Eosinophil Peroxidase Deficiency
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Independent Evolution of Four Heme Peroxidase Superfamilies
Archives of Biochemistry and Biophysics xxx (2015) xxx–xxx Contents lists available at ScienceDirect Archives of Biochemistry and Biophysics journal homepage: www.elsevier.com/locate/yabbi Independent evolution of four heme peroxidase superfamilies ⇑ Marcel Zámocky´ a,b, , Stefan Hofbauer a,c, Irene Schaffner a, Bernhard Gasselhuber a, Andrea Nicolussi a, Monika Soudi a, Katharina F. Pirker a, Paul G. Furtmüller a, Christian Obinger a a Department of Chemistry, Division of Biochemistry, VIBT – Vienna Institute of BioTechnology, University of Natural Resources and Life Sciences, Muthgasse 18, A-1190 Vienna, Austria b Institute of Molecular Biology, Slovak Academy of Sciences, Dúbravská cesta 21, SK-84551 Bratislava, Slovakia c Department for Structural and Computational Biology, Max F. Perutz Laboratories, University of Vienna, A-1030 Vienna, Austria article info abstract Article history: Four heme peroxidase superfamilies (peroxidase–catalase, peroxidase–cyclooxygenase, peroxidase–chlo- Received 26 November 2014 rite dismutase and peroxidase–peroxygenase superfamily) arose independently during evolution, which and in revised form 23 December 2014 differ in overall fold, active site architecture and enzymatic activities. The redox cofactor is heme b or Available online xxxx posttranslationally modified heme that is ligated by either histidine or cysteine. Heme peroxidases are found in all kingdoms of life and typically catalyze the one- and two-electron oxidation of a myriad of Keywords: organic and inorganic substrates. In addition to this peroxidatic activity distinct (sub)families show pro- Heme peroxidase nounced catalase, cyclooxygenase, chlorite dismutase or peroxygenase activities. Here we describe the Peroxidase–catalase superfamily phylogeny of these four superfamilies and present the most important sequence signatures and active Peroxidase–cyclooxygenase superfamily Peroxidase–chlorite dismutase superfamily site architectures. -
SUPPLEMENTARY DATA Supplementary Figure 1. The
SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary -
GRAS Notice 665, Lactoperoxidase System
GRAS Notice (GRN) No. 665 http://www.fda.gov/Food/IngredientsPackagingLabeling/GRAS/NoticeInventory/default.htm ORIGINAL SUBMISSION 000001 Mo•·gan Lewis Gf<N Ob()&h5 [R1~~~~~~[Q) Gary L. Yingling Senior Counsel JUL 1 8 2016 + 1.202. 739 .5610 gary.yingling@morganlewis .com OFFICE OF FOO~ ADDITIVE SAFETY July 15, 2016 VIA FEDERAL EXPRESS Dr. Antonia Mattia Director Division of Biotechnology and GRAS Notice Review Office of Food Additive Safety (HFS-200) Center for Food Safety and Applied Nutrition Food and Drug Administration 5100 Paint Branch Parkway College Park, MD 20740-3835 Re: GRAS Notification for the Lactoperoxidase System Dear Dr. Mattia: On behalf of Taradon Laboratory C'Taradon"), we are submitting under cover of this letter three paper copies and one eCopy of DSM's generally recognized as safe ("GRAS'') notification for its lactoperoxidase system (''LPS''). The electronic copy is provided on a virus-free CD, and is an exact copy of the paper submission. Taradon has determined through scientific procedures that its lactoperoxidase system preparation is GRAS for use as a microbial control adjunct to standard dairy processing procedures such as maintaining appropriate temperatures, pasteurization, or other antimicrobial treatments to extend the shelf life of the products. In many parts of the world, the LPS has been used to protect dairy products, particularly in remote areas where farmers are not in close proximity to the market. In the US, the LPS is intended to be used as a processing aid to extend the shelf life of avariety of dairy products, specifically fresh cheese including mozzarella and cottage cheeses, frozen dairy desserts, fermented milk, flavored milk drinks, and yogurt. -
Genomic Evidence of Reactive Oxygen Species Elevation in Papillary Thyroid Carcinoma with Hashimoto Thyroiditis
