Supporting Information

Total Page:16

File Type:pdf, Size:1020Kb

Supporting Information Supporting Information Gruhne et al. 10.1073/pnas.0810619106 SI Materials and Methods detected by immunofluorescence. Cells (3 ϫ 104)in100␮L PBS Cell Lines. Details of the cell lines used in this study are shown in were deposited on glass slides by cytospin centrifugation and fixed Table S3. All cell lines were maintained in RPMI 1640 supple- in fresh 4% formaldehyde (Merck), pH 8, for 10 min. The slides mented with penicillin (100 U/mL), streptomycin (0.1 mg/mL), were then stained overnight at 4°C with anti-pH2AX (Upstate) or FCS (10%), and glutamine (2 mM) (all from Sigma–Aldrich) with anti-ATM (Novus Biologicals) and developed with goat anti- (complete medium). The stable EBNA-1 transfected BJAB-E1 rabbit or goat antimouse IgG Alexa Fluor 488 (Molecular Probes, cell line was kept in complete medium supplemented with 2 Invitrogen). Digital images were captured using a LEITZ-BMRB mg/mL Geneticin (Gibco). A BJAB subline that stably expresses fluorescence microscope (Leica) equipped with a CCD camera a tetracycline-regulated EBNA-1 gene (BJAB-tTAE1) was pro- (Hamamatsu Photonics) and analyzed with Photoshop software duced by transfection of the pTRE2pur-FlagEBNA-1 plasmid (Adobe Systems). into the BJAB-tTA cell line that carries a tet-off–regulated transactivator (kind gift of Martin Rowe, University of Birming- Detection of Reactive Oxygen Species. Reactive oxygen species ham, United Kingdom) followed by selection in 1 mg/mL were detected by staining with DCFDA (Invitrogen), a cell- puromycin and 500 mg/mL hygromycin B (Calbiochem). The permeable indicator that becomes fluorescent when its acetate pTRE2pur-FlagEBNA-1 plasmid was produced by cloning the group is removed by intracellular oxidases. Cells (75 ϫ 104) were FlagEBNA-1 ORF excised as a HindIII-NotI fragment from labeled for 45 min with 2 ␮M DCFDA in PBS and then incubated pCDNA3-FlagEBNA-1 vector into the same sites of pTRE2 overnight at 4°C. Fluorescence was analyzed using a FACScali- shuttle vector. An EcoRV-NotI fragment was then cloned into bur cytometer (Becton-Dickinson) with excitation at 488 nm and the PvuII-NotI sites of pTRE2pur vector (Clontech) to produce emission at 533 nm and recorded in FL-1. Ten thousand events the puromycin-selectable pTRE2pur-FlagEBNA-1 plasmid. In- were scored for each sample. The values of fluorescence inten- ducible expression of EBNA-1 was determined by culture in the sity were converted to the molecule equivalent of fluorescence presence or absence of 2 ␮g/mL tetracycline (Sigma-Aldrich). (MEFL) using Shero rainbow calibration particles (BD Bio- EBNA-1 was detected by SDS-PAGE and Western blots using sciences). The results were expressed as MEFL. Where indicated the specific mouse monoclonal antibody OT1X (gift of Jaap the cells were pretreated overnight with 3.5 mM ebselen (Alexis Middeldorp, Vrije Universiteit, Amsterdam, The Netherlands). Biochemicals), a glutathione peroxidase mimetic that scavenges TWO3, HeLa, and HEK293 cell lines were transfected with ROS, or with 1 mM citric acid (Sigma-Aldrich). pCDNA3-FlagEBNA1 using the jetPEI (Polyplus-transfection) reagent according to the manufacturer’s instructions. The EBV- Analysis of EBV-Regulated Genes. Twenty-four microarray gene negative BL cell line DG75 was transfected using the nucleo- expression datasets from 18 EBV-negative and -carrying Burkitt’s fection protocol according to the manufacturer’s instructions lymphoma lines and EBV-transformed lymphoblastoid cells lines (program K25; Amaxa Biosystems). The expression of NOX2 was (Table S2) were extracted from the gene expression profiles of 