Science,

28 Shenzhen, China) with a 0.8 mm burr (78042, RWD Life Science, Shenzhen, China) using the

29 following coordinates: 2 mm posterior to the lambdoid suture, 2 mm lateral to the midline,

30 and 2.5 mm ventral from the surface of the skull. 3×105 Med-113FH cells or Med-314FH cells Page 10 of 29

1 in a volume of 3 µl were stereotaxically injected into the cerebellum using a 33G needle

2 mounted at a Hamilton syringe (7634-01, Hamilton) at an infusion rate of 1 µl/min. After

3 injection, the needle was kept in place for about 5 min to equilibrate the pressure within the

4 cranial vault. The incision was closed with two to three interrupted sterile sutures (CR434,

5 Jinhuan Medical, Shanghai, China). Mice were randomized into different groups (n=5 in each

6 group) according to the proper luminescence signal. For drug treatment in vivo, vismodegib

7 was used at 30 mg/kg for oral administration once a day, PGE1 was used at 15 mg/kg for i.p.

8 administration once a day. Tumor growth was monitored weekly by bioluminescence

9 acquisitions using the IVIS Spectrum Imaging System (PerkinElmer). Survival data were

10 collected throughout these orthotopic xenograft experiments.

11 Flank xenograft experiments

12 The flank xenograft experiments were approved by the Institutional Animal Care and Use

13 Committee of Institute of Zoology, Chinese Academy of Sciences, and conducted in

14 compliance with institutional guidelines. In brief, 5×106 GLI2-overexpressed DAOY cells in a

15 total volume of 100 µl of 1:1 mixture of PBS:Matrigel were injected subcutaneously at the

16 flank of each 6-7-week-old NOD-PrkdcscidIl2rgtm1/Vst mice (VITALSTAR, Beijing, China).

17 When tumors were grown to a median size of 100 mm3, mice were randomized into three

18 groups (n=8 in each group) and treated with solvent only, vismodegib (30 mg/kg, daily oral

19 administration), PGE1 (15 mg/kg daily i.p.) for 51 days respectively. Tumor volume was

20 measured with calipers once every 3 days and calculated by the formula:

21 length×width×width×0.5. At the end of the treatment period, each tumor was harvested and

22 divided for qRT-PCR, H&E, and immunohistochemistry analyses.

23 H&E staining and immunohistochemistry

24 Tumor samples were freshly collected, formalin fixed and paraffin embedded. Before staining,

25 sections were rehydrated by xylene and a series of descending concentrations of ethanol, and

26 then rinsed by deionized H2O. For H&E staining, sections were incubated with

27 Hematoxylin/Eosin following standard procedures. For immunohistochemical staining,

28 sections were performed with sodium citrate buffer for heat-induced epitope retrieval, and

29 then incubated with 1:600 diluted rabbit anti-Ki67 antibody (ab15580, Abcam) at 4°C

30 overnight, washed 3 times every 10 minutes with PBS, and then detected with the anti•rabbit Page 11 of 29

1 DAB kit (PV-9001, ZSBIO, Beijing, China). Slides were rinsed by deionized H2O, dehydrated

2 by a series of ascending concentrations of ethanol and xylene, and then cover slipped. The

3 resulting slides were digitally scanned at 40× magnification on an Aperio VESA 8 system

4 (Leica Biosystems).

5 Statistical analysis

6 Data were shown as mean ± standard deviation (SD) throughout the paper. Two-way analysis

7 of variance (ANOVA) was used for comparing tumor growth curves. Log-rank (Mantel-Cox)

8 test was used for comparing survival curves. For other comparisons, two-tailed Student’s t

9 tests were used to generate p values and a p value less than 0.05 was considered statistically

10 significant. Plots and statistical tests were performed by GraphPad Prism software. Asterisks

11 (*) always represent degree of significance as follows. * p< 0.05; ** p< 0.01; *** p< 0.001;

12 NS, not significant. 13

Page 12 of 29

1 Results

2 A High Content Screening Identifies Prostaglandin Compounds as GLI2 Antagonists

3 The essential role of GLI2 ciliary accumulation in HH pathway activation presents a novel

4 opportunity for high content drug discovery targeting GLI2. We thus developed a high content

5 screening method for small molecules that inhibit GLI2 translocation to the cilia. To facilitate

6 identification of the PC, we first introduced a construct of ADP ribosylation factor like

7 GTPase 13B (ARL13B) tagged with red fluorescent tagRFPT into HH-responsive NIH/3T3

8 cells. ARL13B is a GTPase required for ciliogenesis (29). Subclones of this cell line were

9 created by introducing EGFP::GLI2 expression lentivirus particles. Mouse GLI2 was used in

10 the EGFP fusion construct. A clone with low EGFP::GLI2 expression, designated

11 3T3/ARL13B::tagRFPT/EGFP::GLI2 cell line, was selected for further study. In this cell line,

12 EGFP::GLI2 mirrored previously reported endogenous GLI2 ciliary trafficking behaviors

13 (30,31). EGFP accumulation in the PC was observed upon treatment with SHH-N, the SHH

14 N-terminal signal peptide, or SAG, a small molecule SMO agonist. And its SHH-N induced

15 ciliary accumulation was attenuated by vismodegib or cyclopamine (Supplementary Fig. S1A

16 and S1B). Moreover, GLI-dependent transcriptional activity responds to these treatments as

17 expected for both 3T3/ARL13B::tagRFPT/EGFP::GLI2 cell line and its parental

18 3T3/ARL13B::tagRFPT cell line (Supplementary Fig. S1C). These data indicate that

19 EGFP::GLI2 is a bone fide reporter of GLI2 ciliary localization well-suited to high content

20 screening. To probe the transcriptional output of the HH pathway activity, we next generated

21 another NIH/3T3 reporter stable cell line designated as 3T3/GLI-luc, in which firefly

22 luciferase is driven by GLI-dependent transcriptional activity through 8 tandem repeats of

23 GLI binding sites (GLIBS) (32), and a constitutive renilla luciferase reporter serves as an

24 internal control (Supplementary Fig. S1D-S1F). We overexpressed mouse GLI2 in this

25 3T3/GLI-luc cell line (named 3T3/GLI-luc/GLI2) via delivery of lentiviral particles

26 containing a CMV-driven mouse GLI2 expression construct (Supplementary Fig. S1G).

27 Exogenous GLI2, which can be readily detected by western blot, elicited robust luciferase

28 reporter activity in comparison with the parental cell (Supplementary Fig. S1H and S1I).

