1 the 1,2-Diaminocyclohexane Carrier Ligand in Oxaliplatin Induces P53-Dependent Transcriptional Repression of Factors Involved

Home , DUT (gene)

Author Manuscript Published OnlineFirst on July 24, 2015; DOI: 10.1158/1535-7163.MCT-14-0748 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

The 1,2-diaminocyclohexane carrier ligand in oxaliplatin induces p53-dependent

transcriptional repression of factors involved in thymidylate biosynthesis

Shinichi Kiyonari4,7, Makoto Iimori1, Kazuaki Matsuoka4,6, Sugiko Watanabe4,

Tomomi Morikawa-Ichinose5, Daisuke Miura5, Shinichiro Niimi4,6, Hiroshi Saeki2,

Eriko Tokunaga3, Eiji Oki2, Masaru Morita2, Kenji Kadomatsu7, Yoshihiko Maehara2,4,

and Hiroyuki Kitao1,4*

1Department of Molecular Oncology, 2Department of Surgery and Science,

3Deparrtment of Comprehensive Clinical Oncology, Graduate School of Medical

Sciences, 4Innovative Anticancer Strategy for Therapeutics and Diagnosis Group,

5Metabolic Profiling Research Group, Innovation Center for Medical Redox Navigation,

Kyushu University, 6Taiho Pharmaceutical Co. Ltd., Tokushima, Japan, 7Department of

Biochemistry, Nagoya University Graduate School of Medicine, Aichi, Japan

Running title: Suppression of thymidylate biosynthesis by oxaliplatin

Keywords: oxaliplatin, 1,2-diaminocyclohexane carrier ligand, p53–miR-34a–E2F,

thymidylate biosynthesis

Financial Support

This work was supported by the Science and Technology Incubation Program in

Advanced Regions from the funding program “Creation of Innovation Centers for

Downloaded from mct.aacrjournals.org on September 26, 2021. © 2015 American Association for Cancer Research. Author Manuscript Published OnlineFirst on July 24, 2015; DOI: 10.1158/1535-7163.MCT-14-0748 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Advanced Interdisciplinary Research Areas” from the Japan Science and Technology

Agency, commissioned by the Ministry of Education, Culture, Sports, Science, and

Technology. This work was also supported in part by grants-in-aid from the Ministry of

Education, Science, Sports, and Culture of Japan (S. Kiyonari, JSPS KAKENHI Grant

Number 24701028).

*Corresponding author:

Hiroyuki Kitao, Department of Molecular Oncology, Graduate School of Medical

Sciences, Kyushu University. 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582, Japan.

Tel./Fax: +81-92-642-6499; E-mail: [email protected]

Disclosure of Potential Conflicts of Interest

KM and SN are employees of Taiho Pharmaceutical Co., Ltd. MI and HK are staff

members of an endowed course at Kyushu University funded by a donation from Taiho

Pharmaceutical Co., Ltd.

Word count: 5467

Total number of Figures: 6

Abstract (246 words)

Platinum-based chemotherapeutic drugs are widely used as components of

combination chemotherapy in the treatment of cancer. One such drug, oxaliplatin, exerts

a synergistic effect against advanced colorectal cancer in combination with 5-FU and

leucovorin. In the p53-proficient colorectal cancer cell line HCT116, oxaliplatin

represses the expression of deoxyuridine triphosphatase (dUTPase), a ubiquitous

pyrophosphatase that catalyzes the hydrolysis of dUTP to dUMP and inhibits

dUTP-mediated cytotoxicity. However, the underlying mechanism of this activity has

not been completely elucidated, and it remains unclear whether factors other than

downregulation of dUTPase contribute to the synergistic effect of 5-FU and oxaliplatin.

In this study, we found that oxaliplatin and dachplatin, platinum-based drugs containing

the 1,2-diaminocyclohexane (DACH) carrier ligand, repressed the expression of nuclear

isoform of dUTPase (DUT-N), whereas cisplatin and carboplatin did not. Oxaliplatin

induced early p53 accumulation, upregulation of primary miR-34a transcript expression,

and subsequent downregulation of E2F3 and E2F1. Nutlin-3a, which activates p53

non-genotoxically, had similar effects. Introduction of miR-34a mimic also repressed

E2F1 and DUT-N expression, indicating that this miRNA plays a causative role. In

addition to DUT-N, oxaliplatin repressed, in a p53-dependent manner, the expression of

genes encoding enzymes involved in thymidylate biosynthesis. Consequently,

oxaliplatin significantly decreased the level of dTTP in the dNTP pool in a

p53-dependent manner. These data indicate that the DACH carrier ligand in oxaliplatin

triggers signaling via the p53–miR-34a–E2F axis, leading to transcriptional regulation

that ultimately results in accumulation of dUTP and reduced dTTP biosynthesis,

potentially enhancing 5-FU cytotoxicity.

Introduction

Platinum-based chemotherapeutic drugs, such as cisplatin

[cis-diamminedichloroplatinum (II)], carboplatin

[cis-diammine(1,1-cyclobutanedicarboxylato)platinum (II)], and oxaliplatin

[1,2-diaminocyclohexaneoxalatoplatinum (II)], are widely used in the treatment of

various types of cancer, usually in combination with other types of drugs (e.g.,

antimetabolites, alkylating agents, or microtubule inhibitors) (1, 2). The platinum-based

drugs exert their cytotoxic effects primarily by producing platinum (Pt)-DNA adducts

with similar complexities but distinct structures. Cisplatin and carboplatin add the

cis-diammine carrier ligand at DNA adducts, whereas oxaliplatin adds the

1,2-diaminocyclohexane (DACH) carrier ligand (Supplementary Fig. S1). At the

cellular level, cisplatin and oxaliplatin induce distinct cellular responses. In the

p53-proficient colorectal cancer cell line HCT116, cisplatin slows down the DNA

replication phase and activates the G2–M checkpoint, whereas oxaliplatin activates the

G1–S checkpoint and completely blocks the G2–M transition (Supplementary Fig. S2)

(3). However, the molecular mechanism by which the structural differences in Pt-DNA

adducts cause different cellular responses and cytotoxicity is not fully understood.

