DOCSLIB.ORG

Genome-Wide Association Analysis of Metabolic Syndrome Quantitative Traits in the GENNID Multiethnic Family Study

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genome-Wide Association Analysis of Metabolic Syndrome Quantitative Traits in the GENNID Multiethnic Family Study Wan et al. Diabetol Metab Syndr (2021) 13:59 https://doi.org/10.1186/s13098-021-00670-3 Diabetology & Metabolic Syndrome RESEARCH Open Access Genome-wide association analysis of metabolic syndrome quantitative traits in the GENNID multiethnic family study Jia Y. Wan1, Deborah L. Goodman1, Emileigh L. Willems2, Alexis R. Freedland1, Trina M. Norden‑Krichmar1, Stephanie A. Santorico2,3,4,5 and Karen L. Edwards1*American Diabetes GENNID Study Group Abstract Background: To identify genetic associations of quantitative metabolic syndrome (MetS) traits and characterize heterogeneity across ethnic groups. Methods: Data was collected from GENetics of Noninsulin dependent Diabetes Mellitus (GENNID), a multieth‑ nic resource of Type 2 diabetic families and included 1520 subjects in 259 African‑American, European‑American, Japanese‑Americans, and Mexican‑American families. We focused on eight MetS traits: weight, waist circumfer‑ ence, systolic and diastolic blood pressure, high‑density lipoprotein, triglycerides, fasting glucose, and insulin. Using genotyped and imputed data from Illumina’s Multiethnic array, we conducted genome‑wide association analyses with linear mixed models for all ethnicities, except for the smaller Japanese‑American group, where we used additive genetic models with gene‑dropping. Results: Findings included ethnic‑specifc genetic associations and heterogeneity across ethnicities. Most signifcant associations were outside our candidate linkage regions and were coincident within a gene or intergenic region, with two exceptions in European‑American families: (a) within previously identifed linkage region on chromosome 2, two signifcant GLI2-TFCP2L1 associations with weight, and (b) one chromosome 11 variant near CADM1-LINC00900 with pleiotropic blood pressure efects. Conclusions: This multiethnic family study found genetic heterogeneity and coincident associations (with one case of pleiotropy), highlighting the importance of including diverse populations in genetic research and illustrating the complex genetic architecture underlying MetS. Keywords: Metabolic syndrome, Genetic epidemiology, Family studies, Quantitative trait loci, Linkage Background Treatment Panel (NCEP ATP) III criteria [3], typically Metabolic syndrome (MetS) is a common, complex used in the United States for clinical diagnosis, defnes condition characterized by hyperlipidemia, hyperten- MetS as the presence of at least three of fve risk fac- sion, hyperglycemia, and excess abdominal fat [1–3]. tors: elevated systolic and/or diastolic blood pressure Te National Cholesterol Education Program’s Adult (SBP, DBP), elevated triglycerides (TG), decreased high density lipoprotein (HDL)-cholesterol, elevated fasting glucose, and abdominal obesity [1, 3]. Due to the cluster- *Correspondence: [email protected] 1 Department of Epidemiology and Biostatistics, Program in Public Health, ing of these characteristics [4, 5], individuals with MetS University of California, 635 E. Peltason Dr, Mail Code: 7550, Irvine, CA are at risk for cardiovascular and metabolic diseases 92697, USA such as stroke and diabetes [6–10]. Moreover, in several Full list of author information is available at the end of the article © The Author(s) 2021. This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http:// creat iveco mmons. org/ licen ses/ by/4. 0/. The Creative Commons Public Domain Dedication waiver (http:// creat iveco mmons. org/ publi cdoma in/ zero/1. 