29 Using the 3T3/ARL13B::tagRFPT/EGFP::GLI2 cell line, we conducted a high content Page 13 of 29

1 screening for small molecule inhibitors of SHH-N induced ciliary accumulation of

2 EGFP::GLI2 (Supplementary Fig. S2A). Compound libraries screened herein include

3 FDA-approved drugs, candidates being studied in clinical trials and compounds with

4 annotated biological functions. Through this screen, we identified several hits that include

5 known HH pathway inhibitors, thus validating the assay (Supplementary Fig. S2B). Amongst

6 the hits were 6 prostaglandins, including prostaglandin A1 (PGA1), prostaglandin D1 alcohol

7 (PGD1 alcohol), 5-trans prostaglandin D2 (5-trans PGD2), prostaglandin E1 (PGE1),

8 prostaglandin J2 (PGJ2), 15-deoxy-Δ12,14-prostaglandin J2 (15-deoxy-Δ12,14-PGJ2) (Fig.

9 1A-1C).

10 In agreement of GLI2 amplification as a drug refractory mechanism for vismodegib, no

11 inhibitory effect against GLI2 induced luciferase activity was observed for vismodegib at

12 concentration up to 10 μM, way higher than its saturated dose against wild-type activity (Fig.

13 1D and Supplementary Fig. S1F). In contrast, all 6 prostaglandins identified in the primary

14 high content screening and additional 16 prostaglandin analogs inhibit GLI2 induced pathway

15 activity in the GLI-luciferase assay (Fig. 1D, Supplementary Fig. S3A-S3P). Among these

16 prostaglandins, PGE1, also known as alprostadil, is an FDA-approved drug commonly used

17 for the treatment of pulmonary hypertension, erectile dysfunction, and peripheral artery

18 occlusive disease (33,34). Therefore, we used PGE1 as a representative of these

19 prostaglandins in further investigations. We confirmed that PGE1 effectively inhibits

20 expression of GLI2 target genes, including Gli1 and Ptch1, whereas vismodegib and

21 cyclopamine showed no inhibitory effect (Fig. 1E).

22 PGE1 Inhibits Drug-Resistant SMO Mutants

23 Given that PGE1 overcomes drug resistance introduced at the GLI level, we suspect, from an

24 epistasis standpoint, it would also overcome other major drug refractory mechanisms

25 introduced by SMO point mutations and show activity with a broader spectrum. Therefore,

26 we examined HH pathway activity mediated by two drug refractory SMO mutants,

27 SMO-D473H and SMO-W535L (also known as SMO-A1 or SMO-M2) (8,23), which were

28 identified in patients who experienced devastating cancer relapses during vismodegib

29 treatments (21,24). In agreement with this expectation, PGE1 effectively suppressed both

Page 14 of 29

1 vismodegib-resistant mutants in luciferase reporter assays of HH pathway activity (Fig. 2A

2 and 2B), and while examining endogenous Gli1 and Ptch1 mRNA expression levels (Fig.

3 2C-2E), and endogenous GLI1 protein levels (Fig. 2F). All 6 prostaglandins identified from

4 the primary high content screening inhibited SMO mutants with equivalent potency to

5 wild-type SMO (SMO-WT) (Fig. 2B and Supplementary Fig. S4A-S4E). Consistently, no

6 IC50 shift was observed for PGE1 when escalating concentrations of SAG, a potent HH

7 pathway agonist by binding and activating SMO protein (35), were applied, in contrast to

8 results obtained for vismodegib (Fig. 2G and 2H). In addition to pathway activity introduced

9 by SAG, that introduced at a further upstream level by SHH-N, can also be inhibited by PGE1,

10 probed by various measurements (Supplementary Fig. S5A-S5C). Taking these data together,

11 PGE1 showed pan-inhibition for multiple drug-resistant causes of SMO targeted cancer

12 therapy, including GLI2 overexpression and SMO mutations, and PGE1 likely functions at a

13 downstream level from SMO.

14 PGE1 Antagonizes GLI2 via a cAMP-PKA-Ubiquitin Regulatory Cascade

15 We next explored potential mechanisms underlying PGE1 inhibition against GLI2. Previous

16 reports suggest that PGE1 might function through activation of cyclic adenosine

17 monophosphate (cAMP) signaling (36,37). To this end, we employed a luciferase reporter

18 controlled by cAMP responsive element (CRE). PGE1 indeed activated CRE-luciferase

19 reporter in a dose dependent manner (Fig. 3A), similar to a known cAMP agonist Forskolin

20 (FSK) (Supplementary Fig. S6A) (38). To test whether PGE1 inhibition of GLI2 works

21 through a cAMP-PKA dependent mechanism, we generated a GLI2 mutant where PKA

22 phosphorylation sites were altered (GLI2 ∆PKA), along with another GLI2 variant for

23 comparison, where phosphorylation sites of GSK-3β were mutated (GLI2 ∆GSK-3β) (Fig. 3B)

24 (28). In the GLI-luciferase assay, we found that PGE1 and FSK failed to inhibit GLI2 ∆PKA

25 induced HH pathway activation, while wild-type GLI2 and GLI2 ∆GSK-3β remain unaffected

26 (Fig. 3C), suggesting PGE1's GLI2 regulation specifically dependent on PKA mediated

27 phosphorylation.

28 To further study whether PGE1 regulation of GLI2 is mediated by PKA, we took advantage

29 of PKI, an inhibitor peptide of PKA (39). We also generated a PKI mutant control, mutating

Page 15 of 29

1 essential arginines at 20 and 21 positions (40). As expected, administration of PKI, but not its

2 mutant form, significantly decreased CRE-luciferase signals stimulated by either PGE1 or

3 FSK (Supplementary Fig. S6B). In support of PGE1 functioning through PKA mediated GLI2

4 regulation, PKI rescued the PGE1 inhibitory effect on GLI2 induced HH pathway activity

5 (Fig. 3D) and GLI2 protein levels (Fig. 3E). Furthermore, using a polyclonal antibody

6 developed against phosphorylated substrates of PKA, we observed that PGE1 treatment

7 results in GLI2 phosphorylation, and such phosphorylation was abrogated by PKI (Fig. 3F).

8 Together with GLI2 mutagenesis analyses (Fig. 3B and 3C), these results demonstrate PGE1

9 inhibits GLI2 activity by modulating PKA mediated phosphorylation of GLI2.

10 The decreased GLI2 protein levels on introduction of PGE1 (Fig. 3E) prompted us to

11 further examine the potential effect of PGE1 on GLI2 ubiquitination. Previous studies suggest

12 that GLI2 protein stability may be regulated by a sequence of events from multisite

13 phosphorylation, ubiquitination, and consequent degradation by the proteasome (41,42). To

14 this end, we transfected Flag-Gli2 construct into HEK293T cells with HA-ubiquitin construct

15 in the presence or absence of PGE1. Strikingly, PGE1 treatment increased the ubiquitination

16 of GLI2 in comparison with a vehicle control. Treatment with PKI, not its mutant, reversed

17 this effect (Fig. 3G). These data support a working mechanism of PGE1 regulation of GLI2

18 mediated by a cascade of events, including activation of PKA, followed by GLI2

19 phosphorylation, ubiquitination, and subsequent degradation.

20 PGE1 Initiates GLI2 Regulation Through the EP4 Receptor

21 Having identified the cAMP-PKA-Ubiquitination regulatory cascade of PGE1 on GLI2

22 activity, it is tempting to ask that through which receptor(s) does the drug triggers such effect.