Oxaliplatin exerts synergistic effects in combination with 5-fluorouracil (5-FU)

and leucovorin (LV). The combination of these three drugs, called FOLFOX, is now a

standard regimen for patients with advanced colorectal cancer (4). In addition to its

RNA-mediated toxicity (5), 5-FU is metabolized to 5-fluoro-dUMP, which specifically

suppresses the activity of thymidylate synthase (TS). Because TS plays an essential role

in de novo dTTP synthesis by catalyzing the conversion of dUMP to dTMP, inhibition

of this enzyme induces dUMP/dUTP accumulation. dUTP misincorporation into DNA

and subsequent DNA repair processes mediated by uracil DNA glycosylases lead to

massive DNA degradation and cause cytotoxicity (6). However, deoxyuridine

triphosphatase (dUTPase), a pyrophosphatase that catalyzes the hydrolysis of dUTP to

dUMP, eliminates dUTP from the dNTP pool and prevents dUTP misincorporation into

DNA (7). Indeed, dUTPase is often overexpressed in tumors, and elevated expression of

dUTPase in the nuclei of tumor cells is correlated with resistance to 5-FU–based

chemotherapy in patients with metastatic colorectal cancer (8). Furthermore, small

interfering RNA (siRNA)-mediated knockdown of the gene encoding dUTPase (DUT)

sensitizes various cancer cell lines to TS-targeted compounds, including 5-FU (9-11).

Despite the significant clinical advantages of oxaliplatin in combination with

5-FU–based chemotherapy, the underlying mechanism has not been fully elucidated

(12). Downregulation of TS by oxaliplatin has been proposed as one possible

mechanism (13). Furthermore, a previous study showed that expression of the gene

encoding the nuclear isoform of dUTPase (DUT-N) is repressed by oxaliplatin in a

p53-dependent manner (14). Detailed in vitro analysis revealed that DUT expression is

regulated by the transcription factors E2F1 and Sp1, and oxaliplatin induces the

enrichment of p53 at the DUT-N promoter with a concomitant reduction in the level of

Sp1 (14). However, the contribution of E2F1 to this process has not been clearly

demonstrated. The E2F pathway (E2F3 and E2F1) is also downregulated by miR-34a, a

member of the miR-34 family (comprising miR-34a, b, and c) (15). These microRNAs

are induced by adriamycin in colon cancer cells in a p53-dependent manner (16) and by

nutlin-3a, a small-molecule activator of p53 that disrupts the p53–MDM2 interaction by

binding to the hydrophobic pocket of MDM2 even in the absence of genotoxic stress

(17, 18). However, it remains unknown whether miR-34a is involved in transcriptional

regulation under oxaliplatin-induced stress.

In this study, we found that oxaliplatin and dachplatin, but not cisplatin or

carboplatin, induced p53-dependent repression of DUT-N expression, confirming the

involvement of Pt-DNA adducts containing the DACH carrier ligand in this process.

Oxaliplatin activated p53 via phosphorylation at Ser15, but the activation of the ATM–

Chk2 and ATR–Chk1 signaling pathways was marginal. Like nutlin-3a,

oxaliplatin-induced repression of DUT-N expression was preceded by early

accumulation of p53 and upregulation of primary miR-34a transcript and subsequent

downregulation of E2F3 and E2F1. Furthermore, several genes encoding dihydrofolate

reductase (DHFR), thymidine kinase 1 (TK1) and TS, enzymes involved in thymidylate

biosynthesis, were also repressed by oxaliplatin treatment. Consequently, the amount of

dTTP in the dNTP pool was significantly decreased by oxaliplatin treatment in a

p53-dependent manner. Taken together, our data indicate that DACH-Pt-DNA adducts

induced by oxaliplatin effectively stabilize p53 and upregulate miR-34a, resulting in

repression of gene expression driven by the transcription factors E2F3 and E2F1. The

oxaliplatin-triggered suppression of thymidylate biosynthesis may increase the

cytotoxicity of TS inhibitors.

Materials and Methods

Cell culture and reagents

The colorectal cancer cell lines HCT116, LoVo, and SW480 were purchased from

American Type Culture Collection (ATCC) in 2011. These cells were authenticated by

short tandem repeat analysis in 2014. HCT-116 p53-/- cells were kindly provided by B.

Vogelstein (Johns Hopkins University); they were confirmed to be p53-null by

immunoblot analysis (Supplementary Fig. S3A), but otherwise were not authenticated.

Cells were maintained in the supplier’s suggested culture media supplemented with

10% fetal bovine serum (FBS). The following reagents were purchased from the

indicated suppliers: cisplatin, carboplatin, and oxaliplatin (Tokyo Chemical Industry);

dichloro(1,2-diaminocyclohexane)platinum(II) (dachplatin) (Sigma–Aldrich); and

nutlin-3a [(-)-nutlin-3] (Cayman Chemical).

Western blotting and antibodies

Whole-cell extracts were obtained by solubilizing cell pellets in NET-N buffer (20 mM

Tris-HCl [pH 8.0], 150 mM NaCl, 1 mM EDTA, 0.5% NP-40) containing protease and

phosphatase inhibitor cocktail (Nacalai Tesque). Protein concentrations were measured

using the BCA protein assay reagent (Thermo Scientific). For Western blotting, 10 or 20

μg of whole-cell extract was subjected to SDS-PAGE, and the following antibodies

were used: anti-dUTPase (H00001854-M01, Abnova), anti–β-actin (A5316, Sigma),

anti-p53 (M7001, Dako), anti–phospho-p53 (Ser15) (#9284, Cell Signaling Technology

[CST]), anti-p21 (sc-397, Santa Cruz Biotechnology [SCBT]), anti-Chk1 (sc-8408,

SCBT), anti–phospho-Chk1 (Ser345) (#2348, CST), anti-Chk2 (#3440, CST), anti–

phospho-Chk2 (Thr68) (#2661, CST), Anti-E2F-1 (#3742, CST), and anti–E2F3

(sc-878, SCBT). Chemiluminescent signals were detected on an ImageQuant LAS 4000

Mini (GE Healthcare Life Sciences), and signal intensities were quantitated using the

ImageQuant TL (GE Healthcare Life Sciences) or the ImageJ (NIH) software.

RNA interference and ectopic expression of miRNA mimic

RNAiMax (Life technologies) was used for siRNA transfection. siRNA sequences were

as follows: siGL2 (luciferase) control (19), CGUACGCGGAAUACUUCGATT; siTP53

(p53), GAAAUUUGCGUGUGGAGUAUU (20); and siDUT-M (the mitochondrial

isoform of dUTPase), CUACCAUUUCCUUACGUCUTT (Sigma-Aldrich). Ectopic

expression of miR-34a mimic transcript was performed using miRCURY LNA™

microRNA Mimic (Takara). The human TK1 gene was amplified from cDNA isolated

from HCT116 p53+/+ cells with the following primers: TK1_ATG_Fw,

CACCATGAGCTGCATTAACCTGCCC; TK1_Last_Rv,

GTTGGCAGGGCTGCATTGCAGAATC. The TK1 cDNA was cloned into a

pcDNA3.1 expression vector with the 3×FLAG tag at the C-terminus using the

Gateway cloning system (Invitrogen). X-tremeGENE HP DNA Transfection Reagent

(Roche) was used for plasmid transfection.