336 examined 48 h later by Western blotting. human B cell phenotypes representative of a wide selection of normal, transformed, and experimentally manipulated B cells Scoring of Chromosomal Abnormalities. Rapidly growing cells were (PubMed ID: 15778709; National Center for Biotechnology Infor- treated with 30 ng/mL colcemide (KaryoMAX; Invitrogen) for mation Gene Expression Omnibus: GSE2350). The Affymetrix 90 min to induce metaphase arrest, washed in hypotonic buffer GeneChip HG-U95Av2 array including Ϸ10,000 human genes was containing 75 mM KCl (Sigma-Aldrich), fixed, dropped onto used in this analysis. One hundred thirty-four genes involved in cold glass slides, and mounted in DAPI containing Vectashield ROS metabolism (Table S1) were identified according to their (Vector Laboratories). Digital images were captured using a annotation in the Gene Ontology database. One hundred twenty- LEITZ-BMRB fluorescence microscope (Leica) equipped with one probe sets corresponding to 103 of the 134 genes were present a CCD camera (Hamamatsu Photonics) and analyzed using in the HG-U95Av2 array. Significance analysis of microarray Photoshop software (Adobe Systems). Fifty metaphases for each (SAM) was used to identify genes that are differentially regulated cell lines were examined for the presence of dicentric chromo- in EBV-positive compared with EBV-negative cells. SAM calcu- somes, chromosome fragments, rings, chromosome gaps, and lates a ␦ value for each probe set that represents the significance of double minutes. the observed differential gene expression. The differential regula- tion of 4 genes showing a cut-off ␦ value Ն2 was validated by Detection of DNA Double-Strand Breaks and DNA Damage Response. RT-PCR, and NOX2 protein expression was detected by Western Double-strand DNA breaks were detected by the comet assays as blots. Expression of regulated genes was investigated by RT-PCR. described by Blasiak et al. (1) with minor modifications. Briefly, 105 RNA was isolated from 4 ϫ 106 cells by lysis in 0.5 ml TRIzol cells were resuspended in 37°C warm 1% low-melting agarose and (Invitrogen), followed by incubation on ice for 5 min. After adding then dropped onto a slide coated with 1% agarose. The drops were 0.1 mL chloroform (Merck), cell debris were spun down for 5 min covered with a small coverslip and incubated at 4°C until solidified. at 14,200 ϫ g, and the water phase was mixed with 0.25 mL The slides were then incubated in lysis buffer (2.5 M NaCl, 100 mM isopropanol (Sigma-Aldrich) and spun down again for 10 min at EDTA, 10 mM Tris⅐HCl, 0.5% Triton-X-100, and 10% DMSO; pH 14,200 ϫ g. The pellet was washed with 70% ethanol and resus- 9.5)foratleast1hat4°Candthensoaked in electrophoresis buffer pended in ddH2O. To produce cDNA, 3 ␮g RNA was mixed with (300 mM sodium acetate and 100 mM Tris⅐HCl; pH 8.5). Electro- ddH2O and oligo-dT (0.05 mg/mL; Invitrogen), boiled for 10 min phoresis was carried out for 25 min at 25 V in a horizontal chamber at 70°C, and cooled on ice for 5 min, and then 5ϫ First Strand buffer kept at 4°C. Thereafter slides were washed 3 times in neutralization (250mM Tris-HCi pH 8.3, 375mM KCi, 15mM MgCl2), 200 nM buffer (0.4 M Tris, pH 7.5) and stained with DAPI (Vectashield; DTT, 1 mM dNTPs, 100 U MNLV-RT, and 10 U RNase (all from Vector Laboratories). Images were taken using a Nikon Eclipse Invitrogen) was added. The mixture was incubated for1hat37°C. TE300, and comet length was analyzed using Comet Score 1.5 Two microliters of DNA was mixed with the primers (GAPDH: software (Tritec). Activated ATM and phosphorylated H2AX were CAT CAC CAT CTT CCA GGA GC, GAG TCC TTC CAC GAT Gruhne et al. www.pnas.org/cgi/content/short/0810619106 