The Year in Helicobacter 2020

EDITOR: David Y. Graham, M.D.

Guest Editors: Francis Mégraud & Peter Malfertheiner

Online only from 2011 The Year in Helicobacter

XXXIIIrd Internaঞ onal Workshop on Helicobacter & Microbiota in Inﬂ ammaঞ on & Cancer

Virtual Conference September 12, 2020

Guest editors: Francis Mégraud & Peter Malfertheiner

This publicaঞ on has been supported by European Helicobacter and Microbiota Study Group Helicobacter VOLUME 25 SUPPLEMENT 1 SEPTEMBER 2020

CONTENTS

REVIEW ARTICLES e12734 Review: Epidemiology of Helicobacter pylori Linda Mezmale, Luiz Gonzaga Coelho, Dmitry Bordin and Marcis Leja e12735 Review: Diagnosis of Helicobacter pylori infecঞ on Gauri Godbole, Francis Mégraud and Emilie Bessède e12736 Review: Pathogenesis of Helicobacter pylori infecঞ on Milica Denic, Elie e Touaࢼ and Hilde De Reuse e12737 Review - Helicobacter, inﬂ ammaঞ on, immunology and vaccines Karen Robinson and Philippe Lehours e12738 Review - Helicobacter pylori and non-malignant upper gastro-intesঞ nal diseases Chris ࢼ an Schulz and Juozas Kupcˇinskas e12739 Review: Gastric cancer: Basic aspects Carlos Resende, Carla Pereira Gomes and Jose Carlos Machado e12740 Review: Prevenঞ on and management of gastric cancer Marino Venerito, Alexander C. Ford, Theodoros Rokkas and Peter Malfertheiner e12741 Review: Extragastric diseases and Helicobacter pylori Rinaldo Pellicano, Gianluca Ianiro, Sharmila Fagoonee, Carlo R. Se anni and Antonio Gasbarrini e12742 Review: Helicobacter pylori infecঞ on in children Ji-Hyun Seo, Kristen Bortolin and Nicola L. Jones e12743 Review – Treatment of Helicobacter pylori infecঞ on 2020 Anthony O’Connor, Takahisa Furuta, Javier P. Gisbert and Colm O’Morain e12744 Review: Other Helicobacter species Annemieke Smet and Armelle Menard e12745 Abstracts e12746 Author Index e12747 Keywords Index

Helicobacter Test INFAI®

One of the most used 13C-urea breath tests for the diagnosis of Hp-infections worldwide

• New line of INFAI packaging and serialization according the EU’s Falsified Medicines Directive • More than 6.8 million Helicobacter Test INFAI performed worldwide • Registered in more than 40 countries worldwide • First approved Hp test for children from the ages of 3 to 11 • Modified Hp test for patients taking PPIs (REFEX) • Cost-effective CliniPac Basic for hospital and GPs use

INFAI GmbH Phone: +49 221 880 44-3 Riehler Str. 36 Fax: +49 221 880 44-55 50668 Cologne Email: [email protected], [email protected] Germany Web: www.infai.de, www.infai.co.uk New Instruments Generations in Breath Test Analysis

TIME FOR CHANGE

IR-FORCE 200 Android

IR-FORCE 200 Fancy

IR-FORCE 300 Plus

Beijing Richen - force Science & Technology Co. Ltd European Subsidiary: Richen Europe S.r.l., 4/A, Dian Tong Creative Square, Via San Cristoforo, 78 - 20090 Trezzano Sul Naviglio, Milano, Italy No.7 Jiuxianqiao North Street Chaoyang District, Beijing, China

DOI: 10.1111/hel.12734

REVIEW ARTICLE

Review: Epidemiology of Helicobacter pylori

Linda Mezmale1 | Luiz Gonzaga Coelho2,3 | Dmitry Bordin4,5,6 | Marcis Leja1,7

1Faculty of Medicine, Institute of Clinical and Preventive Medicine, University of Abstract Latvia, Riga, Latvia This review summarizes the recent knowledge on the epidemiology of Helicobacter 2 Alfa Institute of Gastroenterology, Clinics pylori and the potential modes of transmission. In addition to English language publica- Hospital, Federal University of Minas Gerais, Belo Horizonte, Brazil tions, the authors have included original full-text publications from Russia and Latin 3Faculty of Medicine, Federal University of America published in the original languages. High H pylori prevalence has been re- Minas Gerais, Belo Horizonte, Brazil ported in Russia, Jordan, Iran, China, and Latin American countries as well as in Arctic 4A. S. Loginov Moscow Clinical Scientific Center, Moscow, Russia populations in Canada. Indigenous inhabitants in the Arctic were found to be infected 5Tver State Medical University, Tver, Russia substantially more frequently than non-indigenous inhabitants. In Amsterdam, the 6 A.I. Yevdokimov, Moscow State University Netherlands, the ethnic minority groups were at a significantly higher risk of being H of Medicine and Dentistry, Moscow, Russia pylori seropositive compared to the Dutch population. For the first time, data on the 7Digestive Diseases Centre GASTRO, Riga, Latvia prevalence from Armenia have been published indicating 41.5% H pylori prevalence. Convincing evidence on the decline of H pylori prevalence in Southeast Hungary and Correspondence Marcis Leja, Faculty of Medicine, Institute of Taiwan was published. A study from Chile suggested high infection rates in newborns Clinical and Preventive Medicine, University during the first month after birth. Two meta-analyses covered the potential correlation of Latvia, 1 Gailezera, Riga LV1079, Latvia. Email: [email protected] between H pylori and periodontal diseases, therefore addressing the potential oro-oral transmission rates. Periodontal disease was found to be more prevalent in H pylori-in- Funding information FLPP (Fundamental and Applied Research fected subjects. Other studies addressed the potential role of drinking water and food Projects) Programme in Latvia products as well as socioeconomic factors in transmitting the infection. Several studies in Asia addressed annual reinfection rates of H pylori, ranging from 1.5% in China to 3.1% in Korea. Finally, a review was published on the current evidence and future per- spective of analysing H pylori in ancient human remains by a metagenomic approach.

KEYWORDS acquisition, ancient remains, epidemiology, H pylori, prevalence, reinfection, risk factors, transmission

1 | HELICOBACTER PYLORI PREVALENCE Netherlands (2011-2015), explored the prevalence of H pylori and WORLDWIDE CagA seropositivity among 4683 adults. H pylori seroprevalence was highest in the Ghanaian (84%), followed by Moroccan (81%), Turkish Several studies on H pylori prevalence were published during the last (66%), African Surinamese (51%), South-Asian Surinamese (48%), year. The key results of selected studies and reviews are briefly sum- and Dutch (17%) participants. All ethnic minority groups had a sig- marised below. nificantly higher risk of being H pylori seropositive compared to the Dutch group. All groups, except the Moroccans, had a significantly higher proportion of individuals with CagA + H pylori strains com- 1.1 | Europe pared to the Dutch participants.1 The epidemiological study in Southeast Hungary that inves- The HELIUS study (Healthy Life in an Urban Setting) having enrolled tigated H pylori infection in 1001 healthy blood donors by H py- a random sample of the largest ethnic groups in Amsterdam, The lori IgG serology reported a prevalence of 32%.2 A higher H pylori

8 prevalence was found among males (34.9% vs 29.2%, P = .052) was reported. The authors claim that this rate which is lower than and in rural areas (36.2% vs 27.9%, P = .005). Additionally, agri- in Linqu city and the rural region in Shandong Province as well as cultural/industrial workers were more likely to be positive than Shanghai city reflects the level of urbanisation, sanitation, and ac- office workers (38.3% vs 30.1%, P = .0095). Authors concluded cess to clean water as well as the socioeconomic status. No convinc- that the prevalence of H pylori infection decreased in recent de- ing increase in the prevalence with age was observed, yet a decline cades in Southeast Hungary (eg previous serological studies in in the infection was observed in individuals born between 1980 and blood donors conducted in 1993 and 1999 reported 63.3% and 2004.8 62.3% seroprevalence, respectively); however, it remains high in A small study from Taiwan reported 21.2% H pylori prevalence middle-aged rural populations.2 in asymptomatic adults and 37.9% prevalence in patients with dys- Results from a few recently published studies in Russian lan- pepsia. Older age and presence of dyspeptic symptoms were inde- guage on the prevalence of H pylori in Russia have also been in- pendently associated with a higher prevalence of H pylori infection. cluded. The prevalence of H pylori among medical employees was The authors claimed a decrease in the prevalence that was 54.4% in assessed in two cities in Russia – Moscow and Kazan (in Southwest 1992 in Taiwan.9 of Russia, capital of the Republic of Tatarstan) using the 13C-urea breath test (UBT) HELICARB (Russia) and locally validated methodology.3,4 The overall H pylori prevalence was 53% (52.6% men, 57.6% 1.3 | Middle East women) among 286 subjects. Higher prevalence was observed with increasing age: 44.1% were found to be infected in the age group Two studies reported high seroprevalence in the general population 18-24 years, and 66.6% in the group above 60 years. The prevalence of the Middle East region. of the infection in Moscow was substantially lower (49.8%) than in A cross-sectional study was conducted in Jordan (2015-2016) Kazan (67%). by enrolling asymptomatic individuals, relatives of health-seeking A serology-based study that conducted on healthy volunteers in individuals in randomly selected healthcare centres covering every Ryazan in central Russia (2017-2018) revealed IgG positivity (using governorate of the country. Altogether 88.6% of 460 study sub- IMMULITE 2000, Germany) in 65.6% of the adults and 20.8% of the jects were positive with an ELISA test (Enzygnost® anti-H pylori children not treated previously for H pylori.5 II IgG, Siemens, Munich, Germany). The factors associated with H The first study on the prevalence of H pylori in Armenia was pub- pylori positivity were: increased age (the highest prevalence was in lished in 2019. H pylori seropositivity was revealed in 41.5% (39.6% age ≥ 50 years (93.4%)), consumption of raw milk compared to those men, 42.0% women) of symptomatic health check-up attendees who did not consume milk, and location of residence. Drinking water based on an ELISA test (Enzygnost anti-H pylori II IgG, Siemens, sources, consumption of undercooked meat, and consumption of Munich, Germany). The lowest infection rate (13.6%) was reported traditional wild herbs were not associated with H pylori infection.10 in the youngest age group - 18-25 years, and the highest rate (83.3%) A study addressing the correlation between H pylori and cardio- in the age group over 65 years.6 vascular diseases was conducted in Karaj, Iran. A 68.0% seroprevalence was found among 97 adult subjects.11