23 There are four E-prostanoid receptors for PGE1, designated EP1, EP2, EP3, and EP4

24 receptors (43). To determine which EP subtype(s) transduces the PGE1 signal, we first

25 examined their expression and found that only EP1 and EP4 were detected in the NIH/3T3

26 cells, the HH-responsive cells used in primary screening and secondary studies above, thus

27 excluding EP2 and EP3 as the functional receptor for PGE1 action in this scenario (Fig. 4A).

28 Next, we took advantage of the selective EP agonists, including sulprostone (agonist of EP1

29 and EP3) (44), butaprost (EP2 receptor specific agonist) (45), and rivenprost (EP4 receptor

Page 16 of 29

1 specific agonist) (46). In GLI-luciferase assays, qRT-PCR analyses of endogenous Gli1 and

2 Ptch1, and western blot examination of GLI1 protein level, rivenprost elicited a similar effect

3 on HH signaling compared with PGE1, while neither sulprostone nor butaprost was active,

4 indicating EP4 receptor mediated PGE1's effect on HH signaling (Fig. 4B-4D).

5 We next further addressed the question of whether EP4 mediates the PGE1-induced HH

6 pathway inhibition by knocking out EP4 using the CRISPR-Cas9 approach (Supplementary

7 Fig. S7A and S7B). In strong contrast with wild-type cells, treatment of PGE1 in EP4

8 knockout monoclonal cell lines failed to inhibit HH pathway activation by SHH-N, probed by

9 mRNA level of Gli1 and Ptch1 and protein level of GLI1 (Fig. 4E and 4F). Consistently,

10 PGE1 also failed to inhibit SAG-induced HH pathway activities in EP4 knockout cells

11 (Supplementary Fig. S7C and S7D). These findings directed us to examine the subcellular

12 localization of EP4 in the NIH/3T3 cells. Immunofluorescence imaging analysis showed that

13 EP4 co-localized with the PC marker ARL13B, in agreement with its role in PGE1 regulation

14 of HH pathway (Fig. 4G). Taken together, we concluded that PGE1 initiates the

15 cAMP-PKA-Ubiquitination regulatory cascade of GLI2 through acting on EP4 receptor,

16 possibly on the PC (Fig. 4H).

17 PGE1 Inhibits Growth of Drug Refractory Human MB Xenografts

18 Having gained molecular insights of PGE1 regulation of GLI2 activity, we next explored its

19 potential application in treating refractory tumors associated with current SMO targeted

20 cancer therapies. Previous cancer studies in the field have utilized tumor allografts derived

21 from genetically modified mice, which were also limited in just examining drug refractory

22 SMO mutants (47,48). To minimize inter-species variation, we first used DAOY cell line, a

23 human SHH subtype MB cell line with known PTCH1 mutations (49,50). It has been widely

24 used as a SHH subtype MB model for HH signaling studies (49-53). EP1, EP2, and EP4

25 receptors were detected through RT-PCR in DAOY cells (Supplementary Fig. S8A). Among

26 the selective EP agonists, only rivenprost elicited inhibitory activity similar with PGE1

27 against the HH pathway activity in DAOY (Supplementary Fig. S8B), consistent with our

28 observations in mouse NIH/3T3 cells (Fig. 4B-4D). We thus concluded that PGE1 also acts

29 on EP4 in DAOY cells. To model drug resistance arising from both SMO and GLI2

Page 17 of 29

1 abnormalities, we generated DAOY sublines in which human SMO-D473H and human GLI2

2 was stably overexpressed respectively. Cell viability and expression of pathway target genes

3 (GLI1 and PTCH1) in wild-type DAOY cells, SMO-D473H-overexpressed DAOY cells and

4 GLI2-overexpressed DAOY cells significantly decreased upon PGE1 treatments, whereas

5 SMO-D473H-overexpressed DAOY cells and GLI2-overexpressed DAOY cells showed

6 expected resistance to both vismodegib and cyclopamine (Fig. 5A-5F). To determine whether

7 PGE1 acts on HH signaling via PKA activation in DAOY cells, we overexpressed GLI2

8 ∆PKA and found that PGE1’s effect on cellular viability was absent (Supplementary Fig.

9 S8C). In addition, PGE1’s inhibitory activity against HH pathway was no longer observed

10 upon knockdown of EP4, reinforcing the role of EP4 for PGE1 (Supplementary Fig. S8D).

11 These results demonstrated PGE1's effect against tumor cell growth in vitro and the

12 underlining HH pathway activity.

13 We next focused on GLI2-overexpressed DAOY cells in tumor xenograft studies in vivo,

14 which also gained a growth advantage over wild-type DAOY cells (Supplementary Fig. S8E).

15 Administrations with 15 mg/kg PGE1 on a daily basis led to significant tumor growth

16 inhibition (Fig. 6A and 6B). On the contrary, saturated treatments with 30 mg/kg vismodegib

17 on a daily basis conferred no inhibition of tumor growth (Fig. 6A and 6B). Of note, previous

18 studies showed a daily treatment regime with 25 mg/kg vismodegib delivered complete

19 blockade against the growth of Ptch1+/- murine tumor allografts (54). In agreement with a

20 PGE1 inhibitory action on GLI2, PGE1 attenuated GLI1 and PTCH1 expression in the tumors

21 (Fig. 6C). Hematoxylin and Eosin (H&E) staining revealed that PGE1-treated tumors showed

22 evidence of necrosis as seen by destruction of organized nests of basophilic tumor cells and

23 pyknosis (black arrowhead), whereas vehicle or vismodegib-treated tumors showed nests of

24 well-organized tumor cells (red arrowhead) (Fig. 6D). Consistent with tumor growth

25 inhibition delivered by PGE1, Ki67 positive proliferating cells markedly decreased in

26 comparison with vehicle and vismodegib controls (Fig. 6E and 6F).