1of13 ACC; NOX2: forward: ATC CAT GGA GCT GAA CGA TTG, Mission shRNA NOX2 transduction particles; Invitrogen) and reverse: CTC TGT CCA GTC CCC AAC GAT; GPX1: forward: nontarget shRNA (Mission nontarget shRNA control transduction GAA CGC CAA GAA CGA AGA GAT T, reverse: GCA TGA particles; Invitrogen) were used for transduction of 2.5 ϫ 105 AGT TGG GCT CGA A; ACOX1, forward: CTC ACT CGC AGC BJAB-E1 cells at 2.7, 2.9, and 9.6 transfection units per milliliter, CAG CGT TA, reverse: ATT GAG GCC CAC AGG TTC CCA), respectively, and NOX2 expression was assayed after 48 h by 10ϫ PCR RXA buffer, 50 nM MgCl, 1 mM dNTPs (all from Western blots. Invitrogen), and 1 U Taq Polymerase (New England BioLabs). The GAPDH PCR was run for 21 cycles at 55°C annealing temperature, Western Blotting. Total cell lysates were prepared in lithium do- NOX2 for 31 cycles at 65°C annealing temperature, GPX1 for 28 decyl sulfate (LDS) sample buffer, fractionated in precast 4%–12% cycles at 61°C annealing temperature, and ACOX1 for 29 cycles at SDS-PAGE gradient gels (Invitrogen), and transferred to PVDF 57°C annealing temperature. The products were resolved on a 1% membranes (Millipore). The blots were probed with anti-EBNA1 agarose gel for 15 min at 80 V. (OT1X, given by Y. Middeldorp, Vrije Universiteit, Amsterdam, The Netherlands), ␤-actin (AC-15, 1:2,000; Sigma-Aldrich), rabbit phox NOX2 Promoter Activity. A firefly luciferase reporter plasmid was serum anti-Nox2 (1:200; White Label), rabbit serum anti p22 (FL-195; Santa Cruz Biotechnology), rabbit serum anti-p47phox constructed by cloning a PCR fragment corresponding to nucleo- phox tide Ϫ533 to ϩ6 of the human NOX2 gene (forward primer: (Millipore), anti-p67 (cl.29; BD Biosciences), and anti-Rac1 5Ј-GATGGTAGATCTTTTTCAGCACA CACACACAAG- (BD Biosciences), followed by the appropriate HRP-conjugated TATA-3Ј, reverse: 5Ј-GTGGCAGATCTTGAATGTGTTGTGT secondary antibody (Zymed), developed by enhanced chemilumi- T TGCCTTTCTTC-3Ј, BAC-RPCI-11, clone RP11–715D15 gene nescence. CYBB, from RZPD Deutsches Ressourcenzentrum fur Genomfor- Immunostaining. Cells (3 ϫ 104) in 0.1 mL PBS were deposited on schung) into the pGL3-Enhancer vector (Promega). HL60 cells glass slides by cytospin centrifugation and fixed in fresh 4% were transfected with 1 ␮g of each NOX2-Luc reporter plasmid formaldehyde (Merck), pH 8, for 10 min.
Recommended publications
  • Novel Binding Partners of PBF in Thyroid Tumourigenesis
    NOVEL BINDING PARTNERS OF PBF IN THYROID TUMOURIGENESIS By Neil Sharma A thesis presented to the College of Medical and Dental Sciences at the University of Birmingham for the Degree of Doctor of Philosophy Centre for Endocrinology, Diabetes and Metabolism, School of Clinical and Experimental Medicine August 2013 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. SUMMARY Thyroid cancer is the most common endocrine cancer, with a rising incidence. The proto-oncogene PBF is over-expressed in thyroid tumours, and the degree of over-expression is directly linked to patient survival. PBF causes transformation in vitro and tumourigenesis in vivo, with PBF-transgenic mice developing large, macro-follicular goitres, effects partly mediated by the internalisation and repression of the membrane-bound transporters NIS and MCT8. NIS repression leads to a reduction in iodide uptake, which may negatively affect the efficacy of radioiodine treatment, and therefore prognosis. Work within this thesis describes the use of tandem mass spectrometry to produce a list of potential binding partners of PBF. This will aid further research into the pathophysiology of PBF, not just in relation to thyroid cancer but also other malignancies.