1.2 | Asia 1.4 | Latin America and the Caribbean A prospective, cross-sectional study HIOC (Helicobacter pylori Infection in Oilfield Community) involving employees and their fam- The systematic review and meta-analysis by Curado et al included ily members was conducted in the Jidong community of Hebei prov- studies published between 1987 and 2012; 22 articles from 14 ince, China.7 Among the 4796 consecutive study subjects tested counties in Latin America and the Caribbean area were in the final by UBT, H pylori infection was present in 52.3%. The infection was analysis with a total population of 24 178 individuals. The overall found more frequently in married subjects than singles (P = .02), prevalence of H pylori infection was 57.6%; in children and adoles- those with a lower education level (P = .01), using barreled vs. piped cents the prevalence was 48.3%, and 69.2% in adults. It should be 12 water (P = .04), and more frequently consuming garlic (P = .03) noted that no difference was observed in relation to gender. as well as in alcohol consumers when compared to non-drinkers A retrospective study, based on reports of gastric endoscopic bi- (P = .02). Furthermore, responders that were familiar with the route opsies performed in a private laboratory affiliated with the Brazilian of H pylori transmission and related diseases had a lower prevalence Health System was performed by Rodrigues et al. The prevalence of the infection than those who were not aware (P = .01, P = .03, of H pylori was 31.7% (out of 4604 participants). Furthermore, the respectively).7 prevalence was significantly higher in patients consulting the pub- A large study originating from a third-tier (fast-growing small lic health service (42%) compared to patients consulting the private 13 and medium-sized cities) city, Wenzhou in China, was published, re- health service (25.6%), (P < .01). porting data on 53 260 study subjects having undergone medical The study led by Castabeda et al14 suggested a relatively high check-ups (2013-2017). Based on the UBT results, 48.4% prevalence prevalence of H pylori as well as virulent strains in the Peruvian MEZMALE et al. | 3 of 5 population. The prevalence of H pylori was 62.9% in the entire study A growing interest for H pylori infection in the oral cavity and its population and 60.8% in the gastric cancer subset. CagA was de- role in the oral-oral route of transmission was noted. A meta-analy- tected in 79.9% of H pylori-infected patients in the whole series; sis was performed on 11 studies including 1993 participants (1319 vacAs1 and vacAm1 alleles were identified in 41.6% and 60.7% of with chronic periodontitis (CP) and 674 controls) who had oral and the patients respectively. In addition, detection of Epstein Barr virus gastric H pylori tested by PCR and rapid urease test. When com- (EBV) with quantitative real-time polymerase chain reaction (qPCR) pared to the H pylori-negative population, H pylori-positive patients was performed on DNA using the Primerdesign EBV kit (Genesig had a significantly increased risk of CP (OR = 3.42, 95% CI = 2.71- Advanced, Southampton, UK) with a region of BNRF1 as the target. 4.31).19 Another meta-analysis of 13 studies involving 6800 patients, The prevalence of EBV was 14.1% in the entire study population, and also suggested that the risk of periodontal diseases in the patients it was higher in gastric cancer cases; a co-infection of H pylori and with oral H pylori positivity was 2.31 (95% CI, 1.00-2.68) times EBV was found in 7.8%, and it was also higher in the case of gastric higher than those with H pylori negativity.20 These findings suggest cancer.14 that periodontal pocketing and inflammation may favour H pylori A population-based study in Cuba indicated that among 1, 274 colonisation. three-year-old children, a 5% prevalence of H pylori infection, and positivity was associated with sleeping together. Furthermore, the protective factors were found to be drinking water from delivery 2.2 | Waterborne transmission trucks and living in a nuclear family unit.15 To address the potential role of aquatic environments and sewage sludge (SS) in the transmission of H pylori infection, a study was de- 1.5 | Arctic communities in North America signed to detect the presence of H pylori in different aquatic environments and in SS using PCR-based methods. A total of 88 samples The prevalence of H pylori infection in Western Canadian Arctic were collected from various aquatic environments as well as anaero- communities was investigated by Fagan-Garcia et al16 A total of 878 bically digested SS in the city of Isfahan, central part of Iran. Using H participants were recruited between 2008 and 2013, of whom 62% pylori 16S rRNA gene as target, H pylori was detected in 36% (14/39) were H pylori-positive (by UBT, histology and/or culture). The larg- of wastewater samples and 8% (2/25) of water samples, while ampli- est variation in prevalence concerned ethnicity, with non-indigenous fication of the ureA gene yielded in only two positive samples, which participants having a much lower prevalence (22%) than indigenous indicates a lack of specificity of the first target. None of the SS sam- participants (66%). Furthermore, the prevalence of atrophic gastritis ples were positive for H pylori. The authors suggest that H pylori can was 43% among H pylori-positive individuals, and the prevalence of be detected in drinking well water samples without the detection of intestinal metaplasia was 17%.16 faecal coliform bacteria which are commonly used as an indicator of water quality.21 A cross-sectional study among the tribal (Mizo origin) popu- 2 | HELICOBACTER PYLORI ACQUISITION lation in Northeast India was performed to evaluate the peculiar habit of the use of tobacco smoke-infused aqueous solution called The acquisition and transmission of H pylori infection remain debat- "tuibur" on H pylori infection. H pylori infection was searched in able. Direct person-to-person transmission (oral-oral, gastro-oral, 475 endoscopic samples by the rapid urease test and PCR ampli- faecal-oral, breastfeeding and iatrogenic pathways) appears to be fication of the ureC gene. The use of "tuibur" was associated with the main route.17 Other routes of transmission were investigated an increased OR of H pylori infection (OR: 3.32; 95% Cl, 1.95-5.83). including waterborne, zoonotic, milk ingestion-based and raw veg- The habit of "tuibur" consumption may be a contributing factor to etable-based, each of which requiring a contaminated intermediate the high prevalence of H pylori infection and gastritis among the environmental reservoir. Mizo population.22 A high positivity rate of H pylori contamination in drinking water has been implicated as one of the causes of the high gastric cancer 2.1 | Person-to-person transmission rates observed in some countries. A Peruvian study aimed to detect the presence of H pylori in the tap water in the homes of 82 recently To study the dynamics of colonisation/infection by H pylori during diagnosed gastric cancer patients in Lima city. Water samples were the first six months of life, Chilean authors evaluated faecal speci- analysed for hspA and ureA genes by qPCR H pylori was detected mens from 67 mothers prior to giving birth, and from their children in 69.5% of gastric tissues and in 12.2% of analysed tap water. No at seven days, one month and six months of age by using a stool an- correlation was identified between gastric infection and water con- 23 tigen test. 71.6% of the pregnant mothers were positive for H pylori. tamination (70% vs 69.4%, P = .971). During the first month of life, prevalence and incidence of the infec- Several studies addressed the prevalence of H pylori in seafood. tion were 23.9% and 13%, respectively. These results suggest that The presence of vacA by qPCR was found in Spanish commercial sea- there is a high risk of H pylori infection during the first month of life.18 food samples; it was positive in 12 of 100 samples, with 67% (8/12) 4 of 5 | MEZMALE et al. identified in mussels, 25% (3/12) in clams, and only 8% (1/12) in on epidemiologic studies between Tibetan and Han populations31 by cockles.24 Another study showed that H pylori was able to survive in considering the high prevalence of infection in Tibet. artificially contaminated mussels for six days, two days in a cultivable Finally, Maixner et al32 reviewed available data on ancient human form and four days in a non-cultivable form.25 remains to demonstrate the presence of H pylori. While the best evidence so far is available for the European Copper Age mummy known as Iceman, other studies on the analysis of stomach tissue 2.3 | Raw vegetable-based transmission or stool samples in mummified materials from Chile, Mexico, Alaska, and South Korea are being discussed. Based on these achievements, It has been suggested that H pylori can also be acquired from the investigators are currently collecting and analysing further an- vegetables. Free-living amoebae are protozoans found in vegeta- cient contents and coprolites by metagenomic diagnostic approach bles.26 They are transmission vehicles for amoeba-resistant bacte- and genome reconstruction.32 ria, among which H pylori was included.26 In a study of 20 lettuce (Lactuca sativa) samples from different shops located in Eastern ACKNOWLEDGEMENTS Spain, no H pylori was detected, neither by molecular techniques The work was supported by the FLPP (Fundamental and Applied nor by culture. However, intra-amoebic H pylori DNA was detected Research Projects) Programme in Latvia, Project nr lzp-2018/1-0135 by means of PMA-qPCR in 55% of the samples and viable intra- "Research on implementation of a set of measures for prevention amoebic H pylori cells in 25% of the samples using the DVC-FISH of gastric cancer mortality by eradication H. pylori and timely rec- technique.26 ognition of precancerous lesions." Luiz Gonzaga Coelho had support from Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), Brazil. 2.4 | Milk ingestion-based transmission CONFLICT OF INTEREST Household animal's milk has been assumed to be a probable source The authors have declared no disclosures of interests related to this of H pylori infection in humans. The first study in Algeria regard- work. ing the zoonotic aspect of H pylori was performed. Cows' milk and faecal samples were used to detect and identify H pylori using a REFERENCES bacteriology culture method. Out of 200 sera and 200 milk sam- 1. Alberts CJ, Jeske R, de Martel C, et al. Helicobacter pylori sero- ples, 12% and 4% were positive, respectively, for the H pylori IgG prevalence in six different ethnic groups living in Amsterdam: The HELIUS study. Helicobacter. 2020;25(3):e12687. antibody. The glmM gene was also detected in the milk of 13% of 2. Balint L, Tiszai A, Kozak G, et al. Epidemiologic characteristics the cows and was confirmed in all cows presenting H pylori IgG in of Helicobacter pylori infection in southeast Hungary. World J the milk.27 Gastroenterol. 2019;25(42):6365-6372. 3. Plavnik RG, Bakulina NV, Mareyeva DV, Bordin DS. Helicobacter pylori epidemiology: clinical and laboratory parallels. In Russian. Effective Pharmacotherapy. Gastroenterology. 2019;15(36):16-20. 3 | REINFECTION 4. Bordin DS, Plavnik RG, Nevmerzhitskiy VI, et al. Prevalence of Helicobacter pylori among medical workers in Moscow and Kazan 13 Several studies were published on the reinfection rates of H pylori. according to C-urease breath test. In Russian. Almanac Clin Med. In a large cohort from South Korea (10 468 eradicated subjects), re- 2018;46(1):40-49. 5. Zhestkova TVBM, Lymar YuYu, Papkov SV. The prevalence of infection of H pylori was calculated to occur at the rate of 3.06% per Helicobacter pylori infection among population of Ryazan region, 28 person-year. In a multi-centre prospective, observational study Russian. IP Pavlov Russian Med Biol Herald. 2019;27(1):35-40. in China involving 5193 subjects, the annual reinfection rate was 6. Gemilyan M, Hakobyan G, Benejat L, et al. Prevalence of Helicobacter 1.5%.29 Reinfection was associated with the following risk factors: pylori infection and antibiotic resistance profile in Armenia. Gut Pathog. 2019;11:28. minority groups (HR 4.7, 95% CI, 1.6-13.9), a low level of educa- = 7. Wang W, Jiang W, Zhu S, et al. Assessment of prevalence and risk tion (HR = 1.7, 95% CI, 1.1-2.6), a family history of gastric cancer factors of Helicobacter pylori infection in an oilfield Community in (HR = 9.9, 95% CI, 6.6-14.7), and the residence located in Western Hebei, China. BMC Gastroenterol. 2019;19(1):186. 8. Hong W, Tang HL, Dong XL, et al. Prevalence of Helicobacter pylori China (HR = 5.5, 95% CI, 2.6-11.5) following by Central China infection in a third-tier Chinese city: relationship with gender, age, (HR 4.9, 95% CI, 3-8.1) (all P .05).29 = < birth-year and survey years Microb. Health Dis. 2019;1:e150. 9. Chen MJ, Fang YJ, Wu MS, et al. Application of Helicobacter pylori stool antigen test to survey the updated prevalence of Helicobacter pylori 4 | FURTHER STUDY PLANS infection in Taiwan. J Gastroenterol Hepatol. 2020;35(2):233-240. 10. Obaidat MM, Roess AA. First nationwide seroepidemiology and risk factors report of Helicobacter pylori in Jordan. Helicobacter. Two study protocols for systemic reviews were published: for a sys- 2019;24(3):e12572. tematic review of H pylori prevalence in Southwest China30 to address 11. Afsharpooyan S, Mohammadian T. Seroepidemiology study of longitudinal changes during recent periods, and for a; meta-analysis Helicobacter pylori infection and its effect on cardiovascular MEZMALE et al. | 5 of 5

diseases in Karaj, Iran. Monoclon Antib Immunodiagn Immunother. 23. Castillo M, Bernabe L, Castaneda CA, et al. Helicobacter pylori de- 2019;38(6):277-281. tected in tap water of Peruvian patients with gastric cancer. Asian 12. Curado MP, de Oliveira MM, de Araujo FM. Prevalence of Pac J Cancer Prev. 2019;20(11):3193-3196. Helicobacter pylori infection in Latin America and the Caribbean 24. Pina-Perez MC, Gonzalez A, Moreno Y, Ferrus MA Helicobacter py- populations: A systematic review and meta-analysis. Cancer lori detection in shellfish: A real-time quantitative polymerase chain Epidemiol. 2019;60:141-148. reaction approach. Foodborne Pathog Dis. 2019;16(2):137-143. 13. Rodrigues MF, Guerra MR, Alvarenga AVR, Souza DZO, Costa 25. Quaglia NC, Storelli MM, Scardocchia T, et al. Helicobacter py- R, Cupolilo SMN Helicobacter pylori infection and gastric can- lori: Survival in cultivable and non-cultivable form in artifi- cer precursor lesions: Prevalence and associated factors in a cially contaminated Mytilus galloprovincialis. Int J Food Microbiol. reference laboratory in Southeastern Brazil. Arq Gastroenterol. 2020;312:108363. 2019;56(4):419-424. 26. Moreno-Mesonero L, Hortelano I, Moreno Y, Ferrus MA. Evidence 14. Castaneda CA, Castillo M, Chavez I, et al. Prevalence of Helicobacter of viable Helicobacter pylori and other bacteria of public health in- pylori infection, its virulent genotypes, and Epstein-Barr virus in terest associated with free-living amoebae in lettuce samples by Peruvian patients with chronic gastritis and gastric cancer. J Glob next generation sequencing and other molecular techniques. Int J Oncol. 2019;5:1-9. Food Microbiol. 2020;318:108477. 15. Venero-Fernández SJ, Ávila-Ochoa I, Menocal-Herredia L, et al. 27. Guessoum M, Guechi Z, Adnane M. First-time serological and mo- Prevalencia y factores asociados a infección por Helicobacter pylori lecular detection of Helicobacter pylori in milk from Algerian lo- en preescolares de La Habana, Cuba. Estudio de base poblacional. cal-breed cows. Veterinary World. 2018;11(9):1326-1330. Revista de Gastroenterología de México. 2020;85(2):151-159. 28. Choi YK, Ahn JY, Won SH, et al. Eradication rate of Helicobacter 16. Fagan-Garcia K, Geary J, Chang HJ, et al. Burden of disease from pylori reinfection in Korea: A retrospective study. J Gastroenterol Helicobacter pylori infection in western Canadian Arctic communi- Hepatol. 2019;34(10):1696-1702. ties. BMC Public Health. 2019;19(1):730. 29. Xie Y, Song C, Cheng H, et al. Long-term follow-up of Helicobacter 17. Zaman C, Osaki T, Furuta Y, et al. Enhanced infectivity of strains of pylori reinfection and its risk factors after initial eradication: a large- Helicobacter pylori isolated from children compared with parental scale multicentre, prospective open cohort, observational study. strains. J Med Microbiol. 2019;68(4):633-641. Emerg Microbes Infect. 2020;9(1):548-557. 18. Merino JS, Araneda L, Linconir-Campos P, Parra C, Saez K, Garcia 30. Wang R, Bai D, Xiang W, et al. Helicobacter pylori prevalence in the A. Dynamics of Helicobacter pylori infection in infants during Southwest of China: A protocol for systematic review. Medicine. the first six months of life, Spanish. Enferm Infecc Microbiol Clin. 2020;99(11):e19369. 2019;37(2):109-111. 31. Bai D, Wang AM, Liu K, et al. Prevalence difference of Helicobacter 19. Wei X, Zhao H-Q, Ma C, et al. The association between chronic pylori infection between Tibetan and Han ethnics: The pro- periodontitis and oral Helicobacter pylori: A meta-analysis. PLoS tocol of a meta-analysis on epidemiologic studies. Medicine. One. 2019;14(12):e0225247. 2019;98(52):e18566. 20. Chen Z, Cai J, Chen YM, et al. A meta-analysis of the association be- 32. Maixner F, Thorell K, Granehall L, et al. Helicobacter pylori in ancient tween the presence of Helicobacter pylori and periodontal diseases. human remains. World J Gastroenterol. 2019;25(42):6289-6298. Medicine. 2019;98(22):e15922. 21. Farhadkhani M, Nikaeen M, Hassanzadeh A, Nikmanesh B. Potential transmission sources of Helicobacter pylori infection: detection of How to cite this article: Mezmale L, Coelho LG, Bordin D, H pylori in various environmental samples. J Environ Health Sci Eng. Leja M. Review: Epidemiology of Helicobacter pylori. 2019;17(1):129-134. 22. Mukherjee S, Madathil SA, Ghatak S, et al. Association of to- Helicobacter. 2020;25(Suppl. 1):e12734. https://doi. bacco smoke-infused water (tuibur) use by Mizo people and org/10.1111/hel.12734 risk of Helicobacter pylori infection. Environ Sci Pollut Res Int. 2020;27(8):8580-8585.

DOI: 10.1111/hel.12735

REVIEW ARTICLE

Review: Diagnosis of Helicobacter pylori infection

Gauri Godbole1 | Francis Mégraud2,3 | Emilie Bessède2,3

1Gastrointestinal Pathogens Unit, National Infection Service, Public Health England, Abstract London, UK New imaging techniques are still the topic of many evaluations for both the diagnosis 2 Inserm U1053 Bariton, University of of Helicobacter pylori gastritis and the detection of early gastric cancer. Concerning Bordeaux, Bordeaux, France 3National Reference Centre for invasive tests, there were studies on the reuse of the rapid urease test material for Campylobacters and Helicobacters, other tests, and a novel fluorescent method to be used for histology but with limited Bacteriology Laboratory, Pellegrin Hospital, Bordeaux, France sensitivity. Progress occurred essentially in the molecular methods area, especially next-generation sequencing which is applied to detect both H pylori and the muta- Correspondence Francis Mégraud, Centre National de tions associated with antibiotic resistance. For non-invasive tests, a few studies have Référence pour les Campylobacters et been published on the validity of breath collection bags, the shortening of the testing Hélicobacters, Laboratoire de Bactériologie, Hôpital Pellegrin, Place Amélie Raba Léon, time, the performance of different analysers or the added value of citric acid in the 33076 Bordeaux, France. protocol. The accuracy of serological immunochromatographic tests is also improv- Email: [email protected] ing. Multiplex serology detecting antibodies to certain proteins allows confirmation of a current infection. Dried blood spots can be used to collect and store blood without a loss of accuracy. Finally, the serum antibody titer can be useful in predicting the risk of gastric cancer. Several stool antigen tests were evaluated with good results, and a novel test using immunomagnetic beads coated with monoclonal antibodies is potentially interesting. PCR detection in stools can also be effective but needs an efficient DNA extraction method. The use of easyMAG® (bioMérieux) combined with Amplidiag® H pylori + ClariR (Mobidiag) appears to be powerful.