27 Two caveats can be found in the above DAOY based studies: one is that the cell line might

28 lose its accuracy in modeling the original tumor after prolonged passaging and in vitro

29 culturing; the other is that xenografting to the flank did not accurately reflect real tumor

30 environment of MB-the cerebellum. Therefore, we further tested the effect of PGE1 using two Page 18 of 29

1 patient-derived orthotopic xenograft models, Med-113FH and Med-314FH, harboring PTCH1

2 mutation and GLI2 amplification respectively (55). Both of them express EP4

3 (Supplementary Fig. S9A). Med-113FH cells stably expressing a firefly luciferase reporter

4 were transplanted into the cerebellum of immune-compromised mice and tumors were

5 measured with IVIS imaging system. We treated the orthotopic allografts of Med-113FH with

6 vehicle control or 15 mg/kg PGE1, and observed a significant decrease in orthotopic tumor

7 growth in PGE1-treated mice, as well as an increase in overall survival in PGE1-treated mice

8 (Fig. 7A-7C). As expected, PGE1 treatment resulted in significant reduction of the expression

9 of endogenous GLI1 and PTCH1 mRNAs (Supplementary Fig. S9B). Meanwhile, we

10 observed a decreased protein level of GLI2 and an elevated protein expression of p-CREB in

11 Med-113FH orthotopic allografts treated with PGE1, supporting a consistent mechanism of

12 action in Med-113FH tumors (Supplementary Fig. S9C). In a similar approach, orthotopic

13 cerebellum tumors implanted with a firefly luciferase-labeled subline of Med-314FH were

14 treated with vehicle control or 30 mg/kg vismodegib or 15 mg/kg PGE1. We observed marked

15 reduction in the growth of Med-314FH orthotopic allografts in response to PGE1 but not

16 vismodegib, together with an improved overall survival for Med-314FH orthotopic allografts

17 treated with PGE1 but not vismodegib (Fig. 7D-7F). Consistently, in Med-314FH orthotopic

18 allografts, we observed downregulation of endogenous GLI1 and PTCH1 mRNA expression,

19 decreased GLI2 protein expression and increased p-CREB protein expression after PGE1

20 treatment (Supplementary Fig. S9D and S9E).

21 It has been reported that PGE1 can efficiently cross the blood-brain barrier (BBB) in

22 multiple mammals (56-58). And administration of PGE1 in newborns resulted in neurological

23 and electroencephalographic changes, indicating distribution in the brain (59). Therefore,

24 BBB might not be an obstacle for repurposing PGE1 to treat MB, a brain disease. In addition,

25 it was reported that PGE1 is metabolized at a high speed in patients (60,61). Therefore, we

26 also examined its two main metabolites in human, 13,14-dihydro-PGE1 and

27 15-keto-13,14-dihydro-PGE1 (62). Both of them inhibit GLI2 activity, the former displaying

28 a comparable potency to PGE1, while the latter is less active (Supplementary Fig. S10A and

29 S10B), thus suggesting that its fast metabolism unlikely limits its activity against GLI2 driven

30 drug refractory human tumor growth. Page 19 of 29

1 To further explore whether additional drug repurposing opportunities exist, lastly we

2 examined 4 FDA-approved prostaglandins (misoprostol, latanoprost, tafluprost and travoprost)

3 and 1 prostaglandin having undergone clinical trials (rivenprost) (Supplementary Fig. S11A).

4 Among them, misoprostol and rivenprost showed similar potency with PGE1 in antagonizing

5 GLI2 activity, while the other three, including latanoprost, tafluprost and travoprost, had no

6 inhibitory effect (Supplementary Fig. S11A). This observation implied that additional

7 opportunities other than PGE1 potentially exist for drug repurposing. Taken together, these

8 results support that PGE1, as a representative of many prostaglandins identified in this study,

9 would provide potential opportunities for further therapeutic translation targeting tumors

10 refractory to current generation SMO antagonists.

11 Discussion

12 Drug resistance is a major and devastating challenge associated with targeted cancer therapies.

13 Those targeting HH pathway is no exception. Superior to the strategy targeting drug

14 refractory SMO mutants, an alternative to target downstream GLI2 amplification, as

15 demonstrated in the current study, show effects of a broader molecular spectrum and

16 pan-inhibition against multiple drug refractory mechanisms, including SMO mutagenesis.

17 Using PGE1 as a representative of prostaglandins identified from our screen, a novel

18 mechanism of GLI2 regulation triggered by its action on EP4 receptor was discovered (Fig. 4).

19 More importantly, using human MB xenograft models that displayed resistance to vismodegib,

20 PGE1 demonstrated significant inhibition against tumor growth (Fig. 6A and 6B, Fig. 7D-7F),

21 thus highlighting potential opportunities for future clinical translation.

22 We demonstrated PGE1 acts through EP4 to inhibit the HH signaling. Intriguingly, we

23 observed EP4 localization to the PC, the central cellular organelle for HH signaling

24 transduction (Fig. 4G). A hypothetical model was proposed where PGE1 binds to EP4

25 receptor on the cilium, thereby activating cAMP-PKA signaling to promote GLI2

26 phosphorylation and subsequent degradation in an ubiquitin-proteasome-dependent manner

27 (Fig. 4H). In support of the model, we found that GLI2 ∆PKA was resistant to PGE1

28 treatment and PKI rescued PGE1’s effect on GLI2 stability and transcriptional activity (Fig.

29 3C-3E). Page 20 of 29

1 Current study used PGE1 as a representative for mechanistic investigations. Nonetheless,

2 several prostaglandins showed similar pan-inhibition against pathway activation at multiple

3 levels, including that associated with drug refractory mechanisms (Fig. 1D, Fig. 2B, and

4 Supplementary Fig. S4A-S4E). It was reported that although functioning through distinct

5 receptors, intracellular signaling transduction stimulated by these prostaglandins converge

6 into cAMP elevation (63). In contrast, latanoprost, tafluprost and travoprost, which are known

7 to enhance cellular Ca2+ levels through FP receptor (63), but has no effect on cAMP level, are

8 inactive in inhibition of GLI2 activity (Supplementary Fig. S11A). We observed that FP

9 receptor is expressed in the NIH/3T3 cells used in this experiment (Supplementary Fig. S11B),

10 thus ruling out the possibility that lack of inhibition against GLI2 activity is due to lack of FP

11 receptor expression.

12 The concentrations of PGE1 required for full inhibition of HH pathway activity in our

13 cell-based assays (5-10 µM, Fig. 2B, 2H, and Supplementary Fig. S5A) are comparable to

14 clinically relevant level at 10 µM reported for human cardiac regeneration (64), implying that

15 dosing unlikely being a limiting factor for further clinical translation. It is also worth pointing

16 out that PGE1 is not the only FDA approved drug among active prostaglandins identified in

17 the current study (Supplementary Fig. S11A). Therefore, we provided a rich source of

18 potential opportunities for medicinal chemistry optimization, if necessary before entering

19 clinical trials, and drug repurposing, taking advantages of their well-characterized

20 pharmacokinetics and safety profiles. 21

Page 21 of 29

1 Acknowledgements

2 We highly appreciate Dr. Andrew P. McMahon (University of South California, Los Angeles,

3 USA) for reading and discussion of this paper. We are grateful to Dr. Yongbin Chen

4 (Kunming institute of zoology, Chinese Academy of Sciences, Kunming, China) for sharing

5 p8×GLIBS-firefly luciferase plasmid. We thank the Brain Tumor Resource Lab at Fred

6 Hutchinson Cancer Research Center offering Med-113FH and Med-314FH human SHH-MB

7 lines. We thank Dr. Changmei Liu (Institute of zoology, Chinese Academy of Sciences,

8 Beijing, China) for the gift of mouse ovary samples. We also thank Dr. Wei Li (Institute of

9 zoology, Chinese Academy of Sciences, Beijing, China) for assisting with protein

10 ubiquitination techniques. We would like to thank colleagues in our lab for helpful

11 discussions and our colleagues from the Zhongguacun Park Campus of the Institute of

12 Zoology at the Chinese Academy of Sciences for sharing instruments, technical assistance,

13 and helpful discussions. This study was supported by the National Natural Science

14 Foundation of China (No. 91957121, 31571514 to Y. Wang), Beijing Municipal Natural

15 Science Foundation (No. Z190013 to Y. Wang), Capital’s Funds for Health Improvement and

16 Research (No. CFH 2018-2-2042 to T. Jiang), the Hundred Talents Program of Chinese

17 Academy of Sciences, and State Key Laboratory of Stem Cell and Reproductive Biology (to Y.

18 Wang). A patent covering the novel findings of prostaglandins and analogs modulating HH

19 pathway, GLI2 activity, and tumor growth, has been filed.