    [Show full text]
  • Immobilization of Firefly Luciferase on PVA-Co-PE Nanofibers Membrane
    Research Article www.acsami.org Immobilization of Firefly Luciferase on PVA-co-PE Nanofibers Membrane as Biosensor for Bioluminescent Detection of ATP † † Wenwen Wang, Qinghua Zhao, Mengying Luo, Mufang Li, Dong Wang,* Yuedan Wang, and Qiongzhen Liu School of Materials Science and Engineering, Wuhan Textile University, Wuhan 430073, China ABSTRACT: The bioluminescent reaction catalyzed by firefly luciferase has become widely established as an outstanding analytical system for assay of adenosine triphosphate (ATP). When in solution, the luciferase is unstable and cannot be reused. The problem can be partially solved by immobilizing the luciferase on solid substrates. The poly(vinyl alcohol-co-ethylene) (PVA-co-PE) nanofibers membrane has abundant active hydroxyl groups on the surface. The PVA-co-PE nanofibers membrane was first activated by cyanuric chloride with triazinyl group. Then the activated PVA-co- PE nanofibers membrane was subsequently reacted with 1,3-propanediamine and biotin. The firefly luciferase was immobilized onto the surface of 1,3-propanediamine- and biotin-functionalized membranes. The surface chemical structure and morphologies of nanofibers membranes were characterized by FTIR-ATR spectra and SEM. The hydrophilicity of membranes was tested by water contact angle measurements. The detection of fluorescence intensity displayed that the firefly-luciferase-immobilized PVA-co-PE nanofibers membranes indicated high catalytic activity and efficiency. Especially, the firefly-luciferase-immobilized nanofiber membrane which was functionalized
    [Show full text]
  • Crystal Structure of Firefly Luciferase Throws Light on a Superfamily of Adenylate-Forming Enzymes Elena Conti, Nick P Franks and Peter Brick*
    Research Article 287 Crystal structure of firefly luciferase throws light on a superfamily of adenylate-forming enzymes Elena Conti, Nick P Franks and Peter Brick* Background: Firefly luciferase is a 62 kDa protein that catalyzes the production Address: Biophysics Section, Blackett Laboratory, of light. In the presence of MgATP and molecular oxygen, the enzyme oxidizes its Imperial College, London SW7 2BZ, UK. substrate, firefly luciferin, emitting yellow-green light. The reaction proceeds *Corresponding author. through activation of the substrate to form an adenylate intermediate. Firefly luciferase shows extensive sequence homology with a number of enzymes that Key words: acyl-coenzyme A ligase, adenylate, utilize ATP in adenylation reactions. firefly luciferase, peptide synthetase, X-ray crystallography Results: We have determined the crystal structure of firefly luciferase at 2.0 Å Received: 30 Nov 1995 resolution. The protein is folded into two compact domains. The large N-terminal Revisions requested: 21 Dec 1995 domain consists of a b-barrel and two b-sheets. The sheets are flanked by Revisions received: 15 Jan 1996 a-helices to form an ababa five-layered structure. The C-terminal portion of the Accepted: 31 Jan 1996 molecule forms a distinct domain, which is separated from the N-terminal domain Structure 15 March 1996, 4:287–298 by a wide cleft. © Current Biology Ltd ISSN 0969-2126 Conclusions: Firefly luciferase is the first member of a superfamily of homologous enzymes, which includes acyl-coenzyme A ligases and peptide synthetases, to have its structure characterized. The residues conserved within the superfamily are located on the surfaces of the two domains on either side of the cleft, but are too far apart to interact simultaneously with the substrates.
    [Show full text]
  • (ER) Membrane Contact Sites (MCS) Uses Toxic Waste to Deliver Messages Edgar Djaha Yoboue1, Roberto Sitia1 and Thomas Simmen2
    Yoboue et al. Cell Death and Disease (2018) 9:331 DOI 10.1038/s41419-017-0033-4 Cell Death & Disease REVIEW ARTICLE Open Access Redox crosstalk at endoplasmic reticulum (ER) membrane contact sites (MCS) uses toxic waste to deliver messages Edgar Djaha Yoboue1, Roberto Sitia1 and Thomas Simmen2 Abstract Many cellular redox reactions housed within mitochondria, peroxisomes and the endoplasmic reticulum (ER) generate hydrogen peroxide (H2O2) and other reactive oxygen species (ROS). The contribution of each organelle to the total cellular ROS production is considerable, but varies between cell types and also over time. Redox-regulatory enzymes are thought to assemble at a “redox triangle” formed by mitochondria, peroxisomes and the ER, assembling “redoxosomes” that sense ROS accumulations and redox imbalances. The redoxosome enzymes use ROS, potentially toxic by-products made by some redoxosome members themselves, to transmit inter-compartmental signals via chemical modifications of downstream proteins and lipids. Interestingly, important components of the redoxosome are ER chaperones and oxidoreductases, identifying ER oxidative protein folding as a key ROS producer and controller of the tri-organellar membrane contact sites (MCS) formed at the redox triangle. At these MCS, ROS accumulations could directly facilitate inter-organellar signal transmission, using ROS transporters. In addition, ROS influence the flux 2+ 2+ of Ca ions, since many Ca handling proteins, including inositol 1,4,5 trisphosphate receptors (IP3Rs), SERCA pumps or regulators of the mitochondrial Ca2+ uniporter (MCU) are redox-sensitive. Fine-tuning of these redox and ion signaling pathways might be difficult in older organisms, suggesting a dysfunctional redox triangle may accompany 1234567890 1234567890 the aging process.