0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Wan et al. Diabetol Metab Syndr (2021) 13:59 Page 2 of 15 US-based studies of families [11–15], MetS quantitative on chromosome 3 among MA families [33]. Tese can- and multivariate factor traits are highly heritable with didate linkage regions are large (between 150 and 540 about half of the variation between subjects explained by Mbp), with multiple traits mapping to these regions and genetics in families of European descent [14, 15] and par- evidence for heterogeneity across ethnic groups [33]. A ticularly for obesity and lipid-related traits in families of more in-depth evaluation of these regions to determine if African Americans [12, 14], Mexican Americans [13] and linkage is due to pleiotropy or co-incident linkage/asso- Japanese Americans [11]. Family-based studies have been ciation, along with a broader focus on understanding if a primary approach for identifying genetic infuences on diferent trait clustering contributes to heterogeneity is a range of disease and still ofer many advantages [16, 17] needed. We used the GENetics of NonInsulin-dependent including being robust to confounding due to underlying Diabetes mellitus (GENNID) resource [37], a multieth- population structure and phenotype model misspecif- nic study of families with type 2 diabetes (T2D), and a cations, using pedigree structures and information on GWAS approach to identify quantitative trait nucleotides related individuals to detect genotyping errors [16], and (QTNs) with possible pleiotropic or coincident efects having more power to detect rare variants [16, 17]. and to examine evidence for heterogeneity in genetic Candidate gene [18–23] and genome-wide associa- association fndings for MetS traits across ethnic groups. tion studies (GWAS) [18, 24–27] have already gener- ated a number of candidate genes and variants possibly Methods associated with MetS. However, the number of variants Study subjects is still growing [8], particularly in the Asian population GENNID is an American Diabetes Association (ADA) [28]. Nonetheless, many questions still remain about the resource of genetic, questionnaire, and laboratory data underlying genetic architecture of MetS. For example, from multiplex, ethnically diverse AA, EA, JA and MA are the genetic infuences the same regardless of which families with T2D, diagnosed using the National Diabe- NCEP traits cluster within an individual? Accumulat- tes Data Group criteria [38]. In this cross-sectional study ing evidence suggests that the specifc combination of from 1993 to 1997, T2D families were ascertained in two traits may matter and could explain the large number of phases across multiple centers in the United States [37]. variants associated with MetS [29, 30]. Several obesity- Phase 1 focused primarily on larger, multi-generational related loci have been shown to be associated with dif- data collection of families with at least two T2D afected ferent MetS traits [8, 31]. For example, obesity, high TG, siblings in addition to at least three frst-degree relatives. high fasting insulin, and low HDL are associated with Phase 2 ascertained sibling pairs and nuclear families MIP1, MC4R, and PRKD1, yet when these same traits are with at least two T2D afected siblings, and if at most combined with hypertension, they are associated with one parent was ascertained, then data was collected on FTO and TMEM18 [8]. at least two additional siblings. AA, EA, and MA families Results from our previous studies suggest diferences were collected in both phases while JA families were only in the clustering due to the underlying genetics of MetS collected in Phase 1 [37, 39]. Tis study used all available traits by ethnicity [32–34]. For example, while a sig- data except for the Phase 2 EA data (N = 371 subjects) nifcant genetic correlation between weight and waist is which were not yet genotyped. Self-identifed race, fam- present in African American (AA), European American ily and medical histories, anthropometric and lab meas- (EA), Japanese American (JA) and Mexican American urements were obtained from participants. Specifcally, (MA) families [32, 34], the genetic correlation between we focused on eight MetS-related, quantitative traits high systolic blood pressure (SBP) and diastolic blood (i.e., HDL, TG, SBP, DBP, fasting insulin, fasting glucose, pressure (DBP) is seen only in AA, EA, and MA fami- weight, and waist circumference) defned from anthropo- lies [34]. Te signifcant genetic correlation of lipids (TG morphic and lab measurements. Pedigree relationships, and HDL) has been shown to be characteristic among age, sex, and diabetes status were obtained from the data EA and JA families [32, 34]. Tese diferences in cluster- collection and questionnaires. ing patterns may be driven by diferent sets of underlying genetic infuences and could explain the large number of Genotying and imputation genetic variants and genes associated with MetS. Previously, using microsatellite markers, linkage analy- Previously, family-based genetic linkage analyses nomi- ses identifed candidate regions for multivariate MetS nated chromosomal regions with putative causal vari- traits as described in Edwards et al. [32]. For this study, ants for individual and multivariate MetS traits. Results the Northwest