Page 22 of 29

1 References

2 1. McMahon AP, Ingham PW, Tabin CJ. Developmental roles and clinical significance of 3 hedgehog signaling. Curr Top Dev Biol 2003;53:1-114. 4 2. Roberts KJ, Kershner AM, Beachy PA. The Stromal Niche for Epithelial Stem Cells: A Template 5 for Regeneration and a Brake on Malignancy. Cancer Cell 2017;32:404-10. 6 3. Wu F, Zhang Y, Sun B, McMahon AP, Wang Y. Hedgehog Signaling: From Basic Biology to 7 Cancer Therapy. Cell Chem Biol 2017;24:252-80. 8 4. Amakye D, Jagani Z, Dorsch M. Unraveling the therapeutic potential of the Hedgehog 9 pathway in cancer. Nat Med 2013;19:1410-22. 10 5. Corbit KC, Aanstad P, Singla V, Norman AR, Stainier DY, Reiter JF. Vertebrate Smoothened 11 functions at the primary cilium. Nature 2005;437:1018-21. 12 6. Rohatgi R, Milenkovic L, Scott MP. Patched1 regulates hedgehog signaling at the primary 13 cilium. Science 2007;317:372-6. 14 7. Kim J, Kato M, Beachy PA. Gli2 trafficking links Hedgehog-dependent activation of 15 Smoothened in the primary cilium to transcriptional activation in the nucleus. Proc Natl Acad 16 Sci U S A 2009;106:21666-71. 17 8. Xie J, Murone M, Luoh SM, Ryan A, Gu Q, Zhang C, et al. Activating Smoothened mutations in 18 sporadic basal-cell carcinoma. Nature 1998;391:90-2. 19 9. Raffel C, Jenkins RB, Frederick L, Hebrink D, Alderete B, Fults DW, et al. Sporadic 20 medulloblastomas contain PTCH mutations. Cancer Res 1997;57:842-5. 21 10. Tostar U, Malm CJ, Meis-Kindblom JM, Kindblom LG, Toftgard R, Unden AB. Deregulation of 22 the hedgehog signalling pathway: a possible role for the PTCH and SUFU genes in human 23 rhabdomyoma and rhabdomyosarcoma development. J Pathol 2006;208:17-25. 24 11. Gailani MR, Stahle-Backdahl M, Leffell DJ, Glynn M, Zaphiropoulos PG, Pressman C, et al. The 25 role of the human homologue of Drosophila patched in sporadic basal cell carcinomas. Nat 26 Genet 1996;14:78-81. 27 12. Reifenberger J, Wolter M, Weber RG, Megahed M, Ruzicka T, Lichter P, et al. Missense 28 mutations in SMOH in sporadic basal cell carcinomas of the skin and primitive 29 neuroectodermal tumors of the central nervous system. Cancer Res 1998;58:1798-803. 30 13. Cho YJ, Tsherniak A, Tamayo P, Santagata S, Ligon A, Greulich H, et al. Integrative genomic 31 analysis of medulloblastoma identifies a molecular subgroup that drives poor clinical 32 outcome. J Clin Oncol 2011;29:1424-30. 33 14. Northcott PA, Shih DJ, Peacock J, Garzia L, Morrissy AS, Zichner T, et al. Subgroup-specific 34 structural variation across 1,000 medulloblastoma genomes. Nature 2012;488:49-56. 35 15. Buczkowicz P, Ma J, Hawkins C. GLI2 is a potential therapeutic target in pediatric 36 medulloblastoma. J Neuropathol Exp Neurol 2011;70:430-7. 37 16. Yauch RL, Gould SE, Scales SJ, Tang T, Tian H, Ahn CP, et al. A paracrine requirement for 38 hedgehog signalling in cancer. Nature 2008;455:406-10. 39 17. Hoy SM. Glasdegib: First Global Approval. Drugs 2019;79:207-13. 40 18. Chen JK, Taipale J, Cooper MK, Beachy PA. Inhibition of Hedgehog signaling by direct binding 41 of cyclopamine to Smoothened. Genes Dev 2002;16:2743-8. 42 19. Dlugosz A, Agrawal S, Kirkpatrick P. Vismodegib. Nat Rev Drug Discov 2012;11:437-8. 43 20. Burness CB. Sonidegib: First Global Approval. Drugs 2015;75:1559-66.

