University of Groningen

Brain death and organ donation Hoeksma, Dane

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record

Publication date: 2017

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA): Hoeksma, D. (2017). Brain death and organ donation: Observations and interventions. Rijksuniversiteit Groningen.

Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.

Download date: 28-09-2021 Brain Death and Organ Donation

Observations and Interventions

Dane Hoeksma Brain Death and Organ Donation

Observations and Interventions

Proefschrift

ter verkrijging van de graad van doctor aan de Rijksuniversiteit Groningen Dane Hoeksma op gezag van de PhD-thesis rector magnifcus prof. dr. E. Sterken en volgens besluit van het College voor Promoties. This PhD-project was fnancially supported by De openbare verdediging zal plaatsvinden op University Medical Center Groningen woensdag 6 september 2017 om 12.45 uur Junior Scientifc Masterclass, Faculty of medicine University Of Groningen Research Institute GUIDE door The printing of this thesis was kindly supported by: University Medical Center Groningen Research Institute GUIDE Noord-Negentig B.V. Chipsoft B.V. Dane Hoeksma geboren op 14 februari 1988 Cover and invitation: Anne van Erp and Dane Hoeksma te Ispingo, Zuid-Afrika Layout: Rens Dommerholt, Persoonlijk Proefschrift, www.persoonlijkproefschrift.nl Printing: Ipskamp printing, www.ipskampprinting.nl

Copyright: Dane Hoeksma, 2017-06-11

ISBN number: 978-94-028-0690-8

All rights reserved. No part of this publication may be reproduced, stored in a retrieval system or transmitted in any form without explicit prior permission of the author. Promotores Paranimfen Prof. dr. H.G.D. Leuvenink M. Kirschbaum Prof. dr. H. van Goor R. Mencke

Beoordelingscommissie Prof. dr. J.L. Hillebrands Prof. dr. D.J. Reijngoud Prof. dr. B. Yard CONTENTS

Chapter 1 Introduction 9

Chapter 2 Slow induction of brain death leads to decreased renal function and increased hepatic apoptosis in brain-dead rats 21

Chapter 3 Quality of donor lung grafts: A comparative study between explosive and gradual brain death induction models in rats 41

Chapter 4 Inadequate anti-oxidative responses in kidneys of brain-dead rats 55

Chapter 5 Differences between kidney and liver perfusion, oxygen consumption, and metabolism during brain death 73

Chapter 6 MnTMPyP, a selective superoxide dismutase mimetic, reduces oxidative stress in kidneys of brain-dead rats 95

Chapter 7 MnTMPyP treatment of brain-dead rats leads to improved renal function during ex vivo reperfusion 115

Chapter 8 Discussion and future perspectives 129

Chapter 9 English and Dutch summary 137

List of abbreviations 146 Author affliations 151 Acknowledgments 152 Biography 157

CHAPTER Introduction 1 CHAPTER 1 INTRODUCTION

Renal transplantation is the most effective therapy for end-stage renal disease. In 2015, 442 kidneys from deceased donors, the largest donor pool, were transplanted in the Graft survival 1 1 Netherlands . At the end of this year, 554 patients were still awaiting a kidney transplant. 100 1 The total amount of kidneys transplanted in the Eurotransplant region was 3206 in the year LD kidney 2015 while 10400 patients were waiting for a kidney transplant. In the United states, 17.107 80 DBD kidney kidney transplants were performed while 100.791 patients were still on the waiting list2,3. DCD kidney These data indicate that the demand of donor organs outweighs the supply. Therefore, an 60 increase in donor organs is necessary to meet the pressing demand. 40 Kidneys can be retrieved from living donors (LD) and deceased donors. Between the two, deceased donors form the majority since living donors are scarce4. Deceased donors can Percent survival 20 be classifed into deceased brain-dead (DBD) and deceased circulatory death donors 0 5 (DCD) . Of the kidneys transplanted from deceased donors, most are retrieved from 0 5 10 15 20 25 brain-dead donors. However, in many countries, the number of kidneys obtained from Years DCD donors are increasing and in some countries, like the Netherlands, these kidneys Figure 1. Renal graft survival in transplant recipients transplanted between 1993 and 2015 in the University are already transplanted as frequently as DBD kidneys. This is because increased amounts Medical Center Groningen. Graft survival is superior when organs are retrieved from living donors (LD) compared of kidneys from DCD donors who die unexpectedly are being more frequently used for to deceased donors. Within the deceased donor group, organs retrieved from brain-dead donors (DBD) show transplantation. Most DCD donor kidneys used for transplantation are from donors who superior graft survival compared to cardiac-death donors (DCD). die expectedly in the sense that cardiac arrest is anticipated. In the future, an increased amount of DCD donors could be realized as some countries are starting to use organs from unexpected DCD donors. There are different options to meet the increasing demand for donor organs. Many countries have resorted to the use of expanded criteria donors (ECD) to meet the increased 6 The outcome of kidneys retrieved from different donor types varies. The graft survival rates demand of donor organs . ECD donors are older donors (>60 years) or donors aged 50 of kidneys from different donor types from the University Medical Center Groningen are to 59 years with two of the following: cerebrovascular accident as the cause of death, pre- depicted in Figure 1. Kidneys from living donors are superior to deceased donor kidneys existing hypertension, or terminal serum creatinine greater than 1.5 mg/dl. In the future, which can be explained by shorter warm- and cold ischemia times. DBD kidneys do not more ECD donors will be evident due to the aging population. Regarding DCD donors, suffer warm ischemia but are usually subjected to long periods of cold ischemia during an increased amount of DCD donors could be realized by increased use of organs from transport. In addition to cold ischemia, DCD kidneys usually suffer prolonged periods of unexpected DCD. In Spain and Russia, kidneys from unexpected DCD donors are being 7-9 warm ischemia which results in the worst outcomes amongst the three donor types. This increasingly used . Unexpected DCD donors form a large group and may represent a effect is typically observed soon after transplantation as the incidence of primary non- potential option to decrease the demand for donor kidneys. function (PNF) of DCD grafts is 9%, while DBD and LD grafts show PNF rates of 5 and 1%, respectively. However, overall graft survival of DCD-, DBD- and LD transplantation Transplanting kidneys from more marginal donors like ECD and DCD donors is likely to is 86%, 86% and 93%, respectively. Therefore, outcomes from LD kidneys is superior to be associated with decreased rates of graft survival. Therefore, developing strategies to deceased donors but overall outcome is not compromised between either two deceased improve graft survival rates of transplanted kidneys could be advantageous. By doing donor types. However, short term outcome of DCD kidneys is inferior compared to DBD so, these strategies could result in increased graft survival and thereby prevent patients kidneys with regard to, like mentioned above, PNF, but also delayed graft function (DGF; from being relisted on the kidney waiting list. These strategies could also beneft more 82% and 30%, respectively). Yet, despite that deceased donation infuences graft survival conventional donor types such as DBD donors as these kidneys suffer numerous insults in negatively, transplanting deceased donor kidneys represent a good solution for patients the donor. Furthermore, all transplants are subjected to ischemia-reperfusion (I-R) injury with end stage renal disease as the ten-year graft survival rate exceeds 85%. during the transplantation process and therefore even LD donor kidneys could beneft from such strategies. A major break-through was evident with the benefcial effect of machine perfusion on graft survival of deceased donor kidney transplants compared to cold storage10.

As mentioned above, kidneys from brain-dead donors lead to inferior outcomes compared to kidneys from living donation4. This phenomenon is related to pathophysiological changes that take place in the brain-dead donor. Brain death (BD) leads to major hemodynamic derailments, systemic infammation, and altered metabolism which potentially affects future donor organs11-13. Furthermore, brain dead donor organs suffer increased I-R injury 14. Major hemodynamic derailments are due to the catecholamine storm which is characteristic for the onset of BD13. The catecholamine storm is believed to be the bodies fnal attempt to maintain cerebral perfusion against increasing intracranial pressure. The

10 11 CHAPTER 1 INTRODUCTION

large amounts of secreted catecholamines lead to severe vasoconstriction and possible mitochondrial electron transport chain (ETC), by xanthine and NADPH oxidase, the ischemic damage to organs15. Furthermore, spinal cord ischemia will result in vascular tricarboxylic acid (TCA) cycle enzymes aconitase and α-ketoglutarate dehydrogenase, 1 collapse and consequently decreased blood fow and increased ischemia. Circulating by non-TCA cycle enzymes and by monoamine oxidases and cytochrome b5 reductase, 1 cytokines are evident soon after the onset of BD with IL-6 being the most implicated located in the outer mitochondrial membrane39. Endogenous antioxidants such as cytokine in BD. Expression of adhesion molecules and infltration of infammatory cells in superoxide dismutase (SOD), glutathione peroxidase (GpX) and catalase regulate the organs is also evident soon after the onset of BD16. The increased production of cytokines levels of ROS accurately40. However, certain pathological conditions increase radical could be secreted by the dying cerebrum or by organs that suffer ischemic insults due to the production which can overwhelm antioxidant protection. Excessive ROS generation leads hemodynamic instability. Altered metabolism is observed in the kidney and liver of brain- to damaged nucleic acids, proteins, and lipids. which damages enzymes in the ETC leading dead animals. Most notably a switch is apparent from aerobic to anaerobic metabolism. The to mitochondrial dysfunction, decreased ATP production and increased generation of altered metabolism could be the result of both hemodynamic changes and infammatory ROS. mediators. Furthermore, brain death-related processes such as the catecholamine storm are affected by the speed at which intracranial pressure (ICP) increases17. A faster increase in ICP leads to higher levels of circulating catecholamines, which is particularly detrimental for cardiac and pulmonary graft function. Indeed, traumatic brain injury, the most common cause of BD preceded by a rapid increase in ICP, is a risk factor for mortality in heart recipients18. In contrast, a cerebrovascular cause of death, usually preceded by a slower increase in ICP, is a risk factor for renal and hepatic graft dysfunction19,20. However, this phenomenon is not believed to be associated with a slower increase in ICP. Rather, donor characteristics such as obesity, old age, and the presence of cardiovascular disease are regarded as the underlying cause.

Many studies have focused on attempting to counteract BD-related pathophysiological processes. Hemodynamic, infammatory, and metabolic changes have all been counteracted with often good experimental results. Experimental research shows that blocking the catecholamine storm has a benefcial effect on lung function parameters and histology 21. Treating brain-dead rats with methylprednisolone leads to improved renal graft survival and reduced rejection22. Metabolic changes have been tackled through administration of thyroid hormones which has differential effects on the liver and kidney 23,24. Figure 2. Sources of cellular superoxide production and its clearance by endogenous anti-oxidants. Adapted from Wang, K. 2013. Superoxide (O2-) is formed mainly from the mitochondrial electron transport chain (ETC). Many benefcial experimental interventions in brain-dead donors have been studied Endogenous anti-oxidants such as superoxide dismutase (SOD) convert superoxide to hydrogen peroxide (H2O2) clinically as well. Early studies involving the administration of methylprednisolone to brain- which can subsequently be converted to water (H2O) by amongst others catalase and glutathione peroxidase dead donors however did not show benefcial effects25-27. In a later study, a reduction in (GpX). pro-infammatory cytokines in the donor kidney prior to transplantation was evident22. No benefcial effects of methylprednisolone on kidney function after transplantation were observed. Improved renal function after transplantation has only been observed with the BD pathophysiology, which comprises hemodynamic, infammatory, and metabolic administration of dopamine to brain-dead donors28-31. changes, can lead to oxidative stress through aforementioned processes39,41,42. Hemodynamic changes, and the resulting ischemia, trigger mitochondrial dysfunction and Oxidative stress has been documented in brain-dead kidneys in both experimental and the subsequent leakage of radicals from the mitochondrial respiratory chain. The infux of clinical studies16,32. Several studies show that BD is associated with oxidative damage of infammatory cells can cause increased oxidative stress as large amounts of superoxide cellular lipid membranes12,33. Lipid peroxidation leads to membrane permeabilization and are released which forms part of the respiratory burst to kill pathogens. Furthermore, impairment of enzymatic processes and ion pumps which results in membrane dysfunction metabolic changes can lead to mitochondrial dysfunction and thereby increase the and cell toxicity34-36. BD-related lipid peroxidation is correlated with DGF in renal transplant oxidative load. Considering all the possible sources of oxidative stress, anti-oxidative recipients32. The levels of malondialdehyde (MDA), a product of lipid peroxidation, in the therapy could encompass many different options. Therefore, prior assessment as to what preservation solution of kidneys retrieved from brain-dead donors correlate well with might be the most up-stream cause of oxidative stress could be useful for administration DGF. Moreover, donor serum MDA levels correlate with acute rejection and immediate of an effcient anti-oxidative compound. and long-term renal allograft function. In expanded criteria donors (ECD), MDA levels in The primary aim of this thesis is to assess the detrimental effects of BD on different donor machine perfusion solution also correlate with DGF37. organs and to thereby put forward and test organ-specifc therapies. Many studies have Reactive oxygen species (ROS) are mainly formed in the mitochondrial electron transport been conducted on the detrimental effects of brain death and many studies have focused chain (ETC, Fig.2) and are essential for cellular homeostasis, mitosis, differentiation, on preventing these effects. Unfortunately, many of these interventional studies don’t signaling and survival38. Superoxide can be generated from complexes I and III of the show positive clinical effects. Likely, increased and more in depth knowledge about organ-

12 13 CHAPTER 1 INTRODUCTION

specifc effects of BD is necessary to gain advancements in treating brain-dead donors. Therefore, in this thesis we delved deeper into certain detrimental effects which were The kidney is by far the most transplanted organ. Therefore, in Chapter 6, we undertook 1 already touched upon on by previous studies, such as oxidative stress and metabolism. an interventional study by treating brain-dead rats with the goal of improving renal quality. 1 Furthermore, to gain more insight into the processes leading up to BD, we assessed the Oxidative membrane damage in brain-dead donors correlates with delayed graft function effects of different speeds of BD induction on donor organs. The speed of BD induction in renal transplant recipients. Therefore, anti-oxidative therapy administered to brain-dead has shown to infuence heart function and damage. Clinically, brain insults tend to progress donors could lead to improved transplantation outcomes. Based on the observations made to BD at different speeds. Therefore, we aimed to investigate the effects of speed of in Chapter 2, 4, and 5, we treated brain-dead rats with MnMTPyP, a selective superoxide BD induction on other organs than the heart as this could also contribute to organ- and dismutase mimetic, after slow BD induction. In Chapter 2 we found that oxidative stress donor-specifc interventions. was increased more after slow BD induction so we chose this form of induction to study the effects of MnTMPyP. In Chapter 4 we showed that superoxide is probably one of the most In Chapter 2 we focused on assessing the effects of fast and slow BD induction on the “upstream” oxidative processes in BD. Therefore, a superoxide dismutase mimetic could two most frequently transplanted organs, the kidney and liver. In this Chapter we aimed potentially eliminate this process and exert benefcial downstream effects. In Chapter 5 we to assess general differences between these organs elicited by fast and slow speed BD showed that oxidative stress is likely infuence by decreased regional renal perfusion which induction. Subsequently, in later Chapters, more in depth analysis could be performed leads to changes in metabolism and oxidative stress. At the same time this shows that in based on these initial results. In Chapter 2 we used the most clinically relevant function anti-oxidative therapy should comprise a compound which can exert effect in the renal and damage markers, such as plasma creatinine and plasma levels of ASAT and ALAT tissue since the maintenance of hemodynamic stability is not suffcient. to determine the effects of speed of BD induction on the kidney and liver. Furthermore, commonly used marker for infammation in BD, such as IL-6 and other common markers In Chapter 6 we showed that MnTMPyP exerts benefcial effects on the kidney as shown by for cell death such as caspase expression and the oxidative stress marker MDA were decreased renal and systemic oxidative stress. However, no benefcial effects on function assessed. were seen which we attributed to the fact that BD does not lead to suffcient oxidative damage to expect benefcial effects of anti-oxidative treatment. Therefore, in Chapter 7, In Chapter 3, similarly to Chapter 2, we assessed the effects of fast and slow BD induction we assessed renal function of kidneys of brain-dead rats treated with MnTMPyP in an ex on lung parameters. Experimental data shows that the heart is negatively affected by a fast vivo isolated perfused kidney system. increase in intracranial pressure which is attributed to a more severe catecholamine storm. Experimental research has shown that blocking the catecholamine storm has a benefcial effect on lung function. Moreover, clinical data shows that a traumatic cause of BD, associated with a fast increase in ICP, leads to decreased lung function. No experimental data has been published on the effects of speed of BD induction on the lung. Therefore, we aimed to assess the effect of the speed of BD induction on lung function and damage. This data could help in designing donor-specifc management strategies and optimal organ allocation policies.

Chapter 4 of this thesis is an expansion of the observation done in Chapter 2 that slow BD leads to increased renal oxidative stress compared to fast induction. In this Chapter, we investigated oxidative and anti-oxidative processes after fast and slow speed BD induction. These processes could explain the increased renal oxidative stress observed especially after slow BD induction. This data could lead to specifc anti-oxidative therapy for brain-dead donors and thereby possibly improve transplantation outcomes.

Chapter 2 and 4 show that BD leads to increased renal oxidative stress. These results were manifested despite the maintenance of hemodynamic stability. In Chapter 5, we investigated how BD affects regional renal and hepatic hemodynamics and metabolic effects in these organs and how this might affect the oxidative processes we observed in previous Chapters. Changes in metabolism elicited by brain death were shown almost thirty years ago. However, no clinical relevant interventions have evolved from this pioneering work. Therefore, in this Chapter, we looked more deeply into metabolic changes in the liver and kidney. We assessed changes in levels of glucose, fatty acids, and proteins. Moreover, mitochondrial functional changes were assessed and changes in regional hepatic and renal perfusion.

14 15 CHAPTER 1 INTRODUCTION

REFERENCES JL, Dykstra DM, Punch JD, DebRoy MA, et al. Characteristics associated 29. Schnuelle P, Berger S, de Boer J, 1 Transplantation 1988 Jan;45(1):32-36. with liver graft failure: the concept of a Persijn G, van der Woude FJ. Effects 1 1. https://www.eurotransplant.org/cms/ 12. Schuurs TA, Morariu AM, Ottens PJ, ‘t donor risk index. Am J Transplant 2006 of catecholamine application to brain- index.php?page=yearlystats. Hart NA, Popma SH, Leuvenink HG, et Apr;6(4):783-790. dead donors on graft survival in solid 2. http://optn.transplant.hrsa.gov/. al. Time-dependent changes in donor 21. Avlonitis VS, Wigfeld CH, Kirby organ transplantation. Transplantation 3. http://www.usrds.org/2015/view/ brain death related processes. Am J JA, Dark JH. The hemodynamic 2001 Aug 15;72(3):455-463. v2_07.aspx. Transplant 2006 Dec;6(12):2903-2911. mechanisms of lung injury and 30. Schnuelle P, Yard BA, Braun C, 4. Terasaki PI, Cecka JM, Gjertson DW, 13. Bos EM, Leuvenink HG, van Goor H, systemic infammatory response Dominguez-Fernandez E, Schaub Takemoto S. High survival rates of Ploeg RJ. Kidney grafts from brain following brain death in the transplant M, Birck R, et al. Impact of donor kidney transplants from spousal and dead donors: Inferior quality or donor. Am J Transplant 2005 Apr;5(4 dopamine on immediate graft living unrelated donors. N Engl J Med opportunity for improvement? Kidney Pt 1):684-693. function after kidney transplantation. 1995 Aug 10;333(6):333-336. Int 2007 Oct;72(7):797-805. 22. Pratschke J, Kofa G, Wilhelm MJ, Am J Transplant 2004 Mar;4(3):419- 5. Kootstra G, Daemen JH, Oomen 14. Weiss S, Kotsch K, Francuski M, Vergopoulos A, Laskowski I, Shaw GD, 426. AP. Categories of non-heart-beating Reutzel-Selke A, Mantouvalou L, Klemz et al. Improvements in early behavior 31. Schnuelle P, Gottmann U, Hoeger S, donors. Transplant Proc 1995 R, et al. Brain death activates donor of rat kidney allografts after treatment Boesebeck D, Lauchart W, Weiss C, Oct;27(5):2893-2894. organs and is associated with a worse of the brain-dead donor. Ann Surg et al. Effects of donor pretreatment Rao PS, Ojo A. The alphabet soup of I/R injury after liver transplantation. 2001 Dec;234(6):732-740. with dopamine on graft function after kidney transplantation: SCD, DCD, Am J Transplant 2007 Jun;7(6):1584- 23. Schwartz I, Bird S, Lotz Z, Innes CR, kidney transplantation: a randomized ECD--fundamentals for the practicing 1593. Hickman R. The infuence of thyroid controlled trial. JAMA 2009 Sep nephrologist. Clin J Am Soc Nephrol 15. Herijgers P, Leunens V, Tjandra-Maga hormone replacement in a porcine 9;302(10):1067-1075. 2009 Nov;4(11):1827-1831. TB, Mubagwa K, Flameng W. Changes brain death model. Transplantation 32. Kosieradzki M, Kuczynska J, 7. de Gracia MC, Osorio JM, Perez- in organ perfusion after brain death in 1993 Mar;55(3):474-476. Piwowarska J, Wegrowicz-Rebandel Villares JM, Galindo P, Ruiz MC, the rat and its relation to circulating 24. Pienaar H, Schwartz I, Roncone A, I, Kwiatkowski A, Lisik W, et al. Perez-Marfl A, et al. A new program catecholamines. Transplantation 1996 Lotz Z, Hickman R. Function of kidney Prognostic signifcance of free of kidney transplantation from donors Aug 15;62(3):330-335. grafts from brain-dead donor pigs. radicals: mediated injury occurring after cardiac death in Spain. Transplant 16. Morariu AM, Schuurs TA, Leuvenink The infuence of dopamine and in the kidney donor. Transplantation Proc 2012 Nov;44(9):2518-2520. HG, van Oeveren W, Rakhorst G, Ploeg triiodothyronine. Transplantation 1990 2003 Apr 27;75(8):1221-1227. 8. Pieter Hoogland ER, van Smaalen RJ. Early events in kidney donation: Oct;50(4):580-582. 33. Rebolledo RA, Hoeksma D, Hottenrott TC, Christiaans MH, van Heurn LW. progression of endothelial activation, 25. Chatterjee SN, Terasaki PI, Fine CM, Bodar YJ, Ottens PJ, Wiersema- Kidneys from uncontrolled donors oxidative stress and tubular injury S, Schulman B, Smith R, Fine RN. Buist J, et al. Slow induction of brain after cardiac death: which kidneys do after brain death. Am J Transplant Pretreatment of cadaver donors with death leads to decreased renal worse? Transpl Int 2013 May;26(5):477- 2008 May;8(5):933-941. methylprednisolone in human renal function and increased hepatic 484. 17. Shivalkar B, Van Loon J, Wieland W, allografts. Surg Gynecol Obstet 1977 apoptosis in rats. J Transl Med 2016 9. Reznik ON, Skvortsov AE, Reznik Tjandra-Maga TB, Borgers M, Plets Nov;145(5):729-732. May 19;14(1):141-016-0890-0. AO, Ananyev AN, Tutin AP, Kuzmin C, et al. Variable effects of explosive 26. Jeffery JR, Downs A, Grahame JW, 34. Jain SK, Shohet SB. Calcium DO, et al. Uncontrolled donors with or gradual increase of intracranial Lye C, Ramsey E, Thomson AE. A potentiates the peroxidation of controlled reperfusion after sixty pressure on myocardial structure randomized prospective study of erythrocyte membrane lipids. Biochim minutes of asystole: a novel reliable and function. Circulation 1993 cadaver donor pretreatment in renal Biophys Acta 1981 Mar 20;642(1):46- resource for kidney transplantation. Jan;87(1):230-239. transplantation. Transplantation 1978 54. PLoS One 2013 May 30;8(5):e64209. 18. Cohen O, De La Zerda DJ, Beygui R, Jun;25(6):287-289. 35. Vladimirov YA, Olenev VI, Suslova TB, 10. Moers C, Smits JM, Maathuis MH, Hekmat D, Laks H. Donor brain death 27. Soulillou JP, Baron D, Rouxel A, Cheremisina ZP. Lipid peroxidation in Treckmann J, van Gelder F, Napieralski mechanisms and outcomes after heart Guenel J. Steroid-cyclophosphamide mitochondrial membrane. Adv Lipid BP, et al. Machine perfusion or cold transplantation. Transplant Proc 2007 pretreatment of kidney allograft Res 1980;17:173-249. storage in deceased-donor kidney Dec;39(10):2964-2969. donors. A control study. Nephron 36. Tribble DL, Aw TY, Jones DP. The transplantation. N Engl J Med 2009 19. Pessione F, Cohen S, Durand D, 1979;24(4):193-197. pathophysiological signifcance Jan 1;360(1):7-19. Hourmant M, Kessler M, Legendre C, 28. Schnuelle P, Lorenz D, Mueller A, of lipid peroxidation in oxidative 11. Novitzky D, Cooper DK, Morrell et al. Multivariate analysis of donor Trede M, Van Der Woude FJ. Donor cell injury. Hepatology 1987 Mar- D, Isaacs S. Change from aerobic risk factors for graft survival in kidney catecholamine use reduces acute Apr;7(2):377-386. to anaerobic metabolism transplantation. Transplantation 2003 allograft rejection and improves 37. Nagelschmidt M, Minor T, Gallinat A, after brain death, and reversal Feb 15;75(3):361-367. graft survival after cadaveric renal Moers C, Jochmans I, Pirenne J, et al. following triiodothyronine therapy. 20. Feng S, Goodrich NP, Bragg-Gresham transplantation. Kidney Int 1999 Lipid peroxidation products in machine Aug;56(2):738-746. perfusion of older donor kidneys. J 16 17 CHAPTER 1 INTRODUCTION

Surg Res 2013 Apr;180(2):337-342. 38. Poyton RO, Ball KA, Castello PR. 1 Mitochondrial generation of free 1 radicals and hypoxic signaling. Trends Endocrinol Metab 2009 Sep;20(7):332- 340. 39. Valko M, Leibfritz D, Moncol J, Cronin MT, Mazur M, Telser J. Free radicals and antioxidants in normal physiological functions and human disease. Int J Biochem Cell Biol 2007;39(1):44-84. 40. Zhang H, Go YM, Jones DP. Mitochondrial thioredoxin-2/ peroxiredoxin-3 system functions in parallel with mitochondrial GSH system in protection against oxidative stress. Arch Biochem Biophys 2007 Sep 1;465(1):119-126. 41. Himmelfarb J, McMonagle E, Freedman S, Klenzak J, McMenamin E, Le P, et al. Oxidative stress is increased in critically ill patients with acute renal failure. J Am Soc Nephrol 2004 Sep;15(9):2449-2456. 42. Nakayama M, Nakayama K, Zhu WJ, Shirota Y, Terawaki H, Sato T, et al. Polymorphonuclear leukocyte injury by methylglyoxal and hydrogen peroxide: a possible pathological role for enhanced oxidative stress in chronic kidney disease. Nephrol Dial Transplant 2008 Oct;23(10):3096-3102.

18 19 CHAPTER Slow induction of brain death 2 leads to decreased renal function and increased hepatic apoptosis in rats

D Hoeksma* RA Rebolledo* CMV Hottenrott YS Bodar PJ Ottens J Wiersema-Buist HGD Leuvenink

*Authors contributed equally to the manuscript

Published in Journal of Translational Medicine

Reference: J Transl Med. 2016 May 19;14(1):141 Digital object identifer (DOI): 10.1186/s12967-016-0890-0. CHAPTER 2 BRAIN DEATH INDUCTION SPEEDS AND ABDOMINAL EFFECTS

ABSTRACT INTRODUCTION Introduction The shortage of qualitative donor organs remains a limiting factor in organ transplantation. Therefore, utilization of sub-optimal donor types to meet the increasing demand of organs Donor brain death (BD) is an independent risk factor for graft survival in recipients. is inevitable. Today, brain-dead donors form the largest donor pool worldwide for kidney While in some patients BD results from a fast increase in intracranial pressure, usually and liver transplantation1,2. Unfortunately, transplanting kidneys from brain dead donors associated with trauma, in others, intracranial pressure increases more slowly. The speed leads to a higher incidence of rejection and delayed graft function compared to living of intracranial pressure increase may be a possible risk factor for renal and hepatic graft donors3. A cerebrovascular cause of BD is related to renal and liver graft failure indicating dysfunction. This study aims to assess the effect of speed of BD induction on renal and that the nature of brain insults affect graft function as well4,5. hepatic injury markers. Brain death (BD) is a complex pathological condition, characterized by hemodynamic Methods imbalance, hormonal impairment, and a systemic infammatory response. Hemodynamic BD induction was performed in 64 mechanically ventilated male Fisher rats by infating a imbalance comprises changes elicited by brainstem herniation, the resulting catecholamine 4.0F Fogarty catheter in the epidural space. Rats were observed for 0.5 h, 1 h, 2 hrs, or 4 hrs storm, and neurogenic shock due to ischemia of the spinal cord. Systemic infammation following BD induction. Slow induction was achieved by infating the balloon-catheter at is characterized by increased levels of circulating cytokines including interleukin-6 (IL-6), a speed of 0.015 ml/min until confrmation of BD. Fast induction was achieved by infating interleukin-10 (IL-10), tumor necrosis factor-alpha (TNF-α), transforming growth factor- the balloon at 0.45 ml/min for 1 minute. Plasma, kidney and liver tissue were collected for beta (TGF-) and, monocyte chemotactic protein 1 (MCP-1)6-8. This systemic infammatory analysis. environment promotes the migration of infammatory cells into organs triggering a local infammatory and (pro-)apoptotic response9,10. Furthermore, BD affects the pituitary Results function causing endocrine alterations which are considered to exacerbate the graft 11-13 Slow BD induction led to higher plasma creatinine at all time points compared to fast deterioration . induction. Furthermore, slow induction led to increased renal mRNA expression of IL- 6, and renal MDA values after 4 hrs of BD compared to fast induction. Hepatic mRNA Brain death-related processes such as the catecholamine storm are affected by the speed expression of TNF-α, Bax/Bcl-2, and protein expression of caspase-3 was signifcantly at which intracranial pressure (ICP) increases. A faster increase in ICP leads to higher levels higher due to slow induction after 4 hrs of BD compared to fast induction. PMN infltration of circulating catecholamines, which is particularly detrimental for cardiac and pulmonary 14 was not different between fast and slow induction in both renal and hepatic tissue. graft function . Indeed, traumatic brain injury, the most common cause of BD preceded by a rapid increase in ICP, is a risk factor for mortality in heart recipients15. In contrast, a cerebrovascular cause of death, usually preceded by a slower increase in ICP, is a risk factor Conclusion for renal and hepatic graft dysfunction. However, this phenomenon is not believed to be Slow induction of BD leads to poorer renal function compared to fast induction. Also, renal associated with a slower increase in ICP. Rather, donor characteristics such as obesity, old infammatory and oxidative stress markers were increased. Liver function was not affected age, and the presence of cardiovascular disease are regarded as the underlying cause5,16,17. by speed of BD induction but hepatic infammatory and apoptosis markers increased We aimed to assess whether the speed of BD induction affects renal and hepatic quality signifcantly due to slow induction compared to fast induction. These results provide initial in brain dead donor rats. proof that speed of BD induction infuences detrimental renal and hepatic processes which could signify different donor management strategies for patients progressing to BD MATERIALS AND METHODS at different speeds. Sixty-four male Fisher F344 rats (270-300 g) were subjected to either fast or slow BD induction with a BD duration of 0.5 h, 1 h, 2 hrs, or 4 hrs. All animals received care in compliance with the guidelines of the local animal ethics committee according to the Experiments on Animals Act (1996) issued by the Ministry of Public Health, Welfare and Sports of the Netherlands. Animals were anaesthetized using 2-5% isofurane with 100%

O2. Two ml of saline 0,9% were administered s.c. to prevent dehydration during surgery. Animals were intubated via a tracheostomy and ventilated (Tidal Volume: 6.5 ml/kg of body

weight, PEEP of 3 cm of H20 at an initial respiratory rate of 120 and was adjusted to maintain

the ETCO2 in hypocapnic range) throughout the experiment. Cannulas were inserted in the femoral artery and vein for continuous mean arterial pressure (MAP) monitoring and volume replacement. Through a frontolateral hole drilled in the skull, a no. 4 Fogarty catheter (Edwards Lifesciences Co, Irvine, CA) was placed in the epidural space and infated with saline using a syringe pump (Terufusion, Termo Co., Tokyo, Japan). To prevent movements during catheter infation, a bolus of rocuronium (0,6 mg/kg) was administered. Fast and slow induction of BD were induced by infating the catheter at a speed of 0.45 ml/

22 23 CHAPTER 2 BRAIN DEATH INDUCTION SPEEDS AND ABDOMINAL EFFECTS

min or 0.015 ml/min, respectively. For slow speed induction, infation of the balloon was M-MLV reverse transcriptase (Invitrogen, 200U). The mixture was held at 37 °C for 50 min. terminated when the MAP increased above 80 mmHg. For fast induction, the catheter was Next, reverse transcriptase was inactivated by incubating the mixture for 15 min at 70 °C. infated over a period of one minute. BD was confrmed by the absence of corneal refexes Samples were stored at − 20 °C. half an hour after induction after which anesthesia was discontinued. MAP was maintained above 80 mmHg. If necessary, colloid infusion with 10% polyhydroxyethyl starch (HAES) Real-Time PCR (Fresenius Kabi AG, Bad Homburg, Germany) was given in a bolus (limited to a maximum of 1 ml/h) to maintain the MAP above 80 mmHg. Unresponsiveness to HAES indicated Fragments of several genes were amplifed with the primer sets outlined in Table 1. Pooled the start of an intravenous noradrenaline (NA) drip (1 mg/mL). A homeothermic blanket cDNA obtained from brain-dead rats was used as an internal reference. Gene expression control system was used throughout the experiment, maintaining the body temperature was normalized with the mean of -actin mRNA content. Real-Time PCR was carried out in between 37 and 38 °C. At the end of the experimental period a bolus of succinylcholine reaction volumes of 15μl containing 10μl of SYBR Green mastermix (Applied biosystems, (0.1 mg/kg) was administered in order to prevent movements during aortic puncture, Foster City, USA), 0.4μl of each primer (50μM), 4.2μl of nuclease free water and 10 ng of blood and urine were collected. Animals were systemically fushed with cold saline. After cDNA. All samples were analyzed in triplicate. Thermal cycling was performed on the the fush, organs were harvested and tissue samples were snap frozen in liquid nitrogen Taqman Applied Biosystems 7900HT Real Time PCR System with a hot start for 2 min at and stored at -80 °C or fxated in 4% paraformaldehyde. Plasma samples and urine were 50 °C followed by 10 min 95 °C. Second stage was started with 15 s at 95 °C (denaturation also snap-frozen and stored. One animal was discarded in the slow induction 2 hrs group, step) and 60 s at 60 °C (annealing step and DNA synthesis). The latter stage was repeated two animals in the fast induction group 2 hrs and one in the fast induction 4 hrs group due 40 times. Stage 3 was included to detect formation of primer dimers (melting curve) and to unknown amounts of noradrenaline administration. One animal was discarded in the begins with 15 s at 95 °C followed by 60 s at 60 °C and 15 s at 95 °C. Primers were designed fast induction 4 hrs group due to an apnea test conducted during the BD period. with Primer Express software (Applied Biosystems) and primer effciencies were tested by a standard curve for the primer pair resulting from the amplifcation of serially diluted cDNA Animals were randomly assigned to one of 8 experimental groups: samples (10 ng, 5 ng, 2.5 ng, 1.25 ng and 0.625 ng) obtained from brain-dead rats. PCR effciency was 1.8 < < 2.0. Real-time PCR products were checked for product specifcity Fast BD induction 0.5 hrs (n = 8) on a 1.5% agarose gel. Results were expressed as 2− CT (CT: Threshold Cycle). Fast BD induction 1 hrs (n = 8) Fast BD induction 2 hrs (n = 6) Fast BD induction 4 hrs (n = 6) Table 1: Primer sequences used for Real-Time PCR Slow BD induction 0.5 hrs (n = 8) Gene Primers Amplication size (bp) Slow BD induction 1 hrs (n = 8) IL-6 5’-CCAACTTCCAATGCTCTCCTAATG-3’ 89 Slow BD induction 2 hrs (n = 7) 5’- TTCAAGTGCTTTCAAGAGTTGGAT-3’ Slow BD induction 4 hrs (n = 8) TNF-α 5’-GGCTGCCTTGGTTCAGATGT-3’ 79 5’-CAGGTGGGAGCAACCTACAGTT-3’ Biochemical determinations BAX 5’-GCGTGGTTGCCCTCTTCTAC-3’ 74 Plasma levels of alanine transaminase (ALT), aspartate transaminase (AST) and creatinine 5’-TGATCAGCTCGGGCACTTTAGT-3’ were determined at the clinical chemistry lab of University Medical Centre Groningen Bcl2 5’-CTGGGATGCCTTTGTGGAA-3’ 70 according to standard procedures. 5’-TCAGAGACAGCCAGGAGAAATCA-3’

Plasma IL-6 measurement Tissue Malondialdehyde (MDA) Plasma IL-6 was determined by a rat enzyme-linked immunosorbent assay (IL-6 ELISA) kit (R&D Systems Europe Ltd. Abingdon, Oxon OX14 3NB, UK), according to the Kidney and liver tissue were homogenized with a pestle and mortar in PBS containing 5mM manufacturer’s instructions. All samples were analyzed in duplicate and read at 450 nm. butylated hydroxytoluene. MDA was measured fuorescently after binding to thiobarbituric acid. For this, 100µL of tissue homogenate was mixed with 2% SDS followed by 400µL 0.1 RNA isolation and cDNA synthesis N HCL, 50µL 10% phosphotungstic acid and 200µL 0.7% TBA. The mixture was incubated for 30 min at 97°C. To the sample 800µL of 1-butanol were added and centrifuged at 960 g. Total RNA was isolated from whole liver and kidney sections using TRIzol (Life Technologies, Of the supernatant 200 µL were used for fuorescence measurements at 480 nm excitation Gaithersburg, MD). Samples were verifed for absence of genomic DNA contamination and 590 nm emission wavelengths. Samples were corrected for total amount of protein. by performing RT-PCR reactions in which the addition of reverse transcriptase was omitted, using Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) primers. For cDNA Immunohistochemistry synthesis, 1 μl T11VN Oligo-dT (0,5 μg/μl) and 1μg mRNA were incubated for 10 min at 70 °C and cooled directly after that. cDNA was synthesized by adding a mixture containing To detect caspase-3 and HIS48 positive cells in liver and kidney, immunohistochemistry 0.5 μl RnaseOUT® Ribonuclease inhibitor (Invitrogen, Carlsbad, USA), 0.5μl RNase water was performed on 3 or 5 μm sections of paraffn embedded samples. Sections were (Promega), 4 μl 5 x frst strand buffer (Invitrogen), 2 μl DTT (Invitrogen), 1 μl dNTP’s and 1μl deparaffned in a sequence of xylene, alcohol and water. As an antigen retrieval method

24 25 CHAPTER 2 BRAIN DEATH INDUCTION SPEEDS AND ABDOMINAL EFFECTS

we used for caspase-3 samples: EDTA (1mM, pH 8.0) buffer. Next, sections were stained with Caspase-3 primary Antibody (Cell Signaling cat. nr. 9661, 100x diluted in 1% BSA/ PBS) using an indirect immunoperoxidase technique. Endogenous peroxidase was

blocked using H2O2 0.3% in phosphate-buffered saline for 30 min. After thorough washing, sections were incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG as a secondary antibody for 30 min (Dako, Glostrup, Denmark. cat. nr. P0448), followed by rabbit anti-goat IgG as a tertiary antibody for 30 min (Dako, Glostrup, Denmark. cat.

nr. P0449). The reaction was developed using DAB as chromogen and H2O2 as substrate. Sections were counterstained using Mayer hematoxylin solution (Merck, Darmstadt, Germany). For HIS48, mouse monoclonal anti-rat granulocyte antibody (HIS 48; IQ products, Groningen) was dissolved in PBS (pH 7.4) supplemented with 1% bovine serum albumin (BSA). Peroxidase-labeled second antibody (rabbit anti-mouse) was diluted in 1% BSA/PBS containing 5 % normal rat serum. Peroxidase activity was visualized using aminoethylcarbazole. Sections were counterstained with Mayers hematoxylin solution. Negative antibody controls were performed. Localization of immunohistochemical staining was assessed by light microscopy. For each tissue section, positive cells per feld were counted by a blinded researcher in 10 microscopic felds of the tissue at 10x magnifcation. Results were presented as number of positive cells per feld.