Load more

Recommended publications
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]
  • Genetic Variants of Calcium and Vitamin D Metabolism in Kidney Stone Disease
    bioRxiv preprint doi: https://doi.org/10.1101/515882; this version posted January 30, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Genetic variants of calcium and vitamin D metabolism in kidney stone disease Sarah A. Howles D.Phil., F.R.C.S.(Urol), Akira Wiberg B.M.B.Ch., Michelle Goldsworthy Ph.D., Asha L. Bayliss Ph.D., Emily Grout R.G.N., Chizu Tanikawa Ph.D., Yoichiro Kamatani M.D., Ph.D., Chikashi Terao M.D., Ph.D., Atsushi Takahashi Ph.D., Michiaki Kubo M.D., Ph.D., Koichi Matsuda M.D., Ph.D., Rajesh V. Thakker M.D., F.R.C.P., F.R.S., Benjamin W. Turney D.Phil., F.R.C.S.(Urol), and Dominic Furniss D.M., F.R.C.S.(Plast). Nuffield Department of Surgical Sciences, University of Oxford, United Kingdom (S.A.H., M.G., E.G., B.W.T.), Nuffield Department of Orthopaedics, Rheumatology and Musculoskeletal Sciences, University of Oxford, United Kingdom (A.W., D.F.), Academic Endocrine Unit, Radcliffe Department of Medicine, University of Oxford, United Kingdom (S.A.H., M.G., A.B., R.V.T.), Laboratory of Genome Technology, Human Genome Centre, University of Tokyo, Japan (C.Ta.), RIKEN Centre for Integrative Medical Sciences, Kanagawa, Japan (Y.K., C.Te., A.T., M.K.), Laboratory of Clinical Genome Sequencing, Department of Computational Biology and Medical Sciences, University of Tokyo, Japan (K.M.).
    [Show full text]
  • Downregulation of SNRPG Induces Cell Cycle Arrest and Sensitizes Human Glioblastoma Cells to Temozolomide by Targeting Myc Through a P53-Dependent Signaling Pathway
    Cancer Biol Med 2020. doi: 10.20892/j.issn.2095-3941.2019.0164 ORIGINAL ARTICLE Downregulation of SNRPG induces cell cycle arrest and sensitizes human glioblastoma cells to temozolomide by targeting Myc through a p53-dependent signaling pathway Yulong Lan1,2*, Jiacheng Lou2*, Jiliang Hu1, Zhikuan Yu1, Wen Lyu1, Bo Zhang1,2 1Department of Neurosurgery, Shenzhen People’s Hospital, Second Clinical Medical College of Jinan University, The First Affiliated Hospital of Southern University of Science and Technology, Shenzhen 518020, China;2 Department of Neurosurgery, The Second Affiliated Hospital of Dalian Medical University, Dalian 116023, China ABSTRACT Objective: Temozolomide (TMZ) is commonly used for glioblastoma multiforme (GBM) chemotherapy. However, drug resistance limits its therapeutic effect in GBM treatment. RNA-binding proteins (RBPs) have vital roles in posttranscriptional events. While disturbance of RBP-RNA network activity is potentially associated with cancer development, the precise mechanisms are not fully known. The SNRPG gene, encoding small nuclear ribonucleoprotein polypeptide G, was recently found to be related to cancer incidence, but its exact function has yet to be elucidated. Methods: SNRPG knockdown was achieved via short hairpin RNAs. Gene expression profiling and Western blot analyses were used to identify potential glioma cell growth signaling pathways affected by SNRPG. Xenograft tumors were examined to determine the carcinogenic effects of SNRPG on glioma tissues. Results: The SNRPG-mediated inhibitory effect on glioma cells might be due to the targeted prevention of Myc and p53. In addition, the effects of SNRPG loss on p53 levels and cell cycle progression were found to be Myc-dependent. Furthermore, SNRPG was increased in TMZ-resistant GBM cells, and downregulation of SNRPG potentially sensitized resistant cells to TMZ, suggesting that SNRPG deficiency decreases the chemoresistance of GBM cells to TMZ via the p53 signaling pathway.