Endocrine Journal 2015, 62 (10), 857-877 Original Genomic evidence of reactive oxygen species elevation in papillary thyroid carcinoma with Hashimoto thyroiditis Jin Wook Yi1), 2), Ji Yeon Park1), Ji-Youn Sung1), 3), Sang Hyuk Kwak1), 4), Jihan Yu1), 5), Ji Hyun Chang1), 6), Jo-Heon Kim1), 7), Sang Yun Ha1), 8), Eun Kyung Paik1), 9), Woo Seung Lee1), Su-Jin Kim2), Kyu Eun Lee2)* and Ju Han Kim1)* 1) Division of Biomedical Informatics, Seoul National University College of Medicine, Seoul, Korea 2) Department of Surgery, Seoul National University Hospital and College of Medicine, Seoul, Korea 3) Department of Pathology, Kyung Hee University Hospital, Kyung Hee University School of Medicine, Seoul, Korea 4) Kwak Clinic, Okcheon-gun, Chungbuk, Korea 5) Department of Internal Medicine, Uijeongbu St. Mary’s Hospital, Uijeongbu, Korea 6) Department of Radiation Oncology, Seoul St. Mary’s Hospital, Seoul, Korea 7) Department of Pathology, Chonnam National University Hospital, Kwang-Ju, Korea 8) Department of Pathology, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea 9) Department of Radiation Oncology, Korea Cancer Center Hospital, Korea Institute of Radiological and Medical Sciences, Seoul, Korea Abstract. Elevated levels of reactive oxygen species (ROS) have been proposed as a risk factor for the development of papillary thyroid carcinoma (PTC) in patients with Hashimoto thyroiditis (HT). However, it has yet to be proven that the total levels of ROS are sufficiently increased to contribute to carcinogenesis. We hypothesized that if the ROS levels were increased in HT, ROS-related genes would also be differently expressed in PTC with HT. To find differentially expressed genes (DEGs) we analyzed data from the Cancer Genomic Atlas, gene expression data from RNA sequencing: 33 from normal thyroid tissue, 232 from PTC without HT, and 60 from PTC with HT. -
Peroxidasin-Mediated Bromine Enrichment of Basement Membranes
Peroxidasin-mediated bromine enrichment of basement membranes Cuiwen Hea,1, Wenxin Songa,1, Thomas A. Westona, Caitlyn Trana, Ira Kurtza, Jonathan E. Zuckermanb, Paul Guagliardoc, Jeffrey H. Minerd, Sergey V. Ivanove,f, Jeremy Bougourec, Billy G. Hudsone,f,g,h, Selene Colone,f,h,i, Paul A. Voziyane,f, Gautam Bhavee,f,i,j, Loren G. Fonga, Stephen G. Younga,k,2,3, and Haibo Jiangl,m,2,3 aDepartment of Medicine, University of California, Los Angeles, CA 90095; bDepartment of Pathology and Laboratory Medicine, University of California, Los Angeles, CA 90095; cCentre for Microscopy, Characterisation and Analysis, University of Western Australia, 6009 Perth, Australia; dDivision of Nephrology, Washington University School of Medicine, St. Louis, MO 63110; eVanderbilt Center for Matrix Biology, Vanderbilt University Medical Center, Nashville, TN 37212; fDivision of Nephrology, Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232; gVanderbilt Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232; hVanderbilt Institute of Chemical Biology, Vanderbilt University, Nashville, TN 37232; iDepartment of Cell and Developmental Biology, Vanderbilt University, Nashville, TN 37212; jCenter for Kidney Disease, Vanderbilt University Medical Center, Nashville, TN 37232; kDepartment of Human Genetics, University of California, Los Angeles, CA 90095; lSchool of Molecular Sciences, University of Western Australia, 6009 Perth, Australia; and mDepartment of Chemistry, The University of Hong Kong, Hong Kong, China Contributed by Stephen G. Young, May 25, 2020 (sent for review April 22, 2020; reviewed by Douglas Gould and Martin R. Pollak) Bromine and peroxidasin (an extracellular peroxidase) are essen- methionine and a spatially adjacent hydroxylysine residue (lysine- tial for generating sulfilimine cross-links between a methionine 1689) in a partner collagen IV trimer (1, 4). -
Kinetics of Interconversion of Redox Intermediates of Lactoperoxidase