    [Show full text]
  • Bioluminescence Is Produced by a Firefly-Like Luciferase but an Entirely
    www.nature.com/scientificreports OPEN New Zealand glowworm (Arachnocampa luminosa) bioluminescence is produced by a Received: 8 November 2017 Accepted: 1 February 2018 frefy-like luciferase but an entirely Published: xx xx xxxx new luciferin Oliver C. Watkins1,2, Miriam L. Sharpe 1, Nigel B. Perry 2 & Kurt L. Krause 1 The New Zealand glowworm, Arachnocampa luminosa, is well-known for displays of blue-green bioluminescence, but details of its bioluminescent chemistry have been elusive. The glowworm is evolutionarily distant from other bioluminescent creatures studied in detail, including the frefy. We have isolated and characterised the molecular components of the glowworm luciferase-luciferin system using chromatography, mass spectrometry and 1H NMR spectroscopy. The purifed luciferase enzyme is in the same protein family as frefy luciferase (31% sequence identity). However, the luciferin substrate of this enzyme is produced from xanthurenic acid and tyrosine, and is entirely diferent to that of the frefy and known luciferins of other glowing creatures. A candidate luciferin structure is proposed, which needs to be confrmed by chemical synthesis and bioluminescence assays. These fndings show that luciferases can evolve independently from the same family of enzymes to produce light using structurally diferent luciferins. Glowworms are found in New Zealand and Australia, and are a major tourist attraction at sites located across both countries. In contrast to luminescent beetles such as the frefy (Coleoptera), whose bioluminescence has been well characterised (reviewed by ref.1), the molecular details of glowworm bioluminescence have remained elusive. Tese glowworms are the larvae of fungus gnats of the genus Arachnocampa, with eight species endemic to Australia and a single species found only in New Zealand2.
    [Show full text]
  • Proteomic and Metabolomic Analyses of Mitochondrial Complex I-Deficient
    THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 287, NO. 24, pp. 20652–20663, June 8, 2012 © 2012 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A. Proteomic and Metabolomic Analyses of Mitochondrial Complex I-deficient Mouse Model Generated by Spontaneous B2 Short Interspersed Nuclear Element (SINE) Insertion into NADH Dehydrogenase (Ubiquinone) Fe-S Protein 4 (Ndufs4) Gene*□S Received for publication, November 25, 2011, and in revised form, April 5, 2012 Published, JBC Papers in Press, April 25, 2012, DOI 10.1074/jbc.M111.327601 Dillon W. Leong,a1 Jasper C. Komen,b1 Chelsee A. Hewitt,a Estelle Arnaud,c Matthew McKenzie,d Belinda Phipson,e Melanie Bahlo,e,f Adrienne Laskowski,b Sarah A. Kinkel,a,g,h Gayle M. Davey,g William R. Heath,g Anne K. Voss,a,h René P. Zahedi,i James J. Pitt,j Roman Chrast,c Albert Sickmann,i,k Michael T. Ryan,l Gordon K. Smyth,e,f,h b2 a,h,m,n3 David R. Thorburn, and Hamish S. Scott Downloaded from From the aMolecular Medicine Division, gImmunology Division, and eBioinformatics Division, Walter and Eliza Hall Institute of Medical Research, Parkville, Victoria 3052, Australia, the bMurdoch Childrens Research Institute, Royal Children’s Hospital and Department of Paediatrics, University of Melbourne, Parkville, Victoria 3052, Australia, the cDépartement de Génétique Médicale, Université de Lausanne, 1005 Lausanne, Switzerland, the dCentre for Reproduction and Development, Monash Institute of Medical Research, Clayton, Victoria 3168, Australia, the hDepartment of Medical Biology
    [Show full text]
  • Follicular Thyroglobulin Enhances Gene Expression Necessary for Thyroid Hormone Secretion