KEYWORDS linked colour imaging, new generation sequencing, rapid urease test, serology, stool antigen test, urea breath test

1 | ENDOSCOPIC DIAGNOSIS first aim was to determine the sensitivity and specificity of the new method vs WLI. LCI always performed better than WLI with sensi- New endoscopic techniques, especially linked colour imaging (LCI) tivity and specificity for LCI ranging from 83.8% to 85.4% and 79.5% and blue laser imaging (BLI), were extensively evaluated this year ei- to 99.5%, respectively (Table 1). ther for the diagnosis of Helicobacter pylori gastritis or the detection The difficulty stemmed from the fact that there are different of early gastric cancer (EGC). stages of H pylori gastritis, from active inflammation to atrophy In the first case, the studies followed a similar protocol. and intestinal metaplasia, which exhibit very different aspects. Endoscopy was performed with the new imaging technique as well Nevertheless in their study, Wang et al concluded that identification as white light imaging (WLI) on a group of patients for whom the of H pylori gastritis by LCI was especially reliable in the corpus.1 In H pylori status was established by various methods. Several images another study by Jiang et al, using a score of 3.5 as the cut-off value, were obtained from different parts of the stomach and submitted sensitivity and specificity were 83.8% and 99.5%, respectively, for blindly to a group of endoscopists (at least 4) for evaluation. The the diagnosis of H pylori gastritis among 358 patients.2 Ono et al3

Helicobacter. 2020;25(Suppl. 1):e12735. wileyonlinelibrary.com/journal/hel © 2020 John Wiley & Sons Ltd | 1 of 6 https://doi.org/10.1111/hel.12735 2 of 6 | GODBOLE et al. found that LCI significantly improved the accuracy of active gastritis 2 | INVASIVE TESTS diagnosis in patients with a past H pylori infection. Takeda et al also compared BLI-bright in their evaluation, following the Kyoto classi- 2.1 | Rapid urease test fication of gastritis on 261 patients. All endoscopists reported improved visibility with LCI, but BLI-bright was the best for detecting A review on the continuing use of the rapid urease test (RUT) high- intestinal metaplasia.4 Zhu et al5 confirmed that the LCI mode gave lighted the advantages of this cheap, rapid, and specific assay, but the best rates for H pylori infection and BLI-bright with magnification reminded the readers of its limited sensitivity, with potential false- for atrophy and intestinal metaplasia. negative results with standard commercial assays if the bacterial The microvascular architecture pattern of the gastric mucosa load is less than 104 in the biopsy. Furthermore, false-positive results was used with success to predict the H pylori status or atrophy in a may occur with some urease positive bacteria, eg Staphylococcus study carried out in Ecuador.6 capitis ureolyticus.13 A study from Germany compared various com- Studies using artificial intelligence (AI) were also carried out mercial RUTs and found them to be equally sensitive and specific last year. The presence of H pylori infection determined by LCI for H pylori diagnosis and surprisingly more sensitive than histology was “learned” through machine learning. A validation protocol after previous exposure to PPI and/or antibiotics.14 In addition, the was then performed. Images from 105 consecutive patients were gastric biopsy used for the RUT can be reused for other tests like submitted in comparison to the diagnosis made by experienced H pylori PCR. Given that a small proportion of GCs are caused by endoscopists leading to a sensitivity and specificity of 90.4% Epstein Barr virus (EBV), the RUT material was reused for a qPCR and 85.7% respectively, with no significant difference regarding targeting the EBV oriP gene in a Japanese study. Out of 10 cases, H the diagnosis of the endoscopists.7 A convolutional neural net- pylori was detected in nine and EBV in four.15 work was also evaluated on 452 patients in a validation cohort, resulting in a sensitivity and specificity of 81.4% and 90.1%, respectively.8 2.2 | Histology With regard to detection of EGC after H pylori eradication, LCI significantly improved the mean visibility scores and coloured dif- Detection of H pylori by histology is still one of the most commonly ferences compared to WLI, leading to significantly lower miss rates used diagnostic methods by regular staining or immunostaining. A 9 compared to WLI (30.7% vs 64.0%). In a similar study, Majima novel method using γ-glutamyl transpeptidase (GGT) activatable fluo- et al noted map-like redness and the absence of regular arrange- rescent probe was proposed this year. The γ-glutamyl hydroxy methyl ments of collecting venules as a feature of EGC.10 The difference rhodamine green probe reacts with GGT and immediately produces in colour contrast has been used as an objective way of quantifying fluorescence. It was used ex-vivo on gastric biopsies to quantify the colours with the so-called red, green and blue (RGB) pixel brightness GGT activity of H pylori. Its main advantage is the rapidity of the result combined with LCI. A receiver operating characteristic (ROC) curve (15 min) while the sensitivity is still limited (75%-82%).16 was calculated for differentiating cancer from non-cancer. They ob- Another study focused on pathology and also showed the role of H tained an area under the curve of 0.767 with a sensitivity of 60.5% pylori on Brunner's gland hyperplasia and hamartomas in the duodenum.17 and a specificity of 92.1%. Given the progress in endoscopy both for the diagnosis of H pylori infection and the evaluation of gastric cancer (GC) risk, 2.3 | Molecular methods the endoscopic Kyoto classification published in 2013 has been reevaluated.11 2.3.1 | PCR The Italian Society of Digestive Endoscopy also applied valid quality indicators to endoscopy wards in the country. They noted PCR including the assay targeting the 16S rRNA gene confirmed to failures on some points, especially concerning H pylori sampling be a far more sensitive method for H pylori detection in gastric biop- which had not been done in 30% of the centres.12 sies compared to other methods.18

TABLE 1 Performances of endoscopic methods to detect Helicobacter pylori gastritis

Author Technique No. patients/No. Hp+ Sensitivity Specificity Reference 1 Wang et al LCI 103/27 85.4 79.7 Histology + RUT 2 Jian et al LCI 358/127 83.8 99.5 Histology + RUT 3 Ono et al LCI 127/ 84.4 88.9 UBT + Serology 7 Yasuda et al LCI + AI 105/42 90.4 85.7 2 methods among histology, serology, SAT, UBT 8 Zheng et al WLI + CNN 452/104 91.6 98.6 IHC ± UBT Abbreviations: AI, artificial intelligence; CNN, convolutional neural network; IHC, immunohistochemistry; LCI, linked colour imaging; RUT, rapid urease test; SAT, stool antigen test; UBT, urease breath test; WLI, white light imaging. GODBOLE et al. | 3 of 6

Evolving antibiotic resistance continues to be a critical problem 3 | NON-INVASIVE TESTS in the management of H pylori and before culture, real-time (RT)- PCR is being used increasingly given its high sensitivity and specific- 3.1 | Urea breath test ity, its turnaround time of a few hours and its convenient transport conditions. Several commercial RT-PCRs are available, they have the Few articles have been published during this past year concerning added value of detecting macrolide resistance conferred by three urea breath tests (UBT). One study evaluated the validity of breath mutations (A2142G, A2143G and A2142C) on the 23S rRNA gene. collection bags in detecting H pylori on more than 250 patients using Only one commercial assay, a line probe assay (Genotype HelicoDR the BreathID Hp Lab System (Exalenz Bioscience Ltd, Israel).28 This assay, Hain Lifescience, Germany), detects common point mutations system contains an application to control the process and can meas- in both the 23S rRNA gene and the gyrA gene (N87K, D91G, D91N, ure up to 10 sets of bags consecutively and automatically within ap- D91Y) to determine clarithromycin and levofloxacin resistance, proximately 25 minutes. In comparison to histology and RUT, the respectively.13 authors concluded that this system is highly accurate and has several advantages compared to the previous BreathID Hp device, eg the possibility to analyse more samples simultaneously and the good 2.3.2 | Next-generation sequencing stability of the bags facilitating the transport. Another article aimed to compare a short vs a standard sampling The decrease in sequencing costs now allows the addition of next- time during UBT, the BREATHQUALITY UBT (AB Analitica, Padua, generation sequencing (NGS) to the armamentarium to detect H Italy).29 The authors obtained comparable accuracy by shortening pylori and its antibiotic resistance. Using NGS, detection of H pylori the testing time to 15 minutes. mutations that are known to confer resistance to clarithromycin, lev- A prospective study was carried out to compare two devices: ofloxacin, and tetracycline was undertaken directly from formalin- the IRIS-Doc2 (Wagner Analysen-Technik, Germany, now Mayoly fixed paraffin-embedded (FFPE) gastric biopsy specimens on an Ion Spindler Group, France) and the BreathID Hp Lab System used as Torrent (Thermo Fischer) platform in the USA: 133 H pylori positive the reference.30 Five hundred eighteen patients were enrolled and gastric biopsy specimens were identified histologically and subse- each filled two bags prior to the test and two bags after ingestion of quently analysed by NGS to detect mutations in gyrA, 23S rRNA, and the test solution with the same protocol. The correlation between 16S rRNA genes. The method successfully detected H pylori in 126 the two devices was excellent confirming that a single protocol can of 133 cases (95% sensitivity). Mutations conferring resistance were give similar results with different devices. present in 92 cases (73%), including 63 cases with one mutation A study evaluated the effect of citric acid on the accuracy of (50%) and 29 cases with mutations in several genes (23%). In the 58 UBT. In this prospective study, 1207 H pylori positive patients re- cases where treatment history was available, there was a good cor- ceived UBT after a successful eradication treatment. They were then relation between therapy failure and the number of mutated genes: divided into two groups: one received a citric acid meal whereas the no failure in cases with no mutation (0/15), 19% (5/27) failure in other one did not. The UBT values after use of citric acid were signifi- cases with one gene mutation, and 69% (11/16) failure in cases with cantly higher compared to the control group (P < .001). In addition, more than one mutated gene. Common 23S rRNA gene mutations 122 patients were also evaluated by endoscopic biopsy methods. (A2142G or A2143G) were present in 88% (14/16) of failed cases as Compared to invasive tests, there was no significant difference in opposed to only 10% (4/42) of eradicated cases (P < .001). Although the UBT performance between the two groups, even if gastric atro- this is a small study, it shows the feasibility of NGS to detect multid- phy and intestinal metaplasia decreased UBT accuracy.31 rug resistance in culture negative biopsies. It can be used on clinical Finally, a meta-analysis by Abd Rahim et al, reported the differ- specimens collected during standard of care.19 ent 13C-UBT accuracy studies conducted in Asia.32 In total, 15 pro- A study in Switzerland showed a high congruence of >99% be- tocols were referenced and analysed by the authors. Sensitivity and tween phenotypic antibiotic susceptibility results for clarithromycin, specificity of the studies were excellent, even if heterogeneity was levofloxacin, and rifampicin and single nucleotide polymorphisms observed in the different evaluations. However, the review shows (SNPs) identified in the 23S rRNA, gyrA, and rpoB genes using whole that it is possible to reduce heterogeneity by adjusting for the dose genome sequencing (WGS). However, it was not possible to infer a and breath sample collection time. resistance phenotype for metronidazole based on the occurrence of distinct SNPs in frxA and rdxA genes.20 The same good correlation was also found in Cambodia.21 Other studies, using WGS analysis of 3.2 | Serology H pylori strains isolated from gastric biopsies, described new mutations or identification of multiple mutations conferring resistance to A study performed in Japan aimed to evaluate the diagnostic accu- rifampicin, metronidazole and amoxicillin.22-24 racy of four commercially available kits, 2 ELISA kits and 2 latex im- Other studies using NGS platforms were also carried out to munoassay kits for the detection of H pylori infection. Kits were all study the virulence genes of H pylori25,26 as well as to decipher the manufactured in Tokyo, Japan, coming from Eiken Chemical Co, Ltd, gastric and duodenal microbiota.27 or Denka Seiken Co, Ltd. The diagnostic accuracy was determined 4 of 6 | GODBOLE et al. using samples from 213 dyspeptic patients, and UBT was the refer- commercialised kits: Vstrip®HpSA, ImmunoCard STAT!® Campy ence. The authors concluded that, in terms of accuracy, the latex im- (Meridian), another ICT, and an ELISA, Premier Platinum HpSA® PLUS munoassays are as reliable as ELISAs but they have some advantages (Meridian). UBT was considered as the gold standard. Performances in terms of time and cost.33 of the 2 ICTs were similar. They are very convenient and showed an A study performed primarily on African-Americans in the excellent agreement with the ELISA.39 Southeastern United States aimed to detect active infection by se- Finally, a novel SAT has been developed to detect H pylori using ropositivity to H pylori proteins. They measured antibody responses immunomagnetic beads coated with monoclonal antibodies captur- to 13 H pylori proteins using multiplex serology in serum samples of ing the bacterium coupled with a polyclonal antibody-conjugating a training set (n = 78) and validation set (n = 49) collected concur- quantum dot probe. The final detection was achieved using a fluo- rently from patients undergoing UBT. To determine sensitivity, a cut- rescence spectrometer. This test provides a novel potential method off was applied to achieve 90% specificity. They finally concluded for non-invasive detection of the H pylori faecal antigens but further that seropositivity to ≥2 of H pylori proteins VacA, GroEl, HcpC, and testing in clinical studies is needed.40 HP1564 indicates active H pylori infection at high specificity and sensitivity and may allow an approximation of the prevalence of active H pylori infection in large cohorts.34 3.4 | Molecular tests Another study evaluated the utility of dried blood spots (DBS) in detecting H pylori infection in comparison to classical serology. A Concerning molecular tests in stool samples, a study compared an total of 264 paired DBS samples prepared from intravenous blood optimised high throughput, semi-automated workflow to a refer- (IVB) were stored at 4°C, then at −20°C after a period of 24, 48 and ence manual workflow previously described to detect H pylori and 72 hours. Specific IgG antibodies detected by ELISA in DBS were com- its resistance to clarithromycin on unpreserved stools and gastric pared with those from IVB. No significant difference between these 2 biopsies. For this study, material from 96 symptomatic patients was pre-analytical processes was observed confirming that DBS collected collected and DNA extracted in parallel with both the Magna Pure even in field conditions can be used for detecting H pylori infection.35 96 (Roche) and the QIAamp Fast Stool kit (Qiagen). Results obtained Finally, a study was performed to clarify the role of anti-H pylori from stools and gastric biopsies showed that the semi-automated antibodies in the evolution to GC by combining them with the Kyoto workflow can be used to detect and genotype H pylori. Cut-off tem- classification endoscopic score. A multivariate analysis carried out peratures were different between stools and gastric biopsies.41 on 874 cases revealed that nodularity, atrophy, and age between A prospective multicentre study including 1200 patients was ® 40-59 years were correlated with a high serum antibody titer in H performed to evaluate the Amplidiag H pylori + ClariR assay which pylori-infected patients. In summary, serum antibody titer changes can detect H pylori and its resistance to clarithromycin in stools. The with age, reflects gastric mucosal inflammation, and is useful in pre- results of the assay performed on DNA extracted from stools using dicting the risk of GC.36 an automatic extraction (EasyMAG® bioMérieux) were compared with the results obtained with culture/E-test and a quadruplex real-time PCR performed on two gastric biopsies to detect the H pylori 3.3 | Stool antigen tests glmM gene and mutations in the 23S rRNA genes conferring clarithromycin resistance. In this cohort, only 160 patients were positive. ® Opekun et al evaluated the clinical performance of the automated The sensitivity and specificity of the Amplidiag H pylori + ClariR LIAISON® Meridian H pylori stool antigen test (SAT). The test was used assay were respectively 96.3% and 98.7%.42 on 277 patients for whom an endoscopy was performed. Compared Seligova et al aimed to find a reliable nested PCR for the detection to a composite reference test including histology, culture and a RUT, of H pylori in stools, gastric biopsies and saliva. After having tested the the LIAISON® Meridian H pylori SAT gave a sensitivity of 95.5% and a different published nested PCRs, the authors designed a new one to specificity of 97.6% confirming its usefulness in detecting H pylori.37 avoid the lack of specificity of the primers previously used. Thus, they An ELISA, the RIDASCREEN® (R-Biopharm, Darmstadt, Germany) used primers targeting the variable regions of the 16S rRNA gene. and an immunochromatography test (ICT), the RIDAQUICK® Eighty-one patients were enrolled, and the material was collected (R-Biopharm), were evaluated on 266 stool samples from patients simultaneously. The sensitivity of their nested PCR in gastric biop- in comparison to a chemiluminescence assay, the LIAISON® H pylori sies was equivalent to that of UBT, but it was much lower in stools. SA. Results were in concordance, showing that the 2 kits can be used Concerning, saliva, the nested PCR was able to detect H pylori but for H pylori detection.38 correlation with its presence in the stomach was not relevant.43 A Taiwanese study aimed to determine accuracy of a new ICT, the Vstrip® H pylori stool antigen rapid test (Vstrip®HpSA) (Vstrip, Taiwan), in the detection and surveillance of H pylori prevalence 3.5 | Other tests in Taiwan. A total of 347 subjects were included in the study, 152 asymptomatic volunteers and 195 symptomatic patients. Stool Aumpan et al reported their experience using a rapid urine test to de- samples were collected and tested for H pylori with three different tect H pylori antibodies. Gastric biopsies from 94 dyspeptic patients GODBOLE et al. | 5 of 6 were collected and H pylori detected by RUT, culture and histopa- in the era of next generation sequencing. World J Gastroenterol. 2019;25(32):4629-4660. thology. Urine samples collected at the same time were tested with 14. Dechant F-X, Dechant R, Kandulski A, et al. Accuracy of different ® the RAPIRUN H pylori antibody test (Otsuka Pharmaceutical., Ltd). rapid urease tests in comparison with histopathology in patients The rapid urine test was indeed less efficient than the other tests with endoscopic signs of gastritis. Digestion. 2020;101(2):184-190. with a specificity of 90.8% and a sensitivity of 86.2%.44 15. Yanai H, Iizasa H, Chihara D, Murakami T, Nishikawa J, Yoshiyama A frequent problem in the evaluation of a new test is the lack H. Epstein-Barr Virus detection using gastric biopsy specimens after rapid urease test for Helicobacter pylori. Endosc Int Open. of reference. The use of latent class analysis to evaluate different 2019;7(4):E431-E432. H pylori diagnostic tests was proposed for such cases. This model 16. Akashi T, Isomoto H, Matsushima K, et al. A Novel method for rapid uses a combination of observed and estimated results. The authors detection of a Helicobacter pylori infection using a γ-Glutamyltrans- showed that the use of latent class analysis is possible to evaluate H peptidase-activatable fluorescent probe. Sci Rep. 2019;9(1):9467. 17. Destek S, Gul VO. Brunner’s gland hyperplasias and hamartomas pylori tests based on histology, SAT and serology.45 in association with Helicobacter pylori. Can J Gastroenterol Hepatol. 2019;2019:1-6. CONFLICT OF INTEREST 18. Szymczak A, Ferenc S, Majewska J, et al. Application of 16S The authors declare no conflict of interest for this article. rRNA Gene Sequencing in Helicobacter pylori detection. PeerJ. 2020;8:e9099. 19. Nezami BG, Jani M, Alouani D, Rhoads DD, Sadri N Helicobacter pylori REFERENCES mutations detected by Next-Generation Sequencing in Formalin- 1. Wang L, Lin X-C, Li H-L, et al. Clinical significance and influ- fixed, paraffin-embedded gastric biopsy specimens are associated encing factors of linked color imaging technique in real-time with treatment failure. J Clin Microbiol. 2019;57(7):e01834-18. diagnosis of active Helicobacter pylori infection. Chin Med J. 20. Lauener FN, Imkamp F, Lehours P, et al. Genetic determinants and 2019;132(20):2395-2401. prediction of antibiotic resistance phenotypes in Helicobacter pylori. 2. Jiang Z, Nong B, Liang L, Yan Y, Zhang G. Differential diagnosis of J Clin Med. 2019;8(1):53. Helicobacter pylori-associated gastritis with the linked-color imaging 21. Tuan VP, Narith D, Tshibangu-Kabamba E, et al. A Next-Generation score. Dig Liver Dis. 2019;51(12):1665-1670. Sequencing-based approach to identify genetic determinants of an- 3. Ono S, Dohi O, Yagi N, et al. Accuracies of endoscopic diagnosis tibiotic resistance in Cambodian Helicobacter pylori clinical isolates. of Helicobacter pylori-gastritis: multicenter prospective study using J Clin Med. 2019;8(6):858. white light imaging and linked color imaging. Digestion. 2019;1-7. 22. Qureshi NN, Gallaher B, Schiller NL. Evolution of amoxicillin resis- https://doi.org/10.1159/000501634 tance of Helicobacter pylori in vitro : characterization of resistance 4. Takeda T, Asaoka D, Nojiri S, et al. Linked color imaging and the Kyoto mechanisms. Microb Drug Resist. 2014;20(6):509-516. Classification of Gastritis: evaluation of visibility and inter-rater reli- 23. Miftahussurur M, Cruz M, Subsomwong P, et al. Clarithromycin- ability. Digestion. 2019;1-10. https://doi.org/10.1159/000501534 based triple therapy is still useful as an initial treatment for 5. Zhu Y, Wang F, Zhou Y, et al. Blue laser magnifying endoscopy in the Helicobacter pylori infection in the Dominican Republic. Am J Trop diagnosis of chronic gastritis. Exp Ther Med. 2019;18:1993-2000. Med Hyg. 2017;96:1050-1059. 6. Robles-Medranda C, Valero M, Puga-Tejada M, et al. High-definition 24. Saranathan R, Levi MH, Wattam AR, et al. Helicobacter pylori infec- optical magnification with digital chromoendoscopy detects gastric tions in the Bronx, New York: surveying antibiotic susceptibility mucosal changes in dyspeptic-patients. World J Gastrointest Endosc. and strain lineage by whole-genome sequencing. J Clin Microbiol. 2020;12(1):23-32. 2019;58(3):e01591-19. 7. Yasuda T, Hiroyasu T, Hiwa S, et al. Potential of automatic diagnosis 25. Aftab H, Miftahussurur M, Subsomwong P, et al. Two populations of system with linked color imaging for diagnosis of Helicobacter pylori less-virulent Helicobacter pylori genotypes in Bangladesh. PLoS One. infection. Dig Endosc. 2020;32(3):373-381. 2017;12(8):e0182947. 8. Zheng W, Zhang X, Kim JJ, et al. High accuracy of convolutional 26. Imkamp F, Lauener FN, Pohl D, et al. Rapid characterization of vir- neural network for evaluation of Helicobacter pylori infection ulence determinants in Helicobacter pylori isolated from non-atro- based on endoscopic images: preliminary experience. Clin Transl phic gastritis patients by next-generation sequencing. J Clin Med. Gastroenterol. 2019;10(12):e00109. 2019;8(7):1030. 9. Kitagawa Y, Suzuki T, Nankinzan R, et al. Comparison of endoscopic 27. Han H, Lee S-Y, Oh S, Moon H, Cho H, Kim J-H. Correlations of the visibility and miss rate for early gastric cancers after Helicobacter gastric and duodenal microbiota with histological, endoscopic, and pylori eradication with white-light imaging versus linked color imag- symptomatic gastritis. J Clin Med. 2019;8(3):312. ing. Dig Endosc. 2019;32:769-777. 28. Richter V, Gonzalez JO, Hazan S, et al. The validity of breath col- 10. Majima A, Dohi O, Takayama S, et al. Linked color imaging iden- lection bags method in detecting Helicobacter pylori using the tifies important risk factors associated with gastric cancer after Novel BreathID ® Hp Lab System: a Multicenter Clinical Study in 257 successful eradication of Helicobacter pylori. Gastrointest Endosc. Subjects. Ther Adv Gastrointest Endosc. 2019;12:263177451984340. 2019;90(5):763-769. 29. Molina-Molina E, Bonfrate L, Lorusso M, et al. Faster detection of 11. Toyoshima O, Nishizawa T, Koike K. Endoscopic Kyoto classification Helicobacter pylori infection by 13 C-Urea Breath Test. Comparing of Helicobacter Pylori infection and gastric cancer risk diagnosis. short versus standard sampling time. J Gastrointest Liver Dis. World J Gastroenterol. 2020;26(5):466-477. 2019;28:151-161. 12. Spinzi G, Milano A, Brosolo P, et al. The Italian Society for Digestive 30. Coelho LGV, Trindade OR, Leão LA, Ribeiro HG, Freitas IS, Coelho Endoscopy (SIED) Accreditation and Quality Improving Project MCF. Prospective study for validation of a single protocol for the Based on International Standards. Endosc Int Open. 2020;8(3):E33 13C-Urea breath test using two different devices in the diagnosis 8-E345. of H. pylori infection. Arq Gastroenterol. 2019;56(2):197-201. 13. Pohl D, Keller PM, Bordier V, Wagner K. Review of current diag- 31. Kwon YH, Kim N, Yoon H, Shin CM, Park YS, Lee DH. Effect of citric nostic methods and advances in Helicobacter Pylori diagnostics acid on accuracy of 13 C-Urea Breath Test after Helicobacter pylori 6 of 6 | GODBOLE et al.