Page 23 of 29

1 21. Sharpe HJ, Pau G, Dijkgraaf GJ, Basset-Seguin N, Modrusan Z, Januario T, et al. Genomic 2 analysis of smoothened inhibitor resistance in basal cell carcinoma. Cancer Cell 3 2015;27:327-41. 4 22. Buonamici S, Williams J, Morrissey M, Wang A, Guo R, Vattay A, et al. Interfering with 5 resistance to smoothened antagonists by inhibition of the PI3K pathway in medulloblastoma. 6 Sci Transl Med 2010;2:51ra70. 7 23. Yauch RL, Dijkgraaf GJP, Alicke B, Januario T, Ahn CP, Holcomb T, et al. Smoothened Mutation 8 Confers Resistance to a Hedgehog Pathway Inhibitor in Medulloblastoma. Science 9 2009;326:572-4. 10 24. Atwood SX, Sarin KY, Whitson RJ, Li JR, Kim G, Rezaee M, et al. Smoothened variants explain 11 the majority of drug resistance in basal cell carcinoma. Cancer Cell 2015;27:342-53. 12 25. Kool M, Jones DT, Jager N, Northcott PA, Pugh TJ, Hovestadt V, et al. Genome sequencing of 13 SHH medulloblastoma predicts genotype-related response to smoothened inhibition. Cancer 14 Cell 2014;25:393-405. 15 26. Wang Y, Arvanites AC, Davidow L, Blanchard J, Lam K, Yoo JW, et al. Selective identification of 16 hedgehog pathway antagonists by direct analysis of smoothened ciliary translocation. ACS 17 Chem Biol 2012;7:1040-8. 18 27. Yang C, Chen W, Chen Y, Jiang J. Smoothened transduces Hedgehog signal by forming a 19 complex with Evc/Evc2. Cell Res 2012;22:1593-604. 20 28. Riobó NA, Lu K, Ai X, Haines GM, Emerson CP. Phosphoinositide 3-kinase and Akt are essential 21 for Sonic Hedgehog signaling. Proc Natl Acad Sci U S A 2006;103:4505-10. 22 29. Caspary T, Larkins CE, Anderson KV. The Graded Response to Sonic Hedgehog Depends on 23 Cilia Architecture. Dev Cell 2007;12:767-78. 24 30. Haycraft CJ, Banizs B, Aydin-Son Y, Zhang Q, Michaud EJ, Yoder BK. Gli2 and Gli3 localize to 25 cilia and require the intraflagellar transport protein polaris for processing and function. PLoS 26 Genet 2005;1:e53. 27 31. Kiprilov EN, Awan A, Desprat R, Velho M, Clement CA, Byskov AG, et al. Human embryonic 28 stem cells in culture possess primary cilia with hedgehog signaling machinery. J Cell Biol 29 2008;180:897-904. 30 32. Sasaki H, Hui C, Nakafuku M, Kondoh H. A binding site for Gli proteins is essential for 31 HNF-3beta floor plate enhancer activity in transgenics and can respond to Shh in vitro. 32 Development 1997;124:1313-22. 33 33. Murali S, Uretsky BF, Armitage JM, Tokarczyk TR, Betschart AR, Kormos RL, et al. Utility of 34 prostaglandin E1 in the pretransplantation evaluation of heart failure patients with significant 35 pulmonary hypertension. J Heart Lung Transplant 1992;11:716-23. 36 34. Weiss T, Fischer D, Hausmann D, Weiss C. Endothelial function in patients with peripheral 37 vascular disease: influence of prostaglandin E1. Prostaglandins Leukot Essent Fatty Acids 38 2002;67:277-81. 39 35. Chen JK, Taipale J, Young KE, Maiti T, Beachy PA. Small molecule modulation of Smoothened 40 activity. Proc Natl Acad Sci U S A 2002;99:14071-6. 41 36. McCarthy KD, de Vellis J. Alpah-adrenergic receptor modulation of beta-adrenergic, 42 adenosine and prostaglandin E1 increased adenosine 3':5'-cyclic monophosphate levels in 43 primary cultures of glia. J Cyclic Nucleotide Res 1978;4:15-26.

44 37. Maganiello V, Vaughan M. Prostaglandin E1 Effects on Adenosine 3 ′ :5 ′ -Cyclic

Page 24 of 29

1 Monophosphate Concentration and Phosphodiesterase Activity in Fibroblasts. Proc Natl Acad 2 Sci U S A 1972;69:269-73. 3 38. Insel PA, Ostrom RS. Forskolin as a tool for examining adenylyl cyclase expression, regulation, 4 and G protein signaling. Cell Mol Neurobiol 2003;23:305-14. 5 39. Knighton DR, Zheng JH, Teneyck LF, Xuong NH, Taylor SS, Sowadski JM. Structure of a Peptide 6 Inhibitor Bound to the Catalytic Subunit of Cyclic Adenosine-Monophosphate Dependent 7 Protein-Kinase. Science 1991;253:414-20. 8 40. Day RN, Walder JA, Maurer RA. A protein kinase inhibitor gene reduces both basal and 9 multihormone-stimulated prolactin gene transcription. J Biol Chem 1989;264:431-6. 10 41. Bhatia N, Thiyagarajan S, Elcheva I, Saleem M, Dlugosz A, Mukhtar H, et al. Gli2 is targeted for 11 ubiquitination and degradation by beta-TrCP ubiquitin ligase. J Biol Chem 2006;281:19320-6. 12 42. Pan Y, Wang C, Wang B. Phosphorylation of Gli2 by protein kinase A is required for Gli2 13 processing and degradation and the Sonic Hedgehog-regulated mouse development. Dev Biol 14 2009;326:177-89. 15 43. Breyer RM, Bagdassarian CK, Myers SA, Breyer MD. Prostanoid receptors: subtypes and 16 signaling. Annu Rev Pharmacol Toxicol 2001;41:661-90. 17 44. Abramovitz M, Adam M, Boie Y, Carriere M, Denis D, Godbout C, et al. The utilization of 18 recombinant prostanoid receptors to determine the affinities and selectivities of 19 prostaglandins and related analogs. Biochim Biophys Acta 2000;1483:285-93. 20 45. Gardiner PJ. Characterization of prostanoid relaxant/inhibitory receptors (psi) using a highly 21 selective agonist, TR4979. Br J Pharmacol 1986;87:45-56. 22 46. Yoshida K, Oida H, Kobayashi T, Maruyama T, Tanaka M, Katayama T, et al. Stimulation of 23 bone formation and prevention of bone loss by prostaglandin E EP4 receptor activation. Proc 24 Natl Acad Sci U S A 2002;99:4580-5. 25 47. Tang Y, Gholamin S, Schubert S, Willardson MI, Lee A, Bandopadhayay P, et al. Epigenetic 26 targeting of Hedgehog pathway transcriptional output through BET bromodomain inhibition. 27 Nat Med 2014;20:732-40. 28 48. Kim J, Aftab BT, Tang JY, Kim D, Lee AH, Rezaee M, et al. Itraconazole and arsenic trioxide 29 inhibit Hedgehog pathway activation and tumor growth associated with acquired resistance 30 to smoothened antagonists. Cancer Cell 2013;23:23-34. 31 49. Singh J, Wen X, Scales SJ. The Orphan G Protein-coupled Receptor Gpr175 (Tpra40) Enhances 32 Hedgehog Signaling by Modulating cAMP Levels. J Biol Chem 2015;290:29663-75. 33 50. Triscott J, Lee C, Foster C, Manoranjan B, Pambid MR, Berns R, et al. Personalizing the 34 treatment of pediatric medulloblastoma: Polo-like kinase 1 as a molecular target in high-risk 35 children. Cancer Res 2013;73:6734-44. 36 51. Tiberi L, Bonnefont J, van den Ameele J, Le Bon SD, Herpoel A, Bilheu A, et al. A 37 BCL6/BCOR/SIRT1 complex triggers neurogenesis and suppresses medulloblastoma by 38 repressing Sonic Hedgehog signaling. Cancer Cell 2014;26:797-812. 39 52. Raducu M, Fung E, Serres S, Infante P, Barberis A, Fischer R, et al. SCF (Fbxl17) ubiquitylation 40 of Sufu regulates Hedgehog signaling and medulloblastoma development. EMBO J 41 2016;35:1400-16. 42 53. Götschel F, Berg D, Gruber W, Bender C, Eberl M, Friedel M, et al. Synergism between 43 Hedgehog-GLI and EGFR signaling in Hedgehog-responsive human medulloblastoma cells 44 induces downregulation of canonical Hedgehog-target genes and stabilized expression of