Jpn. J. Infect. Dis., 57, 2004 Kinetics of Interconversion of Redox Intermediates of Lactoperoxidase, Eosinophil Peroxidase and Myeloperoxidase Paul Georg Furtmüller, Walter Jantschko, Martina Zederbauer, Christa Jakopitsch, Jürgen Arnhold1 and Christian Obinger* Metalloprotein Research Group, Division of Biochemistry, Department of Chemistry, BOKU-University of Natural Resources and Applied Life Sciences, 1Institute of Medical Physics and Biophysics, School of Medicine, University of Leipzig, Leipzig, Germany SUMMARY: Myeloperoxidase, eosinophil peroxidase and lactoperoxidase are heme-containing oxidoreductases, which undergo a series of redox reactions. Though sharing functional and structural homology, reflecting their phylogenetic origin, differences are observed regarding their spectral features, substrate specificities, redox properties and kinetics of interconversion of the relevant redox intermediates ferric and ferrous peroxidase, compound I, compound II and compound III. Depending on substrate availability, these heme enzymes path through the halogenation cycle and/or the peroxidase cycle and/or act as poor (pseudo-) catalases. Today - based on sequence homologies, tertiary structure and the halide ions is the following: I– > Br– > Cl–. All peroxidases can nature of the heme group - two heme peroxidase superfamilies are oxidize iodide. At neutral pH, only MPO is capable to oxidize distinguished, namely the superfamily containing enzymes from chloride at a reasonable rate (4), and it is assumed that chloride and archaea, bacteria, fungi and plants (1) and the superfamily of thiocyanate are competing substrates in vivo. EPO can oxidize mammalian enzymes (2), which contains myeloperoxidase (MPO), chloride only at acidic pH (5), and at normal plasma concentrations, eosinophil peroxidase (EPO), lactoperoxidase (LPO) and thyroid bromide and thiocyanate function as substrates, whereas for LPO peroxidase (TPO). -
Activation of Human Eosinophils in Vitro by Respiratory Syncytial Virus'
0031-3998/92/3202-0160$03.00/0 PEDIATRIC RESEARCH Vol. 32, No.2, 1992 Copyright © 1992 International Pediatric Research Foundation, Inc. Printed in U.S.A. Activation of Human Eosinophils In Vitro by Respiratory Syncytial Virus' JAN L. L. KIMPEN, ROBERTO GAROFALO,2 ROBERT C. WELLIVER, AND PEARAY L. OGRA2 School ofMedicine, State University ofNew York at Buffalo, Departments ofPediatrics and Microbiology, and Division ofInfectious Diseases, The Children's Hospital, Buffalo, New York 14222 ABSTRACT. To determine the nature of the interaction RSV is the leading cause of pneumonia and bronchiolitis between viruses and eosinophils, normodense eosinophils during infancy (1). It has been speculated that RSV infection in were separated from the blood of healthy volunteers and infancy plays a role in the development of hyperreactive airway incubated in vitro with respiratory syncytial virus (RSV). disease in later life (2). The pathogenesis ofthe inflammation of After incubation for 2 h with the virus, 29.5 ± 15.8% of the airways during acute RSV infection and the mechanisms the eosinophils demonstrated specific binding of the virus underlying the possible development of subsequent airway hy to the cell membrane, as detected by fluorescent staining perreactivityare not completely understood. with an anti-RSV MAb. Superoxide production and leu Recent evidence suggests an important role for eosinophils in kotriene C4 release were measured as determinants of cell a variety of inflammatory states (3). Although the role of eosin activation. Using a cytochrome c reduction assay, super ophils in natural RSV infection is unclear, reports offield studies oxide could be detected in the supernatant 30 min after with a formalin-inactivated RSV vaccine carried out in the late exposure to RSV. -
Peroxidase Activity of Human Hemoproteins: Keeping the Fire Under Control
molecules Review Peroxidase Activity of Human Hemoproteins: Keeping the Fire under Control Irina I. Vlasova 1,2 1 Federal Research and Clinical Center of Physical-Chemical Medicine, Department of Biophysics, Malaya Pirogovskaya, 1a, Moscow 119435, Russia; [email protected]; Tel./Fax: +7-985-771-1657 2 Institute for Regenerative Medicine, Laboratory of Navigational Redox Lipidomics, Sechenov University, 8-2 Trubetskaya St., Moscow 119991, Russia Received: 28 August 2018; Accepted: 1 October 2018; Published: 8 October 2018 Abstract: The heme in the active center of peroxidases reacts with hydrogen peroxide to form highly reactive intermediates, which then oxidize simple substances called peroxidase substrates. Human peroxidases can be divided into two groups: (1) True peroxidases are enzymes whose main function is to generate free radicals in the peroxidase cycle and (pseudo)hypohalous acids in the halogenation cycle. The major true