DOCSLIB.ORG

The Antigenic Significance and Methods of Detection Of

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Antigenic Significance and Methods of Detection Of Postgrad Med J (1992) 68, 707- 713 © The Fellowship of Postgraduate Medicine, 1992 Postgrad Med J: first published as 10.1136/pgmj.68.803.707 on 1 September 1992. Downloaded from Review Article The antigenic significance and methods ofdetection ofthe anti-neutrophil cytoplasmic autoantibodies (ANCA) Xavier Bosch and Ronald A. Asherson' Service ofGeneral Internal Medicine, Hospital Clinic i Provincial, Barcelona, Spain and 'Division of Rheumatology and Connective Tissue Diseases, St Luke's/Roosevelt Division ofColumbia University, New York, USA Introduction Systemic vasculitis is often difficult to diagnose. Cytoplasmic immunostaining pattern of gran- The recent discovery of a new class of auto- ulocytes (c-ANCA) was reported in 1982 in eight antibodies, the anti-neutrophil cytoplasmic auto- patients with segmental necrotizing glomerulo- antibodies (ANCA), provides clinicians with a nephritis.5 Later, four further patients with vas- serological test strongly supportive ofthe diagnosis culitis, glomerulonephritis and the serum presence of the commonest forms of systemic necrotizing of c-ANCA were reported.6 It was only in 1985 vasculitis. ANCA are IgG autoantibodies specific when van der Woude et al.7 noticed that c-ANCA Protected by copyright. for different constituents of neutrophil azurophilic mainly occurred in patients with Wegener's granules and monocyte lysosomes. These anti- granulomatosis, that interest in these antibodies bodies are the first serological markers for several became intense. In addition, Falk and Jennette8 forms ofsystemic vasculitis, particularly Wegener's recognized in 1988 the clinical importance of the granulomatosis and polyarteritis nodosa, as well as perinuclear immunostaining of neutrophils (p- for the commoner types ofnecrotizing and crescen- ANCA) as well as its association with myeloperox- tic glomerulonephritis.' In addition to their recog- idase (MPO). They demonstrated that this was an nized use in the diagnosis and follow-up of these artifactual pattern ofcell fixation with ethanol and conditions, it appears that ANCA may be a found these antibodies mainly in patients with pathogenic factor inducing vascular injury in idiopathic necrotizing and crescentic glomerulo- patients with ANCA-associated disease. This sus- nephritis. picion arises from in vitro evidence that ANCA are It is now well accepted that ANCA have two capable of activating neutrophils causing the main antigenic specificities each one of them release oflytic proteases and toxic oxygen radicals.2 associating with two main clinical disorders. Thus, The existence of autoantibodies against neutro- the c-ANCA mainly represent anti-proteinase 3 http://pmj.bmj.com/ phils has been known for almost 30 years. A (PR3) antibodies which mostly identify patients granulocyte-specific antinuclear factor was re- with biopsy-proven Wegener's granulomatosis. ported in 1964.3 Eight years later, Wiik and Mun- The p-ANCA represent anti-MPO antibodies the4 described a standardized method for the which are mainly seen in patients with pauci- detection of granulocyte-specific anti-nuclear immune necrotizing and crescentic glomerulo- antibodies (GS-ANA). These investigators per- nephritis showing little or no evidence of formed an indirect immunofluorescence (IIF) extra-renal involvement. 