    [Show full text]
  • Developmental Dental Disorders
    Developmental Disturbances in Tooth Formaton: Special Needs John J. Sauk DDS, MS Dean & Professor University of Louisville Interprofessional Collaboration &Care First Look! Signaling in Tooth Development Stages of Tooth Development Developmental Disturbances in Tooth Formaton Some genes affecting early tooth development (MSX1, AXIN2,PAX9, LTBP3,EDA) are associated with tooth agenesis and systemic features (cleft palate, colorectal cancer). By contrast, genes involved in enamel (AMELX, ENAM, MMP20, and KLK4) and dentin (DSPP) structures are highly specific for tooth formation. Genes Associated with Tooth Agenesis Non-syndromic oligodontia Mutations in the homeobox gene Oligodontia with mutations MSX1 lead to specific in MSX1 (4p16.1) hypo/oligodontia. Second premolars and third molars are the most Oligodontia with mutations commonly affected teeth in PAX 9 (14q12–q13) Mutations in the transcription factor gene, PAX9, lead to absence of most Oligodontia with mutations permanent molars with or without in AXIN 2 (17q23–24) hypodontia in primary teeth. Mutations in AXIN2 cause tooth Oligodontia with locus agenesis and colorectal cancer mapped to chromosome (OMIM 608615). The patients who 10q11.2 carry the mutation lack 8–27 permanent teeth. Penetrance of colorectal cancer is very high. MSX1 (4p16.1) Congenital agenesis of second premolars at the lower jaw orthopantomogram. Mutations in AXIN2 cause familial tooth agenesis and predispose to colorectal cancer Severe permanent tooth agenesis (oligodontia) Colorectal neoplasia Dominant inheritance Nonsense mutation Arg656Stop, in the Wnt- signaling regulator AXIN2 Mutations in AXIN2 cause familial tooth agenesis and predispose to colorectal cancer Lammi L et al. Am. J. Human Genet. 74 (2004) pp. 1043-1050. Hypodontia as a risk marker for epithelial ovarian cancer Leigh A.
    [Show full text]
  • A Protocol for Constructing Gene Targeting Vectors: Generating Knockout Mice for the Cadherin Family and Beyond
    PROTOCOL A protocol for constructing gene targeting vectors: generating knockout mice for the cadherin family and beyond Sen Wu1, Guoxin Ying2, Qiang Wu2 & Mario R Capecchi1,2 1Howard Hughes Medical Institute and 2Department of Human Genetics, University of Utah, Salt Lake City, Utah 84112, USA. Correspondence should be addressed to M.R.C. ([email protected]). Published online 29 May 2008; doi:10.1038/nprot.2008.70 s We describe here a streamlined procedure for targeting vector construction, which often is a limiting factor for gene targeting (knockout) technology. This procedure combines various highly efficient recombination-based cloning methods in bacteria, consisting of three steps. First step is the use of Red-pathway-mediated recombination (recombineering) to capture a genomic fragment into a Gateway-compatible vector. Second, the vector is modified by recombineering to include a positive selection gene neo,fromavariety natureprotocol / of modular reagents. Finally, through a simple in vitro Gateway recombination, the modified genomic fragment is switched into a m o c vector that contains negative selection cassettes, as well as unique sites for linearization. To demonstrate the usefulness of this . e r protocol, we report targeted disruptions of members of the cadherin gene family, focusing on those that have not been previously u t B a studied at the molecular genetic level. This protocol needs 2 weeks to construct a targeting vector, and several vectors can be n . easily handled simultaneously using common laboratory setup. w w w / / : p t INTRODUCTION t h Gene targeting, the use of homologous recombination in mouse this procedure is reduced when used for generating large DNA p 1–5 19,20 u embryonic stem (ES) cells to modify mouse genes precisely , constructs, required for gene targeting vector construction .