Quantitative real-time RT-PCR

Total RNA was extracted from drug-treated cells using ISOGEN II (NIPPON GENE),

and cDNA synthesis was performed using ReverTra Ace qPCR RT Master Mix with

gDNA Remover (Toyobo Life Science). Quantitative real-time PCR was carried out on

an Mx3005P qPCR system (Agilent Technologies) using THUNDERBIRD qPCR Mix

(Toyobo Life Science). Because of difficulty with the amplification, the KAPA SYBR

Fast qPCR Kit (NIPPON Genetics) was used for measurement of DUT transcript.

Primer sets used for this analysis were as follows: DHFR_Fw,

CCTGGTTCTCCATTCCTGAG; DHFR_Rv, TGCCACCAACTATCCAGACC;

TK1_Fw, GGCAGTTTTTCCCTGACATC; TK1_Rv, CCTCGACCTCCTTCTCTGTG.

DUT_Fw, CCCTGCTCTGAAGAGACACC; DUT_Rv,

GGGAGCGCTATCTGAATGTC; TS_Fw, GCGCTACAGCCTGAGAGATG; and

TS_Rv, GCCCAAGTCCCCTTCTTC. Primer sets for quantitation of total pri-miR-34a

(at Exon1: Pri-miR-34a_Fw, CTCGGTGACCACGCAGATC; Pri-miR-34a_Rv,

GCAGGACTCCCGCAAAATC) and 18S rRNA (18S.rRNA_Fw,

GCCGCTAGAGGTGAAATTCTTG; 18S.rRNA_Rv, CTTTCGCTCTGGTCCGTCTT)

were prepared as previously described (21). Statistical analysis was preformed by paired

or unpaired t-test.

Quantitation of dTTP by LC-QqQ-MS

Intracellular dTTP was quantitated using liquid chromatography/triple-stage quadrupole

mass spectrometry (LC-QqQ-MS). Samples for LC-QqQ-MS analysis were prepared as

previously described (22) with slight modifications. HCT-116 p53+/+ cells or

HCT-116 p53-/- cells, either non-treated or treated with 5 μmol/L oxaliplatin for 48 h,

were washed twice with ice-cold PBS and quenched with 1 mL ice-cold 100% methanol

containing 5 μmol/L (+)-10-camphor sulfonic acid (10CS) per 1 × 107 cells, incubated

on ice for 3 min, collected by scraping with a rubber policeman, sonicated 10 times

(each cycle consisted of 30 s of sonication and 30 s of cooling) with a BIORUPTOR

(Cosmo Bio Co., Ltd), and centrifuged at 21,500 g for 5 min at 4°C. The supernatants

were collected and mixed with chloroform and water at a ratio of 1:0.5:1, mixed well,

and centrifuged for 5 min. The aqueous fraction was evaporated to dryness on a

centrifugal evaporator (CVE-2000; EYELA) connected to a high vacuum pump

(GCD-051X; ULVAC) and a cold trap (UNI TRAP UT-1000; EYELA). Desiccated

pellets were dissolved in water and filtered before LC-QqQ-MS analysis. The

metabolites from the aqueous fraction were separated by ion-pair HPLC on a Synergi

2.5 µm Hydro-RP 100 Å (100 × 2.0 mm i.d., Phenomenex Inc.) and analyzed using an

LCMS-8040 instrument (Shimadzu) as previously described (23). dTTP was detected

with optimized selective reaction-monitoring transitions in negative-ionization mode as

follows: precursor ion [m/z]/product ion [m/z] = 481/159, 481/383, and 481/120.

Statistical analysis was performed by unpaired t-test.

Results

p53-dependent repression of DUT-N expression is induced by platinum-based drugs

with the DACH carrier ligand

A previous study using isogenic HCT116 colon cancer cells showed that

oxaliplatin-induced transcriptional repression of DUT-N, the nuclear isoform of

dUTPase, is dependent on p53 (14). Consistent with those results, we found that

dUTPase protein levels of were markedly reduced 48 h after oxaliplatin treatment in

HCT116 p53+/+ cells (Fig. 1A upper left), but not in HCT116 p53-/- cells (Fig. 1A upper

right). The same effect was observed in LoVo cells, which express functional p53 (Fig.

1A lower left). The intensity of the lower band, corresponding to DUT-N (24), was

reduced, while the upper band (corresponding to the mitochondrial isoform of dUTPase

(DUT-M), whose expression could be specifically suppressed by siRNA targeting the

mitochondrial isoform; Supplementary Fig. S3B left), was not affected by oxaliplatin

treatment (Fig. 1A lower left). By contrast, this repressive effect was not observed in

SW480 cells (Fig. 1A lower right), which expresses nonfunctional p53 harboring the

R273H and P309S mutations (25). p53 accumulation and p21 induction were observed

after 48 h of oxaliplatin treatment in HCT116 p53+/+ cells and LoVo cells, but not in

HCT116 p53-/- cells or SW480 cells (Supplementary Fig. S3A). Furthermore,

siRNA-mediated suppression of p53 expression alleviated the oxaliplatin-induced

decrease in dUTPase protein in HCT116 p53+/+ cells (Fig. 1B). These results confirm

that oxaliplatin-induced transcriptional repression of DUT-N is dependent on functional

p53 protein.

To identify the components of oxaliplatin that induce the repression of DUT-N

expression, we employed three additional structurally distinct platinum-based drugs

(Supplementary Fig. S1). Of those, dachplatin repressed expression of DUT-N as

effectively as oxaliplatin (Fig. 1C lower left). By contrast, cisplatin and carboplatin,

which form cis-diammine–Pt-DNA adducts, did not repress DUT-N expression, even

when we added these drugs at 5 μmol/L (Fig. 1C upper). After entering cells, oxaliplatin

is metabolized to dachplatin and oxalate. Because oxaliplatin and dachplatin exerted

similar effects on DUT-N expression, our data indicate that the DACH-Pt-DNA adducts

formed by oxaliplatin treatment, rather than the oxalate, induce a distinct DNA-damage

response and efficiently repress DUT-N expression.