peroxidases are myeloperoxidase, eosinophil peroxidase and lactoperoxidase. (2) Pseudo-peroxidases perform various important functions in the body, but under the influence of external conditions they can display peroxidase-like activity. As oxidative intermediates, these peroxidases produce not only active heme compounds, but also protein-based tyrosyl radicals. Hemoglobin, myoglobin, cytochrome c/cardiolipin complexes and cytoglobin are considered as pseudo-peroxidases. Peroxidases play an important role in innate immunity and in a number of physiologically important processes like apoptosis and cell signaling. Unfavorable excessive peroxidase activity is implicated in oxidative damage of cells and tissues, thereby initiating the variety of human diseases. Hence, regulation of peroxidase activity is of considerable importance. Since peroxidases differ in structure, properties and location, the mechanisms controlling peroxidase activity and the biological effects of peroxidase products are specific for each hemoprotein. -
Omalizumab Restores Response to Corticosteroids in Patients with Eosinophilic Chronic Rhinosinusitis and Severe Asthma
biomedicines Article Omalizumab Restores Response to Corticosteroids in Patients with Eosinophilic Chronic Rhinosinusitis and Severe Asthma Yoshiki Kobayashi 1,2,* , Akira Kanda 1,2 , Dan Van Bui 1, Yasutaka Yun 1 , Linh Manh Nguyen 1, Hanh Hong Chu 1, Akitoshi Mitani 1, Kensuke Suzuki 1 , Mikiya Asako 1,2 and Hiroshi Iwai 1 1 Airway Disease Section, Department of Otorhinolaryngology, Kansai Medical University, Hirakata, Osaka 573-1010, Japan; [email protected] (A.K.); [email protected] (D.V.B.); [email protected] (Y.Y.); [email protected] (L.M.N.); [email protected] (H.H.C.); [email protected] (A.M.); [email protected] (K.S.); [email protected] (M.A.); [email protected] (H.I.) 2 Allergy Center, Kansai Medical University Hospital, Hirakata, Osaka 573-1010, Japan * Correspondence: [email protected]; Tel.: +81-72-804-2463 Abstract: Eosinophilic chronic rhinosinusitis (ECRS), which is a subgroup of chronic rhinosinusitis with nasal polyps, is characterized by eosinophilic airway inflammation extending across both the upper and lower airways. Some severe cases are refractory even after endoscopic sinus surgery, likely because of local steroid insensitivity. Although real-life studies indicate that treatment with omalizumab for severe allergic asthma improves the outcome of coexistent ECRS, the underlying mechanisms of omalizumab in eosinophilic airway inflammation have not been fully elucidated. Twenty-five patients with ECRS and severe asthma who were refractory to conventional treatments Citation: Kobayashi, Y.; Kanda, A.; and who received omalizumab were evaluated. -
Leukocyte Myeloperoxidase Deficiency and Disseminated Candidiasis: the Role of Myeloperoxidase in Resistance to Candida Infection
Leukocyte myeloperoxidase deficiency and disseminated candidiasis: the role of myeloperoxidase in resistance to Candida infection Robert I. Lehrer, Martin J. Cline J Clin Invest. 1969;48(8):1478-1488. https://doi.org/10.1172/JCI106114. Research Article The neutrophils and monocytes of a patient with disseminated candidiasis were found to lack detectable levels of the lysosomal enzyme myeloperoxidase (MPO), although they had normal levels of other granule-associated enzymes. Leukocytes from one of the patient's sisters also lacked detectable MPO; leukocytes from his four sons contained approximately one-third of mean normal peroxidase levels. Neither the patient nor his affected relatives had experienced frequent or unusual bacterial infections. The phagocytic activity of the patient's MPO-deficient neutrophils was intact, and the cells displayed normal morphologic and metabolic responses to phagocytosis. In contrast to normal leukocytes which killed 30.5±7.3% of ingested Candida albicans in 1 hr, however, the patient's neutrophils killed virtually none. His leukocytes also failed to kill the strain oCf . albicans recovered from his lesions, as well as other Candida species. These MPO-deficient neutrophils killed Serratia marcescens and Staphylococens aureus 502A at an abnormally slow rate, requiring 3-4 hr to achieve the bactericidal effect attained by normal leukocytes after 45 min. No other abnormalities in his cellular or humoral immune responses were demonstrated. These findings suggest that hereditary MPO deficiency is transmitted as an autosomal recessive characteristic, that the homozygous state conveys enhanced susceptibility to disseminated candidiasis, and that MPO is necessary for candidacidal activity in human neutrophils. Although lending support to the suggested bactericidal role of MPO […] Find the latest version: https://jci.me/106114/pdf Leukocyte Myeloperoxidase Deficiency and Disseminated Candidiasis: the Role of Myeloperoxidase in Resistance to Candida Infection ROBERT I. -