    [Show full text]
  • Entrez ID Gene Name Fold Change Q-Value Description
    Entrez ID gene name fold change q-value description 4283 CXCL9 -7.25 5.28E-05 chemokine (C-X-C motif) ligand 9 3627 CXCL10 -6.88 6.58E-05 chemokine (C-X-C motif) ligand 10 6373 CXCL11 -5.65 3.69E-04 chemokine (C-X-C motif) ligand 11 405753 DUOXA2 -3.97 3.05E-06 dual oxidase maturation factor 2 4843 NOS2 -3.62 5.43E-03 nitric oxide synthase 2, inducible 50506 DUOX2 -3.24 5.01E-06 dual oxidase 2 6355 CCL8 -3.07 3.67E-03 chemokine (C-C motif) ligand 8 10964 IFI44L -3.06 4.43E-04 interferon-induced protein 44-like 115362 GBP5 -2.94 6.83E-04 guanylate binding protein 5 3620 IDO1 -2.91 5.65E-06 indoleamine 2,3-dioxygenase 1 8519 IFITM1 -2.67 5.65E-06 interferon induced transmembrane protein 1 3433 IFIT2 -2.61 2.28E-03 interferon-induced protein with tetratricopeptide repeats 2 54898 ELOVL2 -2.61 4.38E-07 ELOVL fatty acid elongase 2 2892 GRIA3 -2.60 3.06E-05 glutamate receptor, ionotropic, AMPA 3 6376 CX3CL1 -2.57 4.43E-04 chemokine (C-X3-C motif) ligand 1 7098 TLR3 -2.55 5.76E-06 toll-like receptor 3 79689 STEAP4 -2.50 8.35E-05 STEAP family member 4 3434 IFIT1 -2.48 2.64E-03 interferon-induced protein with tetratricopeptide repeats 1 4321 MMP12 -2.45 2.30E-04 matrix metallopeptidase 12 (macrophage elastase) 10826 FAXDC2 -2.42 5.01E-06 fatty acid hydroxylase domain containing 2 8626 TP63 -2.41 2.02E-05 tumor protein p63 64577 ALDH8A1 -2.41 6.05E-06 aldehyde dehydrogenase 8 family, member A1 8740 TNFSF14 -2.40 6.35E-05 tumor necrosis factor (ligand) superfamily, member 14 10417 SPON2 -2.39 2.46E-06 spondin 2, extracellular matrix protein 3437
    [Show full text]
  • Genome Wide Association of Chronic Kidney Disease Progression: the CRIC Study (Author List and Affiliations Listed at End of Document)
    SUPPLEMENTARY MATERIALS Genome Wide Association of Chronic Kidney Disease Progression: The CRIC Study (Author list and affiliations listed at end of document) Genotyping information page 2 Molecular pathway analysis information page 3 Replication cohort acknowledgments page 4 Supplementary Table 1. AA top hit region gene function page 5-6 Supplementary Table 2. EA top hit region gene function page 7 Supplementary Table 3. GSA pathway results page 8 Supplementary Table 4. Number of molecular interaction based on top candidate gene molecular networks page 9 Supplementary Table 5. Results of top gene marker association in AA, based on EA derived candidate gene regions page 10 Supplementary Table 6. Results of top gene marker association in EA, based on AA derived candidate gene regions page 11 Supplementary Table 7. EA Candidate SNP look up page 12 Supplementary Table 8. AA Candidate SNP look up page 13 Supplementary Table 9. Replication cohorts page 14 Supplementary Table 10. Replication cohort study characteristics page 15 Supplementary Figure 1a-b. Boxplot of eGFR decline in AA and EA page 16 Supplementary Figure 2a-l. Regional association plot of candidate SNPs identified in AA groups pages 17-22 Supplementary Figure 3a-f. Regional association plot of candidate SNPs identified in EA groups pages 23-25 Supplementary Figure 4. Molecular Interaction network of candidate genes for renal, cardiovascular and immunological diseases pages 26-27 Supplementary Figure 5. Molecular Interaction network of candidate genes for renal diseases pages 28-29 Supplementary Figure 6. ARRDC4 LD map page 30 Author list and affiliations page 31 1 Supplemental Materials Genotyping Genotyping was performed on a total of 3,635 CRIC participants who provided specific consent for investigations of inherited genetics (of a total of 3,939 CRIC participants).