9-" on September 28, 2021 by guest. procedure on ethanol-fixed neutrophils, which re- mains the standard technique for ANCA detection today. GS-ANA were found to be specific for Methods for the detection ofANCA neutrophil and monocyte nuclei, did not react with lymphocytes, and were mainly detected in patients Several methods have been used to detect ANCA. with rheumatic diseases, especially rheumatoid These include IIF, enzyme-linked immunosorbent arthritis and Felty's syndrome, as well as in some assay (ELISA), radioimmunoassay (RIA), West- patients with ulcerative colitis. ern blotting, dot blotting and immunoprecipita- tion. The first method to detect ANCA was IIF. As Correspondence: Xavier Bosch, M.D., Servicio de mentioned above, this procedure was originally Medicina Interna General, Unidad 1, Hospital Clinic i used for the detection of GS-ANA,12 and today is Provincial, Villarroel, 170, 08036 Barcelona, Spain. still used in the same way. At the First International Accepted: 31 March 1992 ANCA Workshop held in Copenhagen in 1988, 708 X. BOSCH & R.A. ASHERSON Postgrad Med J: first published as 10.1136/pgmj.68.803.707 on 1 September 1992. Downloaded from this method was definitively adapted as the ever, a major problem in this type of assay is that reference for future studies of ANCA.'3 Some many sera containing rheumatoid factors will react investigators have also performed HL-60 cell cul- with these monoclonal antibodies and give a false- tures for detection of ANCA by 1IF and for positive result. distinguishing these from serum autoantibodies Since it is now well known that the major other than ANCA.'4 c-ANCA antigen is PR3, this protein is being used The potential problem with the subjective inter- in many laboratories for detecting anti-PR3 pretation of the two 1IF patterns prompted the antibodies in solid-phase assays."' Likewise, after rapid development of antigen-specific, solid-phase the discovery that the chief p-ANCA antigen was assays. To assess the validity of these assays, it is MPO,8 this well-characterized protein is also being important to be aware of the nature of the antigen used in solid-phase assays for MPO-ANCA detec- preparation used as a substrate as well as the tion in many centres. These assays are highly specificity and label of the secondary antibody specific and sensitive for c-ANCA and p-ANCA, used. The substrates employed in solid-phase respectively. A small percentage of patients with assays are crude extracts of cells, extracts of p-ANCA will have anti-elastase or anti-lactoferrin granules, or sandwich techniques using mono- antibodies which may also now be detected by clonal antibodies or purified proteins. The secon- means of specific ELISAs using either purified dary antibodies commonly used are directed elastase or lactoferrin as a substrate. against human IgG. However, since the presence of The IIF procedure correlates well with the IgM ANCA early in disease has been reported,'5 solid-phase assays in that the number of positive some laboratories use anti-human Ig polyclonal samples is roughly the same, but the antibody titres antibodies as the secondary antibody. show a low correlation with the solid-phase The first solid-phase assay described was a RIA readings. A high IIF titre may thus be low in the using an acid extract of neutrophils. 16 This resulted ELISA and vice versa. The ELISAs are, as in a sensitivity of96% and a specificity of80%. The expected, more sensitive than IIF, but the IIF willProtected by copyright. low specificity was due to false-positive reactions detect a few sera having specificities other than for among systemic lupus erythematosus (SLE) the antigens used for coating in the solid-phase patients. This may be expected, since a whole assays. Normally, between 80% and 90% of sam- cellular extract is used which also contains nuclear ples which are positive by IIF will be positive in antigens. Likewise, the acid extract of whole cells ELISA, and about 90% ofsamples that are positive has also been used to develop an ELISA with the in ELISA will be positive in 11F.24 same drawbacks, that is, a high background and a The strategy used in many laboratories today is high proportion of false-positive reactions."7 How- to screen for ANCA by IIF. Due to problems with ever, the solid-phase assays were greatly improved interpretation of the IIF pattern, an ELISA is now when it was shown that the c-ANCA antigen often also needed to confirm the specificity. This is localized in the primary granules,'8 and assays were especially true when a p-ANCA pattern is seen. The developed using purified extracts of these