Page 25 of 29

1 GLI1. PLoS One 2013;8:e65403. 2 54. Wong H, Alicke B, West KA, Pacheco P, La H, Januario T, et al. 3 Pharmacokinetic-Pharmacodynamic Analysis of Vismodegib in Preclinical Models of 4 Mutational and Ligand-Dependent Hedgehog Pathway Activation. Clin Cancer Res 5 2011;17:4682-92. 6 55. Brabetz S, Leary SES, Gröbner SN, Nakamoto MW, Şeker-Cin H, Girard EJ, et al. A biobank of 7 patient-derived pediatric brain tumor models. Nat Med 2018;24:1752-61. 8 56. Taogoshi T, Nomura A, Murakami T, Nagai J, Takano M. Transport of prostaglandin E1 across 9 the blood-brain barrier in rats. J Pharm Pharmacol 2005;57:61-6. 10 57. Lin MT. Effects of brain monoamine depletions on thermoregulation in rabbits. Am J Physiol 11 1980;238:R364-71. 12 58. Holmes SW, Horton EW. The distribution of tritium-labelled prostaglandin E(1) injected in 13 amounts sufficient to produce central nervous effects in cats and chicks. Br J Pharmacol 14 1968;34:32-7. 15 59. Fariello R, Olley PM, Coceani F. Neurological and electroencephalographic changes in 16 newborns treated with prostaglandins E1 and E2. Prostaglandins 1977;13:901-7. 17 60. Cawello W, Schweer H, Dietrich B, Seyberth HW, Albrecht D, Fox A, et al. Pharmacokinetics of 18 prostaglandin E1 and its main metabolites after intracavernous injection and short-term 19 infusion of prostaglandin E1 in patients with erectile dysfunction. J Urol 1997;158:1403-7. 20 61. Cawello W, Leonhardt A, Schweer H, Seyberth HW, Bonn R, Lomeli AL. Dose proportional 21 pharmacokinetics of alprostadil (prostaglandin E1) in healthy volunteers following 22 intravenous infusion. Br J Clin Pharmacol 1995;40:273-6. 23 62. Schweer H, Meese CO, Watzer B, Seyberth HW. Determination of prostaglandin E1 and its 24 main plasma metabolites 15-keto-prostaglandin E0 and prostaglandin E0 by gas 25 chromatography/negative ion chemical ionization triple-stage quadrupole mass spectrometry. 26 Biol Mass Spectrom 1994;23:165-70. 27 63. Mohan S, Ahmad AS, Glushakov AV, Chambers C, Dore S. Putative role of prostaglandin 28 receptor in intracerebral hemorrhage. Front Neurol 2012;3:145. 29 64. Weiss TW, Mehrabi MR, Kaun C, Zorn G, Kastl SP, Speidl WS, et al. Prostaglandin E1 induces 30 vascular endothelial growth factor-1 in human adult cardiac myocytes but not in human adult 31 cardiac fibroblasts via a cAMP-dependent mechanism. J Mol Cell Cardiol 2004;36:539-46. 32 33

Page 26 of 29

1 Figure Legends

2 3 Figure 1. Identification of six prostaglandins that inhibit GLI2 accumulation in the PC 4 (A) Chemical structures of the six prostaglandin hits. 5 (B, C) Representative images (B) and quantification (C) of prostaglandin inhibition of 6 SHH-N induced GLI2 ciliary accumulation in 3T3/ARL13B::tagRFPT/EGFP::GLI2 cells. 7 Vismodegib (1 μM) was used as a positive control. Prostaglandins were used at 10 μM. Data 8 present mean and SD of four replicates. Scale bar, 20 µm. 9 (D) Dose-response inhibition of the constitutive HH pathway activity by the identified 6 10 prostaglandins and vismodegib in 3T3/GLI-luc/GLI2 cells. Measurements were performed in 11 quadruplicate. Data show mean ± SD. Please note that Ctrl% in this paper is an additional 12 normalization over the mean of DMSO (with or without other compound) treatment as 100%. 13 (E) qRT-PCR analysis of the effect of PGE1 (30 µM), vismodegib (10 µM), cyclopamine (10 14 µM) on endogenous Gli1 and Ptch1 expression in 3T3/GLI-luc/GLI2 cells. Data show mean 15 ± SD from three biological replicates. ** p< 0.01; NS, not significant; Student’s t test. 16 17 Figure 2. Examination of PGE1's effects against HH pathway activity introduced by 18 SMO-D473H, SMO-W535L, and SAG respectively 19 (A, B) Effects of escalating concentrations of vismodegib (A) and PGE1 (B) on 20 GLI-luciferase reporter activity in 3T3/GLI-luc cells overexpressing wild-type SMO (red 21 square), SMO-D473H (blue triangle), or SMO-W535L (green circle). 22 (C-E) qRT-PCR analysis of the effect of vismodegib (10 µM) and PGE1 (30 µM) on 23 endogenous Gli1 and Ptch1 expression in 3T3/GLI-luc cells overexpressing wild-type SMO 24 (C), SMO-D473H (D), or SMO-W535L (E). 25 (F) Western blot analysis of the effect of vismodegib (10 µM) and PGE1 (30 µM) on 26 endogenous GLI1 protein expression in 3T3/GLI-luc cells overexpressing wild-type SMO, 27 SMO-D473H, or SMO-W535L. β-Actin was used as a loading control. 28 (G, H) Dose-dependent inhibition of GLI-luciferase reporter activity by vismodegib (G) and 29 PGE1 (H) in 3T3/GLI-luc cells stimulated with 10 nM (blue circle), 50 nM (red square), or 30 250 nM (green triangle) SAG. Data present mean of quadruplicates ± SD. ** p< 0.01; *** p< 31 0.001; NS, not significant; Student’s t test. 32 33 Figure 3. Regulatory mechanisms underlining PGE1 inhibition of GLI2 34 (A) A CRE-luciferase reporter assay examining the effect of increasing amount of PGE1 on 35 cAMP-PKA levels. Reporter activity in the presence of PGE1 was normalized against activity 36 in the DMSO-treated control. 37 (B) Schematics of wild-type GLI2 (GLI2 WT) and its mutant forms in which mutated 38 phosphorylation sites were highlighted in red (GLI2 ΔPKA and GLI2 ΔGSK-3β). 39 (C) Examination of GLI-luciferase activity upon transfection with GLI2 expression plasmids 40 and treatments with PGE1 (50µM) or FSK (50µM) in NIH/3T3 cells. 41 (D, E) Examination of PKI rescuing effects on PGE1 inhibition of GLI2 activity by 42 GLI-luciferase reporter assay (D) and western blot analysis of GLI2 (E) in NIH/3T3 cells. 43 PKI mutant was used as a comparative control. PGE1 was used at 50 µM.