    [Show full text]
  • 1111111111111111111Inuuu11
    1111111111111111111inuuu1111111111u~ (12) United States Patent (io) Patent No.: US 9,896,681 B2 Goodwin et al. (45) Date of Patent: *Feb. 20, 2018 (54) GENETIC REGULATION OF BONE AND 4,993,413 A 2/1991 McLeod CELLS BY ELECTROMAGNETIC 5,002,890 A 3/1991 Morrison STIMULATION FIELDS AND USES 5,026,650 A 6/1991 Schwarz 5,153,132 A 10/1992 Goodwin THEREOF 5,153,133 A 10/1992 Schwarz 5,155,034 A 10/1992 Wolf (71) Applicant: The United States of America as 5,155,035 A 10/1992 Schwarz Represented by the Administrator of 5,308,764 A 5/1994 Goodwin the National Aeronautics and Space 5,627,021 A 5/1997 Goodwin 5,846,807 A 12/1998 Goodwin Administration, Washington, DC (US) 6,485,963 B1 11/2002 Wolf 6,673,597 B2 1/2004 Wolf (72) Inventors: Thomas J. Goodwin, Kemah, TX 6,730,498 B1 5/2004 Goodwin (US); Linda C. Shackelford, Webster, 6,919,205 B2 7/2005 Brighton TX (US) 7,160,024 B2 1/2007 Dougherty, Sr. 7,179,217 B2 2/2007 Goodwin 7,456,019 B2 11/2008 Goodwin (73) Assignee: The United States of America as 2006/0229487 Al 10/2006 Goodwin represented by the National 2007/0105769 Al 5/2007 Simon Aeronautics and Space 2008/0138415 Al 6/2008 Hussain Administration, Washington, DC (US) 2009/0234417 Al 9/2009 Pastena 2011/0105959 Al 5/2011 OConnor (*) Notice: Subject to any disclaimer, the term of this patent is extended or adjusted under 35 OTHER PUBLICATIONS U.S.C.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name protocadherin 7 Gene Symbol Pcdh7 Organism Mouse Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. NC_000071.6, NT_039305.8 UniGene ID Mm.332387 Ensembl Gene ID ENSMUSG00000029108 Entrez Gene ID 54216 Assay Information Unique Assay ID qMmuCEP0041945 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSMUST00000094783, ENSMUST00000068110 Amplicon Context Sequence AAGCTGCCCCAATGTCAGATGATCTTCGACGAGAACGAATGTTTCCTGGACTTC GAGGTGTCGGTGATAGGGCCCTCACAGAGCTGGGTGGACCTGTTTGAGGGTCG GGTCATCGTGCTGGACATCAACGATAACACGCCCACCTTCCCG Amplicon Length (bp) 120 Chromosome Location 5:57719387-57719536 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 93 R2 0.9994 cDNA Cq 21.89 cDNA Tm (Celsius) 86 gDNA Cq 26.19 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Pcdh7, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • Genome-Wide Association Study Identifies Candidate Genes
    animals Article Genome-Wide Association Study Identifies Candidate Genes Associated with Feet and Leg Conformation Traits in Chinese Holstein Cattle Ismail Mohamed Abdalla 1, Xubin Lu 1 , Mudasir Nazar 1, Abdelaziz Adam Idriss Arbab 1,2, Tianle Xu 3 , Mohammed Husien Yousif 4, Yongjiang Mao 1 and Zhangping Yang 1,* 1 College of Animal Science and Technology, Yangzhou University, Yangzhou 225009, China; [email protected] (I.M.A.); [email protected] (X.L.); [email protected] (M.N.); [email protected] (A.A.I.A.); [email protected] (Y.M.) 2 Biomedical Research Institute, Darfur College, Nyala 63313, Sudan 3 Joint International Research Laboratory of Agriculture and