    Endocrine Journal 2015, 62 (11), 1007-1015 Original Follicular thyroglobulin enhances gene expression necessary for thyroid hormone secretion Yuko Ishido1), 2), 3), Yuqian Luo1), 3), Aya Yoshihara1), 3), Moyuru Hayashi3), Akio Yoshida2), Ichiro Hisatome2) and Koichi Suzuki1), 3) 1) Laboratory of Molecular Diagnostics, Department of Mycobacteriology, Leprosy Research Center, National Institute of Infectious Disease, Tokyo 189-0002, Japan 2) Division of Regenerative Medicine and Therapeutics, Department of Genetic Medicine and Regenerative Therapeutics, Institute of Regenerative Medicine and Biofunction, Tottori University Graduate School of Medical Science, Yonago, 683-8503, Japan 3) Department of Clinical Laboratory Science, Faculty of Medical Technology, Teikyo University, Tokyo 173-8605, Japan Abstract. We have previously shown that follicular thyroglobulin (Tg) has an unexpected function as an autocrine negative- feedback regulator of thyroid hormone (TH) biosynthesis. Tg significantly suppressed the expression of genes necessary for iodide transport and TH synthesis by counteracting stimulation by TSH. However, whether follicular Tg also regulates intracellular TH transport and its secretion from thyrocytes is not known. In the present study, we examined the potential effect of follicular Tg on TH transport and secretion by quantifying the expression of two TH transporters: monocarboxylate transporter 8 (MCT8) and μ-crystallin (CRYM). Our results showed that follicular Tg at physiologic concentrations enhanced both the mRNA and protein expression levels of MCT8 and CRYM in a time- and dose-dependent manner in rat thyroid FRTL-5 cells. Although both the sodium/iodide symporter (NIS), an essential transporter of iodide from blood into the thyroid, and MCT8, a transporter of synthesized TH from the gland, were co-localized on the basolateral membrane of rat thyrocytes in vivo, Tg decreased NIS expression and increased the expression of MCT8 by counteracting TSH action.
    [Show full text]
  • Natural Course of Congenital Hypothyroidism by Dual Oxidase 2 Mutations from the Neonatal Period Through Puberty
    Y Maruo and others Clinical features of DUOX2 174:4 453–463 Clinical Study defects Natural course of congenital hypothyroidism by dual oxidase 2 mutations from the neonatal period through puberty Yoshihiro Maruo1, Keisuke Nagasaki, Katsuyuki Matsui, Yu Mimura, Asami Mori, Maki Fukami2 and Yoshihiro Takeuchi Correspondence should be addressed Department of Pediatrics, Shiga University of Medical Science, Tsukinowa, Seta, Otsu, Shiga 520-2192, Japan, to Y Maruo 1Department of Pediatrics, Niigata University, Niigata, Japan and 2Department of Molecular Endocrinology, Email National Research Institute for Child Health and Development, Tokyo, Japan [email protected] Abstract Aim: We previously reported that biallelic mutations in dual oxidase 2 (DUOX2) cause transient hypothyroidism. Since then, many cases with DUOX2 mutations have been reported. However, the clinical features and prognosis of individuals with DUOX2 defects have not been clarified. Objective: We investigated the prognosis of patients with congenital hypothyroidism (CH) due to DUOX2 mutations. Patients: Twenty-five patients were identified by a neonatal screening program and included seven familial cases. Their serum TSH values ranged from 18.9 to 734.6 mU/l. Twenty-two of the patients had low serum free thyroxine (fT4) levels (0.17–1.1 ng/dl). Twenty-four of the patients were treated with L-thyroxine. Methods: We analyzed the DUOX2, thyroid peroxidase, NaC/IK symporter, and dual oxidase maturation factor 2 genes of these 25 patients by PCR-amplified direct sequencing. An additional 11 genes were analyzed in 11 of the 25 patients using next-generation sequencing. Results: All patients had biallelic DUOX2 mutations, and seven novel alleles were detected.