Oxaliplatin-induced p53 activation is not associated with the activation of Chk1 and

Chk2 kinases

The previous data indicate that DACH-Pt-DNA adducts may elicit some type of

DNA-damage signaling that is not activated by platinum-induced DNA strand breaks

(26). To investigate how DACH-Pt-DNA adducts activate p53 and repress DUT-N

expression, we treated HCT116 p53+/+ cells with 10 μmol/L cisplatin or 1 μmol/L

oxaliplatin (the IC50) for 48 h and examined the status of the ATM–Chk2 and ATR–

Chk1 signaling pathways. In cisplatin-treated cells, phosphorylation of Chk1 at Ser345

(p-Chk1(S345)), the primary target of ATR kinase (27), was detectable at 3 h, peaked at

24 h, and largely disappeared by 48 h (Fig. 2A and 2B left). Phosphorylation of p53 at

Ser15 (p-p53(S15)), which leads to a reduced interaction of p53 with MDM2 and p53

accumulation (28), was also detectable in a similar kinetics (Fig. 2A and 2C right).

Phosphorylation of Chk2 at Thr68 (p-Chk2(T68)), the primary target of ATM kinase

(27), was detectable later at 24 h and 48 h (Fig. 2A and 2B right), as was p21

accumulation (Fig. 2A and 2D left). By contrast, p-Chk1(S345) and p-Chk2(T68) were

barely detectable in oxaliplatin-treated cells (Fig. 2A and 2B), even though p53

accumulation and p-p53(S15) (Fig. 2A and 2C) and p21 accumulation and DUT-N

dissipation (Fig. 2A and 2D) could be observed. These results suggest that

DACH-Pt-DNA adducts activate p53 via a mechanism distinct from the one activated

by cis-diammine-Pt-DNA adducts, which trigger replication stress and DNA strand

breaks (3).

The MDM2 antagonist nutlin-3a and oxaliplatin repress expression of the E2F1 and

E2F3 transcription factors and DUT-N

Our data suggest that p53-dependent oxaliplatin-induced repression of DUT-N

expression is triggered by DNA damage other than DNA strand breaks. Hence, we next

investigated whether p53 activation in the absence of genotoxic stress would still induce

the repression of DUT-N expression. Nutlin-3a activates p53 by disrupting the p53–

MDM2 interaction and inhibiting MDM2 E3 ligase activity toward p53 (17). As

described previously (29), 5 μmol/L nutlin-3a suppressed the growth of HCT116 p53+/+

cells, as did 5 μmol/L oxaliplatin (data not shown). Under these conditions, nutlin-3a

and oxaliplatin induced accumulation of p53 and p21 and repression of DUT-N

expression to a similar extent (Fig. 3A and 3B). Of note, p-p53(S15) was detected only

in oxaliplatin-treated cells, suggesting that oxaliplatin might induce unidentified DNA

damage that triggers this phosphorylation. These events were also observed in

p53-proficient LoVo cells (Fig. 3C and 3D). These results indicate that unidentified

DNA damage induced by oxaliplatin activates p53 via its phosphorylation, but p53

phosphorylation itself is not necessary for the repression of DUT-N expression.

Expression of DUT gene is regulated by the transcription factors Sp1 and E2F1

(14), and the expression of E2F1 is transcriptionally activated by E2F3 (30). Therefore,

we next investigated whether these transcription factors are involved in the repression

of DUT-N expression by nutlin-3a and oxaliplatin. Both nutlin-3a and oxaliplatin

decreased E2F3 and E2F1 protein levels in HCT116 p53+/+ cells (Fig. 3A and 3B) and

LoVo cells (Fig. 3C and 3D). Importantly, a reduction in the levels of E2F3 and E2F1

was already detectable at 24 h, when the reduction in the DUT-N level was marginal

(Fig. 3B and 3D), indicating that downregulation of these transcription factors precedes

the decrease in expression of their target gene product, DUT-N.

Oxaliplatin induces pri-miR-34a prior to repression of DUT-N expression

MicroRNA-34a (miR-34a) is a direct target of p53 and a candidate tumor suppressor of

neuroblastoma (31). Introduction of miR-34a downregulates E2F3 and E2F1 protein

expression in HCT116 and RKO cells (16). Nutlin-3a treatment upregulates miR-34a

expression and represses B-Myb and E2F1 in p53wild-type leukemic cells (18). Hence, we

next investigated whether oxaliplatin upregulates miR-34a expression in HCT116 cells.

A slight but significant increase in the level of the primary miR-34a transcript

(pri-miR-34a), was detected at as early as 3 h after oxaliplatin treatment, and the level of

pri-miR-34a increased gradually thereafter, up to 14-fold by 24 h (Fig. 4A). Inversely,

DUT transcript started to decline as early as 12 h and reached 40% of its initial level at

24 h and 48 h (Fig. 4B). The oxaliplatin-induced upregulation of pri-miR-34a

expression and repression of DUT transcript was also observed in LoVo cells

(Supplementary Fig. S4A and S4B). In HCT116 p53-/- cells, pri-miR-34a was induced

later than 12 h, but the level of induction was significantly lower than in HCT116 p53+/+

cells at all time points (Fig. 4A). Moreover, the repression of DUT transcript was very

limited in HCT116 p53-/- cells (Fig. 4B). These results indicate that oxaliplatin induces

miR-34a prior to repression of DUT transcript, which is mostly dependent on p53.

At the protein level, accumulation of p53 was already detectable by 3 h after

oxaliplatin treatment, whereas p21 was detected at a later time point (9 h) (Fig. 4C and

4D). On the contrary, the level of DUT-N protein was not reduced until 48 h after

oxaliplatin treatment, whereas E2F3 and E2F1 protein levels were clearly reduced by 24

h (Fig. 4C and 4D). These results suggest that signaling via the p53–miR-34a–E2F axis

triggers the repression of DUT-N expression following oxaliplatin treatment. We next

tested whether miR-34a itself represses the expression of E2F1 and DUT-N.

Introduction of miR-34a mimic decreased the levels of the E2F1 and DUT-N proteins at

72 h, whereas introduction of a control miRNA had no effect (Fig. 4E), indicating that

miR-34a plays a causative role in the repression of downstream target gene expression.

Oxaliplatin represses the expression of thymidylate biosynthesis genes and suppresses

dTTP biosynthesis

The thymidylate (dTTP) biosynthesis pathway is a target of fluoropyrimidine-type (i.e.,

5-FU) or antifolate-type (i.e., raltitrexed and pemetrexed) chemotherapeutic drugs (32).