Page 27 of 29

1 (F) Immunoprecipitation assay examining phospho-GLI2 with anti-phospho-(Ser/Thr) PKA 2 substrate antibody that detect proteins containing a phospho-serine/threonine residue with 3 arginine at the -3 position in HEK293T cells transfected with indicated constructs followed by 4 PGE1 (50 µM) treatment. 5 (G) Immunoprecipitation assay examining the effect of PGE1 (50 µM) on the ubiquitination 6 status of Flag-GLI2 in HEK293T cells. Data are represented as mean ± SD of four replicates. 7 The p value shown was calculated by Student’s t test. *** p< 0.001; NS, not significant. 8 9 Figure 4. PGE1 acts through the EP4 receptor to inhibit the HH signaling pathway 10 (A) RT-PCR analysis of the expression of 4 EP receptors in NIH/3T3 cells. NIH/3T3 cells 11 cultured in serum starved medium (NIH/3T3 (-)) and 10 % calf serum media (NIH/3T3 (+))

12 were both examined. Mouse ovary cells and the distilled water (H2O) were used as positive 13 and negative controls respectively. Gapdh was used as the internal reference. 14 (B-D) Effects of selective EP agonists on the SHH-N induced pathway activity in NIH/3T3 15 cells. (B) GLI-luciferase reporter activity in NIH/3T3 cells treated with SHH-N in 16 combination with 10 µM of PGE1, sulprostone, butaprost, and rivenprost respectively. Data 17 present the mean of quadruplicates ± SD. (C) qRT-PCR analysis of mRNA levels of Gli1 and 18 Ptch1in NIH/3T3 cells treated with SHH-N in combination with 10 µM of PGE1, sulprostone, 19 butaprost, or rivenprost. Data show mean ± SD from three independent experiments. (D) 20 Western blot analysis of endogenous GLI1 protein levels in cell lysates from NIH/3T3 cells 21 treated with SHH-N in conjunction with 10 µM of PGE1, sulprostone, butaprost or rivenprost. 22 β-Actin was used as a loading control. 23 (E) qRT-PCR analysis of Gli1 and Ptch1 mRNA levels in wild-type and EP4 knockout cells 24 treated with SHH-N in combination with PGE1 (10 µM) or vehicle control. ** p< 0.01; *** 25 p< 0.001; NS, not significant; Student’s t test. 26 (F) Western blot analysis of GLI1 protein level in wild-type and EP4 knockout cells treated 27 with SHH-N in combination with PGE1 (10 µM) or vehicle control. β-Actin was used as a 28 loading control. 29 (G) Immunostaining for EP4 and ARL13B in NIH/3T3 cells. Representative images of the 30 endogenous localization of EP4 (green) and ARL13B (red) in serum starved NIH/3T3 cells 31 are shown. Cells were counterstained with Hoechst 33342 (blue). Scale bar, 10 µm. 32 (H) A model of PGE1 working mechanism for HH pathway inhibition. PGE1 acts on the EP4 33 receptor on the PC, which triggers the increase of cAMP levels, thereby enhancing PKA 34 activity. Elevated PKA phosphorylates GLI2 and inhibits its translocation to the primary 35 cilium, which consequently promotes GLI2 ubiquitination and subsequent degradation, thus 36 attenuating its activity. 37 38 Figure 5. PGE1 inhibits the cell viability and HH pathway activity in human DAOY 39 medulloblastoma cells and their derivative cell lines resistant to SMO inhibitors 40 (A-C) Cell viability assays in wild-type DAOY cells (A), SMO-D473H-overexpressed 41 DAOY cells (B) and GLI2-overexpressed DAOY cells (C) treated with PGE1 (100 µM), 42 vismodegib (10 µM) and cyclopamine (10 µM). Data represent mean of quadruplicates ± SD. 43 (D-F) qRT-PCR analysis of mRNA levels of GLI1 and PTCH1 in wild-type DAOY cells (D), 44 SMO-D473H-overexpressed DAOY cells (E) and GLI2-overexpressed DAOY cells (F)

Page 28 of 29

1 treated with PGE1 (100 µM), vismodegib (10 µM) and cyclopamine (10 µM). Data show 2 mean ± SD from three independent experiments. * p< 0.05, ** p< 0.01; *** p< 0.001; NS, 3 not significant; Student’s t test. 4 5 Figure 6. Xenograft assay using human DAOY cells overexpressing GLI2 6 (A) Macroscopic appearance of representative allografts at the end of these experiments on 7 day 51. 8 (B) Change of tumor volumes over the time course of treatments with vehicle control, 9 vismodegib (30 mg/kg) or PGE1 (15 mg/kg). Data depict mean ± SD, n=8 in each group. 10 (C) qRT-PCR analysis of GLI1 and PTCH1 mRNA expression in tumors treated with vehicle 11 control, vismodegib (30 mg/kg), and PGE1 (15 mg/kg) respectively. Data represent the mean 12 of three samples ± SD. 13 (D, E) Representative images of H&E (D) and Ki67 (E) staining of tumor tissues treated with 14 vehicle control or vismodegib (30 mg/kg) or PGE1 (15 mg/kg) respectively. The scale bar 15 represents 20 µm. 16 (F) Quantification of Ki67 staining from tumors in (E). Data present the means of three 17 samples ± SD. * p< 0.05; ** p< 0.01; *** p< 0.001; NS, not significant. Student’s t test. 18 19 Figure 7. Patient-derived orthotopic xenograft experiments using the Med-113FH and 20 the Med-314FH tumor models. 21 (A-C) Med-113FH tumor cells transduced with a firefly luciferase reporter were used for 22 cerebellum injections of immune-compromised mice, which were then randomized for 23 treatment with either vehicle control or PGE1 (15 mg/kg). The bioluminescence images (A) 24 and corresponding data analysis (B) of Med-113FH allografts assessed by IVIS imaging. (C) 25 Kaplan-Meier survival curve of the mice injected with luciferase-labeled Med-113FH cells in 26 the cerebellum. 27 (D-F) Med-314FH tumor cells transduced with a firefly luciferase reporter were used for 28 cerebellum injections of immune-compromised mice, which were then randomized for 29 treatment with either vehicle control or vismodegib (30 mg/kg) or PGE1 (15 mg/kg). The 30 bioluminescence images (D) and corresponding data analysis (E) of Med-314FH allografts 31 assessed by IVIS imaging. (F) Kaplan-Meier survival curve of the mice injected with 32 luciferase-labeled Med-314FH cells in the cerebellum. Two-way ANOVA was used for the 33 comparisons of tumor growth curves. Log-rank (Mantel-Cox) test was used for the 34 comparisons of survival curves. Data depict mean ± SD, n=5 in each group. 35

Page 29 of 29

Prostaglandin E1 Inhibits GLI2 Amplification-Associated Activation of the Hedgehog Pathway and Drug Refractory Tumor Growth

Fujia Wu, Chenze Zhang, Chen Zhao, et al.

Cancer Res Published OnlineFirst May 5, 2020.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-19-2052

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2020/05/05/0008-5472.CAN-19-2052.DC1

Author Author manuscripts have been peer reviewed and accepted for publication but have not yet Manuscript been edited.

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/early/2020/05/05/0008-5472.CAN-19-2052. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.