Statistical Analyses Statistical analysis was performed between both experimental groups using a Figure 1. Course of MAP during BD induction and during 4-h BD in fast- and slow-inducted rats. T = 0 represents nonparametric test (Mann Whitney) for every time point. Hazard function and the Mantel- the start of the BD period. Cox were used to compare time of HAES or Noradrenaline administration. All statistical tests were 2-tailed and p < 0.05 was regarded as signifcant. Results are presented as mean ± SD (standard deviation). The amount of HAES needed for a stable MAP was similar after fast and slow speed induction. The amount of administered NA was signifcantly higher in the fast induction RESULTS group compared to slow induction after 0.5 h and 1 h of BD (Table 2). We estimated the chance of noradrenaline and HAES utilization using hazard curves. Slow induction led to As an internal control we compared the catheter volume after brain death induction and a 17.05% probability of NA use in the frst hour of BD, while fast induction led to a 54.84% blood pressure pattern during the induction phase. The fnal catheter volume was similar probability. Additionally, we compared both curves using the Mantel-Cox test. The curves between the slow and fast induction model (0.41 ± 0.03 ml vs 0.41 ± 0.02). During BD for NA use were signifcantly different (p = 0.0004). HAES was used mainly in the frst induction, the MAP showed different characteristic patterns due to fast and slow speed minutes after BD induction. Slow induction led to a 48.39% probability of HAES use in the induction (Figure 1). Slow speed BD induction was characterized by a period of decreased frst 10 min of BD while fast induction led to a 84.38% probability. Curve comparison was blood pressure which typically started 10 min before the end of the induction and in found to be signifcantly different using the Mantel-Cox test (p = 0.0091. Figure 2). which the minimum pressure registered was 51.17 ± 10.76 mm Hg. In contrast, fast speed induction was characterized by a sudden and short increase in MAP which was typically observed at the end of the balloon infation period and in which the maximum pressure Table 2: Total Noradrenaline (1 mg/ml) and HAES 10% infusion requirements. registered was 167.39 ± 37.85 mm Hg. Time (hr) Fast Induction Slow Induction p Value Noradrenaline (ml) 0.5 0.35 ± 0.42 0.10 ± 0.24 0.0188* 1 0.55 ± 0.76 0.05 ± 0.14 0.0238* 2 1.1 ± 1.6 0.13 ± 0.25 0.1515 4 0.33 ± 0.58 0.23 ± 0.42 0.8564 HAES 10% (ml) 0.5 0.44 ± 0.18 0.31 ± 0.26 0.5692 1 0.56 ± 0.18 0.50 ± 0.0 0.9999 2 0.50 ± 0.0 0.38 ± 0.35 0.2000 4 0.56 ± 0.50 0.56 ± 0.42 0.9999

26 27 CHAPTER 2 BRAIN DEATH INDUCTION SPEEDS AND ABDOMINAL EFFECTS

Figure 2. Hazard curves for Noradrenaline and HAES utilization in fast- and slow-inducted rats. * indicates p < 0.05.

ALT and AST plasma levels were measured as liver cell injury markers. No differences were found in ALT levels between fast and slow speed induction. The AST plasma levels were increased due to fast induction compared to slow induction groups after 0.5 and 2 hrs of BD (p = 0.0225 and p = 0.0088, Figure 3).

Plasma creatinine levels were measured in order to estimate kidney function. Creatinine was signifcantly higher after slow induction compared to fast induction at every time point. Plasma urea levels were increased due to slow induction compared to fast induction after 4 hrs of BD (p = 0.0308, Figure 3). Figure 3. Plasma levels of injury markers and function markers in fast- and slow-inducted rats after 0.5, 1, 2, and 4 h BD. * indicates p < 0.05.

Plasma IL-6 levels were measured as a marker for systemic infammation. IL-6 plasma levels were signifcantly increased due to slow induction compared to fast induction after 0.5 and 1 h of BD (p = 0.0014 and p = 0.0002, Figure 4).

Figure 4. IL-6 plasma levels in fast- and slow-inducted rats after 0.5, 1, 2, and 4 h BD. * indicates p < 0.05.

28 29 CHAPTER 2 BRAIN DEATH INDUCTION SPEEDS AND ABDOMINAL EFFECTS

We assessed tissue infammation by measuring the relative expression of pro-infammatory genes in the kidney and liver. Relative TNF-α gene expression in the kidney showed no differences between fast and slow speed induction. In contrast, the relative IL-6 gene expression increased signifcantly due to slow induction compared to fast induction after 0.5 h and 4 hrs (p = 0.0348 and p = 0.0270, Figure 5A). Hepatic TNF-α gene expression increased signifcantly due to slow induction compared to fast induction after 4 hrs of BD (p = 0.0293). No difference was found in the relative gene expression of IL-6 between fast and slow induction (Figure 5B). PMN infltration in renal and hepatic tissue was assessed by His-48 staining. There was no difference in His-48 positive staining in the renal cortex and hepatic tissue between fast and slow induction (Figure 6).

Figure 6. Polymorphonuclear (PMN) infux in renal and hepatic tissue after 4 h of BD. Kidneys after A) fast induction and B) slow induction. Livers after C) fast induction and D) slow induction.

Oxidative stress was assessed by measuring lipid peroxidation. MDA levels were signifcantly higher in renal tissue due to slow induction compared to fast induction after 4 hrs of BD (p = 0.01). Hepatic MDA levels were comparable between fast and slow induction groups after 4 hrs of BD (p = 0.48. Figure 9).

Figure 5. Relative expression of infammatory genes in renal and hepatic tissue in fast and slow induction BD rats after 0.5, 1, 2, and 4 h BD. The fold induction represents the relative expressions of these genes as compared to the expression level of the household GAPDH gene. * indicates p < 0.05.

In order to study apoptotic pathways in renal and hepatic tissue, we measured the ratio between the relative Bax and Bcl-2 expression. No difference was found in the expression of this ratio in renal tissue between fast and slow induction. In contrast, the hepatic gene expression of the Bax/Bcl-2 ratio was signifcantly higher due to slow induction compared to fast induction after 4 hrs of BD (p = 0.0293, Figure 7). Additionally, hepatic cleaved caspase-3 protein expression was signifcantly increased due to slow induction compared to fast induction after 4 hrs of BD (p = 0.001, Figure 8). Figure 7. Ratio of the relative BAX/Bcl-2 expressions in the kidney and liver in fast- and slow-inducted BD rats after 0.5, 1, 2, and 4 h of BD. The fold induction represents the relative expressions of these genes as compared to the expression level of the household GAPDH gene. * indicates p < 0.05. 30 31 CHAPTER 2 BRAIN DEATH INDUCTION SPEEDS AND ABDOMINAL EFFECTS

DISCUSSION We showed that faster BD induction leads to more hemodynamic instability in the frst hour after BD induction and therefore higher amounts of noradrenaline and HAES were The speed at which brain insults progress to BD varies greatly in ICU patients. Even donors required during this time period to maintain MAP within the physiological range. This with the same nature of brain insults progress to BD at different speeds. After infarction is probably related to the higher peak of plasma catecholamine levels caused by fast of the middle cerebral artery, BD can typically manifest itself anywhere between 24 hours BD induction as was shown by Shivalkar et al14. Higher levels of catecholamines lead to and a week18. In a prospective study of patients with subarachnoid haemorrhage who increased myocardial load and injury. Myocardial injury causes a subsequent drop in blood progressed to BD, 26% were still not declared BD after one week19. This large range in pressure and increases the need of hemodynamic support13. The negative effect of fast time intervals is the result of the complex pathophysiology of the processes leading to speed induction on hemodynamic stability appears to fade over time as the administered BD and refective of the speed at which ICP increases20. As of yet, the speed at which ICP amount of HAES and NA did not differ between fast and slow induction at 2 and 4 hours increases, has not been investigated as a possible determinant of renal and hepatic graft of BD. survival. Slow BD induction leads to approximately 10 minutes of severe hypotension in rats as was Here we report for the frst time that the speed of BD induction affects functional, observed here and in other studies24,37. While cerebral insults are commonly associated immunologic, apoptotic, and oxidative stress markers in the kidney and liver. In our with hypertensive periods, there are a number of reports that associate cerebral insults experimental setting, we found that a slower speed of BD induction, elicits more with hypotensive periods in almost 50% of cases21,22 and there is a particularly high risk detrimental renal and hepatic effects compared to a faster speed of BD induction. The for iatrogenic induced hypotension23,24. Even a few minutes of hypotension has been effect of slower speed of BD induction is especially apparent in the kidney as renal function associated with an increased risk for acute kidney injury (AKI)38 possibly aggravated by is diminished which was measured by serum creatinine values. a dysfunction of the renal blood fow autoregulation39. The onset of AKI is refected by decreased kidney function and increased systemic IL-6 release40-42, as observed here. The extent of IL-6 release can predict mortality in patients and determine the degree of kidney injury43,44. However, systemic IL-6 levels described in this study became comparable between the two BD models at 2 and 4 hrs after BD induction. Therefore, systemic IL-6 levels do not refect the different local infammatory responses we observed in our model40,45. Possibly, the combination of AKI and the second hit by BD leads to increased renal IL-6 production after 4 hours of BD46 which is supported by the increased levels of renal IL-6 gene expression in our model. However, no concurrent increase was observed in PMN infltration. In non-brain dead animals, others have described an infltration at 6 hours after AKI onset47. However, BD also leads to induction of proinfammatory gene expression and infltration of immune cells48 and therefore, possibly no difference was found in PMN infux. In AKI, the infltration correlates with MDA levels in the kidney, mediated by IL- 644. In our model, the increased MDA levels in slowly-induced brain-dead rats did not coincide with an increase in PMN infux. This indicates that processes other than PMN infux affect MDA levels. It was previously shown that renal reactive oxygen species (ROS) start increasing from 2 hours of BD despite hemodynamically stable rats25. Therefore, the increase in ROS and lipid peroxidation is likely related to local changes occuring in the kidney. In AKI, oxidative processes mediate peritubular microcirculatory changes which lead to diminished renal perfusion and function35,36. In our model, increased lipid peroxidation could result from the second hit and explain the diminished renal function during the later stages of BD. No difference was observed in hepatic lipid peroxidation between fast and slow BD induction which is in line with AKI as hepatic MDA levels are the result of neutrophil granulocyte infltration48,52 for which we found no difference between models after 4 hours of BD.

Figure 8. Cleaved-caspase 3 expression in renal and hepatic tissue after 4 h of BD. Kidneys after A) fast induction and B) slow induction. Livers after C) fast induction and D) slow induction. * indicates p < 0.01

32 33 CHAPTER 2 BRAIN DEATH INDUCTION SPEEDS AND ABDOMINAL EFFECTS

In conclusion, the presented data provide an initial broad overview of changes elicited by the speed of BD induction. We found that a slower speed of BD induction leads to more detrimental effects in the kidney and liver. This could indicate that speed of BD induction should be taken into account when decisions about organ allocation are made. The effects of speed of BD induction are more pronounced in the kidney as renal function is diminished more due to a slower speed. Nevertheless, hepatic infammatory and apoptotic markers are increased more due to slow induction. We believe that increased knowledge about the processes leading up to BD can be of valuable use for brain-dead donor management and thereby improve transplantation outcomes.

Figure 9. MDA levels in renal and hepatic tissue from fast- and slow-inducted rats after 4 h of BD. * indicates p < 0.05

Plasma ALT and AST levels are known to increase in brain-dead rats6,24. In our experiment ALT levels, refective of liver cell injury, showed no differences between both induction methods. However, AST levels were higher due to fast induction compared to slow induction after 0.5 and 2 h BD. We believe this not to be a refection of liver damage due to no concurrent rise in ALT. Moreover, since AST is found in many tissues including the heart and lung, the early timepoints after which AST is increased, imply a causative role of the catecholamine storm and could be a refection of lung and/or heart damage since these organs are affected by high levels of circulating catecholamines.

Hepatic IL-6 gene expression levels did not differ between models and neither was there a difference in PMN infux. However, hepatic TNF-α gene expression was signifcantly increased due to slow induction compared to fast induction after 4 hours of BD. Besides slow-induction, AKI can be responsible for this fnding as it can lead to distant organ injury and increase hepatic TNF-α gene expression and apoptosis49,50. In our model, slow induction led to increased TNF-α gene and caspase-3 expression even though this group received isofurane half an hour longer which has been shown to limit distant organ injury- induced liver apoptosis [18, 19]. TNF-α is a known inducer of extrinsic apoptosis and therefore signaling through death receptor mediated pathways is plausible in our model29. Since TNF-α has a major implication in hepatic ischemia-reperfusion injury, evaluating hepatic TNF-α levels in human donors that progress to BD at different speeds could reveal differences30-32. Hepatic mRNA expression of the Bax/Bcl-2 ratio was also signifcantly increased due to slow induction compared to fast induction which also suggests a possible role of intrinsic apoptosis through the permeabilization of mitochondria. The causal relationship of these processes and how they are initiated remains unclear and therefore, future investigations should focus on them in more depth. However, a possible cause could be the deposition of complement which has been shown to occur in livers of brain-dead rats and which is a known inducer of apoptosis24. Renal mRNA expression of the Bax/Bcl-2 ratio was not different between fast and slow BD induction. Moreover, there was no renal expression of caspase-3 after both fast and slow induction. This could indicate that the renal insults caused by BD are not severe enough to initiate programmed cell death or that other forms of cell death are initiated which we did not study7,21,22.

34 35 CHAPTER 2 BRAIN DEATH INDUCTION SPEEDS AND ABDOMINAL EFFECTS

REFERENCES 17. Cuende N, Miranda B, Cañón JF, 26. Koudstaal LG, t Hart NA, Ottens Garrido G, Matesanz R. Donor PJ, Van Den Berg A, Ploeg RJ, Van 1. Mizraji R, Alvarez I, Palacios RI, 9. Jassem W, Koo DDH, Cerundolo characteristics associated with liver Goor H, et al. Brain death induces Fajardo C, Berrios C, Morales F, et L, Rela M, Heaton ND, Fuggle graft survival. Transplantation. 2005 infammation in the donor intestine. al. Organ Donation in Latin America. SV. Leukocyte infltration and May 27;79(10):1445–52. Transplantation. 2008 Jul 15;86(1):148– Transplantation Proceedings. 2007 infammatory antigen expression 18. Hacke W, Schwab S, Horn M, Spranger 54. Mar;39(2):333–5. in cadaveric and living-donor livers M, De Georgia M, Kummer von R. 27. Saat TC, Susa D, Roest HP, Kok NFM, 2. Sung RS, Galloway J, Tuttle-Newhall before transplant. Transplantation. “Malignant” middle cerebral artery van den Engel S, IJzermans JNM, et JE, Mone T, Laeng R, Freise CE, et 2003 Jun 27;75(12):2001–7. territory infarction: clinical course and al. A Comparison of Infammatory, al. Organ donation and utilization in 10. Nijboer WN, Schuurs TA, van der prognostic signs. Arch Neurol. 1996 Cytoprotective and Injury Gene the United States, 1997-2006. Am J Hoeven JAB, Leuvenink HGD, van der Apr;53(4):309–15. Expression Profles in Kidneys From Transplant. 2008 Apr 1;8(4 Pt 2):922– Heide JJH, van Goor H, et al. Effects of 19. Lantigua H, Ortega-Gutierrez S, Brain Death and Cardiac Death 34. brain death on stress and infammatory Schmidt JM, Lee K, Badjatia N, Agarwal Donors. Transplantation. 2014 3. Terasaki PI, Cecka JM, Gjertson DW, response in the human donor kidney. S, et al. Subarachnoid hemorrhage: Jul;98(1):15–21. Takemoto S. High survival rates of Transplantation Proceedings. 2005 who dies, and why? Crit Care. BioMed 28. Schuurs TA, Gerbens F, Van Der kidney transplants from spousal and Jan;37(1):367–9. Central Ltd; 2015;19(1):309. Hoeven JAB, Ottens PJ, Kooi KA, living unrelated donors. N Engl J Med. 11. Novitzky D, Cooper DKC, Rosendale 20. Simard JM, Kent TA, Chen M, Tarasov Leuvenink HGD, et al. Distinct 1995 Aug 10;333(6):333–6. JD, Kauffman HM. Hormonal KV, Gerzanich V. Brain oedema in focal transcriptional changes in donor 4. Feng S, Goodrich NP, Bragg-Gresham therapy of the brain-dead organ ischaemia: molecular pathophysiology kidneys upon brain death induction JL, Dykstra DM, Punch JD, DebRoy donor: experimental and clinical and theoretical implications. Lancet in rats: insights in the processes of MA, et al. Characteristics associated studies. Transplantation. 2006 Dec Neurol. 2007 Mar;6(3):258–68. brain death. Am J Transplant. 2004 with liver graft failure: the concept of 15;82(11):1396–401. 21. Van Der Hoeven JAB, Molema G, Dec;4(12):1972–81. a donor risk index. Am J Transplant. 12. Novitzky D, Horak A, Cooper DK, Horst Ter GJ, Freund RL, Wiersema J, 29. Van Der Hoeven JAB, Moshage Blackwell Publishing Ltd; 2006 Rose AG. Electrocardiographic and van Schilfgaarde R, et al. Relationship H, Schuurs T, Nijboer M, van Apr;6(4):783–90. histopathologic changes developing between duration of brain death Schilfgaarde R, Ploeg RJ. Brain death 5. Pessione F, Cohen S, Durand D, during experimental brain death in and hemodynamic (in)stability induces apoptosis in donor liver of Hourmant M, Kessler M, Legendre C, the baboon. TPS. 1989 Feb;21(1 Pt on progressive dysfunction and the rat. Transplantation. 2003 Oct et al. Multivariate analysis of donor 3):2567–9. increased immunologic activation 27;76(8):1150–4. risk factors for graft survival in kidney 13. Cooper DK, Novitzky D, Wicomb of donor kidneys. Kidney Int. 2003 30. Spencer NY, Zhou W, Li Q, Zhang transplantation. Transplantation. 2003 WN. The pathophysiological effects Nov;64(5):1874–82. Y, Luo M, Yan Z, et al. Hepatocytes Feb 15;75(3):361–7. of brain death on potential donor 22. Novitzky D, Cooper DK, Morrell produce TNF- following hypoxia- 6. Weiss S, Kotsch K, Francuski M, organs, with particular reference to D, Isaacs S. Change from aerobic reoxygenation and liver ischemia- Reutzel-Selke A, Mantouvalou L, the heart. Annals of the Royal College to anaerobic metabolism reperfusion in a NADPH oxidase- Klemz R, et al. Brain death activates of Surgeons of England. 1989 Jul after brain death, and reversal and c-Src-dependent manner. AJP: donor organs and is associated 1;71(4):261–6. following triiodothyronine therapy. Gastrointestinal and Liver Physiology. with a worse I/R injury after liver 14. Shivalkar B, Van Loon J, Wieland W, Transplantation. 1988 Jan;45(1):32–6. 2013 Jul 1;305(1):G84–94. transplantation. Am J Transplant. 2007 Tjandra-Maga TB, Borgers M, Plets 23. Myburgh JA, Mythen MG. 31. Goto M, Takei Y, Kawano S, Tsuji Jun;7(6):1584–93. C, et al. Variable effects of explosive Resuscitation fuids. N Engl J Med. S, Fukui H, Fushimi H, et al. Tumor 7. Nijboer WN, Schuurs TA, Van Der or gradual increase of intracranial 2013 Sep 26;369(13):1243–51. necrosis factor and endotoxin in the Hoeven JAB, Fekken S, Wiersema- pressure on myocardial structure 24. Rebolledo R, Liu B, Akhtar MZ, pathogenesis of liver and pulmonary Buist J, Leuvenink HGD, et al. Effect of and function. Circulation. 1993 Ottens PJ, Zhang J-N, Ploeg RJ, et injuries after orthotopic liver Brain Death on Gene Expression and Jan;87(1):230–9. al. Prednisolone has a positive effect transplantation in the rat. Hepatology. Tissue Activation in Human Donor 15. Cohen O, La Zerda De DJ, Beygui on the kidney but not on the liver of 1992 Aug;16(2):487–93. Kidneys. Transplantation. 2004 Oct R, Hekmat D, Laks H. Donor brain brain dead rats: a potencial role in 32. Ben-Ari Z, Hochhauser E, Burstein I, 1;78(7):978–86. death mechanisms and outcomes complement activation. Journal of Papo O, Kaganovsky E, Krasnov T, et 8. Murugan R, Venkataraman R, Wahed after heart transplantation. TPS. 2007 Translational Medicine. 2014;12(1):111. al. Role of anti-tumor necrosis factor- AS, Elder M, Hergenroeder G, Carter Dec;39(10):2964–9. 25. Schuurs TA, Morariu AM, Ottens PJ, T alpha in ischemia/reperfusion injury M, et al. Increased plasma interleukin-6 16. Feng S, Goodrich NP, Bragg-Gresham Hart NA, Popma SH, Leuvenink HGD, in isolated rat liver in a blood-free in donors is associated with lower JL, Dykstra DM, Punch JD, DebRoy et al. Time-dependent changes in environment. Transplantation. 2002 recipient hospital-free survival after MA, et al. Characteristics associated donor brain death related processes. Jun 27;73(12):1875–80. cadaveric organ transplantation*. with liver graft failure: the concept of Am J Transplant. 2006 Dec;6(12):2903– Critical Care Medicine. 2008 a donor risk index. Am J Transplant. 11. Jun;36(6):1810–6. 2006 Apr;6(4):783–90. 36 37 CHAPTER 2 BRAIN DEATH INDUCTION SPEEDS AND ABDOMINAL EFFECTS

33. Morariu AM, Schuurs TA, Leuvenink 41. Grigoryev, D.N., et al., The local and 52. Allen, B.S., The role of leukodepletion HGD, van Oeveren W, Rakhorst G, systemic infammatory transcriptome in limiting ischemia/reperfusion Ploeg RJ. Early Events in Kidney after acute kidney injury. J Am Soc damage in the heart, lung and lower Donation: Progression of Endothelial Nephrol, 2008. 19(3): p. 547-58. extremity. Perfusion, 2002. 17 Suppl: p. Activation, Oxidative Stress and 42. Mehta, R.L., et al., Acute Kidney Injury 11-22. Tubular Injury After Brain Death. Am J Network: report of an initiative to Transplant. 2008 May;8(5):933–41. improve outcomes in acute kidney 34. Kosieradzki M, Kuczynska J, injury. Crit Care, 2007. 11(2): p. R31. Piwowarska J, Wegrowicz-Rebandel I, 43. Simmons, E.M., et al., Plasma cytokine Kwiatkowski A, Lisik W, et al. Prognostic levels predict mortality in patients with signifcance of free radicals: mediated acute renal failure. Kidney Int, 2004. injury occurring in the kidney donor. 65(4): p. 1357-65. Transplantation. 2003 Apr;75(8):1221– 44. Patel, N.S., et al., Endogenous 7. interleukin-6 enhances the renal injury, 35. Seely KA, Holthoff JH, Burns ST, dysfunction, and infammation caused Wang Z, Thakali KM, Gokden N, et al. by ischemia/reperfusion. J Pharmacol Hemodynamic changes in the kidney Exp Ther, 2005. 312(3): p. 1170-8. in a pediatric rat model of sepsis- 45. Barrera-Chimal, J., et al., induced acute kidney injury. AJP: Renal Spironolactone prevents chronic Physiology. American Physiological kidney disease caused by ischemic Society; 2011 Jul;301(1):F209–17. acute kidney injury. Kidney Int, 2013. 36. Wang Z, Holthoff JH, Seely KA, 83(1): p. 93-103. Pathak E, Spencer HJ, Gokden N, 46. Saadia, R. and M. Schein, Multiple et al. Development of oxidative organ failure. How valid is the “two stress in the peritubular capillary hit” model? J Accid Emerg Med, 1999. microenvironment mediates sepsis- 16(3): p. 163-6; discussion 166-7. induced renal microcirculatory failure 47. Hassoun, H.T., et al., Ischemic acute and acute kidney injury. Am J Pathol. kidney injury induces a distant organ 2012 Feb;180(2):505–16. functional and genomic response 37. Marshman, L.A., Cushing’s ‘variant’ distinguishable from bilateral response (acute hypotension) nephrectomy. Am J Physiol Renal after subarachnoid hemorrhage. Physiol, 2007. 293(1): p. F30-40. Association with moderate intracranial 48. Takada, M., et al., Effects of explosive tensions and subacute cardiovascular brain death on cytokine activation collapse. Stroke, 1997. 28(7): p. 1445- of peripheral organs in the rat. 50. Transplantation, 1998. 65(12): p. 1533- 38. Walsh, M., et al., Relationship between 42. intraoperative mean arterial pressure 49. Golab, F., et al., Ischemic and non- and clinical outcomes after noncardiac ischemic acute kidney injury cause surgery: toward an empirical defnition hepatic damage. Kidney Int, 2009. of hypotension. Anesthesiology, 2013. 75(8): p. 783-92. 119(3): p. 507-15. 50. Serteser, M., et al., Changes in hepatic 39. Kirchheim, H.R., et al., Autoregulation TNF-alpha levels, antioxidant status, of renal blood fow, glomerular and oxidation products after renal fltration rate and renin release in ischemia/reperfusion injury in mice. J conscious dogs. Pfugers Arch, 1987. Surg Res, 2002. 107(2): p. 234-40. 410(4-5): p. 441-9. 51. Van Der Hoeven, J.A., et al., Brain 40. Kielar, M.L., et al., Maladaptive role of death induces apoptosis in donor liver IL-6 in ischemic acute renal failure. J of the rat. Transplantation, 2003. 76(8): Am Soc Nephrol, 2005. 16(11): p. 3315- p. 1150-4. 25.

38 39 CHAPTER Quality of donor lung grafts: 3 a comparative study between explosive and gradual brain death induction models in rats

CMV Hottenrott RA Rebolledo D Hoeksma J Bubberman J Burgerhof A Breedijk B Yard M Erasmus HGD Leuvenink

In preparation CHAPTER 3 BRAIN DEATH INDUCTION SPEEDS AND PULMONARY EFFECTS

ABSTRACT INTRODUCTION Introduction Lung transplantations are commonly performed using lungs derived from brain dead organ donors, who died of an extensive central nervous system injury secondary to an Despite the fact that brain death induces pro-infammatory changes, correlating with event of trauma, hemorrhage or infarction1. At onset of brain death series of detrimental the reduction of graft quality and outcome after transplantation, brain dead donors are processes is initiated as a result of increased intracranial pressure. Initially, a massive the major source for transplantation. This study is designed to test whether explosive or increase of catecholamines in the blood occurs, also known as autonomic storm, this is 3 gradual increase in intra cranial pressure, to induce brain death, have a differential effect accompanied by a signifcant increase in systemic vascular resistance (SVR)2-4. The sudden 3 on the graft quality, and to identify deleterious mechanisms during brain death. increase in systemic vascular resistance results in the pooling of a large proportion of the total blood volume in the cardio pulmonary vasculature. Shortly after the autonomic storm Materials and methods the SVR decreases again and the aortic blood fow either normalizes or in most of the 5 Fisher (F344) rats were randomly assigned into three donor groups: 1) no intervention and subjects even results in hypotension . immediate sacrifcation, 2) explosive - and 3) gradual brain death induction model, the Along with the hemodynamic changes brain death initiates an immune response in the 6 latter were subdivided in sacrifcation time points 30 minutes, 1 hour, 2hrs. and 4 hrs. after peripheral organs . Brain death related changes have been identifed as underlying reason 7 brain death induction. During the brain death period the animals were hemodynamically for inferior outcome after lung transplantation . The lung seems to be more susceptible stabilized (MAP > 80 mmHg) and lung protective ventilated (VT = 6.5 ml/kg of body weight to brain death induced injury than other organ systems because from reported brain dead and a PEEP of 3 cmH Hemodynamic changes and pulmonary inspiratory pressure donors 90% of the kidneys and 70% of the livers were procured for transplantation in 2O). 8 9 were monitored, the lungs (n = 8/ group; excluding lost animals) were analyzed with a contrast to only 20% of the lungs in 2007 . Lungs are selected dependent on their quality . histological scoring system and for pro-infammatory changes in gene expression with Reduced graft quality is the result of both, the early hemodynamic changes and the pro- polymerase chain reaction. infammatory immune response which are also linked to the formation of pulmonary edema and increased pulmonary capillary leakage10-12. Nevertheless, more pronounced Results hemodynamic and hormonal changes have been described for the explosive brain death model13,14. As a consequence of the more pronounced alterations in the explosive model Immediately after explosive traumatic brain death induction 6 rats were lost, developing ischemic injury in the donor hearts is more severe, explaining the inferior outcome after severe lung edema and subsequent failure of ventilation compared to none in the gradual transplantation14. The hemodynamic changes in the explosive model have been suggested model. Remarkable was the difference in mean arterial pressure before onset of brain to impact the graft quality before as well as after transplantation10,15. In difference to other death, followed by a considerably higher need of inotropic support in the explosive brain organ systems clinical data are not conclusive whether cause of brain death affects lung death model. In both groups patho-histological changes were found, but in the explosive transplantation outcome16-19. We investigated in an animal experiment if the etiology of model parenchyma injury was already pronounced immediately after confrmation of brain brain death affects the quality of the donor lung graft and whether this is due to differences death as a result of a more pronounced edema formation in the explosive model. The in hemodynamics, immune response or both. over time increasing pro-infammatory changes in gene expression were not substantially different between the models, with the exception of the Vcam1 gene expression that was more pronounced in the gradual model. MATERIALS AND METHODS Animals Conclusion All rats were kept under clean conventional conditions, with a 12/12h light-dark cycle at The results of this study suggest that donor lungs suffer more injury after explosive 22°C and were fed standard rat chow ad libitum. All animals received humane care in onset of brain death, possibly making them unsuitable for transplantation, compared to compliance with the Principles of Laboratory Animal Care (NIH Publication No.86-23, gradual onset. However, fndings in gene expression lead us to conclude that if lungs revised 1985) and the Dutch Law on Experimental Animal Care. The experiments were are considered suitable for transplantation the outcome after transplantation should be approved by the local animal care committee. independent of the etiology of brain death. Experimental groups Fisher (F344) rats weighing 270-300g at the time of experiment were obtained from Harlan, Netherlands. In total seventy-two (excluding 6 animals lost after BD induction) rats were randomly assigned into three groups: 1) no intervention (control), 2) explosive (1 minute) or 3) gradual (30 minutes) brain death induction model. Animals in group 2 and 3 were sacrifced at four different time points: 30 minutes, 1 hour, 2 hours and 4 hours after onset of brain death.