eradication therapy in a region with a high prevalence of atrophic 40. Chen L, Li X, Zou T, et al. Ultrasensitive detection of H pylori in gastritis. Gut Liv. 2019;13(5):506-514. human feces based on immunomagnetic bead capture and fluores- 32. Abd Rahim MA, Johani FH, Shah SA, Hassan MR, Abdul Manaf MR. cent quantum dots. The Analyst. 2019;144(13):4086-4092. 13C-urea breath test accuracy for Helicobacter pylori infection in the 41. Clines N, Beckman E. Development of a high throughput human Asian Population: a meta-analysis. Ann Glob Health. 2019;85(1):110. stool specimen processing method for a molecular Helicobacter pylori 33. Kawai S, Arai K, Lin Y, et al. Comparison of the detection of Clarithromycin Resistance Assay. PLoS One. 2019;14(12):e0224356. Helicobacter pylori infection by commercially available serologi- 42. Pichon M, Pichard B, Barrioz T, et al. Diagnostic accuracy of a non- cal testing kits and the 13C-Urea Breath Test. J Infect Chemother. invasive test for detection of Helicobacter Pylori and resistance to 2019;25(10):769-773. clarithromycin in stool by the Amplidiag H Pylori +ClariR Real-Time 34. Butt J, Blot WJ, Shrubsole MJ, et al. Performance of multiplex serol- PCR Assay. J Clin Microbiol. 2020;58(4):e01787-19. ogy in discriminating active vs past Helicobacter pylori infection in a 43. Šeligová B, Lukáč Ľ, Bábelová M, Vávrová S, Sulo P. Diagnostic reli- primarily African American population in the Southeastern United ability of nested PCR depends on the primer design and threshold States. Helicobacter. 2020;25(1):12671. abundance of Helicobacter pylori in biopsy, stool, and saliva samples. 35. Kumar A, Mhatre S, Dikshit R. Utility of dried blood spots in de- Helicobacter. 2020;25(2):12680. tecting Helicobacter pylori infection. Indian J Med Microbiol. 44. Aumpan N, Vilaichone R-K, Chotivitayatarakorn P, et al. High effi- 2019;37(4):514. cacy of rapid urine test for diagnosis of Helicobacter pylori infection 36. Toyoshima O, Nishizawa T, Sakitani K, et al. Serum Anti- Helicobacter in Thai People. Asian Pac J Cancer Prev. 2019;20(5):1525-1529. pylori antibody titer and its association with gastric nodularity, 45. Jekarl DW, Choi H, Kim JY, et al. Evaluating diagnostic tests for atrophy, and age: a cross-sectional study. World J Gastroenterol. Helicobacter pylori infection without a reference standard: use of 2018;24(35):4061-4068. latent class analysis. Ann Lab Med. 2020;40(1):68. 37. Opekun AR, Zierold C, Rode A, et al. Clinical performance of the automated LIAISON® Meridian H. pylori SA Stool Antigen Test. BioMed Res Int. 2020;2020:1-6. How to cite this article: Godbole G, Mégraud F, Bessède E. 38. Ignatius R, Berg C, Weiland C, et al. Accurate detection of Review: Diagnosis of Helicobacter pylori infection. Helicobacter pylori antigen in human stool specimens by two novel immunoassays. Eur J Microbiol Immunol. 2019;9(2):29-31. Helicobacter. 2020;25(Suppl. 1):e12735. https://doi. 39. Fang Y-J, Chen M-J, Chen C-C, et al. Accuracy of rapid Helicobacter org/10.1111/hel.12735 pylori antigen tests for the surveillance of the updated prevalence of H. pylori in Taiwan. J Formos Med Assoc. 2020. https://doi. org/10.1016/j.jfma.2019.12.003

DOI: 10.1111/hel.12736

REVIEW ARTICLE

Review: Pathogenesis of Helicobacter pylori infection

Milica Denic1,2 | Eliette Touati1 | Hilde De Reuse1

1Département de Microbiologie, Institut Pasteur, UMR CNRS 2001, Unité Abstract Pathogenèse de Helicobacter, Paris, France The original strategies developed by Helicobacter pylori to persistently colonise its 2 Sorbonne Paris Cité, Cellule Pasteur, host and to deregulate its cellular functions make this bacterium an outstanding Université Paris Diderot, Paris, France model to study host-pathogen interaction and the mechanisms responsible for bac- Correspondence terial-induced carcinogenesis. During the last year, significant results were obtained Eliette Touati and Hilde De Reuse, Institut Pasteur, Unité Pathogenèse de Helicobacter, on the role of bacterial factors essential for gastric colonisation such as spiral shape 28, rue du Docteur Roux, 75724 Paris Cedex maintenance, orientation through chemotaxis and the formation of bacteria clonal 15, France. Emails: [email protected]; population islands inside the gastric glands. Particularities of the H pylori cell sur- [email protected] face, a structure important for immune escape, were demonstrated. New insights in

Funding information the bacterial stress response revealed the importance of DNA methylation-mediated Institut Pasteur, Grant/Award Number: regulation. Further findings were reported on H pylori components that mediate Transversal Research Program (PTR 73- 17), Donation of Janssen and Odyssey natural transformation and mechanisms of bacterial DNA horizontal transfer which Reinsurance companies; Agence Nationale maintain a high level of H pylori genetic variability. Within-host evolution was found de la Recherche, Grant/Award Number: ANR16-CE18-0026-03 and ANR15- to be niche-specific and probably associated with physiological differences between CE17-0015; Fondation pour la Recherche the antral and oxyntic gastric mucosa. Médicale, Grant/Award Number: DBF20161136767 In addition, with the progress of CryoEM, high-resolution structures of the major virulence factors, VacA and CagT4SS, were obtained. The use of gastric organoid models fostered research revealing, preferential accumulation of bacteria at the site of injury during infection. Several studies further characterised the role of CagA in the oncogenic properties of H pylori, identifying the activation of novel CagA- dependent pathways, leading to the promotion of genetic instabilities, epithelial-to- mesenchymal transition and finally carcinogenesis. Recent studies also highlight that microRNA-mediated regulation and epigenetic modifications, through DNA methylation, are key events in the H pylori-induced tumorigenesis process.