granules p-ANCA pattern can mask a c-ANCA pattern or with a response at least 20 times better as compared could actually be a true GS-ANA pattern or with the whole cell extract.'9'20 This also resulted in perhaps a regular ANA pattern seen in patients not http://pmj.bmj.com/ a high specificity (greater than 95%), a sensitivity suffering from systemic vasculitis. At all, one may of 80-90% and there were no significant problems then check for lymphocytes, which are negative with false-positive reactions from SLE patients. with p-ANCA, and again perform the IIF with Although this method mainly detects PR3, high formaldehyde fixation. The pattern for MPO- serum concentrations of MPO or other azurophilic ANCA with formaldehyde fixation will change antigens may unfortunately also give a positive from p-ANCA to granular cytoplasmic. If the result. Another approach was taken by Ludemann pattern now remains nuclear, this probably et al.2' who used an affinity column with immuno- represents the presence of ANA or a true GS- on September 28, 2021 by guest. globulin from a patient with Wegener's granulo- ANA."24 The strategy used in our centre is first to matosis. An ELISA using this method seems to be screen for ANCA by standard IIF. When c-ANCA highly specific for c-ANCA and avoids the problem are seen, we then perform an ELISA using purified with false-positivity from other autoimmune sera. PR3. When a p-ANCA pattern is seen, an ELISA However, the antigen is difficult to purify. At the with purified MPO is then performed. When the First International ANCA Workshop, this assay results are doubtful by IIF, we perform an ELISA was found to correlate very well with the assay using purified extract of primary granules as sub- using purified granules.22 Finally, monoclonal strate (Figure 1). antibodies against the c-ANCA antigen have also been used to capture the antigen in a solid-phase assay.23 This has the advantage of selecting mono- clonal antibodies to the antigen of choice.
Load more

Recommended publications
  • Independent Evolution of Four Heme Peroxidase Superfamilies
    Archives of Biochemistry and Biophysics xxx (2015) xxx–xxx Contents lists available at ScienceDirect Archives of Biochemistry and Biophysics journal homepage: www.elsevier.com/locate/yabbi Independent evolution of four heme peroxidase superfamilies ⇑ Marcel Zámocky´ a,b, , Stefan Hofbauer a,c, Irene Schaffner a, Bernhard Gasselhuber a, Andrea Nicolussi a, Monika Soudi a, Katharina F. Pirker a, Paul G. Furtmüller a, Christian Obinger a a Department of Chemistry, Division of Biochemistry, VIBT – Vienna Institute of BioTechnology, University of Natural Resources and Life Sciences, Muthgasse 18, A-1190 Vienna, Austria b Institute of Molecular Biology, Slovak Academy of Sciences, Dúbravská cesta 21, SK-84551 Bratislava, Slovakia c Department for Structural and Computational Biology, Max F. Perutz Laboratories, University of Vienna, A-1030 Vienna, Austria article info abstract Article history: Four heme peroxidase superfamilies (peroxidase–catalase, peroxidase–cyclooxygenase, peroxidase–chlo- Received 26 November 2014 rite dismutase and peroxidase–peroxygenase superfamily) arose independently during evolution, which and in revised form 23 December 2014 differ in overall fold, active site architecture and enzymatic activities. The redox cofactor is heme b or Available online xxxx posttranslationally modified heme that is ligated by either histidine or cysteine. Heme peroxidases are found in all kingdoms of life and typically catalyze the one- and two-electron oxidation of a myriad of Keywords: organic and inorganic substrates. In addition to this peroxidatic activity distinct (sub)families show pro- Heme peroxidase nounced catalase, cyclooxygenase, chlorite dismutase or peroxygenase activities. Here we describe the Peroxidase–catalase superfamily phylogeny of these four superfamilies and present the most important sequence signatures and active Peroxidase–cyclooxygenase superfamily Peroxidase–chlorite dismutase superfamily site architectures.