42 43 CHAPTER 3 BRAIN DEATH INDUCTION SPEEDS AND PULMONARY EFFECTS

Brain death model Gene expression analyses were performed at mRNA level by TaqMan low density array (TDLA). Designed primer sets (Table 1) were loaded with 5 μl cDNA (2ng/µl) and SYBR green Anaesthesia was induced with oxygen (1 l/min) /isofurane 5% and reduced to oxygen/ (Applied Biosystems) into a well of a Taqman low density Array (TLDA) card. Amplifcation isofurane 2% for continuation. Subcutaneously 2 ml of saline were administered before and detection were performed with the ABI Prism 7900-HT Sequence Detection System the start of surgery. Animals were tracheotomized in supine position, intubated with a (Applied Biosystems) measuring the emission of SYBR green. Each sample was measured 14G polyethylene tube and mechanically volume controlled ventilated with a Harvard in triplicate and a pool of sample cDNA served as calibrator. PCR reaction consisted of apparatus (model 683). The ventilation was set at a tidal volume of 6.5 ml/kg of body 40 cycles at 95°C for 15 sec. and 60°C for 60 sec. after initiation for 2 min. at 50°C and 10 3 weight (BW), PEEP of 3 cmH2O and fraction of inspired oxygen (FiO2) of 1 until the end of min. at 95°C. A dissociation curve analysis was performed for each reaction to ensure the 3 brain death induction when it was reduced to 0.5. The respiratory frequency was initially amplifcation of specifc products. set at 120/min. and was throughout the experiment adjusted as needed to keep the Gene expression was normalized with the mean of the housekeeping genes PPIA and ETCO2 between 20-22 mmHg. Eif2b1, and gene expression values calculated with the ∆∆Ct method20. The left femoral artery was cannulated and used for continuous monitoring of mean arterial pressure (MAP), while the left femoral vein was cannulated and used to stabilize the MAP above 80 mmHg by fuid boli (with a maximum of 1 ml per hour) of colloidal Table 1. Designed PCR primers solution (HAES- steril 10%, Fresenius Kabi, Bad Homburg, Germany) and infusions of Primer Gene Forward Primer Reverse Primer Amplicon norepinephrin (0.01 mg/ml) as needed with a perfusor. (bp) In all experimental groups, a fronto-lateral burr hole was drilled with a microdrill at 10,000 Tumor necrosis Tnf AGGCTGTCGCTACATCACTGAA TGACCCGTAGGGCGATTACA 67 rpm with the boring head 9905 (Dremel, Breda, Netherlands) and a 4F Fogarty catheter factor (Edwards Lifesciences LLC, Irvine, U.S.A.) inserted. Brain death was induced with 0.45 ± Il6 Interleukin 6 CCAACTTCCAATGCTCTCCTAATG TTCAAGTGCTTTCAAGAGTTGGAT 89 0.5 ml distilled water by infusion and expansion of the 4F Fogarty catheter with a syringe Chemokine perfusor pump (Terufusion Syringe Pump, model STC-521). For the explosive model the Cinc1 (C-x-C motif) TGGTTCAGAAGATTGTCCAAAAGA ACGCCATCGGTGCAATCTA 78 fogarty catheter was expanded in 60 sec., for the gradual model in 30 min. To reduce ligand 1 muscle movements during BD induction 0.6 mg/kg of bodyweight rocuronium was given. Ccl1 Chemokine (C-C CTTTGAATGTGAACTTGACCCATAA ACAGAAGTGCTTGAGGTGGTTGT 78 Body temperature was monitored rectally and kept at 38°C with a heating pad. Brain death (Mcp1) motif) ligand 2 was confrmed by the absence of corneal refexes 30 minutes after brain death induction. Intercellular At the end of the observation period 0.1 mg/kg of BW succinylcholine was given i.v. just Icam1 adhesion CCAGACCCTGGAGATGGAGAA AAGCGTCGTTTGTGATCCTCC 251 molecule 1 prior to organ harvest to prevent movement due to spinal refexes. After this a laparo- and thoracotomy was performed and the aorta was punctured to withdraw blood for plasma Vascular Vcam1 adhesion TGTGGAAGTGTGCCCGAAA ACGAGCCATTAACAGACTTTAGCA 84 analysis, the circulatory system was subsequently fushed with 40 ml of cold saline after molecule 1 incision of the inferior cava vein and the lung was harvested, after infating the lung with Glyceraldehyde- 2 ml of air with a syringe and clamping of the trachea. Control group lungs were not Gapdh 3-phosphate GTATGACTCTACCCACGGCAAGTT GATGGGTTTCCCGTTGATGA 79 infated since the animals were not intubated. Lung-parts were fxed with 4% of formalin dehydrogenase for histological analysis or snap frozen for wet-dry ratio and molecular biology analysis. B-actin Actin, beta GGAAATCGTGCGTGACATTAAA GCGGCAGTGGCCATCTC 74 Heme- Ho1 CTCGCATGAACACTCTGGAGAT GCAGGAAGGCGGTCTTAGC 74 Wet-Dry ratio oxygenase 1 Peptidylprolyl Ppia TCTCCGACTGTGGACAACTCTAATT CTGAGCTACAGAAGGAATGGTTTGA 76 The weights of the primarily in Eppendorf tubes snap frozen right middle lung lobes were isomerase A measured before and after they were placed for 24 hrs at 100°C on aluminum foil. The Eukaryotic W/D ratio was calculated ((weight before drying at 100°C – alu foil) / (weight after drying at translation Eif2b1 ACCTGTATGCCAAGGGCTCATT TGGGACCAGGCTTCAGATGT 77 100°C – alu foil) = Wet-Dry ratio) and is given as the mean ± standard deviation. initiation factor 2B RNA isolation and reverse transcriptase Polymerase-Chain Reaction Total RNA was isolated from snap frozen lung tissue using Trizol (Invitrogen Life Technologies, Breda, Netherlands) according to the manufacturer’s instructions. Guanidine thiocyanate Histological scoring contaminated samples, identifed by E260/E230 ratio below 1.6 with the nanodrop 1000 Lungs were fxed in 4% formalin, embedded in paraffn and cut in four-µm-thick slices, spectrophotometer, were purifed before continuation. The integrity of total RNA was subsequently stained with haematoxylin-eosin. A fve-point semiquantitative severity- analyzed by gelelectrophoresis. To remove genomic DNA total RNA was treated with based scoring system was used as previously described21. The pathological fndings were DNAse I (Invitrogen, Breda, Netherlands). Of this 1 µg RNA was transcribed into cDNA graded as negative = 0, slight = 1, moderate = 2, high = 3, and severe = 4. The amount using M-MLV (Moloney murine leukemia virus) Reverse Transcriptase (Invitrogen, Breda, of intra- and extra-alveolar haemorrhage, intra-alveolar edema, infammatory infltration Netherlands) in the presence of dNTPs (Invitrogen, Breda, Netherlands), after an initial of the interalveolar septa and airspace and overinfation were rated. Deviating from the incubation with Oligo-dT primers (Invitrogen, Breda, Netherlands). original scoring scheme erythrocyte accumulation below the pleura was scored as 1 =

44 45 CHAPTER 3 BRAIN DEATH INDUCTION SPEEDS AND PULMONARY EFFECTS

present or 0 = not present. The scoring variables were added and a histological total Table 2. Physiological parameters selected in the brain dead donor groups. lung injury score per slide was calculated after morphological examination was performed BL BD BD 1h BD 2h BD 4h simultaneously by two blinded investigators. For this a conventional light microscope was 0.5h used at a magnifcation of 200 across 10 random, non-coincidental microscopic felds. EM GM EM GM EM GM EM GM EM GM n = 30 n = 29 n = 27 n = 19 n = 22 n = 21 n = 15 n = 12 n = 5 n = 6 Plasma analysis Paw 8 ± 1 8 ± 1 9 ± 1 9 ± 1 9 ± 1 9 ± 1 10 ± 2 9 ± 2 11 ± 2 10 ± 2 (cmH O) 3 The collected blood was immediately placed into EDTA-tubes after harvest and centrifuged 2 3 at 10,000 rpm at 4°C. Supernatant was transferred into sterile Eppendorf tubes and stored HR 345 ± 352 ± 426 ± 408 ± 425 ± 375 ± 415 ± 375 ± 387 ± 385 ± until further use at – 80°C. Analysis for troponin and CK-MB were performed in the clinical (/min.) 33 48 48 56 52 58 48 58 44 34 laboratory. The given values are presented as mean ± standard error of the mean. Statistical Analysis A two-way ANOVA was conducted to examine the effects of brain death model and time BD 0.5h– 4h– brain dead group with period of ventilation and circulatory stabilization on physiological parameters, wet-dry-ratio, RTD- PCR, histological scoring, total volume time; BL– baseline before brain death induction; EM– explosive brain death induction administration, NA, CK-MB and Troponin. Outliers were assessed by inspection of the model, expansion of the fogarty catheter in 60 sec. with a pump; GM– gradual brain boxplot. Normality of the data distributions were visually inspected using probability- death induction model, expansion of the fogarty catheter over a period of 30 min. with a probability plot (P-P plot). Not normally distributed data were transformed by the natural pump; HR– heart rate (beats/min.); MAP– mean arterial pressure; Paw– pulmonary airway logarithm. To correct zero values in total volume administration and histological scoring pressure; 0.1 was added before performing the natural logarithm. Mean arterial pressure during The mean arterial pressure in the explosive model was signifcantly higher during twenty brain death induction, Mcp1 and Vcam1 showed in the boxplot a quadratic relationship minutes before end of brain death induction compared to the gradual model. During the with time, for that reason data were transformed by centering the time before end of brain initial phase of hemodynamic stabilization was the MAP higher in the explosive model, death induction for MAP at -10 and Vcam1 and Mcp1 at 1.5 h, subsequently the time was while there was no difference between groups after four hours of stabilization (Figure 1). squared before proceeding. For not normally distributed data (Paw, HR, total volume, NA, In contrast to this the need of total volume administration in the explosive model was wet-dry-rato, edema and pleura infarction) the Mann-Whitney test was used to determine higher compared to the gradual model (1.2 ± 1.1 ml (EM) vs. 0.6 ± 0.5 ml (GM); p < 0.05). differences between brain death models. The MAP was not normally distributed at end of Nevertheless, there were no relevant differences in Wet-Dry ratio between the groups brain death induction and after 4hrs of brain death therefore a Mann-Whitney test was used including the control group. comparing the two brain death models. Data from animals with failure of hemodynamic stabilization were excluded from analysis. Presented data are given as mean ± standard deviation (SD) if not mentioned otherwise. Statistical signifcance was set at p < 0.05. Statistical analyses were performed using IBM SPSS 22.

RESULTS Failure of hemodynamic stabilization Fisher rats (F344) were randomly assigned to control or the brain death models with subgroups of different stabilization periods. In the explosive brain death arm 6 animals were lost immediately after the induction of brain death since ventilation was not feasible (excluded from analysis and replaced), while no animal was lost in the gradual brain death model. At dissection of the thoracic cavity in 5 out of 6 animals a fulminant lung edema was visible.

Physiological data Of the three groups, only the two brain death groups were ventilated and stabilized during which time physiological data were collected. The parameters pulmonary inspiratory pressure, heart rate and mean arterial pressure of each brain death model were taken together as available for the given time points and analyzed (Table 2). There was no difference in pulmonary inspiratory pressure between the models but the heart rate was Figure 1. Mean arterial pressure overtime. Expansion of the fogarty catheter and induction of brain death was fnished at time point zero in both models. After end of brain death induction all animals were stabilized above a elevated in the explosive brain death model. mean arterial pressure of 80 mmHg. The presented mean arterial pressure data are depicted as mean.

46 47 CHAPTER 3 BRAIN DEATH INDUCTION SPEEDS AND PULMONARY EFFECTS

The time of brain death induction does not infuence the investigated proinfammatory gene expression during 4 hrs. of brain death In both brain death models the pro-infammatory cytokine gene expression of Tnf and Il6 was induced, but levels did not reach signifcance between the two models. Gene expression of the Il8-like Cinc1 was unaffected by groups and time. For Mcp1 and Vcam1 an increase in a quadratic regression was noted over time with the time centered at 1.5 3 hrs. For Gapdh a trend towards signifcance (p < 0.053) was found between groups for that 3 reason different housekeeping genes were chosen for further analysis (Table 3).

Table 3. Changes in pro-infammatory cytokine gene expression after different durations of brain death.

RTD-PCR BD 0.5h BD 1h BD 2h BD 4h Control EM GM EM GM EM GM EM GM n = 8 n = 8 n = 8 n = 8 n = 8 n = 8 n = 8 n = 8 n = 8 0.02 ± 1.05 ± 0.60 ± 0.73 ± 0.91 ± 0.75 ± 0.88 ± 1.39 ± 1.52 ± Tnf 0.00 0.36 0.32 0.19 0.32 0.22 0.34 0.65 0.80 Figure 2. Histological total lung injury score. Formalin fxed, paraffn embedded and haematoxylin-eosin stained 0.01 ± 0.72 ± 0.57 ± 0.75 ± 1.17 ± 3.62 ± 2.53 ± 7.22 ± 12.20 ± Il6 left lung lobe slices were scored for the extent of intra- and extra-alveolar haemorrhage, intra-alveolar edema, 0.02 1.49 0.60 0.40 0.93 2.78 2.99 6.74 9.49 infammatory infltration of the interalveolar septa and airspace and overinfation. The pathological fndings were 0.03 ± 0.69 ± 0.41 ± 0.92 ± 1.67 ± 1.58 ± 1.42 ± 1.08 ± 1.38 ± graded as negative = 0, slight = 1, moderate = 2, high = 3, and severe = 4. Deviating from the published original Cinc1 0.03 0.97 0.33 0.60 0.92 1.36 1.11 1.01 0.76 scoring scheme erythrocyte accumulation below the pleura was scored as 1 = present or 0 = not present. The sum of variables gave the total lung injury score. Morphological examination was performed in a blinded fashion by 2 0.02 ± 0.35 ± 0.10 ± 0.2 ± 0.5 ± 1.22 ± 1.24 ± 1.62 ± 2.52 ± Mcp1 investigators, using a conventional light microscope at a magnifcation of 200 across 10 random, non-coincidental 0.02 0.71 0.06 0.10 0.21 0.83 0.26 0.60 1.23 microscopic felds. All values are presented as mean. 0.14 ± 0.55 ± 0.98 ± 1.33 ± 1.59 ± 0.99 ± 1.27 ± 0.81 ± 1.08 ± Control- no intervention; EM- explosive brain death induction within 1 minute by expansion of a intracranial Vcam1 0.04 0.25 0.39 0.36 0.26 0.38 0.27 0.46 0.34 fogarty catheter; GM- gradual brain death induction over a period of 30 minutes; 0.5- 30 minutes of donor stabilization; 1/2/4- hours of donor management 0.82 ± 0.98 ± 1.26 ± 1.44 ± 1.52 ± 1.33 ± 1.75 ± 1.83 ± 1.82 ± GAPDH 0.48 0.39 0.39 0.28 0.24 0.52 058 0.23 0.74

The presented values are mean ± standard deviation (SD). Table 4. Histological lung injury score. BD 0.5h– 4h– brain dead group with period of ventilation and circulatory stabilization time; Control– immediately sacrifced without intervention; Ccl2– chemokine (C-C motif) ligand 2, also known as Mcp1 (Monocyte chemotactic Histological BD BD 1h BD 2h BD 4h protein1); Cxcl1– chemokine (C-x-C motif) ligand 1, also known as Cinc1 (Cytokine induced neutrophil 0.5h chemoattractant1); EM– explosive brain death induction model, expansion of the fogarty catheter in 60 sec. with Score a pump; GM– gradual brain death induction model, expansion of the fogarty catheter over a period of 30 min. Control EM GM EM GM EM GM EM GM with a pump; Il6– interleukin 6; RTD-PCR– real-time detection PCR; Tnf– tumor necrosis factor; Vcam1– vascular adhesion molecule 1 n = 8 n = 8 n = 8 n = 8 n = 8 n = 8 n = 8 n=8 n=8 1.5 ± 0.1 ± 0.3 ± 0.0 ± 1.7 ± 0.2 ± 1.7 ± 0.3 ± Hemorrhage 0.2 ± 0.1 1.8 0.2 0.6 0.0 1.5 0.2 0.5 0.3 0.3 ± 0.0 ± 0.1 ± 0.0 ± 0.3 ± 0.0 ± 0.8 ± 0.0 ± Explosive brain death induction results in more severe lung injury then gradual Edema 0.0 ± 0.0 0.3 0.0 0.1 0.0 0.4 0.0 1.2 0.0 brain death induction on a histological level 2.3 ± 1.6 ± 1.7 ± 1.7 ± 2.8 ± 2.0 ± 2.7 ± 2.2 ± Infammation 1.6 ± 0.6 Total lung injury score was higher in the explosive brain death model than in the gradual 0.7 0.9 0.5 0.4 0.6 0.7 0.9 1.1 brain death model, as well as changes are signifcant over time. This is the result of a 0.9 ± 0.6 ± 0.5 ± 0.6 ± 1.0 ± 0.6 ± 0.9 ± 1.3 ± Over-infation 0.0 ± 0.1 more pronounced hemorrhagic infarcted lung tissue, edema and pleural infarction in the 0.6 0.4 0.3 0.4 0.5 0.3 0.7 0.7 explosive model compared to the gradual brain death model (Figure 2 + Table 4). Pleura 0.3 ± 0.0 ± 0.3 ± 0.1 ± 0.8 ± 0.0 ± 0.6 ± 0.0 ± 0.1 ± 0.4 Infarction 0.5 0.0 0.5 0.4 0.5 0.0 0.5 0.0 5.2 ± 2.3 ± 2.8 ± 2.4 ± 6.5 ± 2.7 ± 6.8 ± 3.8 ± Total 2.0 ± 0.6 3.0 1.2 1.1 0.7 2.4 0.6 3.3 1.5

The values presented are mean ± standard deviation (SD).

48 49 CHAPTER 3 BRAIN DEATH INDUCTION SPEEDS AND PULMONARY EFFECTS

Need of inotropic support and release of heart injury markers are more In a comparative study, with emphasis on the heart, it has been shown that the two brain pronounced in the explosive model death induction models differ in the development of mean arterial pressure during brain death induction. The acute increase in mean arterial pressure in the explosive brain To ensure suffcient oxygenation of the solid organs, brain dead donors are stabilized at death induction model is compared to a more tempered development in the gradual a mean arterial pressure above 80 mmHg, for this inotropic substances are being used model, and is considered to be the result of a more pronounced sympathetic discharge, in the clinic. We chose to give 0.01 mg/ ml noradrenalin (NA) as needed with a perfusor. followed by a more profound hypotension14. Sudden increase in mean arterial pressure There was a distinct difference between the two models, the need of NA was higher in the causes the rupture of the capillary-alveolar membrane and disruption of the barrier 3 explosive model compared to the gradual model (p < 0.005). integrity. Preventing the hypertensive response to explosive brain death induction 3 Both, brain death and inotropic support may have substantial effect on the heart and limited the infammatory immune response and prevented changes in capillary-alveolar subsequently on the lung. For that reason, we analyzed two sensitive markers for heart membrane integrity10. This could explain, why acute cerebral insult and brain death have injury- CK-MB and troponin. The release of CK-MB into the plasma was higher in the been associated with the onset of pulmonary edema5,24,25, while it is rare in subarachnoid explosive model compared to the gradual model, however did not change over time. hemorrhage26, which causes a gradual increase of intracranial pressure. Additionally, the Correlating to the CK-MB levels did the troponin levels differ between the groups. loss of capillary integrity is accompanied by hemorrhage5. The hemodynamic pattern However, there was also a respective increase over time (Table 5). during the initial phase between our two brain death induction models respectively differs and may explain the difference we found in loss of animals during the initial phase after brain death induction. After the induction phase the mean arterial pressure was stabilized Table 5. Administered total inotropic support during donor management and heart muscle injury markers troponin and CK-MB. in our set up by utilization of HAES and noradrenalin. Administration of exogenous noradrenalin has been associated with graft deterioration in other solid organ systems27 BD 0.5h BD 1h BD 2h BD 4h however in the lung the prevention of hypotensive collapse using noradrenalin correlated 28 Control EM GM EM GM EM GM EM GM with reduced edema and infammation . In this setting intrinsic catecholamine levels n = 8 n = 8 n = 8 n = 8 n = 8 n = 8 n = 8 n = 8 n = 8 up on brain death induction were not determined nor histological myocardial changes. However it is expected that the increase in troponin and CK-MB are the results of more NA - 0.8 ± 0.0 ± 0.6 ± 0.1 ± 1.1 ± 0.1 ± 0.3 ± 0.2 ± 14 1.0 0.0 0.8 0.1 1.6 0.2 0.58 0.4 pronounced intrinsic catecholamine release . While there seems to be a correlation between hemodynamic changes and the CK-MB 409 ±175 1656 ± 678 ± 864 ± 731 ± 1091 ± 830 ± 703 ± 671 ± 10,15,28 1046 152 300 225 670 258 66 227 infammatory immune response during brain death , it is not the only reason for the infammatory immune response found in brain dead donor lungs. Exposing living controls Troponin 22 ± 39 31 ± 11 28 ± 17 74 ± 45 34 ± 16 135 ± 59 ± 33 131 ± 130 ± 90 126 152 to blood withdrawn from brain dead donors in the absence of hemodynamic changes causes an infammatory response6. The origin of this systemic infammation has not been The presented values are the mean ± standard deviation (SD). identifed yet6,29. BD 0.5h– 4h– brain dead group with period of ventilation and circulatory stabilization time; CK-MB– Creatine kinase (myocardium); Control– immediately sacrifced without intervention; EM– explosive brain death induction In conclusion, the results of this study suggest that donor lungs suffer more morphological model, expansion of the fogarty catheter in 60 sec. with a pump; GM– gradual brain death induction model, injury after explosive onset of brain death. As a consequence, less lungs from donors with expansion of the fogarty catheter over a period of 30 min. with a pump; NA– Noradrenalin acute onset of brain death might be considered suitable for lung transplantation however this has not been investigated in this study, nor to our knowledge clinically. However, fndings in gene expression lead us to conclude that the outcome after transplantation DISCUSSION should be independent of the etiology of brain death. This is to our knowledge, the frst investigation comparing the effect of explosive and gradual brain death induction models on lung graft quality over different time periods in rats. Both models resulted in the decrease of graft quality over time, however more pronounced in the explosive brain death induction model during the initial phase. This difference was observed in higher mortality, increase of pulmonary inspiratory pressure, more need of hemodynamic support and pronounced patho-histological changes. In contrast to this no differences were found in the investigated proinfammatory gene expression. Since in kidney and heart transplantation the cause of brain death seems to have a substantial infuence on the early outcome after transplantation18,19, a number of studies have investigated the effect of cause of brain death in lung transplantation. While they failed to show a correlation between cause of brain death and outcome16,22,23, it was noted that donors with traumatic brain injury had a higher incidence in severity of rejection episodes though this had no effect on the survival17. However, these studies did not analyse whether the cause of brain death affects the availability of donor organs.

50 51 CHAPTER 3 BRAIN DEATH INDUCTION SPEEDS AND PULMONARY EFFECTS

REFERENCES 22. Waller, D.A., et al., Does the mode of donor death infuence the early 1. Pratschke, J., et al., Accelerated 12. Theodore, J. and E.D. Robin, outcome of lung transplantation? A rejection of renal allografts from brain- Speculations on neurogenic review of lung transplantation from dead donors. Ann Surg, 2000. 232(2): pulmonary edema (NPE). Am Rev donors involved in major trauma. J p. 263-71. Respir Dis, 1976. 113(4): p. 405-11. Heart Lung Transplant, 1995. 14(2): p. 2. Cooper, D.K., D. Novitzky, and W.N. 13. Kolkert, J.L., et al., The gradual onset 318-21. 3 Wicomb, Hormonal therapy in the brain death model: a relevant model 23. Ganesh, J.S., et al., Donor cause 3 brain-dead experimental animal. to study organ donation and its of death and mid-term survival in Transplant Proc, 1988. 20(5 Suppl 7): p. consequences on the outcome after lung transplantation. J Heart Lung 51-4. transplantation. Lab Anim, 2007. 41(3): Transplant, 2005. 24(10): p. 1544-9. 3. Cooper, D.K., D. Novitzky, and W.N. p. 363-71. 24. Simmons, R.L., et al., Respiratory Wicomb, The pathophysiological 14. Shivalkar, B., et al., Variable effects insuffciency in combat casualties. II. effects of brain death on potential of explosive or gradual increase of Pulmonary edema following head donor organs, with particular intracranial pressure on myocardial injury. Ann Surg, 1969. 170(1): p. 39-44. reference to the heart. Ann R Coll Surg structure and function. Circulation, 25. Rogers, F.B., et al., Neurogenic Engl, 1989. 71(4): p. 261-6. 1993. 87(1): p. 230-9. pulmonary edema in fatal and nonfatal 4. Powner, D.J., et al., Changes in serum 15. Avlonitis, V.S., et al., Early head injuries. J Trauma, 1995. 39(5): p. catecholamine levels in patients hemodynamic injury during donor 860-6; discussion 866-8. who are brain dead. J Heart Lung brain death determines the severity 26. Friedman, J.A., et al., Pulmonary Transplant, 1992. 11(6): p. 1046-53. of primary graft dysfunction after complications of aneurysmal 5. Novitzky, D., et al., Pathophysiology lung transplantation. Am J Transplant, subarachnoid hemorrhage. of pulmonary edema following 2007. 7(1): p. 83-90. Neurosurgery, 2003. 52(5): p. 1025-31; experimental brain death in the 16. Wauters, S., et al., Donor cause of discussion 1031-2. chacma baboon. Ann Thorac Surg, brain death and related time intervals: 27. Ueno, T., C. Zhi-Li, and T. Itoh, Unique 1987. 43(3): p. 288-94. does it affect outcome after lung circulatory responses to exogenous 6. Takada, M., et al., Effects of explosive transplantation? Eur J Cardiothorac catecholamines after brain death. brain death on cytokine activation Surg, 2011. 39(4): p. e68-76. Transplantation, 2000. 70(3): p. 436-40. of peripheral organs in the rat. 17. Ciccone, A.M., et al., Does donor 28. Rostron, A.J., et al., Hemodynamic Transplantation, 1998. 65(12): p. 1533- cause of death affect the outcome resuscitation with arginine vasopressin 42. of lung transplantation? J Thorac reduces lung injury after brain death in 7. Zweers, N., et al., Donor brain Cardiovasc Surg, 2002. 123(3): p. 429- the transplant donor. Transplantation, death aggravates chronic rejection 34; discussion 434-6. 2008. 85(4): p. 597-606. after lung transplantation in rats. 18. Pessione, F., et al., Multivariate 29. Skrabal, C.A., et al., Organ-specifc Transplantation, 2004. 78(9): p. 1251-8. analysis of donor risk factors for graft regulation of pro-infammatory 8. Van Raemdonck, D., et al., Lung donor survival in kidney transplantation. molecules in heart, lung, and kidney selection and management. Proc Am Transplantation, 2003. 75(3): p. 361-7. following brain death. J Surg Res, Thorac Soc, 2009. 6(1): p. 28-38. 19. Cohen, O., et al., Donor brain death 2005. 123(1): p. 118-25. 9. Orens, J.B., et al., A review of lung mechanisms and outcomes after transplant donor acceptability criteria. heart transplantation. Transplantation J Heart Lung Transplant, 2003. 22(11): proceedings, 2007. 39(10): p. 2964-9. p. 1183-200. 20. Schmittgen, T.D. and K.J. Livak, 10. Avlonitis, V.S., et al., The hemodynamic Analyzing real-time PCR data by the mechanisms of lung injury and comparative C(T) method. Nat Protoc, systemic infammatory response 2008. 3(6): p. 1101-8. following brain death in the transplant 21. Krebs, J., et al., Open lung approach donor. Am J Transplant, 2005. 5(4 Pt 1): associated with high-frequency p. 684-93. oscillatory or low tidal volume 11. Edmonds, H.L., Jr., et al., Effects of mechanical ventilation improves aerosolized methylprednisolone on respiratory function and minimizes experimental neurogenic pulmonary lung injury in healthy and injured rats. injury. Neurosurgery, 1986. 19(1): p. 36-40. Crit Care, 2010. 14(5): p. R183.

52 53 CHAPTER Inadequate anti-oxidative 4 responses in kidneys of brain-dead rats

D Hoeksma RA Rebolledo CMV Hottenrott Y Bodar J Wiersema-Buist H van Goor HGD Leuvenink

Published in Transplantation

Reference: Transplantation. 2017 Apr;101(4):746-753 Digital object identifer (DOI): 10.1097/ TP.0000000000001417. CHAPTER 4 RENAL OXIDATIVE STRESS DURING BRAIN DEATH

ABSTRACT INTRODUCTION Introduction Delayed graft function (DGF) is a serious complication in 20-35% of the renal transplant recipients1-3. Kidney grafts from brain-dead donors, the most frequently transplanted grafts, Brain death (BD)-related lipid peroxidation, measured as serum malondialdehyde (MDA) lead to DGF in 15-30% of the cases4,5. These fndings cannot be solely attributed to human levels, correlates with delayed graft function (DGF) in renal transplant recipients. How leukocyte antigen (HLA) mismatches, older donor age, or longer cold ischemia times6. BD affects lipid peroxidation is not known. The extent of BD-induced organ damage is Instead, the systemic effects of brain death (BD), which comprise ischemic, infammatory, infuenced by the speed at which intracranial pressure increases. To determine possible and metabolic changes, also affect donor kidney quality and thereby the performance of underlying causes of lipid peroxidation, we investigated the renal redox balance by the future allograft7-9. assessing oxidative and anti-oxidative processes in kidneys of brain-dead rats after fast 4 and slow BD induction. Several studies show that BD is associated with oxidative damage of cellular lipid 4 membranes8,10. Lipid peroxidation leads to membrane permeabilization and impairment Methods of enzymatic processes and ion pumps which results in membrane dysfunction and 11-13 BD was induced in 64 ventilated male Fisher rats by infating a 4.0F Fogarty catheter in the cell toxicity . BD-related lipid peroxidation is correlated with DGF in renal transplant epidural space. Fast and slow inductions were achieved by an infation speed of 0.45 and recipients. Levels of malondialdehyde (MDA), a product of lipid peroxidation, in the 0.015 ml/min, respectively, until BD confrmation. Healthy non brain-dead rats served as preservation solution of kidneys retrieved from brain-dead donors correlate well with 10 reference values. Brain-dead rats were monitored for 0.5, 1, 2, or 4 hr(s) after which organs DGF . Moreover, donor serum MDA levels correlate with acute rejection and immediate and blood were collected. and long-term renal allograft function. In expanded criteria donors (ECD), MDA levels in machine perfusion solution also correlate with DGF14. Results Increased lipid peroxidation can result from increased oxidant production and/or Increased MDA levels became evident at 2 hrs of slow BD induction at which increased decreased anti-oxidative defenses. Hemodynamic, infammatory, and metabolic changes superoxide levels, decreased GPx activity, decreased glutathione (GSH) levels, increased can all independently lead to increased oxidant production15-17 through enzymes such iNOS and HO-1 expression, and increased plasma creatinine levels were evident. At 4 hrs as xanthine oxidase, NADPH oxidase, nitric oxide synthase, and mitochondrial electron after slow BD induction, superoxide, MDA, and plasma creatinine levels increased further transport complexes18. High levels of oxidants or the reaction of oxidants with proteins while GPx acitivity remained decreased. Increased MDA and plasma creatinine levels also can lead to the impairment of antioxidant defense systems such as glutathione peroxidase became evident after 4 hrs fast BD induction. (GPx), catalase (CAT), and superoxide dismutase (SOD)19.

Conclusion BD-related processes, such as the catecholamine storm and infammatory processes are infuenced by the speed at which intracranial pressure (ICP) increases20,21 Clinically, BD leads to increased superoxide production, decreased GPx activity, decreased GSH traumatic brain insults usually lead to faster increases in ICP and therefore progress to levels, increased iNOS and HO-1 expression, and increased MDA and plasma creatinine BD more quickly than cerebrovascular causes22,23. Because BD-related processes are levels. These effects were more pronounced after slow BD induction. Modulation of these infuenced by the speed at which ICP increases, it is likely that oxidative and anti-oxidative processes could lead to decreased incidence of DGF. processes differ between these BD donor types.

Previous reports on oxidative processes in brain-dead donors solely mention the formation of lipid peroxidation products (MDA) in plasma7,8. We hypothesize that the renal redox balance and possible underlying oxidative and anti-oxidative processes are cardinal in the process of lipid peroxidation and that these processes are affected by the speed at which ICP increases. Studying these processes in renal tissue of different BD donor types could provide valuable information for the development of targeted anti-oxidative therapy and thereby improve transplantation outcomes. To assess possible underlying causes of lipid peroxidation, we investigated the renal redox balance by assessing oxidative and anti-oxidative processes in kidneys and plasma of brain-dead rats after fast and slow BD induction.

56 57 CHAPTER 4 RENAL OXIDATIVE STRESS DURING BRAIN DEATH

MATERIALS AND METHODS Anti-oxidative activity assessment of glutathione peroxidase, superoxide dismutase, and catalase Animal BD model To measure anti-oxidative enzymatic responses to oxidative processes, we measured the 24 The amount of animals per group was calculated using the method of Lenth . With a activities of glutathione peroxidase, superoxide dismutase, and catalase. Commercially meaningful difference of 50%, a variability (sigma) of 0.3 and a power of 0.9, 8 rats were available kits were purchased from Cayman Chemical to perform the assays. The assays required per group. Sixty-four male adult Fisher F344 rats (250-300 g) were randomly were performed according to manufacturer’s protocol and results were expressed as assigned to either fast or slow BD induction with a BD duration of 0.5, 1, 2, or 4 hrs. nmol/min/mg protein or as Units/mg protein. These time points were chosen as dynamic effects are observed at these time points which 7,8 resemble longer clinical brain-dead periods . Furthermore, maintaining rats stable for Anti-oxidative activity assessment of glutathione reductase 4 longer periods poses diffculties as cardiac and pulmonary failure become evident. Healthy 4 non brain-dead rats served as reference values. All animals received care in compliance Glutathione reductase activity measurement was adapted from a method by Griffth26.

with the guidelines of the local animal ethics committee according to Experiments on Tissue was lysed in cell lysis buffer composed of 253 M HEPES, 5 mM MgCl2, 5mM EDTA, Animals Act (1996) issued by the Ministry of Public Health, Welfare and Sports of the 2mM PMSF and 10 ng/μl Pepstatine and Leupeptine (Sigma, St. Louis, MO). The buffer was Netherlands. adjusted to a fnal pH of 7.5. Cell suspensions were centrifuged and the supernatant was analyzed. GSH and GSSG were quantifed as follows. Briefy, 20 to 50 μl of the supernatant

BD induction was added to buffer A (125 mM NaH2PO4.H2O and 6.3 mM NaEDTA adjusted to pH 7.5 with NaOH) to a total volume of 100 μl in a transparent fat bottom 96-well plate. Next, 20 Animals were anaesthetized using isofurane with 100% O2. Animals were intubated via μl of 6 mM 5-5’-dithiobis-2-nitrobenate (Sigma, St. Louis, MO), 42 μl of 0.3 mM NADPH a tracheostomy and ventilated (tidal volume: 6.5 ml/body weight (Kg) per stroke, PEEP (Roche Diagnostics, Germany), and 10 μl of 1mM GSH solution, all dissolved in buffer of 3 cm of H20, initial respiratory rate of 120 and corrected based on ETCO2) throughout A, were added to each well. The fnal volume of the mixture was increased to 200 μl by the experiment. Two cannulas were inserted in the femoral artery and vein for continuous adding buffer A. The absorbance was measured at 430 nm for 15 minutes at 30 ºC. The mean arterial pressure (MAP) monitoring and volume replacement. Through a frontolateral linear part of the kinetic curve was used for the rate estimation and compared with a hole drilled in the skull, a no. 4 Fogarty catheter (Edwards Lifesciences Co, Irvine, CA) was standard curve of glutathione reductase (GR). Samples were corrected for total amount of placed in the epidural space and infated with saline using a syringe pump (Terumo, Tokyo, protein and expressed as Units/mg protein. Japan). Fast and slow induction of BD was achieved by infating the catheter at a speed of 0.015 or 0.45 mL/min, respectively. These speeds were chosen based on consistent results Intracellular redox status assessment by reduced (GSH) and oxidized glutathione from previous studies8,25. In the slow induction model, infation of the balloon was halted GSSG measurements once a rise in the MAP above 80 mmHg was noted; refecting the catecholamine storm at the onset of BD. In the fast induction model the catheter was infated for 1 minute. BD was Reduced and oxidized glutathione were measured according to the method of Griffth26.

confrmed in both groups by the absence of corneal refexes. Tissue was lysed in cell lysis buffer composed of 253 M HEPES, 5 mM MgCl2, 5mM EDTA, 2mM PMSF and 10 ng/μl pepstatin and leupeptin (Sigma, St. Louis, MO). The buffer was BD period adjusted to a fnal pH of 7.5. Cell suspensions were centrifuged and the supernatant was analyzed. To measure total glutathione, 20 μl of the supernatant or plasma was added Following confrmation of BD, ventilation was continued and anaesthesia was terminated. to buffer A (125 mM NaH2PO4.H20 and 6.3 mM NaEDTA adjusted to pH 7.5 with NaOH) Mean arterial pressure (MAP) was considered normal ≥ 80 mmHg. If MAP decreased below to a total volume of 100 μl in a transparent fat bottom 96-well plate. Next, 20 μl of 6 normal levels, colloid infusion with polyhydroxyethyl starch (HAES) 10% (Fresenius Kabi mM 5-5’-dithiobis-2-nitrobenate (Sigma, St. Louis, MO), 42 μl of 0.3 mM NADPH (Roche AG, Bad Homburg, Germany) was administered (at a maximum rate of 1ml/hr) to maintain Diagnostics, Germany), all dissolved in buffer A, were added to the wells. Finally, 38 μl of MAP ≥ 80 mmHg. If necessary, intravenous noradrenaline (NA) (1 mg/mL) was administered. glutathione reductase (Roche Diagnostics, Germany) dissolved to an enzyme activity of 5 A homeothermic blanket control system was used throughout the experiment. After the units/ml in Buffer A was added to the wells. The absorbance was measured at 430 nm for experimental time, blood and urine were collected, after which organs were fushed with 15 minutes at 30 ºC. The linear part of the kinetic curve was used for the rate estimation cold saline. After the fush-out, organs were harvested and tissue samples were snap- and compared with a standard curve of GSSG. Samples were corrected for total amount frozen in liquid nitrogen and stored at -80 °C or fxed in 4% paraformaldehyde. Plasma of protein and expressed μmol/g protein. In order to measure GSSG, 1-methyl-2-vinyl samples were also snap-frozen and stored. pyridinium trifate (Sigma, St. Louis, MO) was added at a concentration of 3 mM to the supernatant to block GSH. GSH content was calculated by subtracting GSSG from the Determination of superoxide production with dihydroethidium staining total glutathione values whilst correcting for the molecular weight of the molecules. Four μm cryosections were mounted on slides and washed with Dulbecco’s PBS (DPBS). Sections were incubated with 10 μM dihydroethidium (Sigma, St. Louis, MO) dissolved RNA isolation and qPCR in DPBS at 37°C in the dark for 30 min. Sections were washed twice with DPBS and RNA isolation and qPCR were performed as described before8 In brief, the SV Total RNA immediately scanned for superoxide with a Leica inverted fuorescence microscope isolation (Promega, Leiden, the Netherlands) kit was used to isolate total RNA from rat equipped with rhodamine flter settings. Images were acquired at 40X magnifcation and kidneys . Genomic DNA contamination was verifed by RT-PCR reactions by omitting analyzed using NCBI ImageJ.