Agri-Product Safety, Yangzhou University, Yangzhou 225009, China; [email protected] 4 Faculty of Animal Production, West Kordufan University, Alnuhud City 12942, Sudan; [email protected] * Correspondence: [email protected]; Tel.: +86-0514-87979269 Simple Summary: Feet and leg problems are among the major reasons for dairy cows leaving the herd, as well as having direct association with production and reproduction efficiency, health (e.g., claw disorders and lameness) and welfare. Hence, understanding the genetic architecture underlying feet and conformation traits in dairy cattle offers new opportunities toward the genetic improvement and long-term selection. Through a genome-wide association study on Chinese Holstein cattle, we identified several candidate genes associated with feet and leg conformation traits. These results could provide useful information about the molecular breeding basis of feet and leg traits, thus Citation: Abdalla, I.M.; Lu, X.; Nazar, improving the longevity and productivity of dairy cattle.
    [Show full text]
  • Peripheral Nerve Single-Cell Analysis Identifies Mesenchymal Ligands That Promote Axonal Growth
    Research Article: New Research Development Peripheral Nerve Single-Cell Analysis Identifies Mesenchymal Ligands that Promote Axonal Growth Jeremy S. Toma,1 Konstantina Karamboulas,1,ª Matthew J. Carr,1,2,ª Adelaida Kolaj,1,3 Scott A. Yuzwa,1 Neemat Mahmud,1,3 Mekayla A. Storer,1 David R. Kaplan,1,2,4 and Freda D. Miller1,2,3,4 https://doi.org/10.1523/ENEURO.0066-20.2020 1Program in Neurosciences and Mental Health, Hospital for Sick Children, 555 University Avenue, Toronto, Ontario M5G 1X8, Canada, 2Institute of Medical Sciences University of Toronto, Toronto, Ontario M5G 1A8, Canada, 3Department of Physiology, University of Toronto, Toronto, Ontario M5G 1A8, Canada, and 4Department of Molecular Genetics, University of Toronto, Toronto, Ontario M5G 1A8, Canada Abstract Peripheral nerves provide a supportive growth environment for developing and regenerating axons and are es- sential for maintenance and repair of many non-neural tissues. This capacity has largely been ascribed to paracrine factors secreted by nerve-resident Schwann cells. Here, we used single-cell transcriptional profiling to identify ligands made by different injured rodent nerve cell types and have combined this with cell-surface mass spectrometry to computationally model potential paracrine interactions with peripheral neurons. These analyses show that peripheral nerves make many ligands predicted to act on peripheral and CNS neurons, in- cluding known and previously uncharacterized ligands. While Schwann cells are an important ligand source within injured nerves, more than half of the predicted ligands are made by nerve-resident mesenchymal cells, including the endoneurial cells most closely associated with peripheral axons. At least three of these mesen- chymal ligands, ANGPT1, CCL11, and VEGFC, promote growth when locally applied on sympathetic axons.
    [Show full text]