    [Show full text]
  • SUPPLEMENTARY DATA Supplementary Figure 1. The
    SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary
    [Show full text]
  • GRAS Notice 665, Lactoperoxidase System
    GRAS Notice (GRN) No. 665 http://www.fda.gov/Food/IngredientsPackagingLabeling/GRAS/NoticeInventory/default.htm ORIGINAL SUBMISSION 000001 Mo•·gan Lewis Gf<N Ob()&h5 [R1~~~~~~[Q) Gary L. Yingling Senior Counsel JUL 1 8 2016 + 1.202. 739 .5610 gary.yingling@morganlewis .com OFFICE OF FOO~ ADDITIVE SAFETY July 15, 2016 VIA FEDERAL EXPRESS Dr. Antonia Mattia Director Division of Biotechnology and GRAS Notice Review Office of Food Additive Safety (HFS-200) Center for Food Safety and Applied Nutrition Food and Drug Administration 5100 Paint Branch Parkway College Park, MD 20740-3835 Re: GRAS Notification for the Lactoperoxidase System Dear Dr. Mattia: On behalf of Taradon Laboratory C'Taradon"), we are submitting under cover of this letter three paper copies and one eCopy of DSM's generally recognized as safe ("GRAS'') notification for its lactoperoxidase system (''LPS''). The electronic copy is provided on a virus-free CD, and is an exact copy of the paper submission. Taradon has determined through scientific procedures that its lactoperoxidase system preparation is GRAS for use as a microbial control adjunct to standard dairy processing procedures such as maintaining appropriate temperatures, pasteurization, or other antimicrobial treatments to extend the shelf life of the products. In many parts of the world, the LPS has been used to protect dairy products, particularly in remote areas where farmers are not in close proximity to the market. In the US, the LPS is intended to be used as a processing aid to extend the shelf life of avariety of dairy products, specifically fresh cheese including mozzarella and cottage cheeses, frozen dairy desserts, fermented milk, flavored milk drinks, and yogurt.
    [Show full text]
  • Genomic Evidence of Reactive Oxygen Species Elevation in Papillary Thyroid Carcinoma with Hashimoto Thyroiditis
    Endocrine Journal 2015, 62 (10), 857-877 Original Genomic evidence of reactive oxygen species elevation in papillary thyroid carcinoma with Hashimoto thyroiditis Jin Wook Yi1), 2), Ji Yeon Park1), Ji-Youn Sung1), 3), Sang Hyuk Kwak1), 4), Jihan Yu1), 5), Ji Hyun Chang1), 6), Jo-Heon Kim1), 7), Sang Yun Ha1), 8), Eun Kyung Paik1), 9), Woo Seung Lee1), Su-Jin Kim2), Kyu Eun Lee2)* and Ju Han Kim1)* 1) Division of Biomedical Informatics, Seoul National University College of Medicine, Seoul, Korea 2) Department of Surgery, Seoul National University Hospital and College of Medicine, Seoul, Korea 3) Department of Pathology, Kyung Hee University Hospital, Kyung Hee University School of Medicine, Seoul, Korea 4) Kwak Clinic, Okcheon-gun, Chungbuk, Korea 5) Department of Internal Medicine, Uijeongbu St. Mary’s Hospital, Uijeongbu, Korea 6) Department of Radiation Oncology, Seoul St. Mary’s Hospital, Seoul, Korea 7) Department of Pathology, Chonnam National University Hospital, Kwang-Ju, Korea 8) Department of Pathology, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea 9) Department of Radiation Oncology, Korea Cancer Center Hospital, Korea Institute of Radiological and Medical Sciences, Seoul, Korea Abstract. Elevated levels of reactive oxygen species (ROS) have been proposed as a risk factor for the development of papillary thyroid carcinoma (PTC) in patients with Hashimoto thyroiditis (HT). However, it has yet to be proven that the total levels of ROS are sufficiently increased to contribute to carcinogenesis. We hypothesized that if the ROS levels were increased in HT, ROS-related genes would also be differently expressed in PTC with HT. To find differentially expressed genes (DEGs) we analyzed data from the Cancer Genomic Atlas, gene expression data from RNA sequencing: 33 from normal thyroid tissue, 232 from PTC without HT, and 60 from PTC with HT.
    [Show full text]
  • Peroxidasin-Mediated Bromine Enrichment of Basement Membranes
    Peroxidasin-mediated bromine enrichment of basement membranes Cuiwen Hea,1, Wenxin Songa,1, Thomas A. Westona, Caitlyn Trana, Ira Kurtza, Jonathan E. Zuckermanb, Paul Guagliardoc, Jeffrey H. Minerd, Sergey V. Ivanove,f, Jeremy Bougourec, Billy G. Hudsone,f,g,h, Selene Colone,f,h,i, Paul A. Voziyane,f, Gautam Bhavee,f,i,j, Loren G. Fonga, Stephen G. Younga,k,2,3, and Haibo Jiangl,m,2,3 aDepartment of Medicine, University of California, Los Angeles, CA 90095; bDepartment of Pathology and Laboratory Medicine, University of California, Los Angeles, CA 90095; cCentre for Microscopy, Characterisation and Analysis, University of Western Australia, 6009 Perth, Australia; dDivision of Nephrology, Washington University School of Medicine, St. Louis, MO 63110; eVanderbilt Center for Matrix Biology, Vanderbilt University Medical Center, Nashville, TN 37212; fDivision of Nephrology, Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232; gVanderbilt Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232; hVanderbilt Institute of Chemical Biology, Vanderbilt University, Nashville, TN 37232; iDepartment of Cell and Developmental Biology, Vanderbilt University, Nashville, TN 37212; jCenter for Kidney Disease, Vanderbilt University Medical Center, Nashville, TN 37232; kDepartment of Human Genetics, University of California, Los Angeles, CA 90095; lSchool of Molecular Sciences, University of Western Australia, 6009 Perth, Australia; and mDepartment of Chemistry, The University of Hong Kong, Hong Kong, China Contributed by Stephen G. Young, May 25, 2020 (sent for review April 22, 2020; reviewed by Douglas Gould and Martin R. Pollak) Bromine and peroxidasin (an extracellular peroxidase) are essen- methionine and a spatially adjacent hydroxylysine residue (lysine- tial for generating sulfilimine cross-links between a methionine 1689) in a partner collagen IV trimer (1, 4).
    [Show full text]
  • Kinetics of Interconversion of Redox Intermediates of Lactoperoxidase
    Jpn. J. Infect. Dis., 57, 2004 Kinetics of Interconversion of Redox Intermediates of Lactoperoxidase, Eosinophil Peroxidase and Myeloperoxidase Paul Georg Furtmüller, Walter Jantschko, Martina Zederbauer, Christa Jakopitsch, Jürgen Arnhold1 and Christian Obinger* Metalloprotein Research Group, Division of Biochemistry, Department of Chemistry, BOKU-University of Natural Resources and Applied Life Sciences, 1Institute of Medical Physics and Biophysics, School of Medicine, University of Leipzig, Leipzig, Germany SUMMARY: Myeloperoxidase, eosinophil peroxidase and lactoperoxidase are heme-containing oxidoreductases, which undergo a series of redox reactions. Though sharing functional and structural homology, reflecting their phylogenetic origin, differences are observed regarding their spectral features, substrate specificities, redox properties and kinetics of interconversion of the relevant redox intermediates ferric and ferrous peroxidase, compound I, compound II and compound III. Depending on substrate availability, these heme enzymes path through the halogenation cycle and/or the peroxidase cycle and/or act as poor (pseudo-) catalases. Today - based on sequence homologies, tertiary structure and the halide ions is the following: I– > Br– > Cl–. All peroxidases can nature of the heme group - two heme peroxidase superfamilies are oxidize iodide. At neutral pH, only MPO is capable to oxidize distinguished, namely the superfamily containing enzymes from chloride at a reasonable rate (4), and it is assumed that chloride and archaea, bacteria, fungi and plants (1) and the superfamily of thiocyanate are competing substrates in vivo. EPO can oxidize mammalian enzymes (2), which contains myeloperoxidase (MPO), chloride only at acidic pH (5), and at normal plasma concentrations, eosinophil peroxidase (EPO), lactoperoxidase (LPO) and thyroid bromide and thiocyanate function as substrates, whereas for LPO peroxidase (TPO).
    [Show full text]
  • Activation of Human Eosinophils in Vitro by Respiratory Syncytial Virus'
    0031-3998/92/3202-0160$03.00/0 PEDIATRIC RESEARCH Vol. 32, No.2, 1992 Copyright © 1992 International Pediatric Research Foundation, Inc. Printed in U.S.A. Activation of Human Eosinophils In Vitro by Respiratory Syncytial Virus' JAN L. L. KIMPEN, ROBERTO GAROFALO,2 ROBERT C. WELLIVER, AND PEARAY L. OGRA2 School ofMedicine, State University ofNew York at Buffalo, Departments ofPediatrics and Microbiology, and Division ofInfectious Diseases, The Children's Hospital, Buffalo, New York 14222 ABSTRACT. To determine the nature of the interaction RSV is the leading cause of pneumonia and bronchiolitis between viruses and eosinophils, normodense eosinophils during infancy (1). It has been speculated that RSV infection in were separated from the blood of healthy volunteers and infancy plays a role in the development of hyperreactive airway incubated in vitro with respiratory syncytial virus (RSV). disease in later life (2). The pathogenesis ofthe inflammation of After incubation for 2 h with the virus, 29.5 ± 15.8% of the airways during acute RSV infection and the mechanisms the eosinophils demonstrated specific binding of the virus underlying the possible development of subsequent airway hy­ to the cell membrane, as detected by fluorescent staining perreactivityare not completely understood. with an anti-RSV MAb. Superoxide production and leu­ Recent evidence suggests an important role for eosinophils in kotriene C4 release were measured as determinants of cell a variety of inflammatory states (3). Although the role of eosin­ activation. Using a cytochrome c reduction assay, super­ ophils in natural RSV infection is unclear, reports offield studies oxide could be detected in the supernatant 30 min after with a formalin-inactivated RSV vaccine carried out in the late exposure to RSV.
    [Show full text]
  • Peroxidase Activity of Human Hemoproteins: Keeping the Fire Under Control
    molecules Review Peroxidase Activity of Human Hemoproteins: Keeping the Fire under Control Irina I. Vlasova 1,2 1 Federal Research and Clinical Center of Physical-Chemical Medicine, Department of Biophysics, Malaya Pirogovskaya, 1a, Moscow 119435, Russia; [email protected]; Tel./Fax: +7-985-771-1657 2 Institute for Regenerative Medicine, Laboratory of Navigational Redox Lipidomics, Sechenov University, 8-2 Trubetskaya St., Moscow 119991, Russia Received: 28 August 2018; Accepted: 1 October 2018; Published: 8 October 2018 Abstract: The heme in the active center of peroxidases reacts with hydrogen peroxide to form highly reactive intermediates, which then oxidize simple substances called peroxidase substrates. Human peroxidases can be divided into two groups: (1) True peroxidases are enzymes whose main function is to generate free radicals in the peroxidase cycle and (pseudo)hypohalous acids in the halogenation cycle. The major true peroxidases are myeloperoxidase, eosinophil peroxidase and lactoperoxidase. (2) Pseudo-peroxidases perform various important functions in the body, but under the influence of external conditions they can display peroxidase-like activity. As oxidative intermediates, these peroxidases produce not only active heme compounds, but also protein-based tyrosyl radicals. Hemoglobin, myoglobin, cytochrome c/cardiolipin complexes and cytoglobin are considered as pseudo-peroxidases. Peroxidases play an important role in innate immunity and in a number of physiologically important processes like apoptosis and cell signaling. Unfavorable excessive peroxidase activity is implicated in oxidative damage of cells and tissues, thereby initiating the variety of human diseases. Hence, regulation of peroxidase activity is of considerable importance. Since peroxidases differ in structure, properties and location, the mechanisms controlling peroxidase activity and the biological effects of peroxidase products are specific for each hemoprotein.
    [Show full text]
  • Omalizumab Restores Response to Corticosteroids in Patients with Eosinophilic Chronic Rhinosinusitis and Severe Asthma
    biomedicines Article Omalizumab Restores Response to Corticosteroids in Patients with Eosinophilic Chronic Rhinosinusitis and Severe Asthma Yoshiki Kobayashi 1,2,* , Akira Kanda 1,2 , Dan Van Bui 1, Yasutaka Yun 1 , Linh Manh Nguyen 1, Hanh Hong Chu 1, Akitoshi Mitani 1, Kensuke Suzuki 1 , Mikiya Asako 1,2 and Hiroshi Iwai 1 1 Airway Disease Section, Department of Otorhinolaryngology, Kansai Medical University, Hirakata, Osaka 573-1010, Japan; [email protected] (A.K.); [email protected] (D.V.B.); [email protected] (Y.Y.); [email protected] (L.M.N.); [email protected] (H.H.C.); [email protected] (A.M.); [email protected] (K.S.); [email protected] (M.A.); [email protected] (H.I.) 2 Allergy Center, Kansai Medical University Hospital, Hirakata, Osaka 573-1010, Japan * Correspondence: [email protected]; Tel.: +81-72-804-2463 Abstract: Eosinophilic chronic rhinosinusitis (ECRS), which is a subgroup of chronic rhinosinusitis with nasal polyps, is characterized by eosinophilic airway inflammation extending across both the upper and lower airways. Some severe cases are refractory even after endoscopic sinus surgery, likely because of local steroid insensitivity. Although real-life studies indicate that treatment with omalizumab for severe allergic asthma improves the outcome of coexistent ECRS, the underlying mechanisms of omalizumab in eosinophilic airway inflammation have not been fully elucidated. Twenty-five patients with ECRS and severe asthma who were refractory to conventional treatments Citation: Kobayashi, Y.; Kanda, A.; and who received omalizumab were evaluated.
    [Show full text]
  • Leukocyte Myeloperoxidase Deficiency and Disseminated Candidiasis: the Role of Myeloperoxidase in Resistance to Candida Infection
    Leukocyte myeloperoxidase deficiency and disseminated candidiasis: the role of myeloperoxidase in resistance to Candida infection Robert I. Lehrer, Martin J. Cline J Clin Invest. 1969;48(8):1478-1488. https://doi.org/10.1172/JCI106114. Research Article The neutrophils and monocytes of a patient with disseminated candidiasis were found to lack detectable levels of the lysosomal enzyme myeloperoxidase (MPO), although they had normal levels of other granule-associated enzymes. Leukocytes from one of the patient's sisters also lacked detectable MPO; leukocytes from his four sons contained approximately one-third of mean normal peroxidase levels. Neither the patient nor his affected relatives had experienced frequent or unusual bacterial infections. The phagocytic activity of the patient's MPO-deficient neutrophils was intact, and the cells displayed normal morphologic and metabolic responses to phagocytosis. In contrast to normal leukocytes which killed 30.5±7.3% of ingested Candida albicans in 1 hr, however, the patient's neutrophils killed virtually none. His leukocytes also failed to kill the strain oCf . albicans recovered from his lesions, as well as other Candida species. These MPO-deficient neutrophils killed Serratia marcescens and Staphylococens aureus 502A at an abnormally slow rate, requiring 3-4 hr to achieve the bactericidal effect attained by normal leukocytes after 45 min. No other abnormalities in his cellular or humoral immune responses were demonstrated. These findings suggest that hereditary MPO deficiency is transmitted as an autosomal recessive characteristic, that the homozygous state conveys enhanced susceptibility to disseminated candidiasis, and that MPO is necessary for candidacidal activity in human neutrophils. Although lending support to the suggested bactericidal role of MPO […] Find the latest version: https://jci.me/106114/pdf Leukocyte Myeloperoxidase Deficiency and Disseminated Candidiasis: the Role of Myeloperoxidase in Resistance to Candida Infection ROBERT I.