TS and DHFR, which function in the de novo thymidylate biosynthesis pathway, are the

primary targets of 5-FU and antifolate drugs, respectively. In addition, the salvage

thymidylate biosynthesis pathway, which is initiated by TK1-mediated phosphorylation

of thymidine, is another route for dTTP biosynthesis (33). We focused on three genes

encoding enzymes of the thymidylate biosynthesis pathway, DHFR, TK1 and TS, whose

promoters have architectures similar to those of genes involved in the G1–S transition,

including DUT (34), and whose transcript levels during cell-cycle progression are

regulated by Sp1 and E2F1 (35-37). The expression of DHFR (Fig. 5A), TK1 (Fig. 5B),

and TS (Fig. 5C) was repressed by oxaliplatin treatment in HCT116 p53+/+ cells, but not

in HCT116 p53-/- cells (Figs 5A–C). Consistent with this, 48 h oxaliplatin treatment

caused a significant reduction (~40-fold) of intracellular dTTP in the dNTP pool in

HCT116 p53+/+ cells, whereas no such reduction was observed in HCT116 p53-/- cells

(Fig. 5D). Importantly, ectopic expression of TK1 (Supplementary Fig. S5A), which

significantly increased dTTP in normal proliferating HCT116 p53+/+ cells (Fig. 5E black

bars), partially alleviated dTTP starvation even when cells were cultured in the presence

of 5 μmol/L oxaliplatin for 48 h (Fig. 5E gray bar), without affecting their cell cycle

profile (Supplementary Fig. S5B). These results indicate that oxaliplatin represses the

expression of factors involved in the thymidylate biosynthesis pathway and suppresses

dTTP biosynthesis, largely dependent upon p53.

Discussion

Oxaliplatin has greatly improved 5-FU-based chemotherapy (4). In the adjuvant setting,

the FOLFOX regimen also significantly improved 5-year disease-free survival and

6-year overall survival in patients with stage III colon cancer relative to the 5-FU plus

leucovorin regimen (38, 39). However, it remains unclear why oxaliplatin increases the

antitumor activity of fluoropyrimidine-type antitumor drugs. One reasonable

mechanism that would explain the synergistic effect is p53-dependent repression of

expression of DUT-N, a nuclear isoform of critical sanitizing enzyme dUTPase that

hydrolyzes cytotoxic dUTP to dUMP, in response to oxaliplatin-induced DNA damage

(14). In this study, we found that p53-dependent repression of DUT-N expression by

oxaliplatin was preceded by induction of pri-miR-34a expression and repression of

expression of the transcription factors E2F3 and E2F1. Furthermore, we showed that

oxaliplatin also repressed DHFR, TK1, and TS expression in a p53-dependent manner,

and thereby suppressed dTTP biosynthesis (Fig. 5D). When combined with DUT-N

suppression, an elevated dUTP/dTTP ratio may exacerbate dUTP misincorporation into

DNA, resulting in DNA fragmentation and cytotoxicity (Fig. 6).

Our data indicate that unidentified DNA damage by the DACH carrier ligand of

oxaliplatin activates p53, but it remains unclear how oxaliplatin-induced

DACH-Pt-DNA adducts activate a p53-dependent DNA-damage signaling pathway that

represses DUT-N expression. p-p53(S15) was clearly detected when HCT116 p53+/+ or

LoVo cells were treated with 5 μmol/L oxaliplatin for 24 h (Fig. 3A and 3C), consistent

with previous reports (40, 41). Under our experimental conditions, p53 accumulation

was clearly detectable when HCT116 p53+/+ cells were treated with 1 μmol/L

oxaliplatin for 6 h and this p53 accumulation was also associated with p-p53(S15) (Fig.

2A and 2C). However, the p-p53(S15)/total p53 protein ratio appeared to be lower in

oxaliplatin-treated cells than in cisplatin-treated cells (Fig. 2C right)．In addition,

p-Chk1(S345) by ATR and p-Chk2(T68) by ATM were barely detectable in

oxaliplatin-treated cells (Fig. 2A and 2B). Oxaliplatin may induce p-p53(S15) in a

distinct mechanism, which would be unveiled by identifying the responsible kinase for

p-p53(S15) by oxaliplatin. Since p-p53(S15) weakens the p53–MDM2 interaction and

contributes to p53 accumulation by inhibiting MDM2-mediated p53 degradation (28)

and nutlin-3a also induced p53-mediated repression of DUT-N expression without

p-p53(S15) (Fig. 3A and 3C), this post-translational modification of p53 itself may not

be required for p53 function as a repressor of DUT-N expression once the p53–MDM2

interaction was disrupted.

Our time-course analysis revealed that expression of pri-miR-34a was

upregulated (Fig. 4A) in concert with p53 stabilization after as little as 3 h of 5 μmol/L

oxaliplatin treatment (Fig. 4C), consistent with the fact that p53 directly upregulates

miR-34a precursor expression (31). By contrast, reductions in the levels of DUT

transcript and DUT-N protein were not observed until 12 h (mRNA, Fig. 4B) and 48 h

(protein, Fig. 4C and 4D), respectively. Furthermore, downregulation of E2F1 protein

was already detectable at 24 h (Fig. 4C and 4D). Similar results were also obtained in

LoVo cells (Supplementary Fig. S4). In leukemic cells, nutlin-3a activates p53 and

upregulates miR-34a, which directly suppresses the translation of E2F3 protein, and

E2F1 expression is concomitantly downregulated (18). Transient introduction of

miR-34a into two human colon cancer cell lines, HCT116 and RKO, causes complete

suppression of cell proliferation and induces senescence-like phenotypes by

downregulating E2F3 and E2F1 protein expression (16). We also reproduced this result,

but the reduction in E2F1 or DUT-N protein was not as complete as that induced by

nutlin-3a or oxaliplatin (Fig. 4E). In addition, the significant reduction of DUT

transcript was also seen before E2F downregulation (Fig. 4B and Supplementary Fig.

S4B). These results support the idea that oxaliplatin-induced DACH-Pt-DNA adducts

are the critical activators of p53 and its tumor-suppressive target miR-34; however,

miR-34a is not the sole factor. This conclusion is reasonable because the repression of

DUT transcript is mediated by direct binding of p53 to, and exclusion of Sp1 from, the

promoter region (14).