    [Show full text]
  • Independent Evolution of Four Heme Peroxidase Superfamilies
    Archives of Biochemistry and Biophysics xxx (2015) xxx–xxx Contents lists available at ScienceDirect Archives of Biochemistry and Biophysics journal homepage: www.elsevier.com/locate/yabbi Independent evolution of four heme peroxidase superfamilies ⇑ Marcel Zámocky´ a,b, , Stefan Hofbauer a,c, Irene Schaffner a, Bernhard Gasselhuber a, Andrea Nicolussi a, Monika Soudi a, Katharina F. Pirker a, Paul G. Furtmüller a, Christian Obinger a a Department of Chemistry, Division of Biochemistry, VIBT – Vienna Institute of BioTechnology, University of Natural Resources and Life Sciences, Muthgasse 18, A-1190 Vienna, Austria b Institute of Molecular Biology, Slovak Academy of Sciences, Dúbravská cesta 21, SK-84551 Bratislava, Slovakia c Department for Structural and Computational Biology, Max F. Perutz Laboratories, University of Vienna, A-1030 Vienna, Austria article info abstract Article history: Four heme peroxidase superfamilies (peroxidase–catalase, peroxidase–cyclooxygenase, peroxidase–chlo- Received 26 November 2014 rite dismutase and peroxidase–peroxygenase superfamily) arose independently during evolution, which and in revised form 23 December 2014 differ in overall fold, active site architecture and enzymatic activities. The redox cofactor is heme b or Available online xxxx posttranslationally modified heme that is ligated by either histidine or cysteine. Heme peroxidases are found in all kingdoms of life and typically catalyze the one- and two-electron oxidation of a myriad of Keywords: organic and inorganic substrates. In addition to this peroxidatic activity distinct (sub)families show pro- Heme peroxidase nounced catalase, cyclooxygenase, chlorite dismutase or peroxygenase activities. Here we describe the Peroxidase–catalase superfamily phylogeny of these four superfamilies and present the most important sequence signatures and active Peroxidase–cyclooxygenase superfamily Peroxidase–chlorite dismutase superfamily site architectures.
    [Show full text]
  • Supplementary Materials
    Supplementary Materials COMPARATIVE ANALYSIS OF THE TRANSCRIPTOME, PROTEOME AND miRNA PROFILE OF KUPFFER CELLS AND MONOCYTES Andrey Elchaninov1,3*, Anastasiya Lokhonina1,3, Maria Nikitina2, Polina Vishnyakova1,3, Andrey Makarov1, Irina Arutyunyan1, Anastasiya Poltavets1, Evgeniya Kananykhina2, Sergey Kovalchuk4, Evgeny Karpulevich5,6, Galina Bolshakova2, Gennady Sukhikh1, Timur Fatkhudinov2,3 1 Laboratory of Regenerative Medicine, National Medical Research Center for Obstetrics, Gynecology and Perinatology Named after Academician V.I. Kulakov of Ministry of Healthcare of Russian Federation, Moscow, Russia 2 Laboratory of Growth and Development, Scientific Research Institute of Human Morphology, Moscow, Russia 3 Histology Department, Medical Institute, Peoples' Friendship University of Russia, Moscow, Russia 4 Laboratory of Bioinformatic methods for Combinatorial Chemistry and Biology, Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry of the Russian Academy of Sciences, Moscow, Russia 5 Information Systems Department, Ivannikov Institute for System Programming of the Russian Academy of Sciences, Moscow, Russia 6 Genome Engineering Laboratory, Moscow Institute of Physics and Technology, Dolgoprudny, Moscow Region, Russia Figure S1. Flow cytometry analysis of unsorted blood sample. Representative forward, side scattering and histogram are shown. The proportions of negative cells were determined in relation to the isotype controls. The percentages of positive cells are indicated. The blue curve corresponds to the isotype control. Figure S2. Flow cytometry analysis of unsorted liver stromal cells. Representative forward, side scattering and histogram are shown. The proportions of negative cells were determined in relation to the isotype controls. The percentages of positive cells are indicated. The blue curve corresponds to the isotype control. Figure S3. MiRNAs expression analysis in monocytes and Kupffer cells. Full-length of heatmaps are presented.
    [Show full text]
  • SUPPLEMENTARY DATA Supplementary Figure 1. The
    SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]