Supplementary Materials: Chronic Low Dose Oral Exposure to Microcystin-LR Exacerbates Hepatic Injury in a Murine Model of Non-Alcoholic Fatty Liver Disease
Toxins 2019, 11, 486; doi: 10.3390/toxins11090486 S1 of S23 Supplementary materials: Chronic Low Dose Oral Exposure to Microcystin-LR Exacerbates Hepatic Injury in a Murine Model of Non-Alcoholic Fatty Liver Disease Apurva Lad, Robin C. Su, Joshua D. Breidenbach, Paul M. Stemmer, Nicholas J. Carruthers, Nayeli K. Sanchez, Fatimah K. Khalaf MBChB, Shungang Zhang, Andrew L. Kleinhenz, Prabhatchandra Dube, Chrysan J. Mohammed, Judy A. Westrick, Erin L. Crawford, Dilrukshika Palagama, David Baliu-Rodriguez, Dragan Isailovic, Bruce Levison, Nikolai Modyanov, Amira F. Gohara, Deepak Malhotra, Steven T. Haller and David J. Kennedy Figure S1. Effect of MC-LR on survival and gross liver morphology in both healthy (C57Bl/6J) and NAFLD (Leprdb/J) mice. (A) Kaplan-Meier analysis of the survival period of the C57Bl/6J (WT) and LepRdb/J (db) Toxins 2019, 11, 486; doi: 10.3390/toxins11090486 S2 of S23 mice showed a non-significant (log-rank p = 0.0702) decrease in survival in mice receiving 50 μg/kg (n = 17, 94% survival) and 100 μg/kg MC-LR (n = 17, 82% survival) versus db/Vehicle (n = 15) (100% survival), no deaths were observed in the WT/Vehicle (n = 5) or WT/100 μg/kg MC-LR exposure (n = 5) C57Bl/6J mice; Representative images showing the gross morphology of the livers of Leprdb/J mice that were exposed to (B) Vehicle; (C) 50 μg/kg MC-LR or (D) 100 μg/kg MC-LR. In each case the animals died overnight and there was no observed acute trauma (e.g. tracheal rupture resulting in immediate death) or other signs of improper gavage technique such as visible signs of discomfort or bloating in the time preceding death. -
Biochemical and Pathological Studies on Peroxidases –An Updated Review
Global Journal of Health Science; Vol. 6, No. 5; 2014 ISSN 1916-9736 E-ISSN 1916-9744 Published by Canadian Center of Science and Education Biochemical and Pathological Studies on Peroxidases –An Updated Review Amjad A. Khan1, Arshad H. Rahmani2, Yousef H. Aldebasi3 & Salah M. Aly2,4 1 Department of Basic Health Sciences, College of Applied Medical Science, Qassim University, Qassim, Buraidah, Saudi Arabia 2 Department of Medical Laboratories, College of Applied Medical Science, Qassim University, Qassim, Buraidah, Saudi Arabia 3 Department of Optometry College of Applied Medical Science, Qassim University, Qassim, Buraidah, Saudi Arabia 4 Department of Pathology, Faculty of Veterinary Medicine, Suez Canal University, Ismalia, Egypt Correspondence: Amjad Ali Khan, Department of Basic Health Sciences, College of Applied Medical Sciences, Qassim University, Qassim, Kingdom of Saudi Arabia. Tel: 966-16-380-1266, Fax: 966-16-380-1628. E-mail: [email protected], [email protected] Received: April 4, 2014 Accepted: April 27, 2014 Online Published: May 13, 2014 doi:10.5539/gjhs.v6n5p87 URL: http://dx.doi.org/10.5539/gjhs.v6n5p87 Abstract Peroxidases represent a family of isoenzymes actively involved in oxidizing reactive oxygen species, innate immunity, hormone biosynthesis and pathogenesis of several diseases. Different types of peroxidases have organ, tissues, cellular and sub-cellular level of specificities in their function. Different diseases lead to varied expressions of peroxidases based on several mechanisms proposed. Several researches are going on to understand its deficiency, over-expression and malfunction in relation with different diseases. Some common diseases of mankind like cancer, cardiovascular diseases and diabetes directly or indirectly involve the role of peroxidases.