In addition to DUT-N (14) and TS (13) (Fig. 5C), we found that the expression

levels of DHFR and TK1 mRNA were clearly reduced in HCT116 p53+/+ cells after 24 h

of oxaliplatin treatment (Fig. 5A and 5B). DHFR catalyzes the reduction of

dihydrofolate to tetrahydrofolate, which is an essential cofactor for thymidylate

biosynthesis by TS (35), and TK1 is an essential kinase of the salvage pathway for

thymidylate biosynthesis (33). Consistent with this, following oxaliplatin treatment we

observed a significant decrease in the level of dTTP in the dNTP pool (Fig. 5D), which

was partially alleviated by ectopic TK1 expression (Fig. 5E). The dTTP level also

decreases when HCT116 p53+/+ cells are cultured in the presence of TS inhibitors, such

as 5-FU, FdUrd, or pemetrexed (42). Because it targets genes other than TS, oxaliplatin

may synergize with the suppressive effect on thymidylate biosynthesis and the

cytotoxicity resulting from dTTP depletion. This scenario provides a possible

explanation for the enhancement of 5-FU–based chemotherapy.

The combination of 5-FU and oxaliplatin is a standard chemotherapeutic

regimen for patients with metastatic colorectal cancer (38, 39). Although the correlation

between the clinical benefit of the fluoropyrimidine–oxaliplatin combination and p53

status remains controversial (43, 44), it is possible that unidentified oxaliplatin-induced

DNA damage could exert some cytotoxic effects even on p53-deficient tumor cells,

especially in combination with fluoropyrimidine. Further analysis will be necessary to

evaluate such possibility and clarify its underlying mechanism.

Acknowledgments

We would like to thank Chie Iwamoto, Naoko Katakura, Haruna Masuda, Tomomi

Takada, and Maiko Iseki for their expert technical assistance. We also appreciate the

technical assistance of the Research Support Center, Research Center for Human

Disease Modeling, Kyushu University Graduate School of Medical Sciences.

References

1. Kelland L. The resurgence of platinum-based cancer chemotherapy. Nat Rev Cancer. 2007;7:573-84. 2. Jung Y, Lippard SJ. Direct cellular responses to platinum-induced DNA damage. Chem Rev. 2007;107:1387-407. 3. Voland C, Bord A, Peleraux A, Penarier G, Carriere D, Galiegue S, et al. Repression of cell cycle-related proteins by oxaliplatin but not cisplatin in human colon cancer cells. Mol Cancer Ther. 2006;5:2149-57. 4. de Gramont A, Figer A, Seymour M, Homerin M, Hmissi A, Cassidy J, et al. Leucovorin and fluorouracil with or without oxaliplatin as first-line treatment in advanced colorectal cancer. J Clin Oncol. 2000;18:2938-47. 5. Pettersen HS, Visnes T, Vagbo CB, Svaasand EK, Doseth B, Slupphaug G, et al. UNG-initiated base excision repair is the major repair route for 5-fluorouracil in DNA, but 5-fluorouracil cytotoxicity depends mainly on RNA incorporation. Nucleic Acids Res. 2011;39:8430-44. 6. Longley DB, Harkin DP, Johnston PG. 5-fluorouracil: mechanisms of action and clinical strategies. Nat Rev Cancer. 2003;3:330-8. 7. Vertessy BG, Toth J. Keeping uracil out of DNA: physiological role, structure and catalytic mechanism of dUTPases. Acc Chem Res. 2009;42:97-106. 8. Ladner RD, Lynch FJ, Groshen S, Xiong YP, Sherrod A, Caradonna SJ, et al. dUTP nucleotidohydrolase isoform expression in normal and neoplastic tissues: association with survival and response to 5-fluorouracil in colorectal cancer. Cancer Res. 2000;60:3493-503. 9. Koehler SE, Ladner RD. Small interfering RNA-mediated suppression of dUTPase sensitizes cancer cell lines to thymidylate synthase inhibition. Mol Pharmacol. 2004;66:620-6. 10. Takatori H, Yamashita T, Honda M, Nishino R, Arai K, Yamashita T, et al. dUTP pyrophosphatase expression correlates with a poor prognosis in hepatocellular carcinoma. Liver Int. 2010;30:438-46. 11. Wilson PM, LaBonte MJ, Lenz HJ, Mack PC, Ladner RD. Inhibition of dUTPase induces synthetic lethality with thymidylate synthase-targeted therapies in

non-small cell lung cancer. Mol Cancer Ther. 2012;11:616-28. 12. Alcindor T, Beauger N. Oxaliplatin: a review in the era of molecularly targeted therapy. Curr Oncol. 2011;18:18-25. 13. Yeh KH, Cheng AL, Wan JP, Lin CS, Liu CC. Down-regulation of thymidylate synthase expression and its steady-state mRNA by oxaliplatin in colon cancer cells. Anticancer Drugs. 2004;15:371-6. 14. Wilson PM, Fazzone W, LaBonte MJ, Lenz HJ, Ladner RD. Regulation of human dUTPase gene expression and p53-mediated transcriptional repression in response to oxaliplatin-induced DNA damage. Nucleic Acids Res. 2009;37:78-95. 15. Hermeking H. The miR-34 family in cancer and apoptosis. Cell Death Differ. 2010;17:193-9. 16. Tazawa H, Tsuchiya N, Izumiya M, Nakagama H. Tumor-suppressive miR-34a induces senescence-like growth arrest through modulation of the E2F pathway in human colon cancer cells. Proc Natl Acad Sci U S A. 2007;104:15472-7. 17. Vassilev LT, Vu BT, Graves B, Carvajal D, Podlaski F, Filipovic Z, et al. In vivo activation of the p53 pathway by small-molecule antagonists of MDM2. Science. 2004;303:844-8. 18. Zauli G, Voltan R, di Iasio MG, Bosco R, Melloni E, Sana ME, et al. miR-34a induces the downregulation of both E2F1 and B-Myb oncogenes in leukemic cells. Clin Cancer Res. 2011;17:2712-24. 19. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature. 2001;411:494-8. 20. Matsuoka K, Iimori M, Niimi S, Tsukihara H, Watanabe S, Kiyonari S, et al. Trifluridine induces p53-dependent sustained G2 phase arrest with its massive misincorporation into DNA and few DNA strand breaks. Mol Cancer Ther. 2015; 14:1004-1013. 21. Paris R, Henry RE, Stephens SJ, McBryde M, Espinosa JM. Multiple p53-independent gene silencing mechanisms define the cellular response to p53 activation. Cell Cycle. 2008;7:2427-33. 22. Setoyama D, Fujimura Y, Miura D. Metabolomics reveals that carnitine palmitoyltransferase-1 is a novel target for oxidative inactivation in human cells. Genes Cells. 2013;18:1107-19.