58 59 CHAPTER 4 RENAL OXIDATIVE STRESS DURING BRAIN DEATH

reverse transcriptase with the use of -actin primers. T11VN oligo’s and M-MLV (Invitrogen, Hemodynamic support Breda, the Netherlands) were used for cDNA synthesis from 1 µg total RNA. The ABI Prism More noradrenaline administration was required after fast compared to slow BD induction 7900-HT Sequence Detection System (Applied Biosystems, Waltham, MA) was used to at 0.5 and 1 hrs (Table 2) which was not observed at other time points. No differences in perform amplifcation and detection with the use of emission of SYBR green (Applied HAES administration were observed between fast and slow BD induction at the different Biosystems, Waltham, MA). Assays were performed in triplo. A dissociation curve and gel time points. electrophoresis were used to test for the specifcity of qPCR products. Normalization of gene expression was achieved by standardizing to the mean of -actin mRNA content. Results were expressed as 2^(-∆∆ct) (CT threshold cycle). Primer Express software (Applied Table 2. Total Noradrenaline (1 mg/ml) infusion requirements and number of rats which required Noradrenaline. Biosystems, Waltham, MA) was used to design amplifcation primers (table 1). Time (hrs) Fast Induction Slow Induction p Value 4 Noradrenaline (ml) 0.5 0.35 ± 0.42 (7) 0.10 ± 0.24 (2) 0.0188* 4

Table 1. qPCR primer sequences of the genes b-actin, iNOS, and HO-1. 1 0.55 ± 0.76 (6) 0.05 ± 0.14 (1) 0.0238* 2 1.1 ± 1.6 (4) 0.13 ± 0.25 (2) 0.1515 Gene Primer Sequences Bp 4 0.33 ± 0.58 (2) 0.23 ± 0.42 (2) 0.8564 b-actin 5’-GGAAATCGTGCGTGACATTAAA-3’ 74 5’-GCGGCAGTGGCCATCTC-3’ * indicates a signifcant difference between fast and slow induction groups. iNOS 5’-GAGGAGCCCAAAGGCACAAG-3’ 81 5’-CCAAACCCCTCACTGTCATTTTATT-3’ HO-1 5’-CTCGCATGAACACTCTGGAGAT-3’ 74 5’- GCAGGAAGGCGGTCTTAGC-3’ Plasma creatinine values Plasma creatinine values were signifcantly increased after 4 hrs by fast induction compared to reference values (p < 0.01). After slow induction, creatinine values were signifcantly Determination of oxidative damage through lipid peroxidation quantifcation increased at 0.5, 1, 2, and 4 hrs compared to reference values (p < 0.05, 0.05, 0.01 and MDA was measured fuorescently after binding to thiobarbituric acid. Twenty µL of 0.001 respectively, Table 3). Plasma creatinine values were signifcantly increased by slow kidney tissue homogenates were mixed with 2% SDS and 5mM butylated hydroxytoluene compared to fast induction BD at 4 hrs (p < 0.05). followed by 400 µL 0.1 N HCL, 50 µL 10% phosphotungstic acid and 200 µL 0.7% TBA. The mixture was incubated for 1 hr at 97°C. 800 µL 1-butanol was added to the samples and Table 3. Plasma creatinine levels in reference and fast and slow induction groups. Number of rats per group are centrifuged at 960 g. 200 µL of the 1-butanol supernatant was fuorescently measured at indicated 480 nm excitation and 590 nm emission wavelengths. Samples were corrected for amount of protein and expressed as µmol/g protein. Reference Time (hrs) Fast Induction Slow Induction Plasma creatinine (µmol/L) 26.5 ± 3.51 (8) 0.5 36.25 ± 4.86 (8) 48.25 ± 10.11* (8) Statistical analyses 1 38.50 ± 6.41 (8) 49.38 ± 10.89 * (8) Data were analyzed using GraphPad Prism 5.04 (GraphPad, San Diego, CA, USA). Fast- 2 37.83 ± 10.8 (6) 54.57 ± 10.23 ** (7) and slow induction groups were compared to reference groups using the Kruskall-Wallis 4 49.17 ± 5.27 ** (6) 66.63 ± 19.03 ***# test with Dunns post-hoc correction. Fast- and slow induction groups were compared to each other per time point using the Mann-Whitney U test with Bonferroni correction. P *, **, and *** indicate p < 0.05, 0.01, and 0.001, respectively, compared to reference values. # indicates p < 0.05 < 0.05 was considered statistically signifcant. All data are expressed as the mean ± SD compared to fast-induction (standard deviation) Superoxide production with dihydroethidium staining RESULTS Superoxide was increased at 0.5 hrs of BD by both fast- and slow BD induction compared BD induction to reference values (p < 0.001 and p < 0.05, respectively, Figure 1). Marked increases in superoxide production were also observed at 2 and 4 hrs after slow induction compared One animal from the slow induction 2 hrs group, 2 from the fast induction 2 hrs group to reference values (p < 0.01, and p < 0.001). Superoxide was signifcantly increased after and one from the fast induction 4 hrs group were discarded due to unknown amounts of slow BD induction at 4 hrs compared to fast induction (p < 0.05). noradrenaline administration. One animal was discarded in the fast induction 4 hrs group due to a prolonged apnea test because of uncertainty of BD.

60 61 CHAPTER 4 RENAL OXIDATIVE STRESS DURING BRAIN DEATH

4 4

Figure 1. Renal superoxide generation measured by dihydroethidium (DHE) fuorescence in A. Healthy non brain- dead rats (reference values), B. fast-induction brain-dead rats, and C. Slow-induction brain-dead rats after 4 h of BD. *, **, and *** indicate p < 0.05, 0.01, and 0.001, respectively, compared to reference values. # indicates p < 0.05 compared to fast-induction. 40 x magnifcation. Figure 2. Renal Enzymatic activities of glutathione peroxidase, superoxide dismutase (SOD), catalase, and glutathione reductase after 0.5, 1, 2, and 4 h of BD. Healthy non-brain dead rats served as reference values. * and ** indicate p < 0.05 and 0.01 compared to reference values. ## indicates p < 0.01 compared to fast induction. Glutathione peroxidase activity Glutathione peroxidase (GPx) activity was signifcantly decreased after slow induction of GSH, GSSG, GSH + GSSG (total glutathione) levels and GSSG:GSH ratio BD at 0.5, 1, and 2 hrs compared to reference values (p < 0.05, 0.01, and 0.05, respectively, Figure 3) but increased at 4 hrs. After slow induction of BD, GPx activity decreased GSH levels decreased after both fast- and slow BD induction but only reached signifcance signifcantly at 1 hr and remained decreased at 2 and 4 hrs compared to reference values after slow induction at 2 hrs compared to reference values (p < 0.05). GSSG levels were (p < 0.05, 0.05, and 0.01, respectively, Figure 3). signifcantly increased after slow induction of BD compared to reference values (p < 0.01, Figure 4). Furthermore, GSSG levels were signifcantly increased after slow BD induction SOD activity at 4 hrs compared to fast induction (P < 0.05). Total glutathione levels were unchanged after both fast and slow BD induction. The GSSG:GSH ratio did not change signifcantly SOD activity remained stable at different BD time points. No differences were observed between groups at different time points. between groups at different time points (Figure 3).

Catalase activity Catalase activity was not affected by either fast or slow induction compared to reference values. No differences were observed between groups at different time points (Figure 3).

Glutathione reductase activity Glutathione reductase activity decreased signifcantly after fast BD induction at 0.5 hrs compared to reference values (p < 0.05, Figure 3). Furthermore, the activity was signifcantly increased after slow BD induction at 4 hrs compared to fast induction (p < 0.01, Figure 3).

62 63 CHAPTER 4 RENAL OXIDATIVE STRESS DURING BRAIN DEATH

4 4

Figure 4. Renal mRNA expression levels of inducible nitric oxide synthase (iNOS) and heme-oxygenase 1 (HO-1) after 0.5, 1, 2, and 4 h of BD. Non brain-dead rats served as reference values. *, **, and *** indicate p < 0.05, 0.01, and 0.001, respectively, compared to reference values. # indicates p < 0.05 compared to fast induction.

Lipid peroxidation levels MDA levels were increased signifcantly at 4 hrs of BD by both fast-and slow BD induction compared to reference values (p < 0.05 and p < 0.01, Figure 2). MDA levels were signifcantly increased after slow BD induction at 2 and 4 hrs compared to fast induction (p < 0.001 and p < 0.01).

Figure 3. Renal levels of reduced glutathione (GSH), oxidized glutathione (GSSG), total glutathione (GSH +GSSG), and the ratio of oxidized to reduced glutathione (GSSG:GSH) after 0.5, 1, 2, and 4 h of BD. Healthy non-brain dead rats served as reference values. * and ** indicate p < 0.05 and 0.01, respectively, compared to reference values. # indicates p < 0.05 compared to 4 hours fast induction.

Renal gene expression levels iNOS and HO-1 gene expression were increased at all BD time points after both fast- and slow BD induction. Fast induction resulted in signifcantly increased iNOS gene expression compared to reference values after 2 and 4 hrs of BD (p < 0.01 and 0.001, respectively, Figure 6). Slow induction resulted in earlier increases, namely after 1, 2, and 4 hours of BD (p < 0.01, 0.01, and 0.001, respectively, Figure 6). HO-1 gene expression showed a similar pattern in that slow induction of BD led to an earlier increase. HO-1 gene expression was signifcantly increased after fast induction of BD at 2 and 4 hours compared to reference values (p < 0.05 and 0.001, respectively, Figure 6) while after slow induction of BD, signifcantly increased HO-1 gene expression was observed at 1, 2, and 4 hrs compared Figure 5. Renal lipid peroxidation as measured by malondialdehyde (MDA) levels after 0.5, 1, 2, and 4 h of to reference values (P < 0.05, 0.01, and 0.001, respectively, Figure 6). Finally, HO-1 gene BD. Healthy non-brain dead rats served as reference values. * and ** indicates p < 0.05 and 0.01, respectively, expression was signifcantly higher after slow BD induction at 4 hours compared to fast compared to reference values. ## and ### indicate p < 0.01 and 0.001 compared to fast induction. induction (p < 0.05)

Total plasma glutathione (GSH + GSSG) levels Total glutathione levels in the plasma were unchanged at early BD time points but were signifcantly increased after slow induction of BD at 4 hrs compared to reference values (p < 0.05, Figure 5).

64 65 CHAPTER 4 RENAL OXIDATIVE STRESS DURING BRAIN DEATH

the effects observed in our model, including lipid peroxidation, and therefore increases the risk of DGF in transplant recipients (Figure 7). Thus, the administration of superoxide scavengers to brain-dead donors, especially those progressing to BD slowly, could lead to improved renal transplantation outcomes. Furthermore, considering the decreased GPx activity at almost all time points and its specifc role in protecting lipid membranes, the administration of GPx mimetics could exert benefcial effects as well38.

4 4

Figure 6. Plasma levels of total glutathione (GSH + GSSG) after 0.5, 1, 2, and 4 h of BD. Healthy non-brain dead rats served as reference values. * indicates p < 0.05 compared to reference values.

DISCUSSION The main fnding of this study is that BD leads to increased renal superoxide production, decreased GPx activity, decreased GSH levels, increased iNOS and HO-1 expression, increased MDA levels, and increased plasma creatinine levels. The effects we observed were more pronounced when BD was induced slowly which might explain differences in performance of donor kidneys derived from different donor types27. Figure 7. Proposed mechanism of lipid peroxidation in kideys of brain-dead rats and subsequent risk of DGF in renal transplant recipients. Increased superoxide levels are not suffciently counteracted by superoxide dismutase The fact that graft quality is affected by the speed at which ICP increases has been (SOD) which leads to the initiation of lipid peroxidation. Subsequent propagation of lipid peroxidation proceeds as glutathione peroxidase (GPx) is impaired which results in less conversion of lipid peroxides to lipid alcohols. shown previously. A faster increase in ICP leads to increased myocardial damage and Excess superoxide is scavenged by reduced glutathione (GSH) molecules resulting in increased oxidized decreased function which is likely related to higher levels of hypertension due to increased glutathione (GSSG) levels and increased activity of glutathione reductase (GR). However, glutathione and other catecholamine release (20). Traumatic brain injury, which usually leads to a quick rise in ICP, rescue mechanisms like HO-1 and iNOS cannot fully compensate the surge in superoxide levels which leads to increased lipid peroxidation and thereby increased risk of DGF in renal transplant recipients. is a risk factor for mortality in heart recipients28. In contrast, our study shows that a slower increase in ICP leads to increased lipid peroxidation. Rather than hypertension, this could be related to hypotension and the resulting ischemia, which is observed in patients with The early effects we observed at 0.5 hours are likely the result of major hemodynamic cerebrovascular brain insults29. These patients tend to progress to BD less quickly than changes such as the catecholamine storm which is specifc for the onset of BD31. The patients who suffer traumatic brain injury. Cerebrovascular causes of death in the donor effects observed at later stages are likely8not related to major hemodynamic disturbances are indeed a risk factor for renal graft dysfunction in transplant recipients27. However, this as rats are kept hemodynamically stable. Therefore, changes in the local renal circulation increased risk is attributed to donor specifc characteristics such as age, hypertension, probably affect oxidative processes and renal function at later time points. In acute and cardiovascular disease, while we show here that the speed at which ICP increases kidney injury (AKI) models, local renal circulatory changes become apparent hours after could be of infuence as well. Regardless of the nature of brain insults, the speeds at which renal ischemia39,40. In BD, early hemodynamic changes could represent the frst ischemic brain injuries lead to BD vary greatly between patients. In a series of patients with middle hit after which local renal circulatory changes take place at later time points. Since the cerebral artery infarction, BD occurred anywhere between 24 hours and one week22. A onset of BD cannot be anticipated precisely, counteracting early hemodynamic changes similar time range was evident in patients with subarachnoid hemorrhage23. Therefore, could be diffcult. However, the later oxidative processes, which probably do not involve anti-oxidative therapy could be especially benefcial in donors who progress to BD slowly hemodynamic derailments, could however effectively be counteracted with anti-oxidative after cerebral insults, regardless of the nature of the insult. regimens as explained above. BD leads to phases of renal ischemia as a result of the catecholamine storm, volume In our BD model, the GSSG:GSH ratio was unaltered at all time points which indicates depletion, and neurogenic shock30,31. In classic models of renal ischemia-reperfusion (I-R) that glutathione homeostasis is not affected overall. Augmenting glutathione levels in injury, increased superoxide production, decreased GPx, SOD, and CAT activity, decreased brain-dead donors is therefore most likely futile. In a recent randomized controlled trial, GSH levels, and increased MDA and plasma creatinine levels are observed32-34. Similar n-acetylcysteine, a glutathione precursor, was administered to deceased donors but effects were observed in our BD model. In many models, increased superoxide production no effect was found on renal graft function or survival in recipients41. Like in I-R models, takes a central role in decreasing GPx activity, GSH levels, MDA levels, and increasing glutathione levels decreased in our model but were unaltered at 4 hours despite the pro- plasma creatinine levels 35-37. Considering the time points at which superoxide production oxidative state at the time. This fnding is probably not solely explained by increased is increased in our model, it is likely that superoxide also fulflls a central role in initiating glutathione reductase activity since GSSG levels are signifcantly increased at the time.

66 67 CHAPTER 4 RENAL OXIDATIVE STRESS DURING BRAIN DEATH

Renal glutathione synthesis is totally dependent on renal uptake of glutathione conjugates REFERENCES from the circulation42,43. We observed increased total glutathione plasma levels after slow induction of BD which could be the result of BD-related hepatic apoptosis which is 1. OPTN/SRTR 2011 Annual Data Report. 11. Jain SK, Shohet SB. Calcium signifcantly higher after slow compared to fast BD induction21. Available at: http://srtr.transplant.hrsa. potentiates the peroxidation of gov/annual_reports/2011/flash/01_ erythrocyte membrane lipids. Biochim. Besides detrimental effects, BD also led to the compensatory upregulation of cytoprotective kidney/index.html#/1/zoomed, . Biophys.Acta 1981;642(1):46. genes31. We observed marked increases in renal iNOS and HO-1 expression. iNOS can 2. Siedlecki A, Irish W, Brennan DC. 12. Vladimirov YA, Olenev VI, Suslova TB, exert a protective effect through suppression of infammatory reactions and increasing Delayed graft function in the Cheremisina ZP. Lipid peroxidation in blood fow to ischemic regions44,45. However, higher levels of iNOS expression after slow kidney transplant. Am.J.Transplant. mitochondrial membrane. Adv.Lipid induction did not coincide with decreased lipid peroxidation levels. Furthermore, increased 2011;11(11):2279. Res. 1980;17:173. 4 NO production in an oxidative environment probably exerts a negative effect as NO will 3. Peeters P, Vanholder R. Therapeutic 13. Tribble DL, Aw TY, Jones DP. The 4 quickly react with oxidants such as superoxide, resulting in the production of peroxynitrite, interventions favorably infuencing pathophysiological signifcance of a highly reactive oxidant46. Therefore, increasing NO production in brain-dead donors will delayed and slow graft function lipid peroxidation in oxidative cell probably not exert benefcial effects. Heme-oxygenase 1 (HO-1) is among the most critical in kidney transplantation: mission injury. Hepatology 1987;7(2):377. cytoprotective enzymes that are activated upon cellular stress47. The increased renal impossible? Transplantation 2008;85(7 14. Nagelschmidt M, Minor T, Gallinat expression of HO-1 in BD is therefore believed to form part of a recuperative mechanism48. Suppl):S31. A, et al. Lipid peroxidation products However, in our model, increased HO-1 gene expression did not coincide with decreased 4. Moers C, Kornmann NS, Leuvenink HG, in machine perfusion of older donor lipid peroxidation after slow induction of BD. Probably, the induction of HO-1 by BD is Ploeg RJ. The infuence of deceased kidneys. J.Surg.Res. 2013;180(2):337. either insuffcient or occurs too late to prevent lipid peroxidation. The induction of HO-1 donor age and old-for-old allocation 15. Futrakul N, Tosukhowong P, prior to BD has however proven benefcial in allograft survival in a rat transplantation on kidney transplant outcome. Valyapongpichit Y, Tipprukmas N, model49,50. Therefore, inducing HO-1 in brain-dead donors could pose clinical diffculties Transplantation 2009;88(4):542. Futrakul P, Patumraj S. Oxidative stress as HO-1 might already need to be induced prior to BD to exert benefcial effects. 5. Perico N, Cattaneo D, Sayegh MH, and hemodynamic maladjustment in Remuzzi G. Delayed graft function chronic renal disease: a therapeutic In conclusion, this study shows oxidative and anti-oxidative effects elicited by fast and in kidney transplantation. Lancet implication. Ren.Fail. 2002;24(4):433. slow BD induction. The observed effects could form an explanation for the increased 2004;364(9447):1814. 16. Nakayama M, Nakayama K, Zhu WJ, lipid peroxidation observed in brain-dead donors. Since BD-related lipid peroxidation 6. Terasaki PI, Cecka JM, Gjertson DW, et al. Polymorphonuclear leukocyte correlates with DGF in renal transplant recipients, anti-oxidative therapy in brain-dead Takemoto S. High survival rates of injury by methylglyoxal and hydrogen donors could decrease lipid peroxidation and thereby improve transplantation outcomes. kidney transplants from spousal and peroxide: a possible pathological living unrelated donors. N.Engl.J.Med. role for enhanced oxidative stress in 1995;333(6):333. chronic kidney disease. Nephrol.Dial. 7. Morariu AM, Schuurs TA, Leuvenink Transplant. 2008;23(10):3096. HG, van Oeveren W, Rakhorst G, Ploeg 17. Himmelfarb J, McMonagle E, RJ. Early events in kidney donation: Freedman S, et al. Oxidative stress is progression of endothelial activation, increased in critically ill patients with oxidative stress and tubular injury acute renal failure. J.Am.Soc.Nephrol. after brain death. Am.J.Transplant. 2004;15(9):2449. 2008;8(5):933. 18. Valko M, Leibfritz D, Moncol J, 8. Schuurs TA, Morariu AM, Ottens PJ, Cronin MT, Mazur M, Telser J. Free et al. Time-dependent changes in radicals and antioxidants in normal donor brain death related processes. physiological functions and human Am.J.Transplant. 2006;6(12):2903. disease. Int.J.Biochem.Cell Biol. 9. Novitzky D, Cooper DK, Morrell 2007;39(1):44. D, Isaacs S. Change from aerobic 19. Pigeolet E, Corbisier P, Houbion to anaerobic metabolism A, et al. Glutathione peroxidase, after brain death, and reversal superoxide dismutase, and catalase following triiodothyronine therapy. inactivation by peroxides and oxygen Transplantation 1988;45(1):32. derived free radicals. Mech.Ageing 10. Kosieradzki M, Kuczynska J, Dev. 1990;51(3):283. Piwowarska J, et al. Prognostic 20. Shivalkar B, Van Loon J, Wieland W, signifcance of free radicals: mediated et al. Variable effects of explosive injury occurring in the kidney donor. or gradual increase of intracranial Transplantation 2003;75(8):1221. pressure on myocardial structure and function. Circulation 1993;87(1):230. 68 69 CHAPTER 4 RENAL OXIDATIVE STRESS DURING BRAIN DEATH

21. Rebolledo RA, Hoeksma D, Hottenrott opportunity for improvement? Kidney 41. Orban JC, Quintard H, Cassuto 50. Wagner M, Cadetg P, Ruf R, CM, et al. Slow induction of brain death Int. 2007;72(7):797. E, Jambou P, Samat-Long C, Mazzucchelli L, Ferrari P, Redaelli leads to decreased renal function and 32. Montagna G, Hofer CG, Torres AM. Ichai C. Effect of N-acetylcysteine CA. Heme oxygenase-1 attenuates increased hepatic apoptosis in rats. Impairment of cellular redox status pretreatment of deceased organ ischemia/reperfusion-induced J.Transl.Med. 2016;14(1):141. and membrane protein activities in donors on renal allograft function: apoptosis and improves survival 22. Hacke W, Schwab S, Horn M, Spranger kidneys from rats with ischemic acute a randomized controlled trial. in rat renal allografts. Kidney Int. M, De Georgia M, von Kummer R. renal failure. Biochim.Biophys.Acta Transplantation 2015;99(4):746. 2003;63(4):1564. ‘Malignant’ middle cerebral artery 1998;1407(2):99. 42. Ormstad K, Jones DP, Orrenius territory infarction: clinical course 33. Rahman NA, Mori K, Mizukami M, S. Characteristics of glutathione and prognostic signs. Arch.Neurol. Suzuki T, Takahashi N, Ohyama C. biosynthesis by freshly isolated 4 1996;53(4):309. Role of peroxynitrite and recombinant rat kidney cells. J.Biol.Chem. 4 23. Lantigua H, Ortega-Gutierrez S, human manganese superoxide 1980;255(1):175. Schmidt JM, et al. Subarachnoid dismutase in reducing ischemia- 43. Rankin BB, Wells W, Curthoys NP. hemorrhage: who dies, and why? Crit. reperfusion renal tissue injury. Rat renal peritubular transport Care 2015;19:309. Transplant.Proc. 2009;41(9):3603. and metabolism of plasma [35S] 24. Lenth RV. Statistical power calculations. 34. Knight SF, Kundu K, Joseph G, et al. glutathione. Am.J.Physiol. 1985;249(2 J.Anim.Sci. 2007;85(13 Suppl):E24. Folate receptor-targeted antioxidant Pt 2):F198. 25. Fontana J, Yard B, Stamellou E, et therapy ameliorates renal ischemia- 44. Fukumoto Y, Shimokawa H, Kozai T, et al. Dopamine treatment of brain- reperfusion injury. J.Am.Soc.Nephrol. al. Vasculoprotective role of inducible dead Fisher rats improves renal 2012;23(5):793. nitric oxide synthase at infammatory histology but not early renal function 35. Winterbourn CC, Metodiewa D. The coronary lesions induced by in Lewis recipients after prolonged reaction of superoxide with reduced chronic treatment with interleukin- static cold storage. Transplant.Proc. glutathione. Arch.Biochem.Biophys. 1beta in pigs in vivo. Circulation 2014;46(10):3319. 1994;314(2):284. 1997;96(9):3104. 26. Griffth OW. Determination of 36. Blum J, Fridovich I. Inactivation of 45. Hickey MJ, Granger DN, Kubes glutathione and glutathione disulfde glutathione peroxidase by superoxide P. Inducible nitric oxide synthase using glutathione reductase and radical. Arch.Biochem.Biophys. (iNOS) and regulation of leucocyte/ 2-vinylpyridine. Anal.Biochem. 1985;240(2):500. endothelial cell interactions: studies 1980;106(1):207. 37. Paller MS, Hoidal JR, Ferris TF. in iNOS-defcient mice. Acta Physiol. 27. Pessione F, Cohen S, Durand D, et Oxygen free radicals in ischemic acute Scand. 2001;173(1):119. al. Multivariate analysis of donor risk renal failure in the rat. J.Clin.Invest. 46. Beckman JS, Koppenol WH. Nitric factors for graft survival in kidney 1984;74(4):1156. oxide, superoxide, and peroxynitrite: transplantation. Transplantation 38. Thomas JP, Maiorino M, Ursini F, Girotti the good, the bad, and ugly. 2003;75(3):361. AW. Protective action of phospholipid Am.J.Physiol. 1996;271(5 Pt 1):C1424. 28. Cohen O, De La Zerda DJ, Beygui R, hydroperoxide glutathione 47. Gozzelino R, Jeney V, Soares MP. Hekmat D, Laks H. Donor brain death peroxidase against membrane- Mechanisms of cell protection by mechanisms and outcomes after damaging lipid peroxidation. In heme oxygenase-1. Annu.Rev. heart transplantation. Transplant.Proc. situ reduction of phospholipid and Pharmacol.Toxicol. 2010;50:323. 2007;39(10):2964. cholesterol hydroperoxides. J.Biol. 48. Van Dullemen LF, Bos EM, Schuurs 29. Kataoka K, Taneda M. Reversible arterial Chem. 1990;265(1):454. TA, et al. Brain death induces renal hypotension after acute aneurysmal 39. Wang Z, Holthoff JH, Seely KA, expression of heme oxygenase-1 and subarachnoid hemorrhage. Surg. et al. Development of oxidative heat shock protein 70. J.Transl.Med. Neurol. 1985;23(2):157. stress in the peritubular capillary 2013;11:22. 30. Herijgers P, Leunens V, Tjandra-Maga microenvironment mediates sepsis- 49. Tullius SG, Nieminen-Kelha M, TB, Mubagwa K, Flameng W. Changes induced renal microcirculatory failure Buelow R, et al. Inhibition of ischemia/ in organ perfusion after brain death in and acute kidney injury. Am.J.Pathol. reperfusion injury and chronic graft the rat and its relation to circulating 2012;180(2):505. deterioration by a single-donor catecholamines. Transplantation 40. Seija M, Baccino C, Nin N, et al. Role of treatment with cobalt-protoporphyrin 1996;62(3):330. peroxynitrite in sepsis-induced acute for the induction of heme oxygenase-1. 31. Bos EM, Leuvenink HG, van Goor H, kidney injury in an experimental model Transplantation 2002;74(5):591. Ploeg RJ. Kidney grafts from brain of sepsis in rats. Shock 2012;38(4):403. dead donors: Inferior quality or

70 71 CHAPTER Organ-specifc responses during 5 brain death: increased aerobic metabolism in the liver and anaerobic metabolism with decreased perfusion in the kidneys

AC Van Erp* R Rebolledo* D Hoeksma D NR Jespersen NR P Ottens R Nørregaard M Pedersen C Laustsen JGM Burgerhof JC Wolters J Ciapaite HE Bøtker HGB Leuvenink B Jespersen

*Authors contributed equally to the manuscript

Submitted to Scientifc reports CHAPTER 5 DECREASED RENAL PERFUSION DURING BRAIN DEATH

ABSTRACT INTRODUCTION Introduction The shortage of donor organs suitable for transplantation remains a major healthcare problem. Despite various strategies to expand the donor pool, such as the increased Metabolic assessment of brain-dead donors is a potentially novel strategy to assess and use of marginal, non-heart beating, or living donor grafts1,2, most organs transplanted target graft quality prior to transplantation. This study investigated metabolic changes, worldwide are still obtained from brain-dead donors3. However, compared to living donor tissue perfusion, oxygen consumption, and mitochondrial function, in the liver and kidneys transplantation, transplantation of brain-dead organ grafts leads to higher rejection rates following brain death (BD). and inferior long-term outcomes4-6. Thus, the current challenge is to use all available organs including the suboptimal and concurrently improve transplantation outcomes. Materials and methods BD was induced in mechanically-ventilated rats by infation of an epidurally-placed Fogarty Brain death (BD) causes complex disturbances in body homeostasis. BD is the result of catheter; sham-operated rats served as controls. A 9.4T preclinical MRI system measured increased intracranial pressure (ICP), which leads to progressive ischemia of the cerebrum, 5 hourly oxygen availability (BOLD-related R2*) and perfusion (T1-weighted). After 4 h, brain stem, and spinal cord. Consequently, these changes trigger a sympathetic response 5 hepatic and renal tissue was collected, mitochondria isolated and assessed with high- with catecholamine release, which in turn causes systemic vasoconstriction and decreased 7-9 resolution respirometry. Quantitative proteomics, qPCR, and biochemistry was performed fow through peripheral organs including the liver and kidneys . Furthermore, impairment on stored tissue/plasma. of the hypothalamus and pituitary gland results in hormonal disturbances, including reduced levels of circulating triiodothyronine, vasopressin, and cortisol8. Eventually, Results ischemia of the spinal cord results in the loss of sympathetic tone in the peripheral vascular bed, potentially impacting future organ grafts9,10. Following BD, the liver increased glycolytic gene expression (Pfk-1) with decreased glycogen stores, while the kidneys increased fermentation-related expression (Ldha). These systemic disturbances may have detrimental effects on future donor organs. In During BD, oxygen consumption signifcantly increased in the liver, while tissue perfusion the liver and kidneys, this has been evidenced by increased injury biomarkers in plasma decreased in the kidneys. Mitochondrial respiration and complex I/ATP synthase activity and apoptosis, immune activation, infammation, and oxidative stress in tissue4,6,11-13. were unaffected in both organs following BD. Treatments administered to brain-dead donors to improve post-transplantation graft, and thus recipient, survival may be of beneft. However, systematic reviews show no Discussion consistent evidence for the effectiveness of any such treatments14,15. Hence, new strategies are needed to assess and optimise organ quality prior to transplantation by the use of In conclusion, the liver responds to increased metabolic demands during BD, enhancing innovative organ-specifc treatments given either to the donor or during ex vivo machine aerobic metabolism with functional mitochondria. In contrast, the kidneys shut down perfusion. metabolically, shifting towards anaerobic energy production while renal perfusion is decreased. Our fndings highlight the need for an organ-specifc approach to assess and In an attempt to identify alternatives to assess or improve donor-organ quality, we optimise graft quality prior to transplantation. initiated this study to investigate alterations during BD in the liver and kidneys. Under normal circumstances, both organs are metabolically active, i.e. the liver fulfls a synthesis and detoxifcation function and the kidneys an excretory one. The liver is considered the predominant site for carbohydrate, lipid, and amino acid metabolism16. Nevertheless, the kidneys are responsible for supplying up to half of the total blood glucose levels during prolonged fasting or starvation16,17. These metabolic processes are normally tightly regulated as perturbances in metabolic checkpoints e.g. changes in nutrient or oxygen supply can initiate both apoptosis and necrosis18. Glucose levels in particular are under tight neuro-endocrine control through actions of insulin, catecholamines, thyroid hormone, and cortisol17. Considering the dysregulation of this neuro-endocrine system, as well as tissue injury and apoptosis during BD, it is conceivable that metabolism changes during BD and that these changes refect or even infuence the quality of transplantable organs.

Few studies have explored metabolic changes in the brain-dead donor. Novitzky et al. reported decreased metabolite utilisation and accumulation of fatty acids and lactate in plasma, suggesting a shift from aerobic to anaerobic metabolism19. Similar results in the myocardium of brain-dead pigs pointed towards increased anaerobic metabolism in combination with decreased ATP levels20. These results suggest that the observed metabolic changes are caused either by impaired oxygen utilisation due to a primary

74 75 CHAPTER 5 DECREASED RENAL PERFUSION DURING BRAIN DEATH

metabolic (i.e. mitochondrial) impairment or alternatively, by impaired oxygen delivery at 0.3 ml/h) was administered to avoid movements during MR scanning. Sham animals due to changes in tissue perfusion21. Mitochondrial impairment can cause increased underwent an identical surgical procedure, without insertion of the Fogarty catheter, while anaerobic ATP production as well as oxidative stress22,23 and has previously been observed anaesthesia lasted the entire 4 h of experimental time. in the hearts of brain-dead pigs24 and the muscle fbres of brain-dead, human subjects21. However, mitochondrial function following BD in the liver and kidneys has not been After 4 hrs, the experiment was terminated as previously described27 and the liver, kidneys, examined. Alternatively, the observed anaerobic alterations could result from changes in plasma and urine were harvested. Tissue from the liver and one kidney were used for peripheral perfusion in the hemodynamically unstable brain-dead donor. Animal studies mitochondrial isolation. Additional tissue, plasma and urine were stored. have shown decreased perfusion of the liver and kidney immediately following the Cushing response25 as well as traumatic brain injury26. However, perfusion of the liver and kidneys Plasma injury markers, blood gas analysis, and metabolites during BD has not yet been explored. Plasma levels of AST, ALT, creatinine, urea, LDH, glucose, and lactate were determined at The purpose of this study was to investigate the infuence of BD on systemic and the clinical chemistry laboratory of the University Medical Centre Groningen according 5 specifcally hepatic and renal metabolism, in a rodent BD model. We hypothesised that to standard procedures. Results from one sham animal resulted in supraphysiological 5 previously observed anaerobic changes during BD originated at least in part from either values of plasma markers, which was confrmed statistically with an outlier test. As a mitochondrial dysfunction or impaired peripheral perfusion in the liver and kidneys. To test result, this animal was removed from the analyses. Blood gas analyses were performed this hypothesis we used repetitive in vivo magnetic resonance imaging (MRI) throughout immediately after aortic puncturing using ABL725 analysers (Radiometer Medical Aps, BD to visualise tissue perfusion and oxygenation. Furthermore, mitochondrial function Brønshøj, Copenhagen, Denmark) to determine the pH, partial pressure of oxygen, partial pressure of carbon-dioxide, haemoglobin and SaO . Samples containing blood clots were was assessed by measuring in vitro mitochondrial respiration as well as mitochondrial 2 proteomics. Our fndings showed different metabolic responses in the liver versus kidneys excluded from analyses. during BD, suggesting the need for an organ-specifc approach to assess and optimise 55 graft quality prior to transplantation. Acylcarnitine analysis was performed using a method previously described . Supernatant acylcarnitine concentrations were measured with an API 3000 LC-MS/MS, equipped with a Turbo ion spray source (Applied Biosystems/MDS Sciex, Ontario, Canada). METHODS Brain death model Glucose metabolism and glycogen storage Sixteen male, adult Fisher F344 (Harlan, UK) rats (250-300 g) were randomly assigned to Periodic acid–Schiff staining the BD (n = 8) or sham-operated (sham) group (n = 8). The experimental protocol was To determine glycogen tissue concentrations, a PAS staining was performed in paraffn approved by the Danish Animal Experimentation Inspectorate, under The Ministry of embedded tissue samples. Next, all slices were scanned and 10 pictures per slice at 20 x of 56 Food, Agriculture, and Fisheries (Approval no. 2014-15-2934-01007). All animals received magnifcation used to estimate the positive PAS area with ImageJ script . The fnal value care in compliance with the National Institutes of Health Guide for the Care and Use of per slice was recorded as the mean of positive areas. Laboratory Animals and the European Convention for the Protection of Vertebrate Animals Used for Experimental and Other Scientifc Purposes. Rats were kept in cages in a 12:12 RNA isolation, cDNA synthesis, and Real-Time quantitative PCR hour light-dark cycle, with a temperature of 21°C ± 2°C, and humidity levels of 55% ± 5%. From whole liver and kidney sections, we isolated total RNA using TRIzol (Life Technologies, 11 Animals had ad libitum access to a standard rodent diet (Altromin, Lage, Germany) and Gaithersburg, MD), with a method previously described . Amplifcation of several genes tap water. fragments was done with the primer sets outlined in Table 1. Pooled cDNA from brain-dead rats was used as internal references. Gene expression was normalised with the mean of The brain death model used was previously described by Kolkert et al.27, with the following β-actin mRNA content. Real-Time PCR was carried out according to standard procedures 11 -ΔΔCT adaptations to ensure MRI compatibility. Animals were anesthetized using sevofurane as previously described . Results were expressed as 2 (CT - Threshold Cycle).

with 100% O2, intubated via a tracheostomy, and ventilated (MR-compatible Small Animal Ventilator. SA Instrument, Inc. NY. USA.) with the following ventilation parameters: tidal Table 1. Primer sequences used for Real-Time PCR. volume of 7 ml/kg of body weight (kg) per stroke, positive end expiratory pressure of 3 cm of H O with an initial respiratory rate of 120 per min, and corrected based on end- Gene Primers Amplicon 2 size (bp) tidal CO2 (ETCO2). Continuous MAP monitoring and volume replacement was performed via cannulas that were inserted in the femoral artery and vein, respectively. Besides a Pck-1 5'-TGTTCTCCGAAGTTCGCATCT-3' 5'-CTGCTACAGCTAACGTGAAGAACTG-3' 91 frontolateral hole, drilled for the epidural placement of a no. 4 Fogarty catheter used to Pk 5'-TGGCAGTGTGCAAGGACCA-3' 5'-CTTTATTATTCATTCCTCTGTCCTCTCC-3' 81 induce BD (Edwards Lifesciences Co, Irvine, CA), a second hole was drilled contralaterally Ldha 5'-AATATTACGTGAAATGTAAGATCTGCATATG-3' 5'-TTTTCCTTGGCATGACACTTGAG-3' 70 for ICP monitoring with a 24G cannula. BD was induced by infation of the Fogarty catheter; Pc 5'-ATCTCTTGCCAAATAAGGGTCTGC-3' 5'-CAGAGGTAGAACCCCTCTCCCA-3' 88 this infation was ended once the MAP rose above 80 mmHg. BD was confrmed when the ICP superseded the MAP. Possible reasons for exclusion of animals from the study Pfk-1 5'-GCATAGACAAGGGTTTCTGAGCTTA-3' 5'-AGCACTGGGAGGGAGAGAGAGT-3' 74 was the inability to confrm BD or maintain a normotensive MAP. Rocuronium (0.1 mg/ml Ho-1 5’-CTCGCATGAACACTCTGGAGAT-3’ 5’-GCAGGAAGGCGGTCTTAGC-3’ 74

76 77 CHAPTER 5 DECREASED RENAL PERFUSION DURING BRAIN DEATH

Mitochondrial respiration ASL MRI relies on a difference in the T1-weighted signal of infowing blood compared to that of the tissue of interest, allowing estimation of relative changes in tissue perfusion. Mitochondrial isolation For T1-measurements a single-slice segmented Look–Locker sequence with a gradient- After 4 h of BD, organs were removed and placed into ice-cold 0.9% KCl solution. A 57 echo readout was used to acquire T1-weighted data. The following sequence parameters differential centrifugation procedure was used to isolate either mitochondria from 1.5 were used: matrix of 128×128, FOV of 80×80 mm2, fip angle of 8°, TR of 3 ms, TE of 2 ms, g of liver tissue or a whole kidney. The total volume of working reagent required was inversion times (TI) of 150, 250, 400, 600, 900, 1200, 2500, 4000 ms, and 2 mm thickness. determined by calculation of the protein concentration in the mitochondrial suspension with a BCA protein assay kit (Pierce, Thermo Fisher Scientifc Inc., Rockford, IL, USA). VnmrJ (Agilent Technologies) was used for image reconstruction and volumetric analysis. Manually drawn regions of interest were encompassed around the liver and kidneys. High resolution respirometry Quantitative T2* maps were calculated from pixel-by-pixel analysis using a nonlinear least- The rates of oxygen consumption in isolated mitochondria (0.4 mg/ml of mitochondrial squares ft to the logarithmic magnitude vs. TE. Quantitative T1 maps were was calculated protein) were measured at 37 °C using a two-channel high-resolution Oroboros oxygraph- from a three-parameter ft applied to the inversion recovery Look-Locker sequence, using 2k (Oroboros, Innsbruck, Austria). Assay medium contained: EGTA (0.5 mM), MgCl 5 2 the mathematical approach given by Ramasawmy et al60. 5 (3 mM), KH2PO4 (10 mM), Lactobionic acid (60 mM), Taurine (20 mM), HEPES (20 mM), D-Sucrose (110 mM), and bovine serum albumin (BSA, 1 mg/ml, pH 7.2). The substrates Mitochondrial proteomics, complex I and ATP synthase activity, and tissue ATP for oxidation were: (i) pyruvate (5 mM) + malate (2 mM), (ii) succinate (5 mM) + rotenone (1 μM), (iii) glutamate (5 mM) + malate (5 mM), and (iv) palmitoyl-CoAa (25 μM) + L-carnitine levels (2 mM) + malate (2 mM). To reach maximal ADP-stimulated oxygen consumption (state Targeted, quantitative mitochondrial proteomics 3) hexokinase (4.8 U/ml), glucose (12.5 mM), and ADP (1 mM) were added. Resting state In isolated mitochondria, we quantifed a selection of mitochondrial proteins involved in the oxygen consumption rate (state 4) was measured after we blocked ADP phosphorylation substrate transport, FAO and TCA cycle, using isotopically-labelled standards (13C-labeled with carboxyatractyloside (1.25 μM). The oxygen consumption rate in the uncoupled lysines and arginines). These were derived from synthetic protein concatamers (QconCAT) state (state U) was determined after addition of carbonyl cyanide-4-(trifuoromethoxy) (PolyQuant GmbH, Bad Abbach, Germany), using a method previously described61. phenylhydrazone (FCCP, 2 μM). The respiratory control ratio (RCR) was calculated by dividing oxygen consumption rate in state 3 by that of state 4. Data acquisition (4 Hepatic and renal ATP concentrations Hz sampling frequency) and analysis were performed using DatLab software version 5 Frozen liver and kidney tissue was cut into 20 mm slices; 650 mg of these slices were used (Oroboros, Innsbruck, Austria). to determine ATP content according to standard procedures62.

MRI assessment of oxygen consumption (BOLD) and perfusion (ASL) Complex I and ATP synthase enzyme activity measurements Mitochondria were isolated as previously described57, then diluted in PBS, lysed Animals were placed in a MRI compatible animal-bed (Rapid Biomedical, Würzburg, by sonication, and centrifuged at 600 g for 10 min at 4 °C. Protein concentration was Germany) and the following parameters controlled: rectal temperature, blood and determined in the supernatant using a BCA protein assay kit (Pierce, Thermo Fisher intracranial pressure, ETCO , and pulse oximetry. MRI data was collected with an Agilent 2 Scientifc Inc., Rockford, IL, USA). 9.4 T preclinical MRI system (Agilent Technologies, Yarnton, UK), containing a 72-mm quadrature 1H transmit/receive volume coil (Rapid Biomedical, Würzburg, Germany). Activity of complex I was monitored spectrophotometrically at 600 nm and 37 °C, as previously described63. Rotenone-sensitive complex I activity was calculated using the A high-resolution coronal spin-echo sequence was employed for anatomical description, molar extinction coeffcient of DCIP, equal to 21000 M-1cm-1 and expressed as nmol/min/ acquired using the following sequence parameters: matrix 256×192, feld of view (FOV) mg protein63. The activity of ATP synthase was measured spectrophotometrically at 340 of 107×90 mm2, repetition time (TR) of 3000 ms, echo time (TE) of 22.8 ms, and 1 mm nm and 37 °C, as previously described64. Oligomycin-sensitive ATP synthase activity was thickness. calculated using the molar extinction coeffcient of NADH, equal to 6220 M-1cm-1 and expressed as nmol/min/mg mitochondrial protein64. BOLD MRI relies on differences in oxygenated and deoxygenated haemoglobin concentrations in blood vessels and surrounding tissue. These differences cause contrast in MRI infuencing the so-called spin-spin relaxation rate (R2*), allowing R2* values to be Oxidative stress markers correlated to oxygen consumption (when external factors such as regional perfusion are Determination of oxidative damage through quantifcation of lipid peroxidation accounted for) and inversely correlated to oxygen availability of a specifc region of interest Lipid peroxidation product MDA was quantifed in liver and kidney homogenates (20 (i.e. low R2* values indicate low oxygen consumption yet high oxygenation)58,59. R2* can µl) by measuring the formation of thiobarbituric acid reactive substances with a method be calculated using an oxygenation-dependent sequence (T2*-weighted) and obtained previously described12. using an axial 1H-multi-echo gradient-echo sequence, covering the entire abdomen with 32 slices using the following sequence parameters: matrix of 128×128, FOV of 80×80 Gene expression of protective protein Heme oxygenase-1 mm2, fip angle of 90°, TR of 800 ms, TE of 2, 4, 6, 8, 10, 12, 14, and 16 ms, number of Gene expression of Ho-1 was determined with Real-time PCR as described previously with transients of 2, and 2 mm thickness. R2* levels calculated at baseline (time 0 h) served as the primer set outlined in Table 1. an internal control to calculate relative changes in oxygenation, a measure superior to absolute values59.

78 79 CHAPTER 5 DECREASED RENAL PERFUSION DURING BRAIN DEATH

Statistical Analyses changes in medium-chain (C6 – C12) acylcarnitine concentrations (C6, C12:1, and C14: p < 0.05; C18: p < 0.05, Fig 2). For *R2 BOLD and T1 data, we estimated that we would need a total of 8 animals per group to detect a clinically signifcant difference with an of 0.05, power of 80%, using a two- α Glucose metabolism and glycogen storage in the liver and kidneys following tailed test. Descriptive statistics were done to confrm that the data met the assumption of equal distributions of residuals. A linear mixed model was used with repeated measured brain death over time to analyse the impact of the treatment (BD or sham) on BOLD and ASL in Expression of the glycolytic enzyme phosphofructokinase-1 (Pfk-1) was increased in the the liver and kidney, with fxed effects of time, treatment group, and the interaction of liver (p < 0.001), but not the kidney (p = 0.319) of brain-dead versus sham animals (Fig treatment and time (IBM SPSS Statistics 23). This model was chosen because it takes the 3A). mRNA levels of glycolytic enzyme pyruvate kinase (Pk) did not differ between groups dependency of the measurements across time into consideration, and prevented list-wise the liver (p = 0.336) and kidney (p = 0.130) (Fig 3B). The gluconeogenic enzyme pyruvate deletion caused by missing data points. The model selection for covariance parameters carboxylase (Pc) was similarly expressed in both groups in the liver (p = 0.093) and kidney was chosen based on the best ft according to the Bayesian Information Criterion. When (p = 0.293), whereas PEP carboxykinase-1 (Pck-1) expression was signifcantly lower in the comparing two independent groups at a single time point, the non-parametric Mann- kidneys of brain-dead compared to sham animals (p < 0.001) yet not different between 5 Whitney test was used to identify signifcant differences between the groups (n = 8 in each groups in the liver (p = 0.694, Fig 3E). Expression of the fermentation-related enzyme 5 group) with Prism 6.0 (GraphPad Software Inc, CA, USA). To confrm abnormal results, a lactate dehydrogenase A (Ldha) was not different between groups in the liver (p = 0.190), boxplot was performed to identify extreme outliers and considered signifcant when they whereas increased expression was observed in the kidney of brain-dead versus sham scored > 3 x IQR compared to the other values with IBM SPSS Statistics 23. All statistical groups (p = 0.038) (Fig 3C). Liver glycogen levels estimated with Periodic Acid–Schiff (PAS) tests were 2-tailed and p < 0.05 was regarded as signifcant. Results are presented as mean staining showed a decrease in positively stained areas in the liver (p = 0.026), but not the ± SD (standard deviation). kidney (p = 0.151) of brain-dead versus sham animals (Fig 3F).

RESULTS Brain death parameters As an internal control for the BD model, declaration of BD was confrmed when the ICP superseded the mean arterial pressure (MAP) and consequently cerebral perfusion pressure (CPP) was lower than 0 mmHg (Fig S1). Induction of BD showed a uniform MAP pattern consistent with previous studies11,27, with a mean time 29.3 ± 6.0 min to declare BD declaration. MAP of all animals was maintained above 80 mmHg throughout the experiment without the use of vasopressors or colloids. One out of eight experimental brain-dead animals had a CCP higher than 0 mmHg due to an obstruction of the ICP catheter, but as it showed a characteristic MAP profle and absent corneal and pupillary refexes, the animal was included in the study (Fig S1).

Plasma functional and injury markers, metabolites, and pH following brain death In plasma of brain-dead animals, increased levels of hepatic injury marker aspartate transaminase (AST, p = 0.001) but not alanine transaminase (ALT, p = 0.829) were found compared to sham animals (Fig 1A-B). Renal functional markers urea (p = 0.006) and creatinine (p = 0.001) were also increased following BD (Fig 1C-D). Lactate dehydrogenase Figure 1. Brain death induced renal failure and caused increased AST and lactate levels, yet decreased glucose levels (LDH) levels tended to be higher in the brain-dead group (p = 0.053, Fig 1E). Plasma in plasma. A) aspartate transaminase, B) alanine transaminase, C) creatinine, D) urea, E) lactate dehydrogenase, F) glucose concentrations were signifcantly reduced following BD (p = 0.005, Fig 1F), yet glucose, and G) lactate levels in plasma. H) pH determined with blood gas analyses after 4 h of experimental time. Results are presented as mean ± SD, n = 7 per group (** p < 0.01). lactate levels (p = 0.450, Fig 1G) and pH (p = 0.073, Fig 1H) were not different between the two groups. Results from one sham animal indicated supraphysiological values of these plasma markers, which was confrmed statistically with an outlier test. As a result, this animal was removed from the analyses. No changes in mitochondrial respiration in the liver and kidneys following brain death Acylcarnitine analysis showed that the concentrations of short-chain acylcarnitines (C3, Mitochondrial function was assessed by measuring O2 consumption rates in isolated hepat- C4, and C5: the degradation products of branched-chain amino acids) were signifcantly ic and renal mitochondria when oxidising four different substrate combinations in different increased in the plasma of brain-dead animals (C2 and C5: p < 0.05, C3 and C4: p < 0.01, metabolic states (Fig 4A-D). There were no signifcant changes in the maximal ADP-stimu-

Fig 2). Measurements of mitochondrial fatty acid -oxidation (FAO) metabolites in plasma lated O2 consumption rate (state 3) in both the liver and kidney, indicating that the capac- showed slightly elevated long-chain (C14 – C18) acylcarnitines concentrations, yet minimal ity to produce ATP through the oxidative phosphorylation pathway was not affected by

80 81 CHAPTER 5 DECREASED RENAL PERFUSION DURING BRAIN DEATH

BD. Mitochondrial quality control was assessed with the respiratory control ratio (RCR), as a means to detect any changes in oxidative phosphorylation capacity related to tightness of mitochondrial coupling. The RCRs were not signifcantly different in brain-dead com- pared to sham animals when tested with any of the four substrate combinations (Fig 4E-H).

5 5

Figure 4. Mitochondrial respiration is unaffected in the liver and kidney following brain death. Maximal ADP-

stimulated (state 3) O2 consumption rate and Respiratory Control Ratio (RCR) tested using substrates related to A,E) the TCA cycle (Glutamate + Malate); B,F) complex II-dependent respiration (Succinate + Rotenone); C,G) glutamate transaminase (Glutamate + Malate); and D,H) fatty acid β-oxidation (Palmitoyl-CoA + L-carnitine + Malate). Results are presented as mean ± SD, n = 8 per group.

Increased hepatic oxygen consumption (BOLD) and decreased renal perfusion (ASL) following brain death Figure 2. Brain death increased fatty acid oxidation. After 4 h of experimental time, plasma concentrations of saturated and unsaturated acylcarnitines were measured in sham and brain-dead rats with different carbon (C) chain Blood oxygen level dependent (BOLD) MRI relies on differences in oxygenated and lengths: short (C0 – C5), medium (C6 – C12), and long (C14 – C18) chain acylcarnitines. Data are represented as deoxygenated haemoglobin concentrations in blood vessels and surrounding tissue, mean ± SD, n = 8 per group (* p < 0.05, ** p < 0.01, compared to sham). which in turn causes contrast in the spin-spin relaxation rate (R2*), allowing this rate to be correlated to oxygen availability. R2* baseline values were not different between sham and brain-dead animals in the liver and kidneys (Fig 5A, C, E). Using a linear mixed model for R2* BOLD values in the liver, we found a signifcant interaction between time and treatment group (p < 0.001), showing signifcant changes between groups over time (Fig 5A). Estimated effects in the liver were: BOLD BD = 0.157 + 0.009 * time; BOLD sham = 0.168 – 0.011 * time. In the kidneys, there was no signifcant effect of treatment and time nor a signifcant interaction effect between groups (Fig 5C, E).

Arterial spin labelling (ASL) MRI relies on a difference in the T1-weighted signal of infowing blood compared to that of the tissue of interest. This signal difference can be used to estimate relative changes in tissue perfusion. In the liver, there was no signifcant effect of treatment and time nor a signifcant interaction effect between groups (Fig 5B). In contrast, in each of the kidneys, the linear mixed model for relative T1-weighted perfusion found signifcant interactions between time and treatment group (p < 0.05) in both kidneys (Fig 5D, F). This indicates that there are signifcant changes between the two treatment groups over time. Estimated effects for the left kidney were: ASL BD = 0.429 – 1.356 * time; ASL sham = -0.638 + 1.193 * time. Estimated effects for the right kidney were: ASL BD = -1.113 – 1.160 * time; ASL sham = -0.524 + 0.305 * time.

Figure 3. Carbohydrate metabolism-related gene expression profles and glycogen content in the liver and kidney after 4 h of brain death. Relative gene expression of glycolysis related genes A) Phosphofructokinase-1 (Pfk-1) and B) Pyruvate Kinase (Pk), C) fermentation related gene Lactate dehydrogenase A (Ldha), and gluconeogenesis related genes D) Pyruvate carboxylase (Pc) and E) PEP carboxykinase 1 (Pck-1). F) Periodic acid–Schiff staining of glycogen, overall quantifcation at 20x magnifcation. Results are presented as mean ± SD, n = 8 per group (* p < 0.05, *** p < 0.001).

82 83 CHAPTER 5 DECREASED RENAL PERFUSION DURING BRAIN DEATH

Increased metabolism-related protein expression in the liver and decreased expression in the kidney Using a targeted, quantitative proteomics approach, we quantifed 50 proteins involved in oxidative phosphorylation, tricarboxylic acid cycle (TCA), FAO, and substrate transport, as well as several antioxidant enzymes, in isolated hepatic and renal mitochondria. In the liver of brain-dead animals, we observed increased protein concentrations of peptides involved in substrate transport (Ucp2), the connection between glycolysis and TCA cycle (Dld and Dlat), and FAO (Acadm and Acadvl) (p < 0.05, Fig 6). Interestingly, most signifcant changes in the kidney showed decreased concentrations. These proteins were related to complex I (Ndufs1), TCA cycle (Aco2, Fh, and Suclg2) and the connection between FAO and electron transport chain (Etfdh), and FAO (Hadhb) (p < 0.05, Fig 6). The expression of two renal proteins, involved in substrate transport (Ucp2) and the TCA cycle (Dlat), was 5 signifcantly higher in brain-dead compared to sham animals (p < 0.05, Fig 6). 5 To estimate how these changes in protein expression could infuence the metabolic status of the potential grafts, cellular ATP content was measured. We showed reduced ATP levels in both the liver and kidney of brain-dead animals (both p < 0.001, Fig S2A), suggesting a decreased bio-energetic status in both organs following BD. The signifcantly different renal expression of a complex I peptide, as well as lower ATP levels in both liver and kidney, led us to investigate the activities of complex I and ATP synthase individually. We observed no differences in complex I and ATP synthase activity comparing brain-dead versus sham animals (Fig S2B, C).

Hepatic and renal oxidative stress markers Tissue oxidative stress markers were assessed to evaluate how the observed changes in perfusion and oxygenation affected the liver and kidneys. Malondialdehyde (MDA), which relates to the amount of lipid peroxidation by reactive oxygen species (ROS), was increased in the kidney (p = 0.003), but not the liver (p = 0.442), of brain-dead compared to sham animals (Fig S3A). Furthermore, expression of the stress-response protein Heme oxygenase-1 (Ho-1) was increased in the liver (p = 0.017), while no signifcant changes were observed in the kidney (p = 0.068) in brain-dead versus sham animals (Fig S3B).

Figure 5. Increased hepatic deoxyhaemoglobin concentration and decreased renal blood fow during brain death. A, C, E) Hourly, R2* BOLD Magnetic Resonance Imaging (MRI) was performed to estimate deoxyhaemoglobin levels in brain-dead and sham rats, where time “0” represents baseline measurements. B, D, F) Hourly, T1-weighted MRI data was used to estimate the relative change in tissue blood fow compared to Figure 6. Mitochondrial proteomics profle. Data are represented as mean fold induction of average protein baseline measurements in brain-dead and sham animals. Results are presented as mean ± SD, n = 8 per group concentration (fmol/µg total protein) in BD versus sham groups in the liver and kidney. Differences in protein (interaction group * time: * p < 0.05, ** p < 0.001) G) An example of a greyscale T2 map for liver tissue with on concentrations are considered signifcant when p < 0.05 in BD versus sham groups per individual organ, n = 8 per the left-hand side a grayscale, T2 signal image. On the right-hand side a T2*-weighted signal is represented as group. a colour map. H) An example of T1 signal images of liver tissue at different inversion times. From the top left to bottom right the signal passes from the hepatic vessels through to the hepatic tissue.

84 85 CHAPTER 5 DECREASED RENAL PERFUSION DURING BRAIN DEATH

DISCUSSION However, the notion that the liver responds to increased energetic demands during BD is further supported by increased BOLD-related oxygen consumption, as well as the The aim of the present research was to evaluate the metabolic status of the brain- increased expression of metabolic proteins. BOLD MRI has been well established by dead donor in order to explore novel methods to assess and target graft quality prior researchers studying the central nervous and urogenital system to detect changes in to transplantation. We demonstrated systemic, but also differentiated organ-specifc, oxygen availability. Initial exploratory studies in the liver have shown great promise of this metabolic changes during BD. In the liver, we observed increased aerobic glycolysis with technique in testing for therapeutic effects of tumour chemoembolization therapy32. functional mitochondria, a shift towards fatty acid metabolism, and increased oxygen consumption compared to healthy controls. In the kidneys on the other hand, we found However, to ensure that the BOLD-related oxygen availability we observed was indeed increased anaerobic metabolism concomitant with decreased renal perfusion, despite a refection of oxygen consumption, we assessed several factors also known to infuence functional mitochondria that maintained normal oxygen utilisation. Together, these results BOLD signalling, including changes in tissue blood fow; external factors including pH, portray a distinct metabolic response in the brain-dead donor and provide a framework for hydration status, and circulating volume; and effectiveness of oxygen consumption further exploration of targeted donor and organ assessment and management strategies. for example by the mitochondria33. Firstly, total hepatic blood fow, which normally 5 represents 75% portal and 25% arterial fow34, did not change during the course of BD. 5 A systemic assessment of metabolic alterations following BD revealed changes in plasma Secondly, plasma pH and haemodynamic status did not differ between brain-dead and metabolites that are similar to those observed during prolonged fasting and starvation, and sham animals. Thirdly, mitochondrial function was not affected as was demonstrated that indicate glucose depletion, a shift towards fatty acid metabolism and a breakdown of by mitochondrial respiration and complex activity analyses. Taken together, these data amino acids. These observations confrm previous fndings that demonstrated decreased suggest that increased BOLD-related signal (i.e. lower oxygen availability) is largely glucose and increased fatty acid levels8,19 and that are comparable to those seen during a refection of increased oxygen consumption in the liver during BD. Moreover, we believe prolonged fasting and starvation: the release of free fatty acids from fat tissue and their that this increased oxygen consumption can likely be attributed to increased metabolic use as an alternative energy source when glucose levels are decreased16,17. Furthermore, activity. This is supported by the proteomics analysis showing increased mitochondrial lactate levels and blood pH were unaltered following BD, in agreement with a study on protein expression of several peptides involved in the TCA cycle as well as FAO. The BD in pigs, in which lactate levels normalised within three hours of BD onset7. In contrast, increased expression of proteins involved in these processes suggests that the liver clinical studies have shown variable lactate levels in brain-dead subjects8,19,28, as would facilitates increased oxidative metabolism during BD. be expected in heterogeneous situations. These variations in lactate levels may refect differences in the ability to recycle lactate via the Cori cycle, a pathway that restores or The adaptive hepatic response is in sharp contrast to the metabolic changes observed maintains glucose levels during prolonged fasting and starvation in humans29. in the kidneys. Following BD, a shift towards renal anaerobic glycolysis is evident with decreased ATP levels and increased oxidative stress, which we attribute to decreased Investigating organ-specifc changes during BD, we showed that aerobic metabolism renal perfusion as evidenced by T1-weighted MRI. Normally, the kidneys are important increased in the liver, with functional mitochondria and adequate hepatic perfusion. These players during prolonged fasting, maintaining glucose homeostasis by increasing results suggest that the liver remains metabolically active in order to meet the metabolic gluconeogenesis17. However, following BD, renal expression of Pck-1, the key limiting demands imposed by BD pathophysiology. Firstly, we showed decreased hepatic glycogen enzyme of gluconeogenesis, was decreased in combination with increased anaerobic stores following BD, suggesting increased glucose mobilisation via glycogenolysis. glycolysis and ATP depletion. Similar observations have been made in studies where renal These results are in line with studies that showed increased levels of the glycogenolysis- blood fow was reduced following urinary tract obstruction35, as well as a study on renal regulating hormone glucagon in pigs during BD7,30. Secondly, gene expression data with ischemia in mice that showed reduced levels of cortical glucose, suggestive of decreased in particular the increased expression of Pfk1, the key enzyme regulating the fux through gluconeogenesis36. These results indicate that hypoxia and not an adaptive mechanism to glycolysis, suggests stimulation of glycolysis during BD. This induction of glycolysis prolonged fasting, infuences metabolism in the kidney after BD. combined with decreased ATP levels during BD supports the idea that the liver faces increased energy demands and responds by increasing glucose catabolism. Regulation of The idea of hypoxia as a central injury mechanism is further supported by the decreased glucose metabolism is under direct control of catecholamines31, which stimulate aerobic renal ASL signal, which suggests impaired renal perfusion during BD. The use of ASL glycolysis (and thus ATP production) and increase glucose release via glycogenolysis as an alternative to contrast-dependent MRI has shown promise detecting changes in and gluconeogenesis31. Therefore, it is likely that the catecholamine surge during BD renal perfusion and has positively been correlated to plasma biomarkers in renal allograft contributed to increased hepatic glycolysis and glycogenolysis, even though we did not recipients during acute rejection37,38. In line with our results, a study on traumatic brain observe changes in gluconeogenesis. The absent gluconeogenic response in the liver injury in rodents showed decreased renal blood fow 60 min after injury, visualised with following BD may be due to an experimental duration that was potentially too short to radio-active microspheres, which the authors attributed to increased levels of circulating observe changes in gluconeogenic gene expression. Alternatively, the hepatic response catecholamines26. As renal blood fow is under sympathetic as well as hormonal control39,40, to catecholamines may have been impaired due to changes in adrenergic receptor it is conceivable that increased levels of circulating catecholamines, angiotensin II, and affnity, which can occur under pathophysiological conditions such as infammation or endothelin-I during BD41 are responsible for the decrease in renal perfusion. This is in line bacteraemia31. Thus, BD-induced infammation might have modulated the adrenergic and with a study by Dibona et al. that showed decreased renal blood fow following stimulation subsequent the gluconeogenic response in the liver. of the renal sympathetic nerves, an effect that was absent following renal denervation42. Together these data suggests that the anaerobic changes in the kidney are caused by impaired perfusion, presumably mediated by increased levels of vasoconstrictive hormones or increased sympathetic stimulation.

86 87 CHAPTER 5 DECREASED RENAL PERFUSION DURING BRAIN DEATH

Tissue perfusion of the kidneys is not the only determinant of oxygenation status, as it by increasing aerobic metabolism with functional mitochondria, whilst facilitating the use is also controlled by oxygen consumption, arterial-to-venous shunting, and oxygen of alternative energy sources. In contrast, the kidneys shut down metabolically and suffer 43 saturation (SaO2) levels . Firstly, we showed that oxygen availability and consumption, from oxidative stress, shifting towards anaerobic energy production while renal perfusion measured by mitochondrial respiration as well as BOLD MRI, were unaltered in the decreases. These results highlight the need for an organ-specifc approach to facilitate kidneys following BD. BOLD has previously been tested in transplanted kidney with acute optimal function of the liver and kidneys following BD. We suggest that treatment of the rejection and tubular necrosis44 and showed comparable results to invasive oxygenation liver graft should focus on raising metabolite supply with adequate oxygenation, thereby measurements45. These results suggest that the kidneys adequately consume and utilise optimising the metabolic conditions for the liver. On the other hand, kidney function oxygen following BD, portraying a metabolic phenotype similar to that of the diabetic should be ameliorated by improvement of renal perfusion while supporting cellular kidney in so-called pseudo-hypoxic conditions46-48. In this condition, lactate production detoxifcation, reverting back to aerobic metabolism and replenishing energy stores. An increases despite adequate oxygen consumption and mitochondrial function. Secondly, organ-specifc, dual approach focusing on metabolic changes could be part of a new the observed hypoxic changes following BD are unlikely to be attributable to either strategy to assess and treat organ grafts in the brain-dead donor or afterwards during

changes in arterial-to-venous shunting or SaO2. Shunting is believed to occur primarily as a preservation, and could be the key to improving transplantation outcomes. protective mechanism during hyperoxia or severe hypoxia43, and systemic SaO levels were 5 2 5 optimal throughout our experiment. Thus, our data suggest that the anaerobic changes in the kidney can be explained by decreased renal perfusion. Interestingly, a study on brain-dead rodents by Akhtar et al. suggested that mitochondrial function was impaired following BD, as demonstrated by impaired mitochondrial control ratios49. It is important to note that these results might be explained by a difference in experimental duration of the brain-dead versus the short, 30-min control group. An alternative explanation is that respiration was measured in cortical mitochondria alone49, which might suggest possible intrarenal differences in oxygenation and/or perfusion. Normally, perfusion and oxygenation is most predominant in the cortex of the kidney, while the medulla remains relatively hypoxic45,50. However, to protect the sensitive medulla during hypoxia, blood fow can be redistributed in favour of the medulla51. Another intrarenal difference is that vasoconstrictive hormones have a more pronounced effect on the cortex than the medulla40. Therefore, we suggest that BD might affect cortical perfusion more than medullary perfusion, which might explain differences in mitochondrial function between these areas. Despite possible intrarenal differences or a redistribution of blood fow, our data suggest that the anaerobic changes and oxidative stress in the kidney following BD are the result of overall decreased renal perfusion.

We acknowledge that several limitations apply to this study. Due to the experimental setup sham animals were exposed to a longer anaesthetic duration compared to brain-dead animals, which introduced anaesthetic duration as a possible confounder. Fortunately, studies on the effects of sevofurane administration in mice have shown that sevofurane does not alter histopathology or function of the liver and kidneys52,53, suggesting that possible short-term effects of this anaesthetic are negligible. Furthermore, interpretation of our study results raised questions on possible intrarenal or intrahepatic differences in oxygenation, perfusion, and cellular function. Even though we are aware of the importance of these potential differences, exploring these differences was outside the scope of this study. Additionally, the use of isolated mitochondria to measure mitochondrial respiration may be disadvantageous, as cellular context and effects of proliferation and localisation are lacking54. However, we have chosen to accept this risk as these statistical tests were performed for secondary outcome parameters (e.g. proteomics) which were used to indicate trends that were in support of our primary outcomes parameters (i.e. MRI and mitochondrial respiration).

In conclusion, we provide clear evidence that BD pathophysiology infuences systemic metabolic processes, alongside organ-specifc metabolic changes with noticeable differences between the liver and kidneys. The liver responds to higher metabolic demands

88 89 CHAPTER 5 DECREASED RENAL PERFUSION DURING BRAIN DEATH

REFERENCES 22. Griffths, E. J. & Rutter, G. A. 32. Yang, K., Zhang, X.-M., Yang, L., Xu, Mitochondrial calcium as a key H. & Peng, J. Advanced imaging 1. National Data: Donors Recovered in 11. Rebolledo, R. A. et al. Anti-Apoptotic regulator of mitochondrial ATP techniques in the therapeutic response the U.S. by Donor Type. Available at: Effects of 3,3’,5-Triiodo-L-Thyronine production in mammalian cells. of transarterial chemoembolization https://optn.transplant.hrsa.gov/data/ in the Liver of Brain-Dead Rats. PLoS Biochim. Biophys. Acta 1787, 1324– for hepatocellular carcinoma. World J. view-data-reports/national-data/#. ONE 10, e0138749 (2015). 1333 (2009). Gastroenterol. 22, 4835–4847 (2016). (Accessed: 1st March 2017) 12. Hoeksma, D. et al. Inadequate anti- 23. Hagberg, H., Mallard, C., Rousset, C. 33. Neugarten, J. & Golestaneh, L. Blood 2. Annual Report 2015. Available at: oxidative responses in kidneys of brain- I. & Thornton, C. Mitochondria: hub oxygenation level-dependent MRI for https://eurotransplant.org/cms/ dead rats. Transplantation (2016). of injury responses in the developing assessment of renal oxygenation. Int mediaobject.php?fle=AR_ET_20153. doi:10.1097/TP.0000000000001417 brain. Lancet Neurol 13, 217–232 J Nephrol Renovasc Dis 7, 421–435 pdf. (Accessed: 1st March 2017) 13. Rebolledo, R. A. et al. Slow induction (2014). (2014). 3. Rudge, C., Matesanz, R., Delmonico, of brain death leads to decreased 24. Novitzky, D. et al. Improved 34. Kim, S. H., Kamaya, A. & Willmann, J. 5 F. L. & Chapman, J. International renal function and increased hepatic cardiac allograft function following K. CT perfusion of the liver: principles 5 practices of organ donation. Br J apoptosis in rats. J Transl Med 14, 141 triiodothyronine therapy to both and applications in oncology. Anaesth 108 Suppl 1, i48–55 (2012). (2016). donor and recipient. Transplantation Radiology 272, 322–344 (2014). 4. Bos, E. M., Leuvenink, H. G. D., 14. Dikdan, G. S., Mora-Esteves, C. & 49, 311–316 (1990). 35. Klahr, S., Schwab, S. J. & Stokes, T. J. van Goor, H. & Ploeg, R. J. Kidney Koneru, B. Review of randomized 25. Schrader, H., Hall, C. & Zwetnow, N. Metabolic adaptations of the nephron grafts from brain dead donors: clinical trials of donor management N. Effects of prolonged supratentorial in renal disease. Kidney International Inferior quality or opportunity for and organ preservation in deceased mass expansion on regional blood 29, 80–89 (1986). improvement? Kidney International donors: opportunities and issues. fow and cardiovascular parameters 36. Zager, R. A., Johnson, A. C. M. & 72, 797–805 (2007). Transplantation 94, 425–441 (2012). during the Cushing response. Acta Becker, K. Renal cortical pyruvate 5. Terasaki, P. I., Cecka, J. M., Gjertson, D. 15. Rech, T. H. et al. Management of Neurol. Scand. 72, 283–294 (1985). depletion during AKI. J. Am. Soc. W. & Takemoto, S. High survival rates the brain-dead organ donor: a 26. Yuan, X. Q., Wade, C. E., Prough, D. Nephrol. 25, 998–1012 (2014). of kidney transplants from spousal systematic review and meta-analysis. S. & DeWitt, D. S. Traumatic brain 37. Wu, W.-C., Su, M.-Y., Chang, C.- and living unrelated donors. N. Engl. Transplantation 95, 966–974 (2013). injury creates biphasic systemic C., Tseng, W.-Y. I. & Liu, K.-L. J. Med. 333, 333–336 (1995). 16. JM, B., JL, T. & L, S. in Biochemistry hemodynamic and organ blood fow Renal perfusion 3-T MR imaging: a 6. Weiss, S. et al. Brain death activates (2002). responses in rats. J. Neurotrauma 7, comparative study of arterial spin donor organs and is associated 17. Gerich, J. E. Role of the kidney in 141–153 (1990). labeling and dynamic contrast- with a worse I/R injury after liver normal glucose homeostasis and 27. Kolkert, J. L. P. et al. The gradual enhanced techniques. Radiology 261, transplantation. Am J Transplant 7, in the hyperglycaemia of diabetes onset brain death model: a relevant 845–853 (2011). 1584–1593 (2007). mellitus: therapeutic implications. model to study organ donation and its 38. Lanzman, R. S. et al. Quantifcation of 7. Barklin, A. et al. Does brain death Diabet. Med. 27, 136–142 (2010). consequences on the outcome after renal allograft perfusion using arterial induce a pro-infammatory response 18. Green, D. R., Galluzzi, L. & Kroemer, G. transplantation. Lab. Anim. 41, 363– spin labeling MRI: initial results. Eur at the organ level in a porcine model? Cell biology. Metabolic control of cell 371 (2007). Radiol 20, 1485–1491 (2010). Acta Anaesthesiol Scand 52, 621–627 death. Science 345, 1250256 (2014). 28. Depret, J., Teboul, J. L., Benoit, 39. Artz, N. S. et al. Reproducibility of (2008). 19. Novitzky, D., Cooper, D. K., Morrell, G., Mercat, A. & Richard, C. Global renal perfusion MR imaging in native 8. Novitzky, D., Cooper, D. K. C., D. & Isaacs, S. Change from energetic failure in brain-dead and transplanted kidneys using non- Rosendale, J. D. & Kauffman, H. M. aerobic to anaerobic metabolism patients. Transplantation 60, 966–971 contrast arterial spin labeling. J Magn Hormonal therapy of the brain-dead after brain death, and reversal (1995). Reson Imaging 33, 1414–1421 (2011). organ donor: experimental and clinical following triiodothyronine therapy. 29. Katz, J. & Tayek, J. A. Recycling of 40. Evans, R. G., Eppel, G. A., Anderson, studies. Transplantation 82, 1396–1401 Transplantation 45, 32–36 (1988). glucose and determination of the Cori W. P. & Denton, K. M. Mechanisms (2006). 20. Novitzky, D., Wicomb, W. N., Cooper, Cycle and gluconeogenesis. Am. J. underlying the differential control of 9. Floerchinger, B., Oberhuber, R. & D. K. & Tjaalgard, M. A. Improved Physiol. 277, E401–7 (1999). blood fow in the renal medulla and Tullius, S. G. Effects of brain death on cardiac function following hormonal 30. Roelsgaard, K. et al. Effects of brain cortex. J. Hypertens. 22, 1439–1451 organ quality and transplant outcome. therapy in brain dead pigs: relevance death and glucose infusion on hepatic (2004). Transplant Rev (Orlando) 26, 54–59 to organ donation. Cryobiology 24, glycogen and blood hormones in the 41. Lopau, K., Mark, J., Schramm, L., (2012). 1–10 (1987). pig. Hepatology 24, 871–875 (1996). Heidbreder, E. & Wanner, C. Hormonal 10. McKeown, D. W., Bonser, R. S. & 21. Sztark, F., Thicoïpé, M., Lassié, 31. Barth, E. et al. Glucose metabolism changes in brain death and immune Kellum, J. A. Management of the P., Petitjean, M. E. & Dabadie, P. and catecholamines. Critical Care activation in the donor. Transpl. Int. 13 heartbeating brain-dead organ donor. Mitochondrial energy metabolism Medicine 35, S508–S518 (2007). Suppl 1, S282–5 (2000). Br J Anaesth 108 Suppl 1, i96–107 in brain-dead organ donors. Ann. (2012). Transplant. 5, 41–44 (2000).

90 91 CHAPTER 5 DECREASED RENAL PERFUSION DURING BRAIN DEATH

42. DiBona, G. F. & Kopp, U. C. Neural 53. Colucci, D., Ferrero, P., Ferreyra, P., 62. Op den Dries, S. et al. Hypothermic control of renal function. Physiol. Rev. Elena, G. & Puig, N. R. [Effects of oxygenated machine perfusion 77, 75–197 (1997). sevofurane anesthesia on the immune prevents arteriolonecrosis of the 43. Nourbakhsh, N. & Singh, P. Role of response and biochemical parameters peribiliary plexus in pig livers donated renal oxygenation and mitochondrial in mice. Comparison between single after circulatory death. PLoS ONE 9, function in the pathophysiology of exposure and repeated anesthesia]. e88521 (2014). acute kidney injury. Nephron Clin Rev Esp Anestesiol Reanim 50, 170– 63. Janssen, A. J. M. et al. Pract 127, 149–152 (2014). 175 (2003). Spectrophotometric assay for complex 44. Wang, Y.-T., Li, Y.-C., Yin, L.-L., Pu, H. 54. Brand, M. D. & Nicholls, D. G. I of the respiratory chain in tissue & Chen, J.-Y. Functional assessment Assessing mitochondrial dysfunction samples and cultured fbroblasts. Clin. of transplanted kidneys with magnetic in cells. Biochem. J. 435, 297–312 Chem. 53, 729–734 (2007). resonance imaging. World J Radiol 7, (2011). 64. Rustin, P. et al. Biochemical and 5 343–349 (2015). 55. Derks, T. G. J. et al. Neonatal molecular investigations in respiratory 5 45. Prasad, P. V. Evaluation of intra-renal screening for medium-chain acyl-CoA chain defciencies. Clin. Chim. Acta oxygenation by BOLD MRI. Nephron dehydrogenase (MCAD) defciency 228, 35–51 (1994). Clin Pract 103, c58–65 (2006). in The Netherlands: the importance 46. Williamson, J. R. et al. Hyperglycemic of enzyme analysis to ascertain true pseudohypoxia and diabetic MCAD defciency. J. Inherit. Metab. complications. Diabetes 42, 801–813 Dis. 31, 88–96 (2008). (1993). 56. Update on automated PAS analysis. 47. Takiyama, Y. & Haneda, M. Hypoxia in (2015). Available at: http://khairul. diabetic kidneys. Biomed Res Int 2014, forsciedu.com/?p=1383. (Accessed: 837421 (2014). 12 April 2017) 48. Laustsen, C. Hyperpolarized 13C 57. Mildaziene, V., Nauciene, Z., Baniene, Magnetic Resonance Treatment R. & Grigiene, J. Multiple effects Response Monitoring: A New of 2,2‘,5,5’-tetrachlorobiphenyl on Paradigm for Multiorgan Metabolic oxidative phosphorylation in rat liver Assessment of Pharmacological mitochondria. Toxicol. Sci. 65, 220–227 Interventions? Diabetes 65, 3529–3531 (2002). (2016). 58. Haque, M., Koktzoglou, I., Li, W., 49. Akhtar, M. Z. et al. Using an Integrated Carbray, J. & Prasad, P. Functional -Omics Approach to Identify Key MRI of liver using BOLD MRI: effect of Cellular Processes That Are Disturbed glucose. J Magn Reson Imaging 32, in the Kidney After Brain Death. Am J 988–991 (2010). Transplant 16, 1421–1440 (2016). 59. Neugarten, J. Renal BOLD-MRI and 50. Singh, P., Ricksten, S.-E., Bragadottir, assessment for renal hypoxia. Kidney G., Redfors, B. & Nordquist, L. Renal International 81, 613–614 (2012). oxygenation and haemodynamics in 60. Ramasawmy, R. et al. Hepatic arterial acute kidney injury and chronic kidney spin labelling MRI: an initial evaluation disease. Clin. Exp. Pharmacol. Physiol. in mice. NMR Biomed 28, 272–280 40, 138–147 (2013). (2015). 51. Epstein, F. H. Hypoxia of the renal 61. Wolters, J. C. et al. Translational medulla. Q. J. Med. 57, 807–810 Targeted Proteomics Profling of (1985). Mitochondrial Energy Metabolic 52. Puig, N. R. et al. Effects of sevofurane Pathways in Mouse and Human general anesthesia: immunological Samples. J. Proteome Res. 15, 3204– studies in mice. Int. Immunopharmacol. 3213 (2016). 2, 95–104 (2002).

92 93 CHAPTER MnTMPyP, a selective 6 superoxide dismutase mimetic, reduces oxidative stress in kidneys of brain-dead rats

D Hoeksma PJ Ottens S Veldhuis H van Goor H Leuvenink

In preparation CHAPTER 6 MnTMPyP DECREASES RENAL OXIDATIVE STRESS DURING BRAIN DEATH

ABSTRACT INTRODUCTION Introduction Delayed graft function (DGF) is a serious complication in renal transplant recipients1-3. DGF is associated with acute rejection, chronic allograft failure, and decreased renal function4,5. Delayed graft function (DGF) is a common complication in renal transplant recipients Kidneys from brain-dead donors, the most frequently transplanted kidneys, show DGF receiving kidneys from brain-dead donors. DGF is associated with acute rejection, chronic rates of 15-30%5,6. These fndings are not attributed to human leukocyte antigen (HLA) allograft failure, and decreased renal function. Brain death (BD)-related oxidative stress, mismatches, longer cold ischemia times, or donor age7. Rather, brain death (BD) elicits measured as malondialdehyde (MDA) levels, correlates well with DGF. Therefore, we detrimental effects in the donor which affect future donor grafts8-10. aimed to decrease renal oxidative stress in brain-dead rats through pre-treatment with MnTMPyP, a superoxide dismutase mimetic. BD leads to increased serum levels of the lipid peroxidation marker malondialdehyde (MDA) which indicates oxidative membrane damage9,11. MDA levels in the preservation Methods solution of kidneys retrieved from brain-dead donors correlate well with DGF in renal 11 BD induction was performed on 32 mechanically ventilated male Fisher rats by infating a transplant recipients . Moreover, donor serum MDA levels correlate with acute rejection 4.0 F Fogarty catheter in the epidural space. Rats were observed for 4 h And maintained and immediate and long-term renal allograft function. In expanded criteria donors (ECD), 12 hemodynamically stable through the administration of colloids and norepinephrine. MDA levels in machine perfusion solution also correlate with DGF . 6 Plasma, urine, and kidney tissue were collected for analysis. MnTMPyP (5.0 mg/kg) or 6 13 saline vehicle was administered intraperitoneally 30 min prior to BD induction. Endogenous antioxidants regulate the levels of reactive oxygen species (ROS) accurately . However, pathological conditions can increase oxidant production and overwhelm Results antioxidant defenses. Increased oxidant production results from dysfunctional oxidant producing enzymes such as xanthine oxidase, NADPH oxidase, nitric oxide synthase, and BD resulted in increased levels of renal superoxide, renal and serum MDA levels, renal mitochondrial electron transport chain complexes14. Superoxide is the primary formed oxidized glutathione, and renal HO-1 expression compared to sham values. These oxidant from these enzymes and increased levels are reported after BD15,16. Excessive ROS changes were all attenuated by MnTMPyP pre-treatment. BD also led to increased plasma production can subsequently impair antioxidant enzymes17. A disbalance in production creatinine levels, urinary NAG activity, renal leukocyte infux, and renal IL-6, TNF-α, and and metabolism of ROS leads to oxidative damage of cellular components such as E-selectin gene expression which were not reduced by MnTMPyP pre-treatment. proteins, nucleic acids, and lipid membranes18.

Conclusion Manganese (III) tetrakis(1-methyl-4-pyridyl) porphyrin (MnTMPyP) is a cell permeable superoxide dismutase mimetic with benefcial renal effects in models of sepsis and MnTMPyP pre-treatment of brain-dead rats leads to decreased oxidative stress in kidneys ischemia-reperfusion (I-R) injury19-21. In these models, the decrease in superoxide levels of brain dead rats. Amongst others, BD-related MDA levels were decreased which results in improved renal function and decreased infammation. Furthermore, by decreasing correlate with DGF. Therefore, MnTMPyP treatment of brain-dead donors could lead to superoxide levels, MnTMPyP prevents peroxynitrite formation, a highly potent oxidant22. decreased incidence of DGF and thereby better renal transplantation outcomes.

With the present study, we aimed to decrease renal oxidative stress and thereby serum MDA levels which correlate with DGF, acute rejection and post-transplant renal function in renal transplant recipients. To achieve this goal, we pre-treated brain-dead rats with the superoxide scavenger MnTMPyP.

MATERIALS AND METHODS Animal BD model Male adult Fisher F344 rats (250-300 g) were anesthetized using isofurane and subsequently intubated. The left femoral artery and vein were cannulated for blood pressure monitoring and administration of plasma expanders or norepinephrine. A no. 4 Fogarty catheter (Edwards Lifesciences Co., Irvine, CA, USA) was placed in the epidural space through a frontolateral burr-hole in the skull. The catheter was infated (16 µl/min) with saline using a syringe pump (Terufusion, Termo Co., Tokyo, Japan). Infation at this speed leads to increased levels of renal oxidative stress compared to faster infation15. The increase in intracranial pressure (ICP) leads to BD after approximately 30 min. Infation of the balloon was stopped when the mean arterial pressure (MAP) reached 80 mmHg due to the catecholamine storm characteristic for BD. BD was confrmed by the absence of corneal refexes. Anesthesia was stopped after BD confrmation and the animals remained

ventilated with O2/air. MAP was kept between 80-120 mmHg by using 10% hydroxyethyl 96 97 CHAPTER 6 MnTMPyP DECREASES RENAL OXIDATIVE STRESS DURING BRAIN DEATH

starch (HAES) (Fresenius Kabi AG, Bad Homburg, Germany) and noradrenaline (NA) if to the wells. The absorbance was measured at 430 nm for 15 min at 30 ºC. The linear part necessary. After 4 h of BD, blood was collected through the abdominal artery after which of the kinetic curve was used for the rate estimation and compared with a standard curve the organs were fushed with saline. Centrifuged blood samples and urine from the bladder of oxidized glutathione (GSSG). Samples were corrected for total amount of protein and were snap frozen. Kidneys were harvested and sections stored in formalin as well as snap expressed as μmol/g protein. To measure GSSG, 1-methyl-2-vinyl pyridinium trifate was frozen. Rats were randomly divided between groups as listed below. Sham-operated added at a concentration of 3 mM to the supernatant to block reduced glutathione (GSH). rats were anesthetized, received a burr-hole, and were ventilated for half an hour under GSH content was calculated by subtracting GSSG from the total glutathione values. anesthesia before sacrifce. MnTMPyP (5.0 mg/kg) or saline vehicle was administered intraperitoneally, 30 min before the start of the operation. Heme oxygenase-1 immunohistological staining

Rats were randomly assigned to one of the following experimental groups: Renal heme oxygenase-1 (HO-1) staining was performed on paraffn sections (4 μm). Sections were de-waxed, rehydrated, and subjected to heat-induced antigen retrieval by Group 1: sham-operated rats receiving vehicle (N=8) microwave heating in 1 mM EDTA (pH=8.0). Endogenous peroxidase was blocked with 0.03% H O in PBS for 30 min. Incubation of the primary antibody lasted for 60 min at Group 2: sham-operated rats receiving MnTMPyP (N=7) 2 2 Group 3: brain-dead rats receiving vehicle (N=7) room temperature. Binding of the antibody was detected by incubation with appropriate Group 4: brain-dead rats receiving MnTMPyP (N=7) peroxidase-labelled secondary and tertiary antibodies (Dakopatts, Glostrup, Denmark) 6 for 30 min at room temperature. Antibody dilutions were made in PBS supplemented 6 with 1% bovine serum albumin (BSA) and 1% normal rat serum. Peroxidase activity was Biochemical determinations visualized using 3,3’-diaminobenzidine tetrahydrochloride. Sections were counterstained Plasma levels of creatinine and sodium were determined at the clinical chemistry lab of the with hematoxylin. Negative antibody controls were performed in which the primary University Medical Center Groningen per standard procedures. antibody was omitted. HO-1 quantifcation was achieved by using the positive feld algorithm provided by Aperio ImageScope version 11.1.2.760. Results are expressed as Determination of superoxide production with dihydroethidium staining the proportion of the total number of positive pixels and the total number of pixels. Superoxide production was determined as described before 15. Four μm cryosections Granuolocyte immunological staining were mounted on slides and washed with Dulbecco’s phosphate-buffered saline (DPBS). Sections were incubated with 10 μM dihydroethidium (Sigma, St. Louis, MO, USA) dissolved Five-micrometer renal sections were fxed in acetone and stained with mouse monoclonal in DPBS at 37°C in dark conditions for 30 min. Subsequently, sections were washed twice anti-rat granulocyte antibody (IQ products, Groningen, the Netherlands) which was with DPBS and scanned for superoxide with a Leica inverted fuorescence microscope dissolved in PBS (pH 7.4) supplemented with 1% bovine serum albumin (BSA). The equipped with rhodamine flter settings. Images were acquired at 40X magnifcation and peroxidase-labeled second antibody (rabbit anti-mouse) was diluted in 1% BSA/PBS analyzed using NCBI ImageJ. containing 5% normal rat serum. Aminoethylcarbazole was used to visualize peroxidase activity. Sections were counterstained with hematoxylin. Control sections were incubated Determination of lipid peroxidation with thiobarbituric acid reactive substances with omission of the primary antibody. For each tissue section, positive cells per feld were counted by a blinded researcher in ten microscopic felds of the tissue at 20× magnifcation. Lipid peroxidation levels were determined as described before 15. MDA was measured Results were presented as number of positive cells per feld. fuorescently after binding to thiobarbituric acid. Twenty µL of kidney tissue homogenates or plasma were mixed with 2% SDS and 5mM butylated hydroxytoluene followed by 400 RNA isolation and quantitative polymerase chain reaction µL 0.1 N HCL, 50 µL 10% phosphotungstic acid and 200 µL 0.7% TBA. The mixture was incubated for 1 hr at 97°C. Eight-hundred µL 1-butanol was added to the samples and Quantitive polymerase chain reaction (qPCR) was performed as described before9. The SV centrifuged at 960 g. Two-hundred µL of the 1-butanol supernatant was fuorescently Total RNA isolation kit (Promega, Leiden, the Netherlands) was used to isolate total RNA measured at 480 nm excitation and 590 nm emission wavelengths. Samples were corrected from rat kidneys per manufacturer’s protocol. RT-PCR reactions were performed to verify for amount of protein and expressed as µmol/g protein. samples for the absence of genomic DNA contamination, in which the addition of reverse transcriptase was omitted, using GADPH primers. cDNA synthesis was performed from 1 Glutathione measurements µg total RNA using T11VN oligo’s and M-MLV reverse transcriptase, per supplier’s protocol (Invitrogen, Breda, The Netherlands). The ABI Prism 7900-HT Sequence Detection System 23 Glutathione measurements were conducted as described before . Tissue was lysed in cell (Applied Biosystems, Foster city, CA, USA) was used for amplifcation and detection using lysis buffer composed of 253 M HEPES, 5 mM MgCl , 5mM Ethylenediaminetetraacetic 2 emission from SYBR green. All assays were performed in triplicate. PCR cycles consisted of acid (EDTA), 2mM phenylmethylsulfonyl fuoride (PMSF) and 10 ng/μl pepstatin and an initial activation step at 50°C for 2 min and a hot start at 95°C for 10 min, after which the leupeptin. The buffer was adjusted to a fnal pH of 7.5. Cell suspensions were centrifuged cycles consisted of 40 cycles of 95°C for 15 s and 60°C for 60 s. Specifcity of qPCR products and the supernatant was analyzed. To measure total glutathione, 20 μl of the supernatant was assessed with a dissociation curve at the end of the amplifcation program and by gel was added to buffer A (125 mM NaH PO .H 0 and 6.3 mM NaEDTA adjusted to pH 7.5 with 2 4 2 electrophoresis. Gene expression was normalized with the mean of -actin mRNA content NaOH) to a total volume of 100 μl in a transparent fat bottom 96-well plate. Next, 20 μl of and calculated relative to controls using the relative standard curve method. Results were 6 mM 5-5’-dithiobis-2-nitrobenzoate, 42 μl of 0.3 mM nicotinamide adenine dinucleotide expressed as 2-∆ct (CT threshold cycle). Amplifcation primers were designed with Primer phosphate (NADPH), all dissolved in buffer A, were added to the wells. Finally, 38 μl of Express software and validated in a six-step 2-fold dilution series. The primer sequences glutathione reductase, dissolved to an enzyme activity of 5 units/ml in buffer A, was added and product sizes are given in table 1. 98 99 CHAPTER 6 MnTMPyP DECREASES RENAL OXIDATIVE STRESS DURING BRAIN DEATH

Table 1. qPCR primer sequences of the genes b-actin and IL-6.

Gene Primer Sequences Bp b-actin 5’-GGAAATCGTGCGTGACATTAAA-3’ 74 5’-GCGGCAGTGGCCATCTC-3’ IL-6 5’-CCAACTTCCAATGCTCTCCTAATG-3’ 89 5’- TTCAAGTGCTTTCAAGAGTTGGAT-3’ TNF- α 5’-GGCTGCCTTGGTTCAGATGT-3’ 79 5’-CAGGTGGGAGCAACCTACAGTT-3’ E-selectin 5’-GTCTGCGATGCTGCCTACTTG-3’ 73 5’-CTGCCACAGAAAGTGCCACTAG-3’

NAG injury biomarker To estimate tubular damage, N-acetyl--D-glucosaminidase (NAG) activity in urine was 6 measured using a method based on enzymatic hydrolysis of p-Nitrophenyl N-acetyl--D- 6 glucosaminidase to p-Nitrophenyl and N-acetyl--D-glucosaminidase. Enzymatic activity was expressed as the amount of enzyme required to release 1 µmol of product per minute. NAG levels were corrected for urine creatinine levels and expressed as U/mmol UCr.

Statistical analyses Data were analyzed using GraphPad Prism 5.04 (GraphPad, San Diego, USA). Groups were Figure 1. Blood pressure course during the induction and brain-dead phase. The induction phase showed a characteristic drop in blood pressure. No differences were observed in blood pressure levels between saline and compared using the Kruskall-Wallis test with Dunns post-hoc correction. P < 0.05 was MnTMPyP-treated brain-dead groups. considered statistically signifcant. All data are expressed as the mean ± SD (standard deviation) Superoxide production with dihydroethidium staining RESULTS BD led to signifcantly increased levels of superoxide compared to sham values (p < 0.05, Hemodynamic changes and donor management during BD respectively, Figure 2). Superoxide levels were signifcantly reduced in brain-dead rats pre- treated with MnTMPyP (p < 0.01). BD induction showed the characteristic drop and subsequent increase in blood pressure over a mean of 30.5 min as was described before15. All animals were kept at a mean arterial pressure higher than 80 mmHg during the experiment. No differences were observed in blood pressure profles between groups (Figure 1). No statistical differences were observed in amount of HAES and NA administration between groups (Table 2).

Table 2. Total Noradrenaline (1 mg/ml) and HAES infusion requirements per group.

BD + saline BD + MnTMPyP P value Noradrenaline (ml) 0.31 ± 0.1 0.28 ± 0.3 0.54 HAES (ml) 3.5 ± 0.4 4.1 ± 2.5 0.28

* indicates a signifcant difference between MnTMPyP- and saline-treated brain-dead rats.

100 101 CHAPTER 6 MnTMPyP DECREASES RENAL OXIDATIVE STRESS DURING BRAIN DEATH

Lipid peroxidation Renal and serum MDA levels were increased signifcantly by BD compared to sham values (p < 0.01, Figure 3). Both renal and serum MDA levels were signifcantly decreased by MnTMPyP pre-treatment (p < 0.01 and p < 0.05, respectively).

6 6

Figure 3. Renal and serum levels of lipid peroxidation in sham-operated and brain-dead rats. BD resulted in signifcant increases of renal and serum MDA levels which were attenuated by MnTMPyP pre-treatment. * indicates p < 0.05 compared to vehicle-treated brain-dead rats. ## indicates p < 0.01 compared to sham- operated rats

GSH, GSSG, GSH + GSSG, and the GSSG:GSH ratio BD did not lead to decreased GSH levels compared to sham-operated rats. However, brain-dead rats pre-treated with MnTMPyP resulted in signifcantly increased GSH levels compared to saline-treated brain-dead rats (p < 0.01, fgure 4). BD did lead to signifcantly increased levels of GSSG which were signifcantly attenuated by MnTMPyP pre-treatment (p < 0.01). Also, BD led to an increased GSSG:GSH ratio which was signifcantly attenuated by MnTMPyP pre-treatment (p < 0.05).

Figure 2. DHE staining for renal superoxide in sham-operated and brain-dead rats. A, sham + vehicle. B, sham + MnTMPyP. C, brain death + vehicle, and D, brain death + MnTMPyP. BD led to increased superoxide production compared to sham-operated rats which was markedly decreased by MnTMPyP pre-treatment. * indicates p < 0.05 compared to vehicle-treated brain-dead rats. # indicates p < 0.05 compared to sham-operated rats. 40X magnifcation

102 103 CHAPTER 6 MnTMPyP DECREASES RENAL OXIDATIVE STRESS DURING BRAIN DEATH

6 6

Figure 4. Renal levels of reduced glutathione (GSH), oxidized glutathione (GSSG), total glutathione (GSH+GSSG) and the ratio of oxidized to reduced glutathione GSSG:GSH) in sham-operated and brain-dead rats. MnTMPyP pre-treatment of brain-dead rats resulted in signifcantly increased GSH levels compared to saline-treated brain dead rats. BD resulted in signifcantly increased GSSG levels and GSSG:GSH ratio which were reduced signifcantly by MnTMPyP pre-treatment. * and ** indicate p < 0.05 and 0.01, respectively, compared to vehicle-treated brain- dead rats. # indicates p < 0.05 compared to sham-operated rats.

HO-1 protein expression BD led to a signifcant increase in renal HO-1 expression compared to sham-operated rats (p < 0.01, fgure 5). This increase was signifcantly attenuated in rats pre-treated with MnTMPyP (p < 0.05).

Figure 5. Renal expression of the cytoprotective protein heme oxygenase-1 (HO-1) in sham-operated and brain- dead rats. BD resulted in signifcantly increased HO-1 expression compared to sham-operated rats which was markedly decreased by MnTMPyP pre-treatment. ## indicates p < 0.01 compared to sham-operated rats. * indicates p < 0.05 compared to saline-treated brain-dead rats. 100x magnifcation.

104 105 CHAPTER 6 MnTMPyP DECREASES RENAL OXIDATIVE STRESS DURING BRAIN DEATH

Granulocyte protein expression Renal gene expression levels BD led to a signifcant increase in renal cortical granulocyte expression compared to Renal mRNA levels of interleukin-6 (IL-6), TNF-α, and E-selectin 6 were signifcantly sham-operated rats (p < 0.01, fgure 6). This increase was not decreased by MnTMPyP increased in brain-dead rats compared to sham-operated animals (Figure 7) which was not pre-treatment. attenuated by MnTMPyP pre-treatment.

6 6

Figure 7. Renal expression of the pro-infammatory genes IL-6, TNF-α, and E-selectin in sham-operated and brain- dead rats. BD led to signifcant increase in renal IL-6, TNF-α, and E-selectin expression. MnTMPyP pre-treatment did not result in decreased expression of these genes. # indicates p < 0.05 compared to sham-operated rats. compared to sham-operated rats. 20x magnifcation.

Biochemical determinations BD resulted in increased plasma creatinine levels and decreased creatinine clearance compared to sham-operated rats (table 3). Also, BD resulted in increased fractional sodium excretion. These effects were not affected by MnTMPyP pre-treatment.

Table 3. Biochemical parameters

Sham + saline Sham + MnTMPyP BD + BD + saline MnTMPyP Cortical granulocytes Crs, μmol/L 34.86 ± 7.20 34.29 ± 6.45 96.00 ± 22.62 # 102.71 ± 27.80 20 ## CrC, ml/min 0.38 ± 0.04 0.37 ± 0.03 0.24 ± 0.08 # 0.28 ± 0.09 FeNa, % 1.2± 0.1 1.1 ± 0.1 1.7 ± 0.3 # 1.5 ± 0.3 15 ## Urinary NAG, U/mmol UCr 0.04 ± 0.03 0.03 ± 0.27 0.10 ± 0.36 ## 0.08 ± 0.13

Variables measured 4 hrs after BD or immediately after sham procedure 10 # signifcant at p < 0.05 compared to sham-operated rats ## signifcant at p < 0.05 compared to sham-operated rats ** 5 number of cells number per of cells field 0 Urinary NAG activity After 4 hours of BD, urinary NAG activity was signifcantly increased compared to sham- operated rats (p < 0.01, table 3). The increase in NAG activity was not decreased by BD + vehicle MnTMPyP pre-treatment. Sham + vehicle BD + MnTMPyP Sham + MnTMPyP

Figure 6. Renal infux of polymorphonuclear (PMN) leukocytes in sham-operated and brain-dead rats. BD resulted in signifcantly increased PMN infux compared to sham-operated rats which was not attenuated by MnTMPyP treatment. ## indicates p < 0.01 compared to sham-operated rats. 20x magnifcation.

106 107 CHAPTER 6 MnTMPyP DECREASES RENAL OXIDATIVE STRESS DURING BRAIN DEATH

DISCUSSION postulate that the observed lipid peroxidation in brain-dead donors renders cells more susceptible to I-R injury which leads to increased mitochondrial damage after reperfusion As a proof of concept, we showed that pre-treatment of brain-dead rats with MnTMPyP, and thereby leads to increased risk of DGF. a superoxide scavenger, resulted in decreased renal oxidative stress. MnTMPyP pre- treatment led to the reduction of oxidative stress markers, amongst others renal and The compound MnTMPyP was very effective in our model as renal and plasma MDA levels serum MDA levels, which are a marker of lipid peroxidation and indicate oxidative were reduced to sham values. However, in our study, as a proof of concept, MnTMPyP membrane damage. Brain death (BD)-related lipid peroxidation correlates well with DGF, was administered before BD induction and not during BD. In future studies, the effect of acute rejection, and post-transplant renal function11. Therefore, MnTMPyP treatment of MnTMPyP administration during BD should be evaluated to assess the clinical feasibility of brain-dead-donors could lead to decreased incidence of above mentioned processes and this compound. Since MDA levels only become evident after 2 hours of BD, we hypothesize thereby improved transplantation outcomes (Figure 8). that the administration of MnTMPyP after BD confrmation will lead to the same effects as observed with pre-treatment8,9,15.

Glutathione is regarded as a major anti-oxidative molecule because of its high cellular concentrations and the central role it fulflls in redox reactions29-31. Glutathione can serve as a cofactor for anti-oxidative enzymes but can also react directly with oxidants such 6 as superoxide32. The glutathione disulfde (GSSG)/glutathione (GSH) ratio is a traditional 6 marker for refecting the level of cellular oxidative stress33. In our study, BD led to an increased GSSG/GSH ratio which was decreased by MnTMPyP treatment. Interestingly, increased GSSG levels did not coincide with decreased GSH levels which indicates GSH levels are replenished during BD. In a previous study, we showed that renal GSH levels decreased after 2 hours of BD but returned to reference levels after 4 hours15. Renal glutathione synthesis is totally dependent on the uptake of glutathione conjugates from the circulation34,35. Therefore, the unchanged renal GSH levels could be the result of the increased plasma glutathione levels we observed during BD in the aforementioned study15. Increased plasma glutathione is likely the result of glutathione release into the circulation through hepatic apoptosis which has been shown previously36. Since renal GSH levels do not remain decreased during BD, increasing GSH levels in brain-dead donors could be futile. Indeed, it has been shown that the administration of n-acetylcysteine to brain-dead donors does not lead to decreased incidence of DGF in renal transplant recipients37.

HO-1 may be among the most critical cytoprotective mechanisms that are activated during times of cellular stress such as infammation, ischemia, hypoxia, hyperoxia, hyperthermia, or radiation38. HO-1 has found to be increasingly expressed during BD which refects the need of cytoprotection under these conditions39-41. In this light, it is understandable that transplanting kidneys from brain-dead donors in which HO-1 was induced, led to better graft survival42,43. However, in our study, renal HO-1 expression was signifcantly reduced by MnTMPyP treatment indicating a decrease of the trigger for HO-1 expression and a cardinal role of superoxide in the development of BD-related renal cellular stress. Transplanting kidneys from brain-dead donors treated with MnTMPyP could therefore lead to similar benefcial results compared to studies in which HO-1 was induced. Figure 8. Proposed mechanism of decreased lipid peroxidation in brain-dead donors by MnTMPyP treatment and subsequent decreased risk of IR-injury and DGF (simplifed). Brain death leads to increased superoxide production through hemodynamic instability, infammation, and altered metabolism. MnTMPyP treatment decreases Through its antioxidant properties, MnTMPyP has shown to improve markers of superoxide levels and thereby lipid peroxidation. Lipid peroxidation levels in the brain-dead donor correlate infammation, damage, and renal function in several models19-21,44. In rat models of renal positively with DGF in renal transplant recipients. Therefore, we postulate that decreased lipid peroxidation in the I-R injury, MnTMPyP treatment leads to decreased damage markers, renal levels of brain-dead donor leads to less susceptibility to IR-injury and DGF. infammatory markers, infltrating granulocytes and plasma creatinine levels19. However, MnTMPyP pre-treatment did not lead to the above-mentioned effects in the present study. The explanation for this observation could be that in I-R injury, anoxia is the primary insult Lipid peroxidation leads to membrane dysfunction and subsequent cell toxicity24-26. It which results in damage, an infammatory process, and decreased renal function, whereas has been shown previously that lipid peroxidation related to aging leads to increased in BD, the relative ischemia is not severe enough to cause similar effects. Moreover, in I-R injury upon reperfusion and results in damaged mitochondria27. Recently, post- BD, infammatory processes are likely also initiated through other mechanisms than solely transplant mitochondrial damage was shown to cause a metabolic defcit resulting in the ischemia, such as the dying brain. development of DGF28. Since BD-related lipid peroxidation is associated with DGF, we

108 109 CHAPTER 6 MnTMPyP DECREASES RENAL OXIDATIVE STRESS DURING BRAIN DEATH

In conclusion, MnTMPyP pre-treatment of brain-dead rats leads to decreased renal REFERENCES oxidative stress during BD. Amongst others, the oxidative membrane damage marker MDA, which correlates with DGF, acute rejection, and post-transplant renal function in 1. OPTN/SRTR 2011 Annual Data Report. following triiodothyronine therapy. renal transplant recipients, was reduced by MnTMPyP pre-treatment. Therefore, treatment Available at: Http://Srtr.transplant.hrsa. Transplantation. 1988;45(1):32-36. of brain-dead donors with MnTMPyP could lead to decreased incidences of above gov/annual_reports/2011/flash/01_ 11. Kosieradzki M, Kuczynska J, Piwowarska mentioned processes and thereby improved transplantation outcomes. kidney/index.html#/1/zoomed. . J, et al. Prognostic signifcance of free 2. Siedlecki A, Irish W, Brennan DC. radicals: Mediated injury occurring Delayed graft function in the in the kidney donor. Transplantation. ACKNOWLEDGMENTS kidney transplant. Am J Transplant. 2003;75(8):1221-1227. We would like to thank Jacco Zwaagstra and Janneke Wiersema-buist for their excellent 2011;11(11):2279-2296. 12. Nagelschmidt M, Minor T, Gallinat technical assistance in the laboratory. 3. Peeters P, Vanholder R. Therapeutic A, et al. Lipid peroxidation products interventions favorably infuencing in machine perfusion of older donor delayed and slow graft function kidneys. J Surg Res. 2013;180(2):337- in kidney transplantation: Mission 342. impossible? Transplantation. 2008;85(7 13. Wiernsperger NF. Oxidative stress: The 6 Suppl):S31-7. special case of diabetes. Biofactors. 6 4. Wu WK, Famure O, Li Y, Kim SJ. 2003;19(1-2):11-18. Delayed graft function and the risk 14. Valko M, Leibfritz D, Moncol J, Cronin of acute rejection in the modern era MT, Mazur M, Telser J. Free radicals and of kidney transplantation. Kidney Int. antioxidants in normal physiological 2015;88(4):851-858. functions and human disease. Int J 5. Perico N, Cattaneo D, Sayegh MH, Biochem Cell Biol. 2007;39(1):44-84. Remuzzi G. Delayed graft function 15. Hoeksma D, Rebolledo RA, Hottenrott in kidney transplantation. Lancet. CM, et al. Inadequate anti-oxidative 2004;364(9447):1814-1827. responses in kidneys of brain-dead 6. Moers C, Kornmann NS, Leuvenink HG, rats. Transplantation. 2016. Ploeg RJ. The infuence of deceased 16. Murphy MP. How mitochondria donor age and old-for-old allocation produce reactive oxygen species. on kidney transplant outcome. Biochem J. 2009;417(1):1-13. Transplantation. 2009;88(4):542-552. 17. Pigeolet E, Corbisier P, Houbion 7. Terasaki PI, Cecka JM, Gjertson DW, A, et al. Glutathione peroxidase, Takemoto S. High survival rates of superoxide dismutase, and catalase kidney transplants from spousal and inactivation by peroxides and oxygen living unrelated donors. N Engl J Med. derived free radicals. Mech Ageing 1995;333(6):333-336. Dev. 1990;51(3):283-297. 8. Morariu AM, Schuurs TA, Leuvenink 18. Galley HF. Bench-to-bedside review: HG, van Oeveren W, Rakhorst G, Ploeg Targeting antioxidants to mitochondria RJ. Early events in kidney donation: in sepsis. Crit Care. 2010;14(4):230. Progression of endothelial activation, 19. Liang HL, Hilton G, Mortensen J, oxidative stress and tubular injury Regner K, Johnson CP, Nilakantan after brain death. Am J Transplant. V. MnTMPyP, a cell-permeant SOD 2008;8(5):933-941. mimetic, reduces oxidative stress and 9. Schuurs TA, Morariu AM, Ottens PJ, et apoptosis following renal ischemia- al. Time-dependent changes in donor reperfusion. Am J Physiol Renal brain death related processes. Am J Physiol. 2009;296(2):F266-76. Transplant. 2006;6(12):2903-2911. 20. Seija M, Baccino C, Nin N, et al. Role of 10. Novitzky D, Cooper DK, Morrell peroxynitrite in sepsis-induced acute D, Isaacs S. Change from aerobic kidney injury in an experimental model to anaerobic metabolism of sepsis in rats. Shock. 2012;38(4):403- after brain death, and reversal 410.

110 111 CHAPTER 6 MnTMPyP DECREASES RENAL OXIDATIVE STRESS DURING BRAIN DEATH

21. Wang Z, Holthoff JH, Seely KA, glutathione: Beyond an antioxidant. 41. van Dullemen LF, Bos EM, Schuurs et al. Development of oxidative Cell Death Differ. 2009;16(10):1303- TA, et al. Brain death induces renal stress in the peritubular capillary 1314. expression of heme oxygenase-1 and microenvironment mediates sepsis- 31. Forman HJ, Zhang H, Rinna A. heat shock protein 70. J Transl Med. induced renal microcirculatory failure Glutathione: Overview of its protective 2013;11:22-5876-11-22. and acute kidney injury. Am J Pathol. roles, measurement, and biosynthesis. 42. Fontana J, Yard B, Stamellou E, et 2012;180(2):505-516. Mol Aspects Med. 2009;30(1-2):1-12. al. Dopamine treatment of brain- 22. Nin N, El-Assar M, Sanchez C, et al. 32. Winterbourn CC, Metodiewa D. The dead fsher rats improves renal Vascular dysfunction in sepsis: Effects reaction of superoxide with reduced histology but not early renal function of the peroxynitrite decomposition glutathione. Arch Biochem Biophys. in lewis recipients after prolonged catalyst MnTMPyP. Shock. 1994;314(2):284-290. static cold storage. Transplant Proc. 2011;36(2):156-161. 33. Harris C, Hansen JM. Oxidative stress, 2014;46(10):3319-3325. 23. Griffth OW. Determination of thiols, and redox profles. Methods 43. Kotsch K, Francuski M, Pascher A, et al. glutathione and glutathione disulfde Mol Biol. 2012;889:325-346. Improved long-term graft survival after using glutathione reductase and 34. Ormstad K, Jones DP, Orrenius HO-1 induction in brain-dead donors. 6 2-vinylpyridine. Anal Biochem. S. Characteristics of glutathione Am J Transplant. 2006;6(3):477-486. 6 1980;106(1):207-212. biosynthesis by freshly isolated 44. Pathak E, MacMillan-Crow LA, Mayeux 24. Yajima D, Motani H, Hayakawa M, Sato rat kidney cells. J Biol Chem. PR. Role of mitochondrial oxidants in Y, Sato K, Iwase H. The relationship 1980;255(1):175-181. an in vitro model of sepsis-induced between cell membrane damage and 35. Rankin BB, Wells W, Curthoys NP. renal injury. J Pharmacol Exp Ther. lipid peroxidation under the condition Rat renal peritubular transport 2012;340(1):192-201. of hypoxia-reoxygenation: Analysis and metabolism of plasma [35S] of the mechanism using antioxidants glutathione. Am J Physiol. 1985;249(2 and electron transport inhibitors. Cell Pt 2):F198-204. Biochem Funct. 2009;27(6):338-343. 36. Rebolledo RA, Hoeksma D, Hottenrott 25. Dix TA, Aikens J. Mechanisms CM, et al. Slow induction of brain death and biological relevance of lipid leads to decreased renal function and peroxidation initiation. Chem Res increased hepatic apoptosis in rats. J Toxicol. 1993;6(1):2-18. Transl Med. 2016;14(1):141-016-0890-0. 26. Wong-Ekkabut J, Xu Z, Triampo W, 37. Orban JC, Quintard H, Cassuto E, Tang IM, Tieleman DP, Monticelli Jambou P, Samat-Long C, Ichai C. L. Effect of lipid peroxidation on Effect of N-acetylcysteine pretreatment the properties of lipid bilayers: A of deceased organ donors on renal molecular dynamics study. Biophys J. allograft function: A randomized 2007;93(12):4225-4236. controlled trial. Transplantation. 27. Lucas DT, Szweda LI. Cardiac 2015;99(4):746-753. reperfusion injury: Aging, lipid 38. Choi AM, Alam J. Heme oxygenase-1: peroxidation, and mitochondrial Function, regulation, and implication dysfunction. Proc Natl Acad Sci U S A. of a novel stress-inducible protein 1998;95(2):510-514. in oxidant-induced lung injury. Am J 28. Wijermars LG, Schaapherder Respir Cell Mol Biol. 1996;15(1):9-19. AF, de Vries DK, et al. Defective 39. Nijboer WN, Schuurs TA, van der postreperfusion metabolic recovery Hoeven JA, et al. Effect of brain directly associates with incident death on gene expression and tissue delayed graft function. Kidney Int. activation in human donor kidneys. 2016;90(1):181-191. Transplantation. 2004;78(7):978-986. 29. Franco R, Schoneveld OJ, Pappa A, 40. Bos EM, Schuurs TA, Kraan M, et Panayiotidis MI. The central role of al. Renal expression of heat shock glutathione in the pathophysiology proteins after brain death induction in of human diseases. Arch Physiol rats. Transplant Proc. 2005;37(1):359- Biochem. 2007;113(4-5):234-258. 360. 30. Franco R, Cidlowski JA. Apoptosis and

112 113 CHAPTER MnTMPyP treatment of brain- 7 dead rats leads to improved renal function during ex vivo reperfusion

D Hoeksma NJ Majenberg PJ Ottens ZS Veldhuis H van Goor HGD Leuvenink

In preparation CHAPTER 7 MnTMPyP LEADS TO IMPROVED RENAL FUNCTION DURING REPERFUSION

ABSTRACT INTRODUCTION Introduction Delayed graft function (DGF) is a complication occurring in 20-35% of renal transplant recipients1-3. DGF is associated with acute rejection, chronic allograft failure, and Delayed graft function (DGF) is a common complication in renal transplant recipients decreased renal function3-6. Kidney grafts retrieved from brain-dead donors, the most receiving kidneys from brain-dead donors. Brain death (BD)-related lipid peroxidation, frequently transplanted grafts, show DGF rates of 15-30%7,8. These fndings cannot be measured as maldondialdehyde (MDA) levels, correlate with DGF in renal transplant solely explained by human leukocyte antigen (HLA) mismatches, longer cold ischemia recipients. We aimed to assess the effects of MnTMPyP treatment of brain-dead rats on times, or donor age9. Instead, brain death (BD) itself elicits detrimental effects in the donor. renal function in an ex vivo isolated perfused kidney (IPK) model. BD pathophysiology comprises hemodynamic, hormonal, and infammatory changes. Methods Brain stem herniation results in a catecholamine storm and neurogenic shock through 10 BD induction was performed in 18 mechanically ventilated male Fisher rats by infating ischemia of the spinal cord . Infammatory changes are characterized by an increase in a 4.0F Fogarty catheter in the epidural space. Rats were observed for 4 hrs following BD circulating cytokines such as interleukin-6 (IL-6), interleukin-10 (IL-10), and tumor necrosis 11-13 induction. Rats were maintained hemodynamically stable through the administration of factor-alpha (TNF-α) . These cytokines trigger infammatory responses in different colloids and norepinephrine. After 4 hrs, the left kidney was cannulated and reperfused in organs through the infux of infammatory cells. Further, a drop in hormonal levels is 14 the IPK model for 90 min. The other organs, urine and blood were collected. Perfusate and evident due to pituitary dysfunction . urine samples were collected at different time points in the IPK model. BD pathophysiology results in increased systemic and renal lipid peroxidation which 7 15-18 7 Results is measured as malondialdehyde (MDA) levels . Possible causes of the increase in lipid peroxidation are the changes in hemodynamics, infammation, and hormonal BD resulted in increased levels of renal superoxide and MDA levels which were attenuated impairment19-21. Lipid peroxidation leads to membrane dysfunction and cell toxicity22-24. by MnTMPyP treatment. In the IPK model, MnTMPyP treatment resulted in increased renal BD-associated MDA levels correlate with DGF, acute rejection, and immediate and long- blood fow, decreased perfusate creatinine levels, increased sodium absorption, increased term renal allograft survival18. Therefore, preventing lipid peroxidation in brain-dead urine output, and decreased edema. donors could lead to improved renal transplantation outcomes.

Conclusion Ischemia-reperfusion (I-R) injury poses a major threat to transplanted kidneys and has serious consequences25. Early I-R injury is characterized by apoptosis and is likely MnTMPyP treatment in brain-dead rats leads to improved renal function ex vivo. MnTMPyP mediated by the generation of reactive oxygen species (ROS)26-28. ROS lead to damaged treatment could lead to improved transplantation outcomes. cellular components such as DNA, proteins, and lipids29. The ROS-related effects lead to the production of pro-infammatory cytokines and signaling which contributes to increased damage and immunogenicity30,31. Consequently, many studies have focused on decreasing I-R injury through the administration of anti-oxidative molecules during reperfusion. However, these studies have showed differing clinical results.

BD pathophysiology activates donor organs and is associated with worse I-R injury11. Considering the correlation between MDA levels and renal function after transplantation, we hypothesize that decreasing lipid peroxidation in the brain-dead donor will lead to decreased I-R injury and result in improved renal function. In a previous study we showed that MnTMPyP, a selective superoxide dismutase mimetic, is effective in reducing renal and systemic MDA levels. Here, we test the effects of MnTMPyP treatment of brain-dead rats on kidney function during reperfusion in an isolated perfused kidney (IPK) system.

MATERIALS AND METHODS Animal BD model For this experiment, male adult Fisher F344 rats (250-300 g) were used. Animals were anesthetized using isofurane and subsequently intubated. Cannulae were brought into the left femoral artery and vein for blood pressure monitoring and administrating plasma expanders or norepinephrine. Brain death was induced as described previously. A no. 4 Fogarty catheter (Edwards Lifesciences Co., Irvine, CA) was placed in the epidural space through a frontolateral hole drilled in the skull and slowly infated (16µl/min) with saline

116 117 CHAPTER 7 MnTMPyP LEADS TO IMPROVED RENAL FUNCTION DURING REPERFUSION

using a syringe pump (Terufusion, Termo Co., Tokyo, Japan). The increase in intracranial RNA isolation and qPCR

pressure results in brain death after approximately 30 minutes. Infation of the balloon 15 was stopped when the mean arterial pressure (MAP) reached 80 mmHg due to the qPCR experiments were conducted as described before . Total RNA was isolated from catecholamine storm characteristic for brain death. Anesthesia was stopped after brain rat kidneys using the SV Total RNA isolation kit (Promega, Leiden, the Netherlands) according to the manufacturer’s protocol. RNA samples were verifed for the absence of dead induction and the animals remained ventilated with O2/air. BD was confrmed by the absence of corneal refexes and an apnoea test. MAP was kept between 80-120 genomic DNA contamination by performing RT-PCR reactions, in which the addition of mmHg by using 10% hydroxyethyl starch (Fresenius Kabi AG, Bad Homburg, Germany), reverse transcriptase was omitted, using GADPH primers. cDNA synthesis was performed and if needed norepinephrine. 4 hours after BD induction blood was collected through from 1 µg total RNA using T11VN oligo’s and M-MLV reverse transcriptase, according the abdominal artery after which the organs were fushed with saline. Centrifuged blood to suppliers’s protocol (Invitrogen, Breda, The Netherlands). Amplifcation and detection samples and urine from the bladder were snap frozen. Kidneys were harvested and were performed with the ABI Prism 7900-HT Sequence Detection System (Applied sections stored in formalin as well as snap frozen. Rats were randomly divided, each group Biosystems, Foster city) using emission from SYBR green (SYBR green master mix, Applied consisting of eight animals. Sham-operated rats, which were ventilated for half an hour biosystems). All assays were performed in triplicate. After an initial activation step at 50°C under anaesthesia before scarifcation, served as controls. MnTMPyP (5mg/kg) or saline for 2 min and a hot start at 95°C for 10 min, PCR cycles consisted of 40 cycles of 95°C for was administered intraperitoneally, 30 min before the start of the operation. MnTMPyP 15 s and 60°C for 60 s. Specifcity of qPCR products was routinely assessed by performing was purchased from Merck Millipore (Darmstadt, Germany). a dissociation curve at the end of the amplifcation program and by gel electrophoresis. Gene expression was normalized with the mean of -actin mRNA content and calculated The following experimental groups can be distinguished: relative to controls using the relative standard curve method. Results were fnally expressed as 2-∆ct (CT threshold cycle). Amplifcation primers were designed with Primer Express 7 Group 1: Brain dead rats receiving saline vehicle software (Applied Biosystems) and validated in a six-step 2-fold dilution series. The primer 7 Group 2: brain dead rats receiving MnTMPyP sequences and product sizes are given in table 1.

Isolated perfused kidney system Table 1. qPCR primer sequences of the genes b-actin and iNOS.

To assess renal function after brain death the left kidney was evaluated in an IPK model as Gene Primer Sequences Bp described before32. The renal artery and ureter are cannulated and placed in a chamber in b-actin 5’-GGAAATCGTGCGTGACATTAAA-3’ 74 which the kidney is perfused with DMEM supplemented medium. Supplements included 5’-GCGGCAGTGGCCATCTC-3’ L-glutamine and pH was adjusted to 7.4. Perfusate and urine samples were collected to iNOS 5’-GAGGAGCCCAAAGGCACAAG-3’ 81 estimate renal function. Perfusion medium was maintained at 37°C and oxygenated with 5’-CCAAACCCCTCACTGTCATTTTATT-3’

95% O2 and 5% CO2. Kidneys were perfused at a perfusion pressure of 100 mm HG during 90 mins. Samples were stored at -80°C. Table 2. Total Noradrenaline (1 mg/ml) and HAES infusion requirements and number of rats which required Determination of superoxide production with dihydroethidium staining Noradrenaline.

Four μm cryosections were mounted on slides and washed with Dulbecco’s PBS (DPBS). BD + saline BD + MnTMPyP P value Sections were incubated with 10 μM dihydroethidium (Sigma, St. Louis, MO) dissolved Noradrenaline (ml) 0.31 ± 0.1 0.28 ± 0.3 0.54 in DPBS at 37°C in the dark for 30 min. Sections were washed twice with DPBS and immediately scanned for superoxide with a Leica inverted fuorescence microscope HAES (ml) 3.5 ± 0.4 4.1 ± 2.5 0.28 equipped with rhodamine flter settings. Images were acquired at 40X magnifcation and * indicates a signifcant difference between MnTMPyP- and saline-treated brain-dead rats. analyzed using NCBI ImageJ.

Determination of lipid peroxidation with thiobarbituric acid reactive substances RESULTS 17 MDA was measured as described previously . MDA is measured fuorescently after Hemodynamic changes and donor management during BD binding to thiobarbituric acid. 20µL plasma samples were mixed with 2% SDS and 5mM butylated hydroxytoluene followed by 400µL 0.1 N HCL, 50µL 10% phosphotungstic acid BD induction showed the characteristic drop and subsequent increase in blood pressure and 200µL 0.7% TBA. The mixture was incubated for 30 min at 97°C. 800µL 1-butanol was over a mean of 30.5 minutes (Figure 1). All 16 animals (n=8 per group) were kept at a mean added to the samples and the centrifuged at 960 g. 200 µL of the 1-butanol supernatant arterial pressure higher than 80 mmHg during the experiment. No signifcant differences was fuorescently measured at 480 nm excitation and 590 nm emission wavelengths. were observed between groups in terms of HAES and NA administration. In saline treated brain-dead rats, infusion of 1.5[0.0-4.0] ml HAES 10% was necessary to maintain stable blood pressure. In MnTMPyP treated brain-dead rats, infusion of 3.0[2.0-3.5] ml HAES 10% was needed to maintain stable blood pressure. Saline treated brain-dead rats required 0.7[0.0-2.4] mg NA and MnTMPyP treated brain-dead 0.0[0.0-5.1] mg NA.

118 119 CHAPTER 7 MnTMPyP LEADS TO IMPROVED RENAL FUNCTION DURING REPERFUSION

Superoxide

Figure 1: Mean arterial pressure (MAP) course during brain-death (BD)- induction and BD. The induction phase 60 7 showed a characteristic drop in blood pressure. No differences were observed in blood pressure levels between 7 saline and MnTMPyP-treated brain-dead groups 40 Renal superoxide production in the brain-dead rat * After 4 hrs, superoxide levels were signifcantly reduced in brain-dead rats pre-treated 20 with MnTMPyP compared to non-treated rats (p < 0.05, Figure 2). DHE signal (A.U.) DHE signal

0

BD + vehicle BD + MnTMPyP

Figure 2: DHE staining for superoxide in brain-dead rats treated with vehicle or MnTMPyP. A, BD + vehicle. B, BD + MnTMPyP. MnTMPyP treatment resulted in decreased superoxide production compared to treatment with vehicle. * indicates p < 0.05. 40X magnifcation

Renal lipid peroxidation in the brain-dead rat MDA levels were signifcantly reduced after 4 hrs of BD in brain-dead rats pre-treated with MnTMPyP compared to non-treated rats (p < 0.01, Figure 3).

120 121 CHAPTER 7 MnTMPyP LEADS TO IMPROVED RENAL FUNCTION DURING REPERFUSION

Renal sodium excretion and urine production during reperfusion in the IPK model MDA During reperfusion in the IPK, renal sodium excretion decreased signifcantly of kidneys 8 from brain-dead rats treated with MnTMPyP. Renal sodium excretion was decreased signifcantly compared to vehicle treated rats at 60 and 90 minutes of reperfusion (p < 0.05, Figure 5). Urine output was increased signifcantly during reperfusion of kidneys 6 from brain-dead rats treated with MnTMPyP compared to vehicle treatment at 60 and 90 minutes (p < 0.05). 4 ** mol/g mol/g protein

m 2

0

BD + vehicle 7 BD + MnTMPyP 7 Figure 3: Renal levels of lipid peroxidation in brain-dead rats treated with vehicle or MnTMPyP. MnTMPyP treatment resulted in decreased renal MDA levels compared to treatment with vehicle. ** indicates p < 0.01 compared to saline-treated brain-dead rats. Figure 5: Assessment of fractional sodium excretion and urine production during reperfusion in an isolated perfused kidney (IPK) system of kidneys from brain-dead rats pre-treated with vehicle or MnTMPyP. MnTMPyP pre-treatment led to decreased sodium excretion and increased urine production compared to non-treated rats. * indicates p < 0.05 between groups. Renal blood fow and perfusate creatinine levels during reperfusion in the IPK model Renal weight increase during reperfusion in the IPK model During reperfusion in the IPK, renal blood fow increased signifcantly of kidneys from Renal weight increase was signifcantly more of kidneys of brain-dead rats treated with brain-dead rats treated with MntMPyP during BD. Renal blood fow was signifcantly vehicle compared to MnTMPyP treatment (p < 0.05, Figure 6) increased compared to vehicle treated rats at 30, 60 and 90 minutes of reperfusion (p < 0.05, Figure 4). Perfusate creatinine levels were signifcantly reduced during reperfusion of kidneys from brain-dead rats treated with MnTMPyP compared to vehicle treatment at 60 and 90 minutes (p < 0.05). Weight increase 0.8

0.6

0.4 Grams

0.2 * 0.0

Figure 4: Assessment of renal fow and creatinine clearance during reperfusion in an isolated perfused kidney (IPK) system of kidneys from brain-dead rats pre-treated with vehicle or MnTMPyP. MnTMPyP treatment led to BD + vehicle increased fow and creatinine clearance compared to non-treated rats. * indicates p < 0.05 between groups. BD + MnTMPyP

Figure 6: Kidney weight change after reperfusion in an isolated perfused kidney (IPK) model of kidneys from brain-dead rats treated with vehicle or MnTMPyP. MnTMPyP treatment led to less weight increase compared to non-treated rats. * indicates p < 0.05 between groups.

122 123 CHAPTER 7 MnTMPyP LEADS TO IMPROVED RENAL FUNCTION DURING REPERFUSION

DISCUSSION REFERENCES The role of antioxidants has been studied extensively in the context of I-R injury33-35. In these 1. OPTN/SRTR 2011 Annual Data Report. 11. Weiss S, Kotsch K, Francuski M, studies, antioxidants are administered to counteract the detrimental effects of oxidants Available at: http://srtr.transplant.hrsa. Reutzel-Selke A, Mantouvalou L, Klemz produced during reperfusion. In our study, we counteracted oxidant production in the gov/annual_reports/2011/flash/01_ R, et al. Brain death activates donor brain-dead donor rat as we hypothesized that oxidative damage in the donor predisposes kidney/index.html#/1/zoomed. organs and is associated with a worse kidneys to worse I-R injury. Our main fndings are that MnTMPyP treatment led to increased 2. Siedlecki A, Irish W, Brennan DC. I/R injury after liver transplantation. Am renal blood fow and function which was assessed during the reintroduction of oxygen in Delayed graft function in the kidney J Transplant 2007 Jun;7(6):1584-1593. an IPK model. This shows that decreasing lipid peroxidation in brain-dead could infuence transplant. Am J Transplant 2011 12. Nijboer WN, Schuurs TA, van der rates of DGF, acute rejection, and short and long-term allograft survival since MDA levels Nov;11(11):2279-2296. Hoeven JA, Fekken S, Wiersema-Buist correlate with these processes18. 3. Peeters P, Vanholder R. Therapeutic J, Leuvenink HG, et al. Effect of brain In a previous study, we showed that MnTMPyP treatment of brain-dead rats decreases interventions favorably infuencing death on gene expression and tissue renal lipid peroxidation but does not lead to improved renal function in the rat. However, delayed and slow graft function activation in human donor kidneys. in models of sepsis, MnTMPyP treatment leads to improved renal function in the in kidney transplantation: mission Transplantation 2004 Oct 15;78(7):978- animal36,37. The improved renal function in these studies is attributed to the increased impossible? Transplantation 2008 Apr 986. availability of nitric oxide though the decreased reaction with superoxide. Even though 15;85(7 Suppl):S31-7. 13. Murugan R, Venkataraman R, Wahed renal function decreases during BD, it could be that sepsis elicits more hemodynamic 4. Tapiawala SN, Tinckam KJ, Cardella AS, Elder M, Hergenroeder G, Carter instability leading to longer phases of renal ischemia and thereby increased superoxide CJ, Schiff J, Cattran DC, Cole EH, et M, et al. Increased plasma interleukin-6 7 production. Therefore, reducing superoxide levels in sepsis could have an effect on kidney al. Delayed graft function and the risk in donors is associated with lower 7 function within the rat. The present study shows that decreasing superoxide levels in the for death with a functioning graft. J Am recipient hospital-free survival after brain-dead rat leads to improved renal function after the kidneys have been subjected Soc Nephrol 2010 Jan;21(1):153-161. cadaveric organ transplantation. Crit to I-R injury. We believe that the decrease in superoxide levels and thereby the decreased 5. Yarlagadda SG, Coca SG, Formica Care Med 2008 Jun;36(6):1810-1816. lipid peroxidation in the brain-dead rat results in less susceptibility to I-R injury. This idea RN,Jr, Poggio ED, Parikh CR. 14. Novitzky D, Cooper DK, Rosendale JD, has been shown before in the sense that BD primes organs to worse I-R injury11. This Association between delayed graft Kauffman HM. Hormonal therapy of the could lead to decreased sodium pump dysfunction and apoptosis of proximal tubular function and allograft and patient brain-dead organ donor: experimental cells which could explain the increased sodium reabsorption, increased urine output, and survival: a systematic review and meta- and clinical studies. Transplantation decreased perfusate creatinine levels we observed. The decreased creatinine levels in analysis. Nephrol Dial Transplant 2009 2006 Dec 15;82(11):1396-1401. the perfusate could also be infuenced by the increased renal blood fow we observed. Mar;24(3):1039-1047. 15. Schuurs TA, Morariu AM, Ottens PJ, ‘t This increase in renal blood fow could be related to effects of manganese which forms 6. Qureshi F, Rabb H, Kasiske BL. Silent Hart NA, Popma SH, Leuvenink HG, et the core of MnTMPyP. Manganese increases renal blood fow and GFR by acting as a acute rejection during prolonged al. Time-dependent changes in donor calcium entry blocker38. Another explanation for the increased renal blood fow could be delayed graft function reduces kidney brain death related processes. Am J the effect of superoxide scavenging on renal resistance. Superoxide oxidizes membrane allograft survival. Transplantation 2002 Transplant 2006 Dec;6(12):2903-2911. lipids which causes loss of membrane barriers39. Furthermore, mitochondrial membranes Nov 27;74(10):1400-1404. 16. Morariu AM, Schuurs TA, Leuvenink are affected which results in less ATP production for Na+/K+ pumps and leads to cellular 7. Moers C, Kornmann NS, Leuvenink HG, van Oeveren W, Rakhorst G, Ploeg swelling causing obstruction of the microvasculature and tubules. HG, Ploeg RJ. The infuence of RJ. Early events in kidney donation: deceased donor age and old-for- progression of endothelial activation, Using the IPK model, we tested renal function during the reintroduction of oxygen. In this old allocation on kidney transplant oxidative stress and tubular injury after manner, I-R injury is mimicked in the sense that organs experienced a period of ischemia outcome. Transplantation 2009 Aug brain death. Am J Transplant 2008 during organ harvest and the subsequent cold fush after which they were subjected to 27;88(4):542-552. May;8(5):933-941. the reintroduction of oxygen. However, this model does not resemble all aspects of clinical 8. Perico N, Cattaneo D, Sayegh MH, 17. Rebolledo RA, Hoeksma D, Hottenrott I-R injury as it does not incorporate certain elements such as the presence of leukocytes Remuzzi G. Delayed graft function in CM, Bodar YJ, Ottens PJ, Wiersema- in the perfusion medium. Future research should study longer term effects of MnTMPyP kidney transplantation. Lancet 2004 Buist J, et al. Slow induction of brain treatment on I-R injury. Nevertheless, our aim was to test the early effects of MnTMPyP Nov 13-19;364(9447):1814-1827. death leads to decreased renal treatment on kidney function with minimal external infuences. Therefore, our research 9. Terasaki PI, Cecka JM, Gjertson DW, function and increased hepatic question could be addressed appropriately with the use of this model. Takemoto S. High survival rates of apoptosis in rats. J Transl Med 2016 kidney transplants from spousal and May 19;14(1):141-016-0890-0. living unrelated donors. N Engl J Med 18. Kosieradzki M, Kuczynska J, 1995 Aug 10;333(6):333-336. Piwowarska J, Wegrowicz-Rebandel 10. Bos EM, Leuvenink HG, van Goor H, I, Kwiatkowski A, Lisik W, et al. Ploeg RJ. Kidney grafts from brain Prognostic signifcance of free radicals: dead donors: Inferior quality or mediated injury occurring in the opportunity for improvement? Kidney kidney donor. Transplantation 2003 Int 2007 Oct;72(7):797-805. Apr 27;75(8):1221-1227. 124 125 CHAPTER 7 MnTMPyP LEADS TO IMPROVED RENAL FUNCTION DURING REPERFUSION

19. Futrakul N, Tosukhowong P, by alpha tocopherol in ischemia and microenvironment mediates sepsis- Valyapongpichit Y, Tipprukmas N, reperfusion models of rats. Urol Res induced renal microcirculatory failure Futrakul P, Patumraj S. Oxidative stress 2003 Aug;31(4):280-285. and acute kidney injury. Am J Pathol and hemodynamic maladjustment in 30. Liang HL, Hilton G, Mortensen J, 2012 Feb;180(2):505-516. chronic renal disease: a therapeutic Regner K, Johnson CP, Nilakantan 38. Loutzenhiser R, Horton C, Epstein M. implication. Ren Fail 2002 Jul;24(4):433- V. MnTMPyP, a cell-permeant SOD Effects of diltiazem and manganese 445. mimetic, reduces oxidative stress and renal hemodynamics: studies in the 20. Nakayama M, Nakayama K, Zhu WJ, apoptosis following renal ischemia- isolated perfused rat kidney. Nephron Shirota Y, Terawaki H, Sato T, et al. reperfusion. Am J Physiol Renal Physiol 1985;39(4):382-388. Polymorphonuclear leukocyte injury 2009 Feb;296(2):F266-76. 39. Ouriel K, Smedira NG, Ricotta JJ. by methylglyoxal and hydrogen 31. Yard BA, Daha MR, Kooymans- Protection of the kidney after temporary peroxide: a possible pathological Couthino M, Bruijn JA, Paape ME, ischemia: free radical scavengers. J role for enhanced oxidative stress in Schrama E, et al. IL-1 alpha stimulated Vasc Surg 1985 Jan;2(1):49-53. chronic kidney disease. Nephrol Dial TNF alpha production by cultured Transplant 2008 Oct;23(10):3096-3102. human proximal tubular epithelial 21. Himmelfarb J, McMonagle E, cells. Kidney Int 1992 Aug;42(2):383- Freedman S, Klenzak J, McMenamin E, 389. Le P, et al. Oxidative stress is increased 32. Nijboer WN, Ottens PJ, van Dijk A, 7 in critically ill patients with acute van Goor H, Ploeg RJ, Leuvenink HG. 7 renal failure. J Am Soc Nephrol 2004 Donor pretreatment with carbamylated Sep;15(9):2449-2456. erythropoietin in a brain death model 22. Jain SK, Shohet SB. Calcium reduces infammation more effectively potentiates the peroxidation of than erythropoietin while preserving erythrocyte membrane lipids. Biochim renal function. Crit Care Med 2010 Biophys Acta 1981 Mar 20;642(1):46-54. Apr;38(4):1155-1161. 23. Vladimirov YA, Olenev VI, Suslova TB, 33. Giovannini L, Migliori M, Longoni BM, Cheremisina ZP. Lipid peroxidation in Das DK, Bertelli AA, Panichi V, et al. mitochondrial membrane. Adv Lipid Resveratrol, a polyphenol found in Res 1980;17:173-249. wine, reduces ischemia reperfusion 24. Tribble DL, Aw TY, Jones DP. The injury in rat kidneys. J Cardiovasc pathophysiological signifcance Pharmacol 2001 Mar;37(3):262-270. of lipid peroxidation in oxidative 34. Rhoden EL, Pereira-Lima L, Teloken C, cell injury. Hepatology 1987 Mar- Lucas ML, Bello-Klein A, Rhoden CR. Apr;7(2):377-386. Benefcial effect of alpha-tocopherol in 25. Bonventre JV. Mechanisms of ischemic renal ischemia-reperfusion in rats. Jpn acute renal failure. Kidney Int 1993 J Pharmacol 2001 Oct;87(2):164-166. May;43(5):1160-1178. 35. Seth P, Kumari R, Madhavan S, 26. Devarajan P, Mishra J, Supavekin S, Singh AK, Mani H, Banaudha KK, Patterson LT, Steven Potter S. Gene et al. Prevention of renal ischemia- expression in early ischemic renal reperfusion-induced injury in rats by injury: clues towards pathogenesis, picroliv. Biochem Pharmacol 2000 May biomarker discovery, and novel 15;59(10):1315-1322. therapeutics. Mol Genet Metab 2003 36. Seija M, Baccino C, Nin N, Sanchez- Dec;80(4):365-376. Rodriguez C, Granados R, Ferruelo A, 27. Lameire N. The pathophysiology of et al. Role of peroxynitrite in sepsis- acute renal failure. Crit Care Clin 2005 induced acute kidney injury in an Apr;21(2):197-210. experimental model of sepsis in rats. 28. Lameire N, Van Biesen W, Vanholder R. Shock 2012 Oct;38(4):403-410. Acute renal failure. Lancet 2005 Jan 29- 37. Wang Z, Holthoff JH, Seely KA, Feb 4;365(9457):417-430. Pathak E, Spencer HJ,3rd, Gokden 29. Avunduk MC, Yurdakul T, Erdemli E, N, et al. Development of oxidative Yavuz A. Prevention of renal damage stress in the peritubular capillary

126 127 CHAPTER General Discussion & 8 Future Perspectives CHAPTER 8 ENGLISH AND DUTCH SUMMARY

INTRODUCTION period. Hypotension is observed clinically after non-traumatic brain injury which points to the necessity of adequate perfusion and the anticipation of hypotensive periods with Organs obtained from brain-dead donors show lower rates of graft survival compared to these brain insults16,17. However, hypotension is also observed after traumatic brain injury organs obtained from living donors1. This may be related to the fact that brain death (BD) which indicates the necessity of anticipation of hypotensive phases regardless of the brain itself leads to a cascade of detrimental systemic events such as hemodynamic instability, insult18. Considering our results, ameliorating perfusion is likely especially benefcial for infammation, and altered metabolism which pose a signifcant threat to the structure the kidney as hepatic markers are affected less by slow BD induction. In the ICU, slow and function of the future grafts2-4. Many interventional strategies have been tested in ICP increase can be used as a predictor for hypotensive phases and thereby allow more brain-dead donors with the goal of improving transplantation outcomes. However, adequate anticipation of treatment of hypotension with vasopressors. Furthermore, if only a few have shown benefcial clinical effects of which the most notable involve the adequate perfusion cannot be realized, hypotensive phases could serve as a predictor for administration of methylprednisolone and dopamine5-11. Clinically, the administration the performance of future grafts and aid in decisions pertaining to organ allocation. of methylprednisolone has shown varying effects and no benefcial effects on renal function. Therefore, dopamine is the only interventional strategy in brain-dead donors In contrast to Chapter 2, in Chapter 3 we show that a faster, rather than slower, increase which has shown consistent benefcial effects, including on renal function. To this date, no in ICP leads to an increase in detrimental pulmonary effects. It has been previously shown intervention has been incorporated into standard policy in the management of brain-dead that heart parameters are increasingly affected during a faster increase in ICP19. This has donors. been attributed to the higher catecholamine release in response to the quick rise in ICP. The high release of catecholamines leads to high blood pressure which causes cardiac BD pathophysiology is complex which probably hinders exact determination of all damage and subsequent heart failure. A traumatic cause of brain injury is indeed a risk detrimental pathways. In this thesis, we looked for mechanistic clues to explain the factor for mortality in heart transplant recipients13. Similarly, higher blood pressure caused pathophysiology of BD. Our primary aim was to identify the detrimental processes taking by a faster increase in ICP probably causes increased damage to the lungs as this organ place in the future donor grafts. Based on these fndings we designed novel therapeutic endures low blood pressure in physiological conditions. In the context of BD, it has been 8 interventions to attenuate or prevent graft deterioration. shown that blocking the catecholamine storm prevents rupture of the capillary-alveolar 8 membrane which is associated with edema and infammation20. Therefore, the increased OBSERVATIONS pulmonary edema and hemorrhage we observed after faster increase in ICP is well explained by more alveolar membrane ruptures. No difference was observed between In Chapter 2, we therefore assessed the effect of the speed at which intracranial pressure fast and slow BD induction on infammatory markers which probably indicates that the (ICP) increases in the process leading to BD on functional, damage, and infammatory lungs are affected regardless of the intensity of the catecholamine storm. Preventing high markers of kidney and liver in laboratory animals. We showed that a slower increase in blood pressure could be benefcial for the performance of pulmonary grafts. However, ICP leads to increased detrimental BD effects on the kidney and the liver. The effects preventing high blood pressure in the ICU in traumatic brain injury patients could be of BD on donor organs are well documented, however, less is known about the effects controversial as the increase in blood pressure could be an attempt to maintain adequate of the processes leading to BD. In human conditions, cerebrovascular and traumatic cerebral perfusion when ICP increases. Furthermore, preventing the detrimental effects of causes of brain death are risk factors for renal and cardiac graft survival, respectively12,13. the catecholamine storm could be diffcult as the onset of BD is hard to predict. Therefore, Besides donor characteristics, the difference in survival could be related to the nature of high blood pressure in brain injured patients after a fast increase in ICP could serve as the brain insult as the speed of ICP increase after traumatic and cerebrovascular causes a predictor for pulmonary (and cardiac) function after transplantation and could aid in of brain death can vary greatly. Traumatic brain insults tend to cause fasters rises in ICP decisions pertaining to organ allocation. The speed at which ICP increases seems to than cerebrovascular causes. However, the speed at which ICP increases may even vary have varying effects on the thoracic and abdominal organs. Whereas optimal perfusion when the nature of the brain insult is the same14,15. Therefore, assessing the effects of seems to be benefcial for the abdominal organs, preventing (extreme) hypertension the speed at which ICP increases on organs is warranted. We acknowledge that the seems benefcial for the thoracic organs. In brain-injured patients in which hypertension is underlying pathophysiology of increased ICP is different for traumatic and cerebrovascular present and left unchecked due to possible better cerebral perfusion, the kidney and liver causes and that different experimental models can be used to study these processes. For will probably endure less stress than the lung and heart which could have potential effects example, cerebral infarctions will lead to increased ICP trough cellular swelling whereas on graft survival after transplantation. a traumatic cause typically leads to increased ICP through the rupture of a blood vessel. Nevertheless, the central hallmark of these processes is increased ICP and we used this In Chapter 4, we expanded on the fndings described in Chapter 2, in which we showed common endpoint to study the effect of speed of ICP increase within the confnements of a higher increase in renal MDA levels after slow compared to fast BD induction. In this a single model. In our model, increased ICP was manifested by infating a catheter in the Chapter, we examined possible underlying renal oxidative and anti-oxidative processes epidural space at different speeds which resembles ICP increase by means of a continuous which could explain the increased MDA levels. Of these processes, the high increase in expanding epidural hematoma. superoxide levels was the most notable and indeed, these levels were affected more by slow BD induction. Superoxide is increased early during BD and could form an initiating The increased detrimental effects observed after slow BD induction are most likely related factor in the process leading to increased MDA levels. Therefore, preventing superoxide to the hypotensive phase which we observed during the induction phase. The hypotension formation in brain-dead donors could lead to better transplantation outcomes since probably causes a form of acute kidney injury (AKI) which leads to progressive detrimental donor-related MDA levels correlate with DGF, acute rejection and short and long-term renal effects since the effects we observed are progressive over the course of the BD allograft survival in renal transplant recipients21. The increased renal superoxide levels are

130 131 CHAPTER 8 ENGLISH AND DUTCH SUMMARY

not caused by ischemic phases through major hemodynamic changes as rats are kept we wanted to solely assess the effects of MnTMPyP on renal function in an isolated system hemodynamically stable during the BD period. Therefore, we postulate that superoxide without other possible altering factors. Considering the promising effects of MnTMPyP on scavenger therapy is key in decreasing renal superoxide levels in addition to the renal function and therefore possibly on DGF and graft survival, future research should be maintenance of hemodynamic stability. Our results indicate that anti-oxidative treatment conducted on testing this compound in a transplantation model. of brain-dead donors is probably especially valuable in donors progressing to BD slowly. FUTURE PERSPECTIVES The idea mentioned above, to counteract superoxide levels through anti-oxidative therapy besides the maintenance of hemodynamic stability was reinforced by the fndings The experimental data in this thesis pave the way for similar experiments in human organs. done in Chapter 5. In this Chapter, we showed that increased renal oxidative stress The observational and interventional studies we performed can be conducted in human formation during BD is accompanied by decreased regional renal blood fow despite the brain-dead tissue and donors. The observational studies can be undertaken in human maintenance of normotension. Hepatic perfusion is not affected and therefore ischemia brain-dead donor tissue to assess whether oxidative stress markers are upregulated probably only plays a detrimental role for the liver at the onset of BD through the effects and whether there are differences between donor types. Interventional studies can be of the catecholamine storm. hepatic oxidative stress is not increased during BD as MDA undertaken in human brain-dead donors after they have frst been tested in higher animal levels remain comparable to sham levels. However, we did observe increases in hepatic models. HO-1 expression indicating a hepatic anti-oxidative response. We believe this response could be caused by the decreased activity of complex I which was observed in Chapter Ethical concerns are raised when the question arises to treat brain-injured patients in which 5 which could cause the leakage of superoxide anions. Since no increase in MDA levels death is not yet evident. Brain-injured patients can suffer hypotension and hypertension were observed, the hepatic anti-oxidative response is probably suffcient to protect which leads to ischemia and probably already predisposes to worse I-R injury. Also, we have the liver from oxidative stress. Therefore, anti-oxidative therapy in brain-dead donors seen that organ damage is probably already imminent during the onset of BD through for seems benefcial for the kidney and not the liver. Since modifying regional perfusion example the catecholamine storm. To combat these effects, administration of protective 8 could be diffcult to accomplish clinically, we postulate that anti-oxidative therapy is key compounds should ideally be administered to brain-injured patients when BD is not yet 8 in preventing renal oxidative damage in addition to the maintenance of hemodynamic evident. Many of these interventions have benefcial effects for the patient, regardless of stability. Preventing increased MDA levels in brain-dead donors could result in decreased the effect on possible future donor grafts. For example, hypotensive phases in brain-injured I-R injury as MDA levels correlate with DGF. patients could lead to AKI which could be attenuated with the prophylactic administration of anti-oxidants. Perhaps, in the future, with the combined effects of altered legislation INTERVENTIONS regarding the treatment of brain-injured patients and the advent of compounds with no harmful side effects, improved transplantation results could be realized. In Chapter 6 we administered MnTMPyP, a superoxide dismutase mimetic, to brain-dead rats with the goal of decreasing MDA levels. BD-related MDA levels correlate with DGF Its apparent from this thesis that organs are differentially affected by the effects of BD. in renal transplant recipients and therefore reducing these levels could result in better Future donor management strategies could encompass different interventions with transplantation outcomes. MnTMPyP treatment resulted in decreased MDA levels which the goal of preserving numerous organs within one donor. This would require one shows that superoxide plays a key role in BD-related oxidative processes leading to intervention to not affect the other which seems plausible considering that the optimal increased MDA levels. MnTMPyP treatment did not lead to increased renal function in the environment for an organ is one which resembles normal homeostasis. This poses the ICU brain-dead donor rat. It has been shown that BD predisposes livers to worse I-R injury22. doctor the challenge of undertaking numerous interventions such as the maintenance Similary, increased lipid peroxidation, measured by MDA levels, could predispose renal of normotension, preventing infammation, and the administration of compounds which cells to worse I-R injury. Lipid peroxidation leads to membrane dysfunction and could target local processes that take place independently of hemodynamic and infammatory render the cells more vulnerable to the infux of oxygen radicals. Therefore, in Chapter changes 7, we subjected kidneys of brain-dead rats treated with MnTMPYP to reperfusion injury to assess benefcial effects on organ function. To simulate I-R injury, we used an isolated perfused kidney (IPK) We found that MnTMPyP treatment of brain-dead rats led to amongst others increased renal function. Therefore, MnTMPyP treatment of brain-dead rats could lead to improved graft survival. As mentioned above, we believe the benefcial effects are related to the decrease in lipid peroxidation levels in the kidney of the brain- dead donor which leads to decreased I-R injury. However, the benefcial effects could also be attributed to the prevention of superoxide radicals formed during reperfusion in the IPK. We cannot ascertain that MnTMPyP was still active in the renal cells at the time. The reperfusion injury mimicked in our IPK system shares common features with clinical I-R injury as the kidneys suffered a period of ischemia and were subsequently exposed to the introduction of oxygen in the perfusion fuid. However, our model does not incorporate other processes such as leukocyte infltration. This was not incorporated into the model as

132 133 CHAPTER 8 ENGLISH AND DUTCH SUMMARY

REFERENCES 18. Mahoney EJ, Biff WL, Harrington DT, Cioff WG. Isolated brain injury 1. Terasaki PI, Cecka JM, Gjertson DW, Transplant 2004 Mar;4(3):419-426. as a cause of hypotension in the Takemoto S. High survival rates of 10. Schnuelle P, Gottmann U, Hoeger S, blunt trauma patient. J Trauma 2003 kidney transplants from spousal and Boesebeck D, Lauchart W, Weiss C, Dec;55(6):1065-1069. living unrelated donors. N Engl J Med et al. Effects of donor pretreatment 19. Shivalkar B, Van Loon J, Wieland W, 1995 Aug 10;333(6):333-336. with dopamine on graft function after Tjandra-Maga TB, Borgers M, Plets 2. Bos EM, Leuvenink HG, van Goor H, kidney transplantation: a randomized C, et al. Variable effects of explosive Ploeg RJ. Kidney grafts from brain controlled trial. JAMA 2009 Sep or gradual increase of intracranial dead donors: Inferior quality or 9;302(10):1067-1075. pressure on myocardial structure opportunity for improvement? Kidney 11. Fontana J, Yard B, Stamellou E, and function. Circulation 1993 Int 2007 Oct;72(7):797-805. Wenz H, Benck U, Schnuelle P, et al. Jan;87(1):230-239. 3. Schuurs TA, Morariu AM, Ottens PJ, ‘t Dopamine treatment of brain-dead 20. Avlonitis VS, Wigfeld CH, Kirby JA, Dark Hart NA, Popma SH, Leuvenink HG, et Fisher rats improves renal histology JH. The hemodynamic mechanisms of al. Time-dependent changes in donor but not early renal function in Lewis lung injury and systemic infammatory brain death related processes. Am J recipients after prolonged static response following brain death in the Transplant 2006 Dec;6(12):2903-2911. cold storage. Transplant Proc 2014 transplant donor. Am J Transplant 2005 4. Novitzky D, Cooper DK, Morrell Dec;46(10):3319-3325. Apr;5(4 Pt 1):684-693. D, Isaacs S. Change from aerobic 12. Pessione F, Cohen S, Durand D, 21. Kosieradzki M, Kuczynska J, to anaerobic metabolism Hourmant M, Kessler M, Legendre C, Piwowarska J, Wegrowicz-Rebandel 8 after brain death, and reversal et al. Multivariate analysis of donor I, Kwiatkowski A, Lisik W, et al. 8 following triiodothyronine therapy. risk factors for graft survival in kidney Prognostic signifcance of free radicals: Transplantation 1988 Jan;45(1):32-36. transplantation. Transplantation 2003 mediated injury occurring in the 5. Chatterjee SN, Terasaki PI, Fine Feb 15;75(3):361-367. kidney donor. Transplantation 2003 S, Schulman B, Smith R, Fine RN. 13. Cohen O, De La Zerda DJ, Beygui R, Apr 27;75(8):1221-1227. Pretreatment of cadaver donors with Hekmat D, Laks H. Donor brain death 22. Weiss S, Kotsch K, Francuski M, methylprednisolone in human renal mechanisms and outcomes after heart Reutzel-Selke A, Mantouvalou L, Klemz allografts. Surg Gynecol Obstet 1977 transplantation. Transplant Proc 2007 R, et al. Brain death activates donor Nov;145(5):729-732. Dec;39(10):2964-2969. organs and is associated with a worse 6. Jeffery JR, Downs A, Grahame JW, 14. Hacke W, Schwab S, Horn M, Spranger I/R injury after liver transplantation. Am Lye C, Ramsey E, Thomson AE. A M, De Georgia M, von Kummer R. J Transplant 2007 Jun;7(6):1584-1593. randomized prospective study of ‘Malignant’ middle cerebral artery cadaver donor pretreatment in renal territory infarction: clinical course and transplantation. Transplantation 1978 prognostic signs. Arch Neurol 1996 Jun;25(6):287-289. Apr;53(4):309-315. 7. Soulillou JP, Baron D, Rouxel A, 15. Lantigua H, Ortega-Gutierrez S, Guenel J. Steroid-cyclophosphamide Schmidt JM, Lee K, Badjatia N, Agarwal pretreatment of kidney allograft S, et al. Subarachnoid hemorrhage: donors. A control study. Nephron who dies, and why? Crit Care 2015 Aug 1979;24(4):193-197. 31;19:309-015-1036-0. 8. Schnuelle P, Lorenz D, Mueller A, 16. Kataoka K, Taneda M. Reversible Trede M, Van Der Woude FJ. Donor arterial hypotension after acute catecholamine use reduces acute aneurysmal subarachnoid hemorrhage. allograft rejection and improves Surg Neurol 1985 Feb;23(2):157-161. graft survival after cadaveric renal 17. Marshman LA. Cushing’s ‘variant’ transplantation. Kidney Int 1999 response (acute hypotension) Aug;56(2):738-746. after subarachnoid hemorrhage. 9. Schnuelle P, Yard BA, Braun C, Association with moderate intracranial Dominguez-Fernandez E, Schaub tensions and subacute cardiovascular M, Birck R, et al. Impact of donor collapse. Stroke 1997 Jul;28(7):1445- dopamine on immediate graft function 1450. after kidney transplantation. Am J

134 135 CHAPTER English and Dutch Summary 9 CHAPTER 9 ENGLISH SUMMARY

ENGLISH SUMMARY ischemia-reperfusion injury. Ischemia-reperfusion injury is more evident when organs are transplanted from brain-dead compared to living donors. Counteracting oxygen radical Background formation during reperfusion has proven benefcial effects in experimental models but Organ transplantation is the golden standard for the treatment of chronic organ failure. shows varying effects in the clinical setting. However, donor shortage leads to long waiting lists for transplant patients which increases the risk of serious complications and even mortality. Besides the donor shortage, Observations suboptimal quality of donor organs is another problem which affects transplantation Brain death is the result of increased pressure in the brain leading to decreased perfusion patients. The quality of donor organs determines transplantation outcomes and thereby to the brain with results in irreversible brain damage. The speed at which this pressure, infuences waiting lists. In most cases, organs are donated after death, with exception of also known as intracranial pressure, increases is variable and probably dependent on the kidney and sometimes the liver. Deceased donors can be classifed into two groups, the nature of the underlying mechanism of injury. In Chapter 2 and 3 we show that the namely heart-beating donors, also known as brain-dead donors, and non-heart beating speed at which brain death is induced is a determining factor for the extent of organ donors. Between the two, long-term outcomes are comparable but non-heart beating damage in the donor. In Chapter 2 we showed that a slow brain death induction leads to organs suffer from an elongated period of post-operative recovery in the recipient. All solid decreased kidney function and increased renal infammation and oxidative stress in the organs are transplantable from heart-beating donors because heart function and thereby donor compared to fast induction. In the liver, slow induction led to increased expression blood circulation are not compromised. In non-heart beating donors, the cessation of of infammatory markers and cell death markers. However, functional markers such as blood fow due to cardiac arrest threatens the quality of donor organs, with exception AST and ALT were not affected by induction speed. These observations support the of the kidney and sometimes the liver, to an extent that renders them unacceptable for notion that the speed at which brain death becomes evident should be considered when transplantation. Unfortunately, the state of brain death also negatively impacts organ choosing the optimal donor management strategy. In contrast to chapter 2, in Chapter 3 quality. The goal of this thesis was to describe the detrimental effects of brain-death we show that a faster brain death induction led to more detrimental effects in the lungs, related processes in the donor, during preservation (the period between explanation from evidenced by histological damage such as infarctions, hemorrhage, and edema. The the donor and implantation in the recipient) and reperfusion (the restoration of blood fow differential response to the two induction speeds in the kidney and liver on the one hand to the implanted organ in the recipient) in the recipient. By doing so, we hope to elucidate and the lung on the other hand is likely related to differences in hemodynamics between 9 brain-death related processes responsible for the inferior transplantation outcomes the two models. The slow induction model initially results in low systemic blood pressure 9 compared to living donation. With this knowledge, we wish to put forward treatments to resulting in more pronounced effects in the abdominal organs including the kidney and ameliorate transplantation outcomes. liver. The lung, on the other hand, is an organ that is less affected by low blood pressure. Therefore, the sudden surge in blood pressure elicited by fast induction is likely the cause Clinical research shows that living donation leads to better renal transplantation outcomes of increased lung damage due to rupturing of the capillary-alveolar membrane. compared to donation after brain-death. As such, the state of brain death itself infuences organ quality and thereby forms a risk factor for inferior transplantation outcomes. Brain In Chapter 4 we showed that brain death also led to increased expression of renal oxidative death leads to an array of pathological effects in the donor. In the brain-dead donor, the stress markers in the donor with higher expressions after slower brain death induction. dying cerebrum causes hemodynamic instability, a systemic state of infammation, and Besides increased levels of lipid peroxidation, which is a marker of oxidative damage to decreased secretion of hormones. Despite extensive experimental and clinical research, fatty acids, we also observed increased expression of the superoxide radical in the kidney so far, only the administration of dopamine to brain-dead donors as well as cooling of the following brain death. These results led to the speculation that superoxide production donor to subnormothermic temperatures have proven benefcial effects on renal function could play an initiating role in lipid peroxidation in the donor, which correlates with DGF in the recipient and decrease the incidence of delayed graft function (DGF), the need in renal transplant recipients. Furthermore, we theorize that increased superoxide levels at for dialysis in the frst week after transplantation. Furthermore, dopamine administration the beginning of the brain death period are likely related to the hemodynamic instability leads to decreased mortality in cardiac transplant recipients. during the induction. The increased superoxide levels observed at the end of the brain- dead are likely related to regional perfusion defects in the kidneys. This is supported by Besides the detrimental effects taking place in the donor, other phases of the Chapter 5, in which we show that regional renal perfusion diminishes over the course transplantation process can elicit hazardous effects on organs as well. During surgery, of the brain death period while systematic blood pressure levels are maintained within cessation of the blood leads to a period of no oxygen supply to the organ and oxygen, a physiological range. This suggests that maintenance of adequate blood pressure the so called “ischemic phase”. The longer the ischemic phase lasts, the more damage levels alone is likely not suffcient in decreasing oxidative stress. Therefore, alternative will be apparent. The organ is subsequently stored in special cooling liquid (0-4 degrees) strategies to improve and treat changes caused by diminished renal perfusion, such as the or preserved while perfused on an organ pump to keep damage to a minimum. administration of superoxide scavengers, could be essential. The damage endured by the ischemic phase becomes apparent when the organ is reconnected to the recipient’s blood supply and subsequently receives warm blood Interventions and oxygen, “the reperfusion phase”. The damage caused by reperfusion is likely mediated through the formation of oxygen radicals, the so called “oxidative stress”. To test the effects of administration of superoxide scavengers, in Chapter 6 we pre-treated Together, the damage caused during the ischemic- and reperfusion phase are named brain-dead rats with the superoxide scavenger MnTMPyP. MnTMPyP pre-treatment led to decreased levels of renal superoxide and lipid peroxidation. However, no differences were

138 139 CHAPTER 9 ENGLISH SUMMARY

observed in renal function or renal expression of infammatory markers in the brain-dead rat. Since lipid peroxidation levels correlate with DGF, we hypothesized that improved renal function by MnTMPyP treatment of brain-dead rats could become evident not until after reperfusion. Therefore, in Chapter 7 we reperfused kidneys of brain-dead rats that were pre-treated with MnTMPyP in an ex vivo isolated perfusion kidney (IPK) system. We observed that pre-treatment with MnTMPyP indeed improved renal function during reperfusion. These signifcant results pave the way for further research on the benefcial effects of MnTMPyP in renal transplantations.

Conclusion Brain death leads to detrimental effects in the future organ grafts, which negatively infuence transplantation outcomes. In this thesis, we show that the speed at which brain death is induced is decisive in the extent of damage to the kidney, liver, and lungs. Furthermore, we show that that the administration of anti-oxidative therapy to brain-dead rats leads to benefcial effects in the kidney. Therefore, this work paves the way for future research into the detrimental effects of brain death and its prevention using donor-specifc management strategies.

9 9

140 141 CHAPTER 9 NEDERLANDSE SAMENVATTING

NEDERLANDSE SAMENVATTING koude bewaarvloeistof of door het doorspoelen van het orgaan op een pomp. De schade die het orgaan tijdens de ischemie-fase oploopt wordt evident wanneer het orgaan tijdens Achtergrond de eigenlijke transplantatie aan de bloedcirculatie van de ontvanger wordt gekoppeld en weer wordt voorzien van warm zuurstofrijk bloed, de zogeheten “reperfusie-fase”. Orgaantransplantatie is de gouden standaard voor de behandeling van patiënten met De schade die tijdens deze fase ontstaat is waarschijnlijk gemedieerd door de vorming eindstadium orgaan falen. Echter, het tekort aan donororganen leidt tot lange wachtlijsten van zuurstofradicalen uit de zuurstofmoleculen in het bloed, de zogeheten “oxidatieve en naarmate patiënten langer op de wachtlijst staan, vergroot hun risico op ernstige stress”. Tezamen wordt de schade die tijdens de ischemie en reperfusie ontstaat ook wel complicaties en zelfs overlijden. Naast het donortekort, vormt de soms verminderde ischemie-reperfusie schade genoemd. Onderzoek toont aan dat organen uit hersendode- kwaliteit van donororganen tevens een groot probleem voor transplantatie patiënten. donoren meer ischemie-reperfusie schade oplopen dan levende donoren. Experimentele De kwaliteit van donororganen is bepalend voor transplantatie-uitkomsten en beïnvloedt data laat zien dat het wegvangen van zuurstofradicalen tijdens de reperfusie-fase leidt tot daarmee ook wachtlijsten. De meeste organen zijn afkomstig uit donoren die overleden een verbetering van de nierfunctie na transplantatie. Echter, in de klinische setting heeft zijn, met uitzondering van de nier en sporadisch de lever die ook uit een levende donor het wegvangen van zuurstofradicalen tot wisselende resultaten geleid. getransplanteerd kunnen worden. Overleden donoren kunnen worden onderverdeeld in hartdode- en hersendode donoren. Van deze twee groepen zijn de transplantatie uitkomsten op langere termijn vergelijkbaar maar laten organen afkomstig uit hartdode Observaties donoren een minder gunstig postoperatief herstel zien. Bij hersendode donoren blijft de Hersendood is het resultaat van toenemende druk in de hersenen met als gevolg het hartfunctie gewaarborgd waardoor de bloedcirculatie na het vaststellen van hersendood tekortschieten van de bloedsomloop naar het brein en daaropvolgend irreversibele in stand wordt gehouden. Mede hierdoor kunnen in theorie alle solide organen hersenschade. De snelheid waarmee de druk in de hersenen, ook wel intracraniële druk getransplanteerd worden. Anderzijds is bij hartdode donoren het stoppen van de circulatie genoemd, toeneemt is in de kliniek zeer variabel en waarschijnlijk afhankelijk van de door een hartstilstand voor de meeste organen (met uitzondering van nier en lever) een aard van het achterliggende mechanisme waardoor hersendood geïnduceerd wordt. In grote aanslag op de orgaankwaliteit waardoor transplantatie van dergelijke organen als te Hoofdstuk 2 en 3 laten wij zien dat de snelheid waarmee hersendood geïnduceerd wordt risicovol wordt geacht. Helaas heeft ook het intreden van hersendood negatieve effecten bepalend is voor de mate van schade in de donororganen. Hoofdstuk 2 laat zien dat in op de orgaankwaliteit en zijn transplantatie-uitkomsten van hersendode organen minder de nier, een langzamere inductie van hersendood leidde tot verminderde orgaanfunctie 9 gunstig vergeleken met organen uit een levende donor. Het doel van dit proefschrift en verhoogde ontstekingswaardes en oxidatieve stress in de donor, in vergelijking met 9 was om hersendood-gerelateerde processen in de donor, tijdens orgaan preservatie een snelle inductie. In de lever zagen we dat een langzamere inductie tot verhoogde (de periode na uitname in de donor en implantatie in de ontvanger) en reperfusie (de ontstekingswaardes en celdood leidt, waarbij schademarkers in het bloed (AST en ALT) terugkeer van bloed in het geïmplanteerde orgaan in de ontvanger) in de ontvanger te niet verhoogd zijn. Deze bevindingen suggereren dat de snelheid waarmee hersendood onderzoeken. In verschillende studies hebben we onderzocht welke processen tijdens intreedt invloed heeft op de orgaan kwaliteit en daarmee bepalend zou kunnen zijn in hersendood mogelijk verantwoordelijk zijn voor de uiteindelijk slechtere transplantatie- het kiezen van de optimale donor-management-strategieën bij de behandeling van een uitkomsten in vergelijking met levende donatie. Uiteindelijk hopen we met deze kennis hersendode donor. In Hoofdstuk 3 laten we zien dat in de longen juist een snelle inductie behandelingen te kunnen ontwikkelen en implementeren om hiermee transplantatie- leidt tot meer nadelige effecten. Een snelle inductie zorgde namelijk voor meer schade op uitkomsten te verbeteren. weefselniveau zoals longinfarcten, bloedingen en oedeem. De verschillende responsen in enerzijds de longen en anderzijds de lever en nier is wellicht te verklaren door een Uit klinisch onderzoek blijkt dat levende donatie leidt tot betere niertransplantatie- verschillende respons van deze organen op bloeddruk veranderingen. Een langzamere uitkomsten in vergelijking met donatie na hersendood. Hieruit blijkt dat hersendood- inductie zorgt tijdelijk voor een lage systemische bloeddruk wat waarschijnlijk resulteert in gerelateerde processen de orgaankwaliteit kunnen beïnvloeden en dus een risicofactor meer schade in abdominale organen zoals de nier en lever. De long daarentegen is een vormen voor verslechterde transplantatie-uitkomsten. Hersendood leidt tot een breed orgaan wat relatief ongevoelig is voor een lage bloeddruk, maar des te meer voor een scala aan pathologische effecten in de donor. Door het afsterven van de hersenen hoge bloeddruk. Een snelle inductie en de daarmee gepaard gaande hogere bloeddruk ontstaat er in het lichaam van de donor een instabiele bloedsomloop, algehele steriele is waarschijnlijk moeilijker te verdragen door de longen als gevolg van schade aan het ontstekingsreactie en veranderde hormoonuitscheiding. Ondanks vele experimentele- en alveolocapillaire membraan. klinische studies is tot dusver alleen de toediening van dopamine aan hersendode donoren en het koelen van de donor effectief gebleken in het verbeteren van de nierfunctie in In Hoofdstuk 4 laten we zien dat hersendood tot een verhoogde expressie van ontvangers en verminderen de incidentie van “delayed graft function” (DGF), de noodzaak oxidatieve stress markers in de nier van de donor leidde, waarbij er sprake was van tot dialyse in de eerste week na transplantatie. Tevens leidde dopamine toediening aan een meer uitgesproken verhoging na langzamere inductie. In deze studie zagen we hersendode donoren tot verminderde mortaliteit in ontvangers van harttransplantaties. naast verhoogde niveaus van lipide peroxidatie, het gevolg van oxidatieve schade aan vetzuren (MDA), eveneens verhoogde niveaus van het zuurstofradicaal superoxide in Naast de schadelijke effecten die plaatsvinden in de donor zijn er vervolgens meerdere de nier. Wij speculeerden naar aanleiding van deze resultaten dat superoxide mogelijk fases in het transplantatieproces waarbij organen schade kunnen oplopen. Vanaf de verantwoordelijk is voor de initiatie van lipide peroxidatie in de donor, een proces dat uitname in de donor volgt een periode waarin het orgaan geen bloed en dus geen tevens positief correleert met vertraagde orgaanfunctie (en dus de noodzaak tot dialyse) in zuurstof meer krijgt. Deze periode wordt de ischemie-fase genoemd en des te langer niertransplantatie-ontvangers. We theoretiseren dat verhoogde superoxide levels aan het deze periode duurt, des te meer schade het orgaan oploopt. Na uitname van het orgaan begin van de hersendoodfase hoogstwaarschijnlijk geïnitieerd wordt door schommelingen wordt gepoogd de schade te beperken door het orgaan te “preserveren” in een speciale

142 143 CHAPTER 9 NEDERLANDSE SAMENVATTING

in bloeddruk tijdens de inductiefase. De verhoogde niveaus die later in de hersendoodfase gemeten worden zijn waarschijnlijk gerelateerd aan regionale perfusiedefecten in de nier. In Hoofdstuk 5 laten wij namelijk zien dat er gedurende hersendood in toenemende mate sprake was van een verminderde doorbloeding van de nier, ondanks adequate bloeddrukregulatie in deze ratten. Deze resultaten suggereren dat bloeddrukregulatie alleen niet afdoende is om suffciënte doorbloeding van de nier te bewerkstelligen en mogelijk de vorming van superoxide radicalen ten gevolge van ischemie tegen te gaan. Het voorkomen van oxidatieve stress met behulp van lokale therapie, zoals de toediening van superoxide scavengers (moleculen die radicalen kunnen “wegvangen”), zou hierin uitkomst kunnen bieden.

Interventies In Hoofdstuk 6 laten wij zien dat behandeling van hersendode ratten met de superoxide scavenger MnTMPyP zuurstofradicalen weg kan vangen en lipide peroxidatie tegen kan gaan. Ondanks een verlaging van oxidatieve stress markers zagen wij echter geen verbetering van de nierfunctie, noch een verminderde expressie van infammatoire genen. Gezien de positieve correlatie tussen lipide peroxidatie en DGF in niertransplantatie ontvangers, postuleerden we dat de positieve effecten van MnTMPyP behandeling op orgaan kwaliteit wellicht pas tijdens de reperfusie fase evident zouden worden. In Hoofdstuk 7 hebben we daarom nieren afkomstig uit hersendode ratten gereperfuseerd met behulp van een geïsoleerde nierperfusie opstelling ex vivo. Tijdens deze reperfusie zagen wij dat inderdaad een verbeterde nierfunctie van nieren afkomstig uit ratten 9 voorbehandeld met MnTMPyP. Deze signifcante bevindingen sporen aan tot verder 9 onderzoek naar de positieve effecten van MnTMPyP tijdens niertransplantaties.

Conclusie Hersendood leidt tot schadelijke effecten in donororganen welke transplantatie uitkomsten negatief beïnvloeden. In dit proefschrift laten wij zien dat de manier waarop hersendood geïnduceerd wordt bepalend is voor de schade die ontstaat in de nieren, longen, en lever na hersendood. Verder tonen wij dat anti-oxidatieve therapie aan hersendode ratten tot gunstige effecten leidt in de nier. Met deze bevindingen spoort dit proefschrift aan tot verder onderzoek naar de schadelijke effecten van hersendood en het ontwikkelingen van donor-specifeke management-strategieën ter voorkoming hiervan.

144 145 CHAPTER 9

LIST OF ABBREVIATIONS EDTA Ethylenediaminetetraacetic acid

DCIP 2,6-dichloroindophenol ECD Expanded critera donors

AKI Acute kidney injury FAO Fatty acid oxidation

Paw Airway pressure FOV Field of view

ALT Alanine transaminase FiO2 Fraction of inspired oxygen ADH Antidiuretic hormone FeNa Fractional sodium excretion

ASL Arterial spin labelling GPx Glutathione peroxidase

AST Aspartate transaminase GR Glutathione reductase

AST Aspartate transaminase GAPDH Glyceraldehyde 3-phosphate dehydrogenase

BOLD Blood oxygen level dependent HO-1 Heme oxygenase 1

BW Body weight H2O2 Hydrogen Peroxide

BSA Bovine serum albumin HAES Hydroxethyl starch

BD Brain death IL-6 Interleukin 6

9 FCCP Carbonyl cyanide-4-(trifuoromethoxy) phenylhydrazone IL-10 Interleukin-10 9

CAT Catalase IL-6 Interleukin-6

CPP Cerebral perfusion pressure ICP Intracranial pressure

Cxcl1 Chemokine ligand 1 I-R Ischemia-reperfusion

Ccl2 Chemokine ligand 2 IPK Isolated perfused kidney

CK-MB Creatine kinase (myocardium) LDH Lactate dehydrogenase

CrC Creatinine clearance LDHA Lactate dehydrogenase A

Cinc1 Cytokine induced neutrophil chemoattractant1 LD Living donor

DBD Deceased brain-dead MRI Magnetic resonance imaging

DCD Deceased circulatory death MDA Malondialdehyde

DGF Delayed graft function MnTMPyP: Manganese(III) tetrakis(1-methyl-4-pyridyl)porphyrin

DGF Delayed graft function MAP Mean arterial pressure

DPBS Dulbecco’s phosphate-buffered saline MCP-1 Monocyte chemotactic protein 1

TE Echo time NAG N-acetyl- -D-glucosaminidase

ETC Electron transport chain NADPH nicotinamide adenine dinucleotide phosphate

ETCO2 End-tidal CO2 NA Noradrenaline

146 147 CHAPTER 9

GSSG Oxidized glutathione

SaO2 Oxygen saturation PAS Periodic-Acid Schiff

PMSF Phenylmethylsulfonyl fuoride

PBS Phosphate buffered saline

Pfk-1 Phosphofructokinase-1

PMN Polymorphonuclear

PEEP Positive end expiratory pressure

PNF Primary non-function

P-P Probability-probabilty

Pc Pyruvate carboxylase

Pk Pyruvate kinase

ROS Reactive oxygen species

9 GSH Reduced glutathione 9

TR Repetition time

RCR Respiratory control ratio

Crs Serum creatinine

SD Standard deviation

SOD: Superoxide dismutase

SVR Systemic vascular resistance

TLDA TaqMan low density array

TBA Thiobarbituric acid

TGF- Transforming growth factor-beta

TCA Tricarboxylic acid

TNF- α Tumor necrosis factor alpha

TNF- α Tumor necrosis factor α

UCr Urinary creatinine

Vcam1 Vascular adhesion molecule 1

H2O Water W/D Wet-dry

148 149 CHAPTER 9

AUTHOR AFFILIATIONS YS Bodar1 NR Jespersen2 HE Bøtker2 C Laustsen11 A Breedijk3 HGD Leuvenink1 J Bubberman1 NJ Majenberg1 JGM Burgerhof4 R Nørregaard9 J Ciapaite5,6 PJ Ottens1 M Erasmus7 M Pedersen11 AC van Erp1 RA Rebolledo1,12,13 H van Goor8 ZS Veldhuis1 D Hoeksma1 J Wiersema-Buist1 CMV Hottenrott1 JC Wolters5,14 B Jespersen9,10 B Yard3

1 - Department of Surgery, Groningen Transplant Center, University Medical Center Groningen, the Netherlands 2 - Department of Cardiology, Aarhus University Hospital, Aarhus, Denmark 3 - Department of Medicine, Nephrology, Endocrinology, Diabetology, Rheumatology, 9 Heidelberg University, Mannheim, Germany 9 4 - Faculty of Medical Sciences, Department of Epidemiology, University Medical Center Groningen, Groningen, The Netherlands 5 - Systems Biology Centre for Energy Metabolism and Ageing, University of Groningen, Groningen, the Netherlands. 6 - Department of Pediatrics, University Medical Center Groningen, Groningen, the Netherlands. 7 - Deparment of cardiothoracical surgery, University Medical Center Groningen, Groningen, the Netherlands 8 - Department of Pathology and Medical Biology, University Medical Center Groningen, Groningen, the Netherlands 9 - Department of Clinical Medicine, Aarhus University, Aarhus, Denmark. 10 - Department of Renal Medicine, Aarhus University Hospital, Aarhus, Denmark 11 - MR Research Center, Clinical Institute, Aarhus University, Aarhus, Denmark. 12 - Institute of Biomedical Sciences, Faculty of Medicine, Universidad de Chile, Santiago, Chile. 13 - Department of Digestive Surgery, Faculty of Medicine. Pontifcia Universidad Católica de Chile, Santiago, Chile. 14 - Department of Analytical Biochemistry, Research Institute of Pharmacy, University of Groningen, Groningen, The Netherlands.

150 151 CHAPTER 9

ACKNOWLEDGMENTS I would like to thank Jan Niesing for providing data and fgures at the eleventh hour! I would like to start off by mentioning the frst three guys I met when I just arrived in Norbert Majenberg en Sonja Buisman. My beloved students! I know I learned a lot from Groningen: Martijn Posthumus, Diederik van Korven, and Wouter aan de Stegge. supervising you and I hope you guys learned a thing or two from me! I enjoyed working Experiencing my frst year in Groningen just would not have been the same without the together with the both of you! three of you. You guys know what I mean! After having to have moved from Utrecht, the days spent with you guys made this transition to Groningen feel seamless. We became Atta Rehman, in was in dire need of another oxidative stress outcome measurement and friends and made that year a true once in a life-time experience! Thinking about it and as a matter of chance there you were! Thanks for helping me with the lab work and the realizing those days are gone makes me sad! I love you guys! Indian food we enjoined on numerous occasions! I hope you and your family are doing well in Pakistan! Henri, or as they say these days: professor Leuvenink! The moment I stepped into your offce I immediately knew I was in the right place! You have the ability to appeal to a wide Danial, you are the kind of person that radiates warmth and openness, even in the middle variety of people which is something I really admire. Thanks for believing in me from the of the night when we met in the lab! I knew I had a friend in you the frst time we met! We time I set foot in your offce! should make that trip to Iran soon!

Pragmatic, charismatic, and sympathetic is how I would describe you professor van Goor. Anne Koning and Leon van Dullemen, I don’t know anyone who even closely resembles It’s these characteristics which drew me to you and I think the same holds true for many either of you! You are unique in both your own ways and I am glad I started (and fnished!) others! I really admire your work ethic and learned a great deal from you even though we my PhD project alongside you guys! only started working extensively together in the last year of my PhD! Offce mates Dirk Bosch and Maarten Niebling, sitting in the offce with you guys was a Jacco Zwaagstra, as the head of the lab I really had to watch out for you! Not adhering total experience! Getting pencil cases fown at my neck at a hundred miles an hour whilst to protocols and not wearing a lab-coat got me into trouble with you on a regular basis! listening to the worst music outweighed the fact that no work got done! However, this never stood in the way of a good friendship and I really enjoyed our talks, 9 especially about travelling abroad! Thanks to everyone else from surgical research lab, Welmoet, Geert, Bo, Jeffrey, 9 Michael, Douwe, Jelle, Ton, Valerie, Jan-binne, Peter, Dafna, Leonie and from other Petra, to put it simple, you were indispensable throughout my PhD time! My frst days in labs Vicenzo Terlizzi and Marc Seelen. the lab were under your supervision as were some of my last! I never stopped learning from you. Your organizational and of course technical skills were essential for me and my All other fellow medical students who made my medical and PhD career an unforgettable experiments! one: Catherine de Sonnaville, Ignas Houben, Ashling Stel, Moniek Wouters, Guy Metting van Rijn, Erik Heeg, Michiel van Basten-Batenburg, Thank you! Suzanne, thanks for putting a smile on my face every time you were in the lab! Your soft- natured personality is something truly amazing! Thanks for helping me around the lab and All members of the Masterraad, Manon Crull, Broes Vervliet, Bernard Vonck, Jorien van with experiments every now and then! Dooren, thanks for the times we spent together!

Janneke, I think you have the most experience out of anyone in the lab! The passion and My paranymphs Rik Mencke en Marc Kirschbaum. Rik, we got to know each other at the determination you bring to the job is admirable! Thanks for always helping me so swiftly start of both our PhD’s. Even though you were working on a completely different topic, with any histology work! I hope you have a great time in your new house! you knew all the details of mine due to the endless amount of questions I would ask you! If there was anyone I could ask for help any place, anywhere, anytime, it was you! You Maxi & Rolando. Older than me, both of you were like mentors to me considering the really saved me at moments! You are a person who is truly yourself and not afraid to show amount of experience and “know how” you brought to the table. I was lucky enough to it which I admire very much! Marc, we got to know each other in the lab and it took some catch a ride on the train you guys were in! I learned a great deal from the both of you! time before we became friends! Some things need to grow I guess! You’re the person that leaves an impression anywhere you go and likewise you did on me and the whole of Yves Bodar, like Rihanna said: we fell in love in a hopeless place! From early morning till my PhD period! evening, day in day out, we found ourselves in a small closed operation room amidst brain- dead rats!! Ironically, these days were the best of my research period and you were largely The guys from O.H.G.E (Utrecht), even though you guys were not directly involved in my responsible for that! I am glad we developed a close friendship outside this “hopeless research, you deserve a spot in here no less than anyone else. To put down in words what place” as well. Unfortunately, you will not be able to attend my defense as you will be in you guys have brought me is not possible and therefore will not be taken a shot at! Thank the States! I wish you all the luck in the world and hope to see you more often! you!

Professor J.L. Hillebrands, D.J. Reijngoud, and B. Yard, thanks for reading my thesis and approving it!

152 153 CHAPTER 9

Friends from Deventer, Henry Ong, Mick Verhaaf and Shahroez Peraee, I’ve known you longer than anyone else mentioned above and wish to never lose you guys from my life!

Lucas, my little brother, thank you for always being the calmer one between the two of us! I am real proud of you and hope everything works out for you the way you want!

Dear mom and dad, without you I would not be standing here today. I cannot thank you enough for the unconditional support you always gave and still give.

Dear Anne, the start off my research career had me library-bound and it’s where I frst saw you! Since that day, I’ve felt increasingly inseparable from you! Six years together have brought diffcult times and struggles but having experienced that and eventually surviving that together means everything to me! I love you!

9 9

154 155 CHAPTER 9

BIOGRAPHY

Dane was born on February 14th, 1988, in Durban, South Africa. After having been raised in South Africa, Germany, and Ivory Coast, Dane graduated from high school at the Etty Hillesum Lyceum in 2006 in Deventer, the Netherlands. He obtained a pre-medical degree from University College Utrecht after which he studied medical statistics for a year at the Radboud University in Nijmegen. He then started medical school in 2010 at the Rijksuniversiteit Groningen. During his medical studies, participation in the summer school “Transplantation” led to a research internship at the surgical laboratory under the supervision of professors H.G.D. Leuvenink and H. van Goor. He decided to prolong his research career and alternated this with his medical studies. Two years of full time research eventually led to this thesis. For his medical studies, Dane was a medical intern at the University Medical Centre Groningen as wel as “Deventer Ziekenhuis” in his hometown. During this period, Dane served as the chairman of the commission “de Masterraad” which represents the student body of the medical school of the Rijksuniversiteit Groningen. He completed his medical degree with a fnal internship at the neurosurgical department at the University Medical Center Utrecht which is where he now works as a doctor. 9 9

156 157