    [Show full text]
  • Supplementary Materials: Chronic Low Dose Oral Exposure to Microcystin-LR Exacerbates Hepatic Injury in a Murine Model of Non-Alcoholic Fatty Liver Disease
    Toxins 2019, 11, 486; doi: 10.3390/toxins11090486 S1 of S23 Supplementary materials: Chronic Low Dose Oral Exposure to Microcystin-LR Exacerbates Hepatic Injury in a Murine Model of Non-Alcoholic Fatty Liver Disease Apurva Lad, Robin C. Su, Joshua D. Breidenbach, Paul M. Stemmer, Nicholas J. Carruthers, Nayeli K. Sanchez, Fatimah K. Khalaf MBChB, Shungang Zhang, Andrew L. Kleinhenz, Prabhatchandra Dube, Chrysan J. Mohammed, Judy A. Westrick, Erin L. Crawford, Dilrukshika Palagama, David Baliu-Rodriguez, Dragan Isailovic, Bruce Levison, Nikolai Modyanov, Amira F. Gohara, Deepak Malhotra, Steven T. Haller and David J. Kennedy Figure S1. Effect of MC-LR on survival and gross liver morphology in both healthy (C57Bl/6J) and NAFLD (Leprdb/J) mice. (A) Kaplan-Meier analysis of the survival period of the C57Bl/6J (WT) and LepRdb/J (db) Toxins 2019, 11, 486; doi: 10.3390/toxins11090486 S2 of S23 mice showed a non-significant (log-rank p = 0.0702) decrease in survival in mice receiving 50 μg/kg (n = 17, 94% survival) and 100 μg/kg MC-LR (n = 17, 82% survival) versus db/Vehicle (n = 15) (100% survival), no deaths were observed in the WT/Vehicle (n = 5) or WT/100 μg/kg MC-LR exposure (n = 5) C57Bl/6J mice; Representative images showing the gross morphology of the livers of Leprdb/J mice that were exposed to (B) Vehicle; (C) 50 μg/kg MC-LR or (D) 100 μg/kg MC-LR. In each case the animals died overnight and there was no observed acute trauma (e.g. tracheal rupture resulting in immediate death) or other signs of improper gavage technique such as visible signs of discomfort or bloating in the time preceding death.
    [Show full text]
  • Biochemical and Pathological Studies on Peroxidases –An Updated Review
    Global Journal of Health Science; Vol. 6, No. 5; 2014 ISSN 1916-9736 E-ISSN 1916-9744 Published by Canadian Center of Science and Education Biochemical and Pathological Studies on Peroxidases –An Updated Review Amjad A. Khan1, Arshad H. Rahmani2, Yousef H. Aldebasi3 & Salah M. Aly2,4 1 Department of Basic Health Sciences, College of Applied Medical Science, Qassim University, Qassim, Buraidah, Saudi Arabia 2 Department of Medical Laboratories, College of Applied Medical Science, Qassim University, Qassim, Buraidah, Saudi Arabia 3 Department of Optometry College of Applied Medical Science, Qassim University, Qassim, Buraidah, Saudi Arabia 4 Department of Pathology, Faculty of Veterinary Medicine, Suez Canal University, Ismalia, Egypt Correspondence: Amjad Ali Khan, Department of Basic Health Sciences, College of Applied Medical Sciences, Qassim University, Qassim, Kingdom of Saudi Arabia. Tel: 966-16-380-1266, Fax: 966-16-380-1628. E-mail: [email protected], [email protected] Received: April 4, 2014 Accepted: April 27, 2014 Online Published: May 13, 2014 doi:10.5539/gjhs.v6n5p87 URL: http://dx.doi.org/10.5539/gjhs.v6n5p87 Abstract Peroxidases represent a family of isoenzymes actively involved in oxidizing reactive oxygen species, innate immunity, hormone biosynthesis and pathogenesis of several diseases. Different types of peroxidases have organ, tissues, cellular and sub-cellular level of specificities in their function. Different diseases lead to varied expressions of peroxidases based on several mechanisms proposed. Several researches are going on to understand its deficiency, over-expression and malfunction in relation with different diseases. Some common diseases of mankind like cancer, cardiovascular diseases and diabetes directly or indirectly involve the role of peroxidases.
    [Show full text]