23. Kato H, Izumi Y, Hasunuma T, Matsuda F, Kondo A. Widely targeted metabolic profiling analysis of yeast central metabolites. J Biosci Bioeng. 2012;113:665-73. 24. Wilson PM, Fazzone W, LaBonte MJ, Deng J, Neamati N, Ladner RD. Novel opportunities for thymidylate metabolism as a therapeutic target. Mol Cancer Ther. 2008;7:3029-37. 25. Rochette PJ, Bastien N, Lavoie J, Guerin SL, Drouin R. SW480, a p53 double-mutant cell line retains proficiency for some p53 functions. J Mol Biol. 2005;352:44-57. 26. He G, Kuang J, Khokhar AR, Siddik ZH. The impact of S- and G2-checkpoint response on the fidelity of G1-arrest by cisplatin and its comparison to a non-cross-resistant platinum(IV) analog. Gynecol Oncol. 2011;122:402-9. 27. Cimprich KA, Cortez D. ATR: an essential regulator of genome integrity. Nat Rev Mol Cell Biol. 2008;9:616-27. 28. Lakin ND, Jackson SP. Regulation of p53 in response to DNA damage. Oncogene. 1999;18:7644-55. 29. Shangary S, Ding K, Qiu S, Nikolovska-Coleska Z, Bauer JA, Liu M, et al. Reactivation of p53 by a specific MDM2 antagonist (MI-43) leads to p21-mediated cell cycle arrest and selective cell death in colon cancer. Mol Cancer Ther. 2008;7:1533-42. 30. Johnson DG, Ohtani K, Nevins JR. Autoregulatory control of E2F1 expression in response to positive and negative regulators of cell cycle progression. Genes Dev. 1994;8:1514-25. 31. Hermeking H. p53 enters the microRNA world. Cancer Cell. 2007;12:414-8. 32. Wilson PM, Danenberg PV, Johnston PG, Lenz HJ, Ladner RD. Standing the test of time: targeting thymidylate biosynthesis in cancer therapy. Nat Rev Clin Oncol. 2014;11:282-98. 33. Munch-Petersen B. Enzymatic regulation of cytosolic thymidine kinase 1 and mitochondrial thymidine kinase 2: a mini review. Nucleosides Nucleotides Nucleic Acids. 2010;29:363-9. 34. Lin SY, Black AR, Kostic D, Pajovic S, Hoover CN, Azizkhan JC. Cell cycle-regulated association of E2F1 and Sp1 is related to their functional interaction. Mol Cell Biol. 1996;16:1668-75. 35. McEntee G, Minguzzi S, O'Brien K, Ben Larbi N, Loscher C, O'Fagain C, et

al. The former annotated human pseudogene dihydrofolate reductase-like 1 (DHFRL1) is expressed and functional. Proc Natl Acad Sci U S A. 2011;108:15157-62. 36. Tommasi S, Pfeifer GP. Constitutive protection of E2F recognition sequences in the human thymidine kinase promoter during cell cycle progression. J Biol Chem. 1997;272:30483-90. 37. Dong S, Lester L, Johnson LF. Transcriptional control elements and complex initiation pattern of the TATA-less bidirectional human thymidylate synthase promoter. J Cell Biochem. 2000;77:50-64. 38. Andre T, Boni C, Navarro M, Tabernero J, Hickish T, Topham C, et al. Improved overall survival with oxaliplatin, fluorouracil, and leucovorin as adjuvant treatment in stage II or III colon cancer in the MOSAIC trial. J Clin Oncol. 2009;27:3109-16. 39. Yothers G, O'Connell MJ, Allegra CJ, Kuebler JP, Colangelo LH, Petrelli NJ, et al. Oxaliplatin as adjuvant therapy for colon cancer: updated results of NSABP C-07 trial, including survival and subset analyses. J Clin Oncol. 2011;29:3768-74. 40. de Bruijn MT, Raats DA, Hoogwater FJ, van Houdt WJ, Cameron K, Medema JP, et al. Oncogenic KRAS sensitises colorectal tumour cells to chemotherapy by p53-dependent induction of Noxa. Br J Cancer. 2010;102:1254-64. 41. Liu HF, Hu HC, Chao JI. Oxaliplatin down-regulates survivin by p38 MAP kinase and proteasome in human colon cancer cells. Chem Biol Interact. 2010;188:535-45. 42. Wilson PM, Labonte MJ, Russell J, Louie S, Ghobrial AA, Ladner RD. A novel fluorescence-based assay for the rapid detection and quantification of cellular deoxyribonucleoside triphosphates. Nucleic Acids Res. 2011;39:e112. 43. Zaanan A, Cuilliere-Dartigues P, Guilloux A, Parc Y, Louvet C, de Gramont A, et al. Impact of p53 expression and microsatellite instability on stage III colon cancer disease-free survival in patients treated by 5-fluorouracil and leucovorin with or without oxaliplatin. Ann Oncol. 2010;21:772-80. 44. Kim ST, Lee J, Park SH, Park JO, Lim HY, Kang WK, et al. Clinical impact of microsatellite instability in colon cancer following adjuvant FOLFOX therapy. Cancer Chemother Pharmacol. 2010;66:659-67.

Figure Legends

Figure 1. DACH-Pt-DNA adducts induce p53-dependent downregulation of nuclear

isoform of dUTPase (DUT-N). A. Oxaliplatin-induced DUT-N downregulation.

Colorectal cancer cells were treated with oxaliplatin (Oxali) for 24 or 48 h. B. Effect of

p53 knockdown on oxaliplatin-induced DUT-N downregulation. HCT116 p53+/+ cells

were treated with siRNA against luciferase (siGL2) or TP53 (siTP53), and then treated

with oxaliplatin. C. Effects of other platinum drugs on DUT-N expression. HCT116

p53+/+ cells were treated with cisplatin (Cis), carboplatin (Carbo), or dachplatin (Dach)

for 24 or 48 h. Equal amounts of protein (10 μg) were separated by SDS-PAGE. Levels

of DUT-N protein, normalized against β-actin, are shown relative to the control for the

corresponding time point (defined as 1). Arrowheads and asterisk indicate DUT-N and

mitochondria isoform of dUTPase (DUT-M), respectively.

Figure 2. Oxaliplatin induces DUT-N downregulation and p53 accumulation, but

phosphorylation of Chk1 or Chk2 is marginal. A. Western blot. HCT116 p53+/+ cells

were treated with 10 μmol/L cisplatin (Cis) or 1 μmol/L oxaliplatin (Oxali) for 48 h.

Equal amounts of protein (10 μg) were separated by SDS-PAGE. Relative amounts of

DUT-N protein at each time point, normalized against β-actin, are shown relative to the

levels at 0 h (defined as 1). Arrowheads indicate DUT-N. B. Chk1 and Chk2

phosphorylation level. Bar graphs show the levels of phosphorylation of Chk1 at Ser345

and Chk2 at Thr68, normalized against total Chk1 and Chk2 protein, respectively,

relative to the phosphorylation levels at 24 h (Chk1) or at 48 h (Chk2) in

cisplatin-treated samples (defined as 1). C. p53 accumulation and p53 phosphorylation

level. Bar graphs show the amounts of p53 protein, normalized against β-actin, relative

to the level in the 10 μmol/L cisplatin-treated sample (p53: at 24 h) or the levels of

phosphorylation of p53 at Ser15 normalized against total p53 protein relative to the

phosphorylation level at 12 h in 10 μmol/L cisplatin-treated sample (defined as 1). D.

p21 accumulation and DUT-N dissipation. Bar graphs show the amounts of each protein,

normalized against β-actin, relative to the level in the 10 μmol/L cisplatin-treated

sample (p21: at 48 h) or in the no-drug control (DUT-N), respectively (defined as 1).

Figure 3. The MDM2 antagonist nutlin-3a downregulates DUT-N. A, C. HCT116 p53+/+

cells (A) or LoVo cells (C) were treated with no drug (Ctrl), 5 μmol/L nutlin-3a (Nut) or

5 μmol/L oxaliplatin (Oxali). Equal amounts of protein (20 μg) were separated by

SDS-PAGE. B, D. Levels of E2F3, E2F1 and DUT-N protein dissipation in HCT116

p53+/+ cells (B) or LoVo cells (D). Bar graphs show the amounts of each protein,

normalized against β-actin, relative to the levels in the no-drug control at each time

point (defined as 1). Arrowheads and asterisk indicate DUT-N and DUT-M,

respectively.

Figure 4. Oxaliplatin induces pri-miR-34a and downregulates DUT-N. A. Pri-miR34-a

expression. The amounts of pri-miR-34a, normalized against 18S rRNA, at each time

point after 5 μmol/L oxaliplatin (Oxali) treatment are shown relative to the level in the 0

h control (defined as 1). Error bars represent standard errors from three independent

experiments. Asterisks above graph bars indicate a statistically significant difference

(paired t-test) relative to the 0 h time point. Asterisks above brackets indicate a

statistically significant difference (unpaired t-test) between HCT116 p53+/+ and p53-/-

cells. *: p < 0.05, **: p < 0.01, ***: p < 0.001. B. DUT transcript expression. The

amounts of DUT transcript, normalized against GAPDH mRNA, at each time point after

5 μmol/L oxaliplatin treatment are shown relative to the levels in the 0 h control

(defined as 1). Error bars represent standard errors from three independent experiments.

Asterisks above graph bars indicate a statistically significant difference (paired t-test)

relative to the 0 h time point. *: p < 0.05, **: p < 0.01. C. Protein expression. Equal

amounts of protein (20 μg) were separated by SDS-PAGE. D. Quantitation of protein

expression. Bar graphs show the amounts of p53, p21, E2F3, E2F1 and DUT-N proteins,

normalized against β-actin, at each time point relative to the level after oxaliplatin

treatment for 48 h (p53 and p21) or 0 h (E2F3, E2F1, and DUT-N) (defined as 1). E.

Effect of ectopic expression of miR-34a mimic. HCT116 p53+/+ cells were transfected

either with control miRNA or miR-34a mimic. Equal amounts of protein (20 μg) were

separated by SDS-PAGE. The amounts of E2F1 and DUT-N proteins, normalized

against β-actin, at each time point are shown relative to the level in the control miRNA

transfection at 24 h (defined as 1). Arrowheads indicate DUT-N.

Figure 5. Oxaliplatin suppresses the expression of genes implicated in the thymidylate

biosynthesis pathway. A–C. mRNA expression. The amounts of DHFR (A), TK1 (B)

and TS (C) mRNA, normalized against GAPDH mRNA, in HCT116 p53+/+ and p53-/-

cells after 5 μmol/L oxaliplatin (Oxali) treatment are shown as relative to the level in

the control (Ctrl) at each time point (defined as 1). Error bars represent standard errors

from three independent experiments. Asterisks indicate statistically significant

differences (unpaired t-test) between control and oxaliplatin-treated samples. *:

p < 0.05, **: p < 0.01, ***: p < 0.001. D–E. Relative amount of dTTP in the dNTP

pool. D. HCT116 p53+/+ and p53-/- cells either untreated or treated with 5 μmol/L

oxaliplatin for 48 h. The relative amount was calculated as the level of dTTP normalized

against (+)-10-camphor sulfonic acid (10CS) in the control of each cell (defined as 1). E.

Oxaliplatin-treated HCT116 p53+/+ cells with ectopic TK1-3×FLAG expression. The

relative amount was calculated as the level of dTTP, normalized against 10CS from

HCT116 p53+/+ cells transfected with empty 3×FLAG expression vector (defined as 1).

Error bars represent standard errors from three independent experiments. # indicates

that signals from two of the three experiments were below the detection threshold. The

asterisks indicate statistically significant differences (unpaired t-test). **: p < 0.01, *:

p < 0.05.

Figure 6. Oxaliplatin represses thymidylate biosynthesis via the p53–miR-34a–E2F axis.

DACH-Pt-DNA adducts induced by oxaliplatin treatment effectively stabilize p53,

accompanied by phosphorylation at Ser15, by an unknown mechanism. Stabilized p53

transcriptionally activates cell-cycle regulatory genes (e.g., CDKN1A) and pri-miR-34a,

and represses Sp1-regulated genes. The expression of E2F3 and E2F1 is suppressed by

mature miR-34a. These events lead to the downregulation of genes encoding DUT-N

and thymidylate biosynthesis enzymes, dUTP accumulation and dTTP starvation,

possibly resulting in cytotoxicity caused by uracil-mediated DNA fragmentation.

The 1,2-diaminocyclohexane carrier ligand in oxaliplatin induces p53-dependent transcriptional repression of factors involved in thymidylate biosynthesis

Shinichi Kiyonari, Makoto Iimori, Kazuaki Matsuoka, et al.

Mol Cancer Ther Published OnlineFirst July 24, 2015.

Updated version Access the most recent version of this article at: doi:10.1158/1535-7163.MCT-14-0748

Supplementary Access the most recent supplemental material at: Material http://mct.aacrjournals.org/content/suppl/2015/07/29/1535-7163.MCT-14-0748.DC1

Author Author manuscripts have been peer reviewed and accepted for publication but have not yet been Manuscript edited.

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mct.aacrjournals.org/content/early/2015/07/24/1535-7163.MCT-14-0748. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.