KEYWORDS cagT4SS, chemotaxis, DNA methylation, gastric organoids, H pylori cell shape, miRNA, natural transformation, oncogenesis, VacA

1 | INTRODUCTION and non-enzymatic proteins that act as scaffolds. With three recent publications,1-3 the group of N.R Salama made significant progress 1.1 | Helicobacter pylori shape and surface in the characterisation of the corresponding actors and underlying mechanisms. Using a genome-wide screen, they identified Csd7, The helical cell shape of H pylori facilitates efficient colonisation of an integral inner membrane protein, as an essential determinant of the human stomach. This shape is generated and maintained by the H pylori helical shape that is important for efficient mouse colonisa- action of a combination of peptidoglycan (PG) modifying enzymes tion.1 Through protein-protein interaction with two other cell shape

Helicobacter. 2020;25(Suppl. 1):e12736. wileyonlinelibrary.com/journal/hel © 2020 John Wiley & Sons Ltd | 1 of 6 https://doi.org/10.1111/hel.12736 2 of 6 | DENIC et al. determinants, the Csd1 periplasmic PG endopeptidase, the Csd2 import of transforming DNA during NT into the periplasm. ComH protein and interaction with the filament forming bactofilin CcmA, binds DNA at its C-terminal domain and delivers it to the ComEC inner Csd7 was found to stabilise Csd1. In H pylori, cell shape is controlled membrane channel, a complex able to translocate DNA into the cy- by a highly orchestrated program recruiting many partners that form toplasm.7 Mobile elements like integrative and conjugative elements a “helical shapesome.” A combination of 3D confocal microscopy and (ICEs) represent an important source of genetic diversity among volumetric image analysis was applied to characterise the colonisa- bacteria. Weiss et al characterised the excision/integration and hori- tion of murine gastric glands by a H pylori ∆csd6 straight rod mutant.2 zontal transfer characteristics of H pylori ICEHptfs4. They reported This mutant was found to be attenuated shortly after infection but that transfer of this ICE is independent of its conjugation genes and it then persists during chronic colonisation although eliciting less that homologous recombination is more efficient than site-specific inflammation. Helical shape maintenance implies the control of sev- integration into the recipient chromosome.8 Understanding H pylori eral cell parameters such as diameter, length and helical pitch. By population dynamics inside the gastric environment during infection applying quantitative 3D microscopy analysis of short pulses with is a question of major interest. The genomes of H pylori strains from metabolic probes, Taylor et al revealed that cell growth is enhanced multiple gastric biopsies taken from different stomach regions were at both sidewall curvature extremes and they observed increased analysed by Ailloud et al.9 They observed that within-host evolution levels of the actin-like filament MreB and CcmA at negative and pos- of H pylori is niche-specific and probably associated with the physi- itive Gaussian curvature sites of the bacterium, respectively. These ological differences existing between the antral and oxyntic gastric two proteins thus promote PG synthesis at specific sites and this mucosa. Evidence of natural selection of niche-specific genotypes patterning is one mechanism maintaining the helical shape.3 was revealed for functions such as chemotaxis, regulatory functions The H pylori lipopolysaccharide (LPS) surface structures play an and outer membrane proteins that probably contribute to specific important role in the interaction with the host and in immune es- adaptation to the antral and oxyntic mucosa. Finally, they found cape. Li et al established the first complete LPS biosynthesis path- that antibiotic exposure can induce population bottlenecks; this is way using H pylori strain G27 as a model. Analysing this pathway in undoubtedly an important parameter that shapes the "within-host" a large panel of H pylori strains from different ethnic origins, they population structure of H pylori in patients.9 found that the genes involved in LPS heptan incorporation are lacking in East-Asian strains.4 Given the high gastric cancer (GC) rate in East-Asia, this observation opens interesting questions on a poten- 1.3 | Regulation of gene expression and tial role of LPS heptan in H pylori pathogenesis. H pylori phospholipid stress response composition is also unusual in that it contains a large proportion of cyclopropane fatty acids (CFA). Jiang et al identified the gene en- Response generated by inefficient DNA repair mechanisms, com- coding CFA synthase, hp0416. This function is dispensable for H py- petencefor natural transformation (NT) and high levels activation lori in vitro growth but a ∆hp0416 mutant presents increased acid of heat-shock proteins ensuring cell protection. Promotor sequence sensitivity, disruption of membrane permeability and reduced ca- methylation is an understudied level of gene regulation in bacte- pacity to survive in murine macrophages and to colonise the mouse ria. Narayanan et al showed that a type III DNA methyltransferase, stomach.5 Finally, a major actor in the biogenesis pathway of H pylori M.HpyAXI, whose expression is upregulated at low pH, forms an ac- cell-envelope polysaccharides was identified by Gasiorowski et al.6 tive tetramer able to bind DNA and regulate essential genes, only HupA, an enzyme combining undecaprenyl pyrophosphatase with during acid stress. The M.HpyAXI is thus an enzyme licensed to act phosphatidylglycerol phosphate phosphatase plays a dual function only under acidic conditions like those encountered by H pylori in the in synthesis of cell-wall polysaccharides and phospholipids. HupA is gastric niche.10 essential for murine stomach colonisation and is involved in cationic In H pylori, HrcA is a major repressor known to regulate the ex- anti-microbial peptide (CAMP) resistance. These results underline pression of genes encoding crucial chaperones. Using whole genome the importance of maintaining PG and LPS composition while facing RNA-sequencing, Roncarati et al found that 49 genes were dereg- the hostile gastric niche.6 ulated in an hrcA mutant. The HrcA regulon includes genes coding for chaperones and stress-related proteins as well as other genes encoding functions important for H pylori survival and virulence.11 1.2 | Natural transformation, mobile genetic elements and within-host genomic evolution 1.4 | Gastric colonisation and microbiota H pylori displays exceptionally high genetic diversity and variability that is generated by inefficient DNA repair mechanisms, competence Colonisation of the gastric epithelium by H pylori relies on its ca- for natural transformation (NT) and high levels of recombination. NT pacity to swim into the mucus and its preference for injury sites of allows bacteria to import DNA from the environment and internalise the stomach, a tropism that relies on chemotaxis. Using a murine it into the cytoplasm where it can be integrated into the genome. gastric organoids (gastroids) model in which single cell damage could Damke et al showed that the ComH protein is a receptor for the be introduced by photodamage and subsequent repair monitored, DENIC et al. | 3 of 6

Aihara et al demonstrated that H pylori rapidly accumulates at the Activation of the NF-ΚB signalling pathway leading to massive damage site in an actin polymerization-dependent mechanism and interleukin 8 (IL8) production represents a major inflammatory re- locally limits repair.12 The actual chemoattractant sensed by H pylori sponse of human epithelial cells to infection by H pylori strains with is unknown but the TlpB chemoreceptor was shown to be required a functional T4SS. Several publications recently reported that this for the orientation of the bacteria to the repair site.13 activation relies on the ALPK1-TIFA signalling axis and that the H py- TlpD, one of the four H pylori chemoreceptors, is a non-canonical lori-produced signalling molecule (PAMP) for this axis is heptose cytosolic transducer-like protein important for stomach antrum colo- 1,7-bisphosphate (HBP), an LPS intermediate. However, Pfannkuch nisation. Perkins et al showed that bleach (hypochlorous acid, HOCl) et al identified ADP-glycero-beta-D-manno-heptose (ADP heptose), is a powerful chemoattractant for TlpD. They established a reconsti- a derivative of HBP, as the predominant activator of the ALPK1-TIFA tuted full chemotaxis signalling complex in vitro assay in which HOCl signalling axis.19 The mechanism of translocation or uptake of ADP was sensed at micromolar concentrations by TlpD, much lower con- heptose into host cells and the extent of the cagT4SS contribution centrations than other reactive oxygen species (ROS). The predicted remains to be established. physiological source of HOCl is neutrophils and chemoattraction to Passage of H pylori through the mouse model is known to cause this molecule may constitute a strategy of H pylori to persist in the the loss of T4SS function, which is frequently associated with re- neutrophil-infiltrated gastric glands in order to acquire important combination in the cagY gene that encodes a T4SS core complex pro- nutrients.14 tein. Hansen et al analysed a collection of mouse-passaged strains Chemotaxis can also influence global bacterial behaviour such as and found that, among those that had lost T4SS functionality, 51% biofilms. An H pylori self-produced quorum sensing molecule, autoin- presented recombination in cagY and, for the others, they identified ducer-2 (AI-2), was previously found to act as a chemorepellent and inactivation of 13 additional essential cagT4SS genes, mainly cag5, to reduce biofilm formation. Agent-based models (ABMs) are useful cag10 and cagA.20 tools for exploring the influence of simple interactions between cells Toll-like receptors (TLRs) are innate immune receptors. H py- on the properties of bacterial communities. Using ABM, Sweeney lori has recently been shown to activate the expression of TLR5. et al provide new insights into how local chemotactic behaviour can However, the archetypal activator of TLR5 is flagellin, a protein that, shape H pylori biofilms.15 in H pylori, lacks the conserved and essential D1 interaction domain. How H pylori persists in the human stomach was investigated Here, the authors discovered that one of the cagT4SS components, by Fung et al who propose a model involving the establishment of the protein CagL present at the tip of the secretion pilus, can act as H pylori in a microenvironment deep in the gastric glands.16 The a TLR5 activator. CagL possesses a D1-like motif and is necessary for infection of adult or neonate mice with PMSS1 isogenic H pylori NF-ΚB activation in a TLR5-dependent manner. Using Tlr5-knockout strains, differentially fluorophore-tagged, coupled to quantitative mice, they showed that TLR5 is important for efficient control of 3D confocal microscopy and passive CLARITY technique (PACT) H pylori infection possibly by modulating the immune response.21 analysis, showed bacteria clonal population islands inside glands. It is now well established that the H pylori cagT4SS exploits the Only few bacteria initiated colonisation, leading to glands resistant specific interaction between the bacterial HopQ adhesin and the to subsequently added bacteria. The bacterial density was age- and CEACAM cellular adhesion molecules for translocation of CagA into T-cell response-dependent. As supported by computer simulation, human gastric epithelial cells. In the study of Behrens et al, the role gland colonisation expanded locally as patches by infecting adja- of this interaction on immune cells was studied.22 Using human and cent glands. The authors proposed that gastric glands constitute CEACAM-humanised (hCEACAM) mouse PMNs, they found that a micro-niche for H pylori, allowing a continuous reinfection of the the H pylori HopQ-dependent interaction strongly enhanced CagA superficial mucosa.16 H pylori colonisation also impacts the gastric translocation and phosphorylation. PMNs but not macrophages or microbial community. Mongolian gerbils infected with H pylori strain dendritic cells from hCEACAM mice significantly upregulated the 7.13 and isogenic ∆cagA mutant presented CagA-dependent alter- proinflammatory chemokine MIP-1-alpha. In a model of chronic ations of the gastric mucosal microbiota diversity which evolves with mouse infection, the hCEACAM1 and −6 receptors were found to be the severity of gastric lesions.17 downregulated on neutrophils. These data reveal an important role of H pylori-CEACAM interaction for CagA translocation into neutrophils, a probable strategy of the pathogen to regulate the host im- 1.5 | Virulence factors mune response during the progression of gastric pathology.22

1.5.1 | The cag type 4 secretion system (cagT4SS) 1.5.2 | The VacA vacuolating cytotoxin Injection of the H pylori CagA oncoprotein into gastric epithelial cells relies on the cagT4SS system and causes important cellular dys- VacA is a major virulence factor of H pylori. This secreted toxin inserts regulation that, in some cases, lead to the development of GC. The into the host cell membranes to form chloride-sensitive channels and high-resolution structure of this system, one of the largest bacterial impairs host endolysosomal trafficking, causing an accumulation of secretion system assemblies, has recently been solved.18 dysfunctional lysosomes and autophagosomes. The role of intracellular 4 of 6 | DENIC et al.

H pylori bacteria is still a matter of debate as it is estimated to represent Palrasu et al addressed the question of how the gastric cells re- only 1% of the total colonising bacteria. However, Capurro et al found solve the strong oxidative and genotoxic stress caused by H pylori. that VacA usurped lysosomal and autophagy pathways to generate Using human gastric tissues and infected animals, they identified a protective intracellular reservoir where H pylori survives and, in a the proapoptotic factor Siva1, as a new actor in the host response. mouse model, can be protected from antibiotic treatment and lead to H pylori enhances Siva1 ubiquitination and proteasomal degradation, recrudescence of the infection.23 These effects depend on the capac- through induction of the XIAP E3 ubiquitin ligase via the PI3K/Akt ity of VacA to impair the activity of the TRPML1 calcium channel, a pathway activation. This process is p53-independent and relies on key player in the endolysosomal pathway. In both H pylori-infected cells an intact Cag T4SS. 29 in vitro and in human gastric organoids, a small-molecule agonist of The upstream stimulating factor 1 (USF1) is a basic-He- TRPML1 reverses the toxic effects of VacA culminating in the clear- lix-Loop-Helix (bHLH) transcription factor, known to stabilise p53 in ance of intracellular bacteria.23 Therefore, TRPML1 is a promising response to genotoxic stress. Costa et al reported a protective role therapeutic target for future treatments against H pylori. of USF1 against H pylori-induced carcinogenesis. In Usf1-/- mice, they Many detailed functional and structural studies of VacA have showed that the lack of USF1 accelerated H pylori-induced dysplasia, been performed. However, two recent publications by Zhang et al 24 concomitantly with p53 depletion.30 In vitro, in GECs, H pylori inhib- and Su et al 25 reported the high-resolution structure of full length its nuclear levels of USF1 and p53 and induces USF1 foci close to cell soluble VacA protein in protomeric and oligomeric forms. Cryo- membranes. This mechanism which impairs p53 and USF1 nuclear electron microscopy of VacA s1m1 purified from H pylori was used function promotes genetic instabilities.30 Another bHLH transcrip- in both studies. The models of full length VacA protomer are highly tion factor, BHLHE40, is upregulated during H pylori infection by conserved among the different oligomers. Structure analysis leads activation of a CagA-dependent ERK signaling pathway.31 Through to a mechanistic model where VacA hexamer would be the pre- p-STAT3 interaction, BHLHE40 promotes CXCL12 production and pore-forming state. These studies provide structural insights into contributes to gastric inflammation. These novel findings contribute the process of VacA oligomerization and a molecular model for the to the understanding of how H pylori increases survival of human VacA membrane binding and channel formation. cells with damaged DNA. Finally, Wroblewski et al investigated how H pylori causes aberrant stem cell activation, a landmark of the carcinogenesis process. 1.6 | Host-pathogen interaction The leucine-rich repeats and Ig-like domains 1 (Lrig1) is known to mark a distinct population of progenitor cells. Using a model of ex 1.6.1 | Host response and CagA vivo Lrig1 progenitor cells and following specific Lrig1 lineage ex- oncogenic properties pansion in a mouse model, they found that H pylori infection increased Lrig1-expressing cells in a cag-dependent manner. In human Understanding the mechanisms by which the CagA oncoprotein samples, Lrig1 expression was increased in pre-malignant lesions. promotes H pylori carcinogenic activity is a very important ques- They concluded that chronic H pylori infection stimulates Lrig1- tion. Using a human gastric organoids model, Buti et al found that expressing progenitor cells, which may contribute to promote gastric the apoptosis-stimulating protein of p53 2 (ASPP2), contributed to carcinogenesis.32 the survival of CagA-positive H pylori bacteria in gastric organoids. CagA–ASPP2 protein interaction promoted remodelling of the par- titioning-defective (PAR) polarity complex and led to cell polarity 1.6.2 | Epigenetic regulation and microRNA loss.26 response to H pylori infection A major consequence of CagA injection is cell transformation by promoting an epithelial-to-mesenchymal transition (EMT)-like Genome-wide DNA methylation analysis of human gastric tissue phenotype thereby disrupting cell junctions and enhancing motil- revealed H pylori-induced CpG methylation that is inflammation- ity and invasiveness of the infected cells. Upon contact with gastric triggered. In line with this, chronic inflammation in H pylori-infected epithelial cells (GECs), H pylori activates signalling pathways such as mice was found to be associated with the inhibition of the telomer- Hippo, an important player in the promotion of EMT. The tumour ase reverse transcriptase (TERT) gene expression, as a consequence suppressors LATS1/2 and their substrate YAP1 are components of DNA hypermethylation of its promoter.33 DNA methylation mi- of the Hippo pathway which, once activated, restricts tissue over- croarray analysis in the context of H pylori-triggered chronic inflam- growth. As reported by Molina-Castro et al, H pylori upregulates mation allowed Yamashita et al to show that targets of aberrant LATS2 and YAP1. LATS2 protects GECs against H pylori-mediated DNA methylation differ between "old" and "young" human gastric aberrant differentiation, characterised by the induction of EMT and mucosae.34 MicroRNA are small non-coding RNAs that mediate the development of intestinal metaplasia.27 Interestingly, the lyso- post-transcriptional regulation. Interestingly, microRNA genes were somal associated protein transmembrane 4ß (LAPTM4B), previously also found to be susceptible to aberrant methylation. Chen et al, re- proposed as prognostic factor in GC, is induced in H pylori-infected ported CagA-dependent DNA methylation in the promoter of the GECs and participates in EMT.28 TRPM3 gene that encodes miR-204.35 During evolution of gastritis DENIC et al. | 5 of 6 lesions to preneoplasia, the progressive increase of TRPM3 DNA in Helicobacter pylori is essential for colonization of the stomach. PLoS Pathog. 2019;15(9):1-24. methylation results in a gradual decrease in miR-204 levels. One 7. Damke PP, Di Guilmi AM, Fernández Varela P, et al. Identification miR-204 target is the BIRC2 gene that is overexpressed in GC pa- of the periplasmic DNA receptor for natural transformation of tients with a poor prognosis. By targeting BIRC2, miR-204 inhibits Helicobacter pylori. Nat Commun. 2019;10(1):5357. TNFα-mediated activation of NF-ΚB signalling pathways, as shown 8. Weiss E, Spicher C, Haas R, Fischer W. Excision and transfer of an in cancer GECs. With a xenograft model, they showed that over- integrating and conjugative element in a bacterial species with high recombination efficiency. Sci Rep. 2019;9(1):8915. expression of miR-204 inhibited tumour growth.35 Also using xeno- 9. Ailloud F, Didelot X, Woltemate S, et al. Within-host evolution of graft model and GECs cultures, Ou et al demonstrated the oncogenic Helicobacter pylori shaped by niche-specific adaptation, intragastric properties of another microRNA, miR-155. In H pylori-infected cells, migrations and selective sweeps. Nat Commun. 2019;10(1):2273. miR-155 which is induced in a CagA-dependent manner, suppresses 10. Narayanan N, Banerjee A, Jain D, et al. Tetramerization at low pH licenses DNA methylation activity of M.HpyAXI in the presence of the Kruppel-like transcription factor 4 (KLF4) expression, leading to acid stress. J Mol Biol. 2020;432(2):324-342. 36 promotion of EMT and tumorigenesis. miR-155 was also found to 11. Roncarati D, Pinatel E, Fiore E, Peano C, Loibman S, Scarlato V be upregulated during gastric MALT lymphoma development both Helicobacter pylori stress-response: definition of the HrcA regulon. in patients and mice, together with miR-150, miR-196a and miR- Microorganisms. 2019;7(10):1-11. 12. Aihara E, Medina-Candelaria NM, Hanyu H, et al. Cell injury trig- 138 that could act synergistically in common signalling pathways to gers actin polymerization to initiate epithelial restitution. J Cell Sci. 37 promote lymphomagenesis. Furthermore, specific miRNAs may 2018;131(16):jcs216317. contribute to H pylori persistence and carcinogenesis. As shown 13. Hanyu H, Engevik KA, Matthis AL, Ottemann KM, Montrose MH, by Codolo et al, expression of the class II major histocompatibility Aihara E Helicobacter pylori uses the TlpB receptor to sense sites of gastric injury. Infect Immun. 2019;87(9):e00202-e219. complex transactivator (CIITA) is inhibited through upregulation of 14. Perkins A, Tudorica DA, Amieva MR, James Remington S, Guillemin let-7f-5p, let-7i-5p, miR-146b-5p and miR-185-5p in H pylori-infected K Helicobacter pylori senses bleach (HOCl) as a chemoattractant macrophages as well as in gastritis, preneoplasia and GC patients.38 using a cytosolic chemoreceptor. PLoS Biol. 2019;17(8):e3000395. These recent studies highlight that epigenetic modifications through 15. Sweeney EG, Nishida A, Weston A, et al. Agent-based modeling demonstrates how local chemotactic behavior can shape biofilm DNA methylation and microRNA-mediated regulation are key events architecture. mSphere. 2019;4(3):e00285-19. in the H pylori-induced tumorigenesis process. 16. Fung C, Tan S, Nakajima M, et al. High-resolution mapping reveals that microniches in the gastric glands control Helicobacter pylori col- ACKNOWLEDGMENTS onization of the stomach. PLoS Biol. 2019;17(5):1-28. We want to thank all the members of the Unité Pathogenèse de 17. Noto JM, Zackular JP, Varga MG, et al. Modification of the gastric mucosal microbiota by a strain-specific Helicobacter pylori oncopro- Helicobacter at the Institut Pasteur in Paris. Our research is funded tein and carcinogenic histologic phenotype. MBio. 2019;10(3):1-15. by the Institut Pasteur Transversal Research Program (PTR#73 18. Chung JM, Sheedlo MJ, Campbell AM, et al. Structure of -17), by donations of Janssen and the Odyssey Reinsurance com- the Helicobacter pylori Cag type IV secretion system. Elife. pany, by funding from the Agence Nationale de la Recherche 2019;8:e47644. 19. Pfannkuch L, Hurwitz R, Trauisen J, et al. ADP heptose, a novel (ANR16-CE18-0026-03; ANR15-CE17-0015) and from the pathogen-associated molecular pattern identified in Helicobacter "Fondation pour la Recherche Médicale" (FRM-DBF20161136767). pylori. FASEB J. 2019;33(8):9087-9099. 20. Hansen LM, Dekalb DJ, Cai LP, Solnick JV. Identification of patho- CONFLICT OF INTERESTS genicity island genes associated with loss of type IV secretion function during murine infection with Helicobacter pylori. Infect Immun. The authors declare no conflict of interests. 2020;88(6):e00801-19. 21. Pachathundikandi SK, Tegtmeyer N, Arnold IC, et al. T4SS- REFERENCES dependent TLR5 activation by Helicobacter pylori infection. Nat 1. Yang DC, Blair KM, Taylor JA, et al. A genome-wide Helicobacter py- Commun. 2019;10(1):5717. lori morphology screen uncovers a membrane-spanning helical cell 22. Behrens I-K, Busch B, Ishikawa-Ankerhold H, et al. The HopQ- shape complex. J Bacteriol. 2019;201(14):1-16. CEACAM interaction controls CagA translocation, phosphoryla- 2. Martínez LE, O’Brien VP, Leverich CK, Knoblaugh SE, Salama NR. tion, and phagocytosis of Helicobacter pylori in neutrophils. MBio. Nonhelical Helicobacter pylori mutants show altered gland coloni- 2020;11(1):e03256-19. zation and elicit less gastric pathology than helical bacteria during 23. Capurro MI, Greenfield LK, Prashar A, et al. VacA generates a pro- chronic infection. Infect Immun. 2019;87(7):1-15. tective intracellular reservoir for Helicobacter pylori that is elimi- 3. Taylor JA, Bratton BP, Sichel SR, et al. Distinct cytoskeletal proteins nated by activation of the lysosomal calcium channel TRPML1. Nat define zones of enhanced cell wall synthesis in Helicobacter pylori. Microbiol. 2019;4(8):1411-1423. Elife. 2020;9:1-38. 24. Zhang K, Zhang H, Li S, et al. Cryo-EM structures of Helicobacter 4. Li H, Marceau M, Yang T, et al. East-Asian Helicobacter pylori pylori vacuolating cytotoxin A oligomeric assemblies at near-atomic strains synthesize heptan-deficient lipopolysaccharide. PLoS Genet. resolution. Proc Natl Acad Sci U S A. 2019;116(14):6800. 2019;15(11):1-23. 25. Su M, Erwin AL, Campbell AM, et al. Cryo-EM analysis reveals 5. Jiang X, Duan Y, Zhou B, et al. The cyclopropane fatty acid syn- structural basis of Helicobacter pylori VacA toxin oligomerization. J thase mediates antibiotic resistance and gastric colonization of Mol Biol. 2019;431(10):1956-1965. Helicobacter pylori. J Bacteriol. 2019;201(20):e00374-e419. 26. Buti L, Ruiz-Puig C, Sangberg D, et al. CagA–ASPP2 complex medi- 6. Gasiorowski E, Auger R, Tian X, et al. HupA, the main undecaprenyl ates loss of cell polarity and favors H pylori colonization of human pyrophosphate and phosphatidylglycerol phosphate phosphatase gastric organoids. Proc Natl Acad Sci U S A. 2020;117(5):2645-2655. 6 of 6 | DENIC et al.

27. Molina-Castro SE, Tiffon C, Giraud J, et al. The Hippo kinase gastric mucosa infected with Helicobacter pylori. Clin Epigenetics. LATS2 controls Helicobacter pylori-induced epithelial-mesenchy- 2019;11(1):191. mal transition and intestinal metaplasia in gastric mucosa. Cell Mol 35. Chen P, Guo H, Wu X, et al. Epigenetic silencing of microRNA-204 Gastroenterol Hepatol. 2020;9(2):257-276. by Helicobacter pylori augments the NF-κB signaling pathway 28. Zhou S, Chen H, Yuan P, et al. Helicobacter pylori infection promotes in gastric cancer development and progression. Carcinogenesis. epithelial-to-mesenchymal transition of gastric cells by upregulat- 2019;41(4):430–441. ing LAPTM4B. Biochem Biophys Res Commun. 2019;514(3):893-900. 36. Ou Y, Ren H, Zhao R, et al. Helicobacter pylori CagA promotes the 29. Palrasu M, Zaika E, El-Rifai W, et al. Bacterial CagA protein compro- malignant transformation of gastric mucosal epithelial cells through mises tumor suppressor mechanisms in gastric epithelial cells. J Clin the dysregulation of the miR-155/KLF4 signaling pathway. Mol Invest. 2020;130(5):2422-2434. Carcinog. 2019;58(8):1427-1437. 30. Costa L, Corre S, Michel V, et al. USF1 defect drives p53 degra- 37. Blosse A, Levy M, Robe C, Staedel C, Copie-Bergman C, Lehours P. dation during Helicobacter pylori infection and accelerates gastric Deregulation of miRNA in Helicobacter pylori-induced gastric MALT carcinogenesis. Gut. 2019;gutjnl-2019-318640. lymphoma: from mice to human. J Clin Med. 2019;8(6). 31. Teng Y-S, Zhao Y-L, Li M-S, et al. Upexpression of BHLHE40 in gas- 38. Codolo G, Toffoletto M, Chemello F, et al. Helicobacter pylori damp- tric epithelial cells increases CXCL12 production through interac- ens HLA-II expression on macrophages via the up-regulation of tion with p-STAT3 in Helicobacter pylori-associated gastritis. FASEB miRNAs targeting CIITA. Front Immunol. 2020;10(January):2923. J. 2020;34(1):1169-1181. 32. Wroblewski LE, Choi E, Petersen C, et al. Targeted mobilization of Lrig1+ gastric epithelial stem cell populations by a carcinogenic How to cite this article: Denic M, Touati E, De Reuse H. Helicobacter pylori type IV secretion system. Proc Natl Acad Sci U S Review: Pathogenesis of Helicobacter pylori infection. A. 2019;116(39):19652-19658. 33. Bussière FI, Michel V, Fernandes J, et al. DNA hypermethylation Helicobacter. 2020;25(Suppl. 1):e12736. https://doi. downregulates telomerase reverse transcriptase (TERT) during H org/10.1111/hel.12736 pylori-induced chronic inflammation. J Oncol. 2019;2019:5415761. 34. Yamashita S, Nanjo S, Rehnberg E, et al. Distinct DNA methylation targets by aging and chronic inflammation: a pilot study using

DOI: 10.1111/hel.12737

REVIEW ARTICLE

Review - Helicobacter, inflammation, immunology and vaccines

Karen Robinson1 | Philippe Lehours2,3

1School of Medicine, Nottingham Digestive Diseases Biomedical Research Centre, Abstract University of Nottingham, Nottingham, UK Understanding the mechanisms involved in induction and regulation of the immune 2 UMR1053 Bordeaux Research In and inflammatory response to Helicobacter pylori is extremely important in deter- Translational Oncology, INSERM, Univ. Bordeaux, BaRITOn, Bordeaux, France mining disease outcomes. H pylori expresses a plethora of factors that influence the 3French National Reference Centre for host response. Vaccines against H pylori are desperately needed for the prevention Campylobacters & Helicobacters, Hôpital Pellegrin, Bordeaux, France of gastric carcinogenesis, especially with the increasing trends in antimicrobial resistance. This review summarizes some important findings, published between 1 April Correspondence Karen Robinson, School of Medicine, 2019 and 31 March 2020, in the areas of H pylori-mediated inflammation, immunity Biodiscovery Institute and NIHR Nottingham and vaccines. Digestive Diseases Biomedical Research Centre, University of Nottingham, KEYWORDS Nottingham, UK. Email: [email protected] adaptive immunity, cytokines, Helicobacter pylori, inflammation, innate immunity, vaccines

Philippe Lehours, INSERM U1053-UMR BaRITOn, Team 2 "Helicobacter infection: inflammation and cancer", Bat 2B RDC Zone Nord, 146 rue Léo Saignat, 33076 Bordeaux Cedex, France. Email: [email protected]

Funding information KR is supported by the Medical Research Council, the Wellcome Trust, and also the National Institute for Health Research (NIHR).

1 | INFLAMMATION high-level IL-8 secretion; no response was observed by cell lines. The authors suggested that this culture model models the human gastric 1.1 | Epithelial interactions mucosa more closely than cell lines.1 Several host factors were identified as playing an important role Uotani et al developed a human gastric epithelial organoid mon- in H pylori-mediated gastritis. The pro-forms of IL-1β and IL-18 require olayer culture model to investigate host-Helicobacter pylori interac- activation via inflammasomes and cleavage by proteases. Semper tions. Most research uses human gastric adenocarcinoma-derived et al investigated the role of the cag type IV secretion system (T4SS) cell lines, which do not accurately model normal gastric epithelial in activating the NLRC4 inflammasome during H pylori infection, and cells. Gastric mucosal spheroids were differentiated as monolayers. its impact on gastritis. They showed that the cagT4SS was essential Their polarised cell morphology resembled that of the human gastric for NLRC4 inflammasome activation and IL-18 production from human mucosa, and H pylori infection resulted in transient changes in tight and murine gastric epithelial cells. Unlike WT control mice, Nlrc4−/− junction integrity. The infection induced Interleukin-8 (IL-8) expres- mice did not produce gastric IL-18 when infected with H pylori, and sion but, in contrast to commonly used cell lines, equivalent levels gastritis was milder. IL-18 inhibited expression of β-defensin 1 via an were induced by a cag pathogenicity island (cagPAI) knockout mu- NF-κB-dependent mechanism, resulting in higher H pylori colonisation. tant and the wild-type (WT) strain. When cagPAI-negative clinical The authors concluded that activation of the NLRC4 inflammasome isolates were applied to the gastroid monolayers, they also induced and IL-18 contribute to H pylori persistence and inflammation.2

The transcription factor STAT3 plays a major role in inflamma- (SPEM) mucosal damage. Unexpectedly, infected Aim2−/− mice had tion, and phosphorylation of STAT3 at serine 727 (pS727) is re- worse gastritis than WT animals. Aim2−/− mice had more CD8+ T cells quired for maximal expression of STAT3-regulated genes. The role in their gastric mucosa, and these cells had lost homing receptors of serine phosphorylated STAT3 (pS-STAT3) was examined by Balic and gained markers of tissue-resident memory T (Trm) cells. These et al. Constitutive pS-STAT3 staining was observed in gastric biop- changes were induced by CXCL16 from B cells. The authors con- sies from patients, regardless of H pylori status. Gastric tissue from cluded that Aim2 regulates CD8+ T-cell infiltration independently of Helicobacter felis-infected mice lacking this pS site, contained mark- the inflammasome, and inhibits metaplasia via a novel mechanism.9 edly fewer immune cells compared with WT mice. This indicated that Lv et al7 also reported that gastric epithelial cell expression of MMP- pS-STAT3 plays an important role in H pylori-mediated inflammation 10 led to CXCL16-mediated migration of CD8+ T cells into the H py- and disease.3 lori-infected gastric mucosa. 4 Mejías-Luque et al investigated NF-κB signalling in H felis-in- During H pylori infection, T helper (Th) cell subsets are recruited fected mice. Mice lacking MyD88, an adaptor molecule in the to the gastric mucosa. These vary in function, with Th1 and Th17 NF-κB pathway, had more severe gastric pathology. This effect being more inflammatory and regulatory T cells (Tregs) being immu- was linked to activation of non-canonical NF-κB signalling, with in- nosuppressive. Th cells may be converted into other phenotypes by creased CXCL9 and ICAM1 expression, STAT3 signalling and T-cell the cytokine environment. Shamsdin et al compared frequencies of infiltration in the gastric mucosa of infected MyD88−/− mice.4 IL-9-secreting Th9 cells, IL-9-secreting cytotoxic T cells (Tc9), and Dang et al investigated inflammatory signalling in gastric epithelial IL-9-secreting Th17 and Tc17 cells (Th17/9 and Tc17/9) in periph- cells and showed that the proapoptotic Bcl-2 protein PUMA was eral blood from H pylori-positive and -negative patients. They found upregulated by H pylori infection via Toll-like receptor 2 (TLR2) significantly increased Th17, Tc17, Th17/9, and Tc17/9 subsets, and signalling and NF-κB activation. Severity of apoptosis and inflam- higher serum IL-9, IL-23 and IL-21 concentrations in the infected mation in H pylori-positive human gastric biopsies was associated group.10 with PUMA expression. The authors concluded that PUMA plays Bagheri et al found significantly higher numbers of T-bet+ Th1 an important role in H pylori disease via apoptosis of epithelial cells cells in gastric biopsies from peptic ulcer disease (PUD) patients, and exacerbation of inflammation.5 compared to those with gastritis.11 The same group also reported Kong et al found elevated expression of the hormone adreno- increased gastric Th22 cells in PUD patients. Th1 and Th22 cell num- medullin (ADM) in the H pylori-infected gastric mucosa of mice and bers correlated with Th17 cells, and inversely correlated with Treg humans, correlated with the severity of gastritis. Administration of cells. They concluded that Treg cell responses modulate Th1, Th17 ADM-blocking antibodies to infected mice significantly reduced and Th22 responses. If imbalanced, heightened Th1, Th17 and Th22 gastric inflammation. ADM expression by gastric epithelial cells, activity worsens gastritis and favours PUD.12 mediated via CagA-dependent signalling, induced macrophages to Capitani et al found that H pylori lipoprotein HP1454 stimulated express IL-12, which exacerbated inflammation.6 Lv et al reported proliferation in CD4+ T cell clones from gastric tissues of H pylo- that H pylori-induced matrix metallopeptidase-10 (MMP-10) ex- ri-infected patients, and the infection induced a HP1454-specific pression by gastric epithelial cells, plays a role in enhancing H pylori response. The clones secreted TNFα, IFNγ and IL-17, indicative of colonisation and inflammation via ERK pathway signalling. Human Th1 and Th17 cells. The authors concluded that HP1454 is an im- gastric MMP-10 levels were associated with gastritis severity; portant T cell antigen, with properties likely to promote gastric colonisation densities and gastric inflammation were reduced in inflammation.13 MMP-10−/− mice compared to WT mice.7 Kuo et al showed that IL-21 plays an important role in gastritis in H pylori-infected mice, expression of IL-33 and its receptor ST-2 was upregulated in H py- and the mucosal Th1 and Th17 response is reduced in IL-21−/− mice. lori-infected gastric epithelial cells. ST-2 localised into lipid rafts in Yasmin et al showed significantly reduced IL-17A expression in the cell membranes. In the gastric mucosa of infected mice, increased Peyer's patches and mesenteric lymph nodes of infected IL-21−/− IL-33 and ST-2 expression exacerbated leukocyte infiltration and mice compared to WT mice. Exposure of H pylori-infected dendritic the severity of inflammation.8 cells (DCs) to IL-21 inhibited expression of the costimulatory molecule CD40, and impaired the ability of DCs to induce antigen-specific Th17 cell proliferation. IL-21 may therefore have both pro-inflam- 2 | IMMUNOLOGY matory and immunoregulatory activities, the balance of which may affect H pylori disease outcome.14 2.1 | Lymphocytes and innate lymphoid cells Innate lymphoid cells (ILCs) are important in regulating immune responses and homeostasis of the intestine. Bostick et al studied El-Zaatari et al found that expression of an inflammasome com- the effects of two intestinal Helicobacter species, Helicobacter ponent called Absent in melanoma 2 (Aim2), was increased in the apodemus and Helicobacter typhlonius, on ILC frequencies. These gastric mucosa of mice with H felis-induced premalignant changes. infections resulted in ILC activation and inflammatory damage to Aim2 is involved in the activation of IL-1β and IL-18, and was antici- the gut mucosa, but suppressed the activity and proliferation of pated to contribute to spasmolytic peptide-expressing metaplasia type 3 ILCs (ILC3s).15 ROBINSON and LEHOURS | 3 of 6

2.2 | Neutrophils, macrophages and dendritic cells of SLFN4 in human gastric cancer tissue, and elevated levels of MIR130b were also present in the serum. MIR130b was shown to Chu et al characterised the role of hepatoma-derived growth factor activate NFκB p65, contributing to inflammation and metaplastic (HDGF) in H pylori-mediated gastritis. In human gastric biopsies, high changes in the stomach.22 expression was associated with H pylori colonisation and neutrophil Codolo et al reported that H pylori reduces HLA-II expression in −/− scores. In infected HDGF mice, gastric neutrophil infiltration, TNFα macrophages, by suppressing expression of the class II MHC trans- and cyclooxygenase-2 (COX-2) responses were reduced. Exposure activator (CIITA). This was dependent on upregulation of miRNAs of neutrophils to HDGF in vitro induced differentiation and chemot- let-7f-5p, let-7i-5p, miR-146b-5p, and -185-5p. These miRNAs were actic responses.16 Yang & Wang found upregulated expression of the increased in mucosal biopsies from gastritis patients, suggesting neutrophil-associated antigen CD177 in the gastric mucosa of H py- their role in immune evasion.23 Arnold et al showed that BATF3- lori-infected mice, which correlated with gastritis severity. Gastritis dependent CD103+ DCs are required for induction of gastric Th1 scores were similar in infected WT and CD177-/- mice, indicating that responses to H pylori in mice, and for recruitment of peripherally in- CD177 expression is stimulated by inflammation.17 duced Tregs to the infected mucosa. BATF3−/− mice expressed lower Gobert et al found that H pylori activates the reverse transsul- levels of CXCR3 and CXCL9/10 chemokines, which indicated the role furation pathway (RTP) in macrophages. RTP involves enzymes in- of BATF3-dependent DCs in the migration of CXCR3+ T-effector and 24 cluding cystathionine γ-lyase (CTH) to produce hydrogen sulphide Treg cells to infected sites and their local expansion. from l-cysteine or homocysteine. CTH expression was induced in H pylori-infected macrophages, which interfered with macrophage activation via metabolic disruption, accumulation of putrescine, and 3 | VACCINES histone modifications. They concluded that CTH is subverted by H pylori for immune evasion.18 3.1 | Immunogenic antigens: Old friends and new Two signals are needed for NLRP3 inflammasome activation candidates and production of mature IL-1β by immune cells. Signal 1 induces expression of inflammasome components, and signal 2 provided by Among the old and well know vaccine candidates, H pylori urease is host and microbial factors (including adenosine triphosphate [ATP] considered to be a good antigen.25 Liu et al developed a multivalent and the microbial toxin nigericin) is required for inflammasome scaf- subunit H pylori vaccine containing H pylori urease subunit A (UreA), fold formation and activation. Pachathundikandi et al investigated urease subunit B (UreB) and neutrophil-activating protein (HP- NLRP3 regulation using human monocytes and macrophages. They NAP) with double-mutant heat-labile toxin (dmLT) from Escherichia confirmed that H pylori infection increased pro-IL-1β expression, but coli. Oral immunisation of H pylori-infected mice significantly re- secretion of the mature cytokine was low. When ATP or nigericin duced gastric bacterial colonisation and induced antigen-specific was added to infected cells, the NLRP3 inflammasome became ac- serum IgG, mucosal IgA, and Th1, Th2 and Th17 responses.26 Guo tive and high mature IL-1β secretion occurred. H pylori cannot gener- et al tested a multivalent epitope vaccine FVpE, containing HP-NAP, ate signal 2; therefore, other factors in the inflamed gastric mucosa three peptides from CagA and VacA, and a urease multi-epitope provide this.19 peptide (UE) from CTB-UE, administrated with a polysaccharide Chonwerawong et al showed that expression of NLR family adjuvant (PA). In mice, FvpE and the multi-epitope vaccine CTB-UE CARD domain-containing 5 (NLRC5) was significantly higher in gas- could induce specific antibodies against H pylori urease. However, tric biopsies from H pylori-positive compared to -negative patients. only FVpE could induce high levels of specific antibodies to CagA, NLRC5−/− macrophages expressed significantly higher levels of in- VacA, and NAP. Oral therapeutic immunisation with FVpE plus PA flammatory cytokines. Mice with macrophages unable to express significantly reduced the H pylori colonisation density in Mongolian NLRC5, had more severe H felis-induced gastric pathology than WT gerbils. The protection of FVpE was related to the mixed Th cell mice, and there were more abundant B-cell follicles. NLRC5 therefore responses and epitope-specific antibodies against various H pylori inhibits Helicobacter-induced gastritis and prevents the development antigens.27 of lymphoid follicles.20 Zhao et al reported that MALT lymphoma A vaccine design targeting conserved or essential genes is of patients and H felis-infected mice had elevated numbers of myeloid major interest for vaccine development. Hornburg et al developed suppressor cells (MDSCs) in their gastric mucosa, accompanied by a combined discovery-driven mass spectrometry and computational higher numbers of IL-17-producing gamma delta T-cells (γδT17), in- strategy to identify bacterial vaccine candidates and validate their dicating their role in the development of gastric MALT lymphoma. A immunogenicity using H pylori. They isolated surface antigens by en- subset of MDSCs in the SPEM gastric mucosa of H felis-infected mice zymatic cleavage and identified 72 surface-exposed antigens. One express the myeloid differentiation factor Schlafen4 (Slfn4).21 Ding candidate jhp_0775, encoding for a hypothetical protein, induced et al compared the transcriptomes of SLFN4+ and SLFN4− gastric specific B and T cell responses and significantly reduced colonisation MDSCs, and microRNA MiR130b was highly expressed by SLFN4+ levels in mouse therapeutic vaccination studies. In infected humans, cells. They showed that MiR130b plays an essential role in the func- jhp_0775 was immunogenic and activated IFNγ secretion from pe- tion of MDSCs. MIR130b co-localised with a human homologue ripheral blood T cells.28 4 of 6 | ROBINSON and LEHOURS

Liu et al analysed the protein composition and potential vaccine elevated serum IgG levels and reduced gastric urease activity fol- function of outer membrane vesicles (OMVs) derived from H pylori lowing H pylori challenges. strain 7.13. C57BL/6 mice were immunised orally with OMVs or an H pylori whole-cell vaccine (WCV), with or without cholera toxin (CT) as an adjuvant. Oral immunisation with OMVs elicited stron- 3.4 | Immune response and vaccine efficacy ger serum and mucosal antibody responses than WCV plus CT. The OMVs predominantly induced Th2-biased immune responses that An effective vaccine should prevent initial acquisition of the infec- reduced bacterial loads. OMV-based vaccines could therefore be of tion and protect against reinfections. Longet et al demonstrated that great value in controlling H pylori infection.29 prophylactic intragastric immunisation with a whole-cell killed H py- HpaA, an H pylori surface-located lipoprotein was proposed lori antigen administered together with the non-toxic oral adjuvant as a putative vaccine candidate against H pylori infection. Xue α-galactosylceramide (α-GalCer) induced effective immune pro- et al showed that LP2, which mimics the terminal structure of native tection against H pylori infection in mice. This vaccine formulation HpaA, was able to activate TLR2.30 An H pylori peptide antigen with elicited strong intestinal and systemic Th1 responses as well as sig- the sequence Met-Val-Thr-Leu-Ile-Asn-Asn-Glu (MVTLINNE) was nificant antigen-specific mucosal and systemic antibody responses. also used by Espinosa-Ramos et al in prophylactic immunisation. They also reported that the protective intestinal Th1 responses in- This peptide protected 100% of the mice against H pylori infection, duced were dependent on CD1d, IL-1R as well as IL-17R signaling.39 31 but the immune mechanisms remain to be identified. Therefore, α-GalCer could be a promising adjuvant for inclusion in an oral vaccine. Nemattalab et al designed a study to compare the effects of Th1, 3.2 | In silico vaccine design could help in Th2, Treg and Th17 modulatory effects on the efficacy of H pylori identifying new vaccine candidates vaccine. They used a bicistronic vector for simultaneous expression of oipA gene and modified mice IL-18, IL-17A, IL-22 and Foxp3 cy- Recent advances in bioinformatics have increased research on novel tokines. Four weeks after bacterial challenge, potent clearance of vaccine candidates. HPAG1_0576 from H pylori HPAG1, which H pylori infection was seen. Highest cell-mediated immunity cyto- shares 98% identity with TNF-α inducing protein (Tip-α) of H pylori, kines were produced in the IL-17 receiving group in which the Treg was chosen by Ashrafi et al32 Bioinformatics analyses suggested the responses were suppressed previously by the administration of the presence of immunogenic CD8+ and CD4+ T-cell epitopes and a po- Foxp3 as an immunogen.40 tential to induce IFNγ-mediated responses. Cho et al reported on Liu et al showed that Trm cells are enriched at the sites of previ- structure-based molecular studies of H pylori FliD (hpFliD). Assays ous infection and required for enhanced protective immunity. They with anti-H pylori antibodies demonstrated that hpFliD-specific D4 suggest that conventional vaccine strategies are unable to establish and D5 domains are highly antigenic, providing a molecular basis for a measurable antigen-specific memory cell pool in the stomach. In further vaccine development.33 comparison, gastric subserous injection of mice with a micro-dose Khan et al explored the H pylori proteome and designed a B and of an alum-based H pylori vaccine can induce a pool of local CD4+ T cell multi-epitope subunit vaccine: antigenic epitopes were pre- Trm cells. Upon Helicobacter infection, CD4+ Trm cells orchestrate a dicted from CagA, OipA and GroEL.34 Urrutia-Baca et al described swift recall response with the recruitment of circulating antigen-spe- a multi-epitope vaccine composed of CTB fused to epitopes from cific Th1/Th17 cells to trigger a tissue-wide pathogen clearance. This eleven H pylori proteins.35 Surface-exposed membrane proteins study highlights the need to design a vaccine strategy against H py- were predicted from 826 proteins of 53 H pylori strains by Pasala lori by establishing the protective CD4+ Trm cells.29 et al, who proposed novel vaccine cocktails and insights for T-cell Xu et al showed that vaccine-induced gastric CD4+ Trm cells pro- driven subunit vaccine design. Validation of these proposed vaccines liferate in situ to amplify the immune response against H pylori. A de- is needed to verify their safety and immunogenicity.36 crease in H pylori colonisation was observed in the vaccinated mice which could be related to the presence of pro-inflammatory myeloid cells still in the stomach of the vaccinated mice.41 3.3 | Recombinant antigen delivery modes Akter et al aimed to find immune correlates to vaccine efficacy, the frequencies of neutrophils, eosinophils and inflammatory mono- + +- CagL is highly conserved amongst pathogenic H pylori strains. cytes and CD4 T-cell memory and mucosa homing integrin α4β7 Aliramaei et al suggested that recombinant CagL could be a suit- cells. H pylori antigens and cholera toxin or the multiple mutant CT able vaccine candidate, expressed by Lactococcus lactis. After oral (mmCT) were administered via the sublingual (SL) and intragastric immunisation of mice, a significant increase in CagL-specific serum route (IG). They observed that in the blood of mice after SL or IG IgA, IgG, IL-17 and IFNγ was observed. CagL-specific IgA was also route of vaccination, changes in frequencies of innate and adaptive detected in the faeces. This vaccine is therefore immunogenic and immune cell subsets were present compared to infection controls. 37 + able to induce mucosal responses. Mice orally immunised with In particular, the frequency of circulating mucosal homing α4β7 C- recombinant L lactis expressing H pylori Lpp20 antigen38 also had D4+T cells after vaccination correlated with low bacterial load in the ROBINSON and LEHOURS | 5 of 6 stomach of individual mice irrespective of the immunisation route. 14. Yasmin S, Dixon B, Olivares-Villagomez D, Algood HMS. Interleukin-21 (IL-21) downregulates dendritic cell cytokine re- This study revealed that the innate and adaptive immune cell subsets sponses to Helicobacter pylori and modulates T lymphocyte IL- can be measured in the blood after vaccination and that an increased 17A expression in Peyer's patches during infection. Infect Immun. + + frequency of α4β7 CD4 in the blood after immunisation could act 2019;87(11):e00237-19. as a predictor for vaccine efficacy.42 15. Bostick JW, Wang Y, Shen Z, et al. Dichotomous regulation of group As reported by Sutton and Boag,43 there are currently no ad- 3 innate lymphoid cells by nongastric Helicobacter species. Proc Natl Acad Sci USA. 2019;116(49):24760-24769. vanced vaccine candidates. No new clinical trials were reported. 16. Chu TH, Huang ST, Yang SF, et al. Hepatoma-derived growth factor participates in Helicobacter pylori-induced neutrophils ACKNOWLEDGEMENTS recruitment, gastritis and gastric carcinogenesis. Oncogene. KR is supported by research funding from the Medical Research 2019;38(37):6461-6477. 17. Yang XT, Wang ZJ. CD177 expression and inflammation grade in Council, the Wellcome Trust and the National Institute for Health Helicobacter pylori-infected wild-type and CD177(-/-) C57BL/6 Research NIHR, through the Biomedical Research Centre at mice. Anal Cell Pathol (Amst). 2019;2019:9506863. Nottingham University Hospitals NHS Trust and the University of 18. Gobert AP, Latour YL, Asim M, et al. Bacterial pathogens hijack the Nottingham. The views expressed are those of the authors and not innate immune response by activation of the reverse transsulfura- tion pathway. MBio. 2019;10(5):e02174-19. necessarily those of the NHS, the NIHR, or the Department of Health. 19. Pachathundikandi SK, Blaser N, Bruns H, Backert S. Helicobacter pylori avoids the critical activation of NLRP3 inflammasome-mediated CONFLICT OF INTEREST production of oncogenic mature IL-1beta in human immune cells. The authors declare no conflict of interest. Cancers (Basel). 2020;12(4):803. 20. Chonwerawong M, Ferrand J, Chaudhry HM, et al. Innate immune molecule NLRC5 protects mice from Helicobacter-induced forma- REFERENCES tion of gastric lymphoid tissue. Gastroenterology. 2020;159(1):169- 1. Uotani T, Murakami K, Uchida T, et al. Changes of tight junction and 182.e8. interleukin-8 expression using a human gastroid monolayer model 21. Zhao Y, Lu F, Ye J, et al. Myeloid-derived suppressor cells and gam- of Helicobacter pylori infection. Helicobacter. 2019;24(3):e12583. madeltaT17 cells contribute to the development of gastric MALT 2. Semper RP, Vieth M, Gerhard M, Mejias-Luque R Helicobacter py- lymphoma in H felis-infected mice. Front Immunol. 2019;10:3104. lori exploits the NLRC4 inflammasome to dampen host defenses. J 22. Ding L, Li Q, Chakrabarti J, et al. MiR130b from Schlafen4(+) MDSCs Immunol. 2019;203(8):2183-2193. stimulates epithelial proliferation and correlates with preneoplastic 3. Balic JJ, Saad MI, Dawson R, et al. Constitutive STAT3 serine phos- changes prior to gastric cancer. Gut. 2020. https://doi.org/10.1136/ phorylation promotes Helicobacter-mediated gastric disease. Am J gutjnl-2019-318817 Pathol. 2020;190(6):1256-1270. 23. Codolo G, Toffoletto M, Chemello F, et al. Helicobacter pylori damp- 4. Mejías-Luque R, Lozano-Pope I, Wanisch A, et al. Increased LIGHT ens HLA-II expression on macrophages via the up-regulation of expression and activation of non-canonical NF-κB are observed in miRNAs targeting CIITA. Front Immunol. 2019;10:2923. gastric lesions of MyD88-deficient mice upon Helicobacter felis in- 24. Arnold IC, Zhang X, Artola-Boran M, et al. BATF3-dependent den- fection. Sci Rep. 2019;9(1):7030. dritic cells drive both effector and regulatory T-cell responses in 5. Dang Y, Zhang Y, Xu L, et al. PUMA-mediated epithelial cell apop- bacterially infected tissues. PLoS Pathog. 2019;15(6):e1007866. tosis promotes Helicobacter pylori infection-mediated gastritis. Cell 25. Mirzaei N, Poursina F, Moghim S, Rashidi N, Ghasemian SH. Death Dis. 2020;11(2):139. The study of H pylori putative candidate factors for single- and 6. Kong H, You N, Chen H, et al. Helicobacter pylori-induced adreno- multi-component vaccine development. Crit Rev Microbiol. medullin modulates IFN-gamma-producing T-cell responses and 2017;43(5):631-650. contributes to gastritis. Cell Death Dis. 2020;11(3):189. 26. Liu M, Zhong Y, Chen J, et al. Oral immunization of mice with a mul- 7. Lv YP, Cheng P, Zhang JY, et al. Helicobacter pylori-induced matrix tivalent therapeutic subunit vaccine protects against Helicobacter metallopeptidase-10 promotes gastric bacterial colonization and pylori infection. Vaccine. 2020;38(14):3031-3041. gastritis. Sci Adv. 2019;5(4):eaau6547. 27. Guo L, Hong D, Wang S, et al. Therapeutic protection against H 8. Kuo CJ, Chen CY, Lo HR, et al. Helicobacter pylori induces IL-33 pro- pylori infection in Mongolian gerbils by oral immunization with a duction and recruits ST-2 to lipid rafts to exacerbate inflammation. tetravalent epitope-based vaccine with polysaccharide adjuvant. Cells. 2019;8(10). Front Immunol. 2019;10:1185. 9. El-Zaatari M, Bishu S, Zhang M, et al. Aim2-mediated/IFN-beta- 28. Hornburg D, Kruse T, Anderl F, et al. A mass spectrometry guided independent regulation of gastric metaplastic lesions via CD8+ T approach for the identification of novel vaccine candidates in cells. JCI. Insight. 2020;5(5):1290. Gram-negative pathogens. Sci Rep. 2019;9(1):17401. 10. Shamsdin SA, Alborzi A, Ghaderi A, Lankrani KB, Pouladfar GR. 29. Liu Q, Li X, Zhang Y, et al. Orally-administered outer-membrane Significance of TC9 and TH9 in Helicobacter pylori-induced gastritis. vesicles from Helicobacter pylori reduce H pylori infection via Th2- Helicobacter. 2020;25(1):e12672. biased immune responses in mice. Pathog Dis. 2019;77(5). 11. Bagheri N, Shirzad H, Mirzaei Y, et al. T-bet(+) cells polarization in 30. Xue RY, Guo MF, Guo L, et al. Synthetic lipopeptide enhances patients infected with Helicobacter pylori increase the risk of peptic protective immunity against Helicobacter pylori infection. Front ulcer development. Arch Med Res. 2019;50(3):113-121. Immunol. 2019;10:1372. 12. Sanaii A, Shirzad H, Haghighian M, et al. Role of Th22 cells in 31. Espinosa-Ramos D, Caballero-Hernandez D, Gomez-Flores R, et al. Helicobacter pylori-related gastritis and peptic ulcer diseases. Mol Immunization with a synthetic Helicobacter pylori peptide induces Biol Rep. 2019;46(6):5703-5712. secretory IgA antibodies and protects mice against infection. Can J 13. Capitani N, Codolo G, Vallese F, et al. The lipoprotein HP1454 of Infect Dis Med Microbiol. 2019;2019:e8595487. Helicobacter pylori regulates T-cell response by shaping T-cell recep- 32. Ashrafi H, Siraji MI, Showva NN, et al. Structure to function anal- tor signalling. Cell Microbiol. 2019;21(5):e13006. ysis with antigenic characterization of a hypothetical protein, 6 of 6 | ROBINSON and LEHOURS

HPAG1_0576 from Helicobacter pylori HPAG1. Bioinformation. protective IL-1R- and IL-17R-dependent Th1 responses. NPJ 2019;15(7):456-466. Vaccines. 2019;4:45. 33. Cho SY, Song WS, Oh HB, Kim HU, Jung HS, Yoon SI. Structural 40. Nemattalab M, Shenagari M, Taheri M, et al. Co-expression of analysis of the flagellar capping protein FliD from Helicobacter py- Interleukin-17A molecular adjuvant and prophylactic Helicobacter lori. Biochem Biophys Res Commun. 2019;514(1):98-104. pylori genetic vaccine could cause sterile immunity in Treg sup- 34. Khan M, Khan S, Ali A, et al. Immunoinformatics approaches to expressed mice. Cytokine. 2020;126:e154866. plore Helicobacter pylori proteome (virulence factors) to design B 41. Xu N, Ruan G, Liu W, et al. Vaccine-induced gastric CD4(+) tis- and T cell multi-epitope subunit vaccine. Sci Rep. 2019;9(1):13321. sue-resident memory T cells proliferate in situ to amplify im- 35. Urrutia-Baca VH, Gomez-Flores R, De La Garza-Ramos mune response against Helicobacter pylori insult. Helicobacter. MA, Tamez-Guerra P, Lucio-Sauceda DG, Rodriguez-Padilla 2019;24(5):e12652. MC. Immunoinformatics approach to design a novel epi- 42. Akter S, Jeverstam F, Lundgren A, et al. The frequency of circulat- tope-based oral vaccine against Helicobacter pylori. J Comput Biol. ing integrin alpha4beta7(+) cells correlates with protection against 2019;26(10):1177-1190. Helicobacter pylori infection in immunized mice. Helicobacter. 36. Pasala C, Chilamakuri CSR, Katari SK, Nalamolu RM, Bitla AR, 2019;24(6):e12658. Amineni U. Epitope-driven common subunit vaccine design against 43. Sutton P, Boag JM. Status of vaccine research and development for H pylori strains. J Biomol Struct Dyn. 2019;37(14):3740-3750. Helicobacter pylori. Vaccine. 2019;37(50):7295-7299. 37. Aliramaei MR, Khorasgani MR, Rahmani MR, Zarkesh Esfahani SH, Emamzadeh R. Expression of Helicobacter pylori CagL gene in Lactococcus lactis MG1363 and evaluation of its immunogenicity as How to cite this article: Robinson K, Lehours P. Review - an oral vaccine in mice. Microb Pathog. 2019;142:e103926. Helicobacter, inflammation, immunology and vaccines. 38. Sun N, Zhang R, Duan G, et al. A food-grade engineered Lactococcus lactis strain delivering Helicobacter pylori Lpp20 allevi- Helicobacter. 2020;25(Suppl. 1):e12737. https://doi. ates bacterial infection in H pylori-challenged mice. Biotechnol Lett. org/10.1111/hel.12737 2019;41(12):1415-1421. 39. Longet S, Abautret-Daly A, Davitt CJH, et al. An oral alpha-galactosylceramide adjuvanted Helicobacter pylori vaccine induces

DOI: 10.1111/hel.12738

REVIEW ARTICLE

Review - Helicobacter pylori and non-malignant upper gastrointestinal diseases

Christian Schulz1 | Juozas Kupčinskas2

1Department of Medicine II, University Hospital, LMU Munich, Munich, Germany Abstract 2Department of Gastroenterology & This review takes into account recent publications focusing on the relationship be- Institute for Digestive Research, Lithuanian tween Helicobacter pylori infection and non-malignant diseases of the upper gastro- University of Health Sciences, Kaunas, Lithuania intestinal tract. The authors have summarized current knowledge on associations between the H pylori infection and non-malignant upper GI conditions including gas- Correspondence Christian Schulz, Department of Medicine troesophageal reflux disease (GERD), Barrett's esophagus, eosinophilic esophagitis II, University Hospital, LMU Munich, (EOE), peptic ulcer disease (PUD), H pylori gastritis, celiac disease and functional dys- Marchioninistraße 15, Munich 81377, Germany. pepsia. In the field of GERD, current data focusing on different locations of H pylori Email: [email protected] infection detect significant differences between antrum- and corpus predominant gastritis explainable by different changes in acid secretion in different gastric niches. High volume studies from Sweden and Brazil underline the safety of H pylori eradication concerning the risk of Barret's esophagus or adenocarcinoma. The relationship betweenH pylori infection and EOE remains uncertain, but current data supports the concept of expected positive and protective effects of H pylori exposure reducing the risk of EOE. Analyzing biomarkers might be helpful to identify subjects under risk for the development of precancerous lesions after H pylori infection, where microRNAs, IL-9 and IL-4, and also Tc17/9 and Th17/9 and microbiota profiles showed promising results to identify subgroups under risk.

KEYWORDS dyspepsia, eosinophilic esophagitis, gastroesophageal reflux disease, peptic ulcer disease

1 | INTRODUCTION This review summarizes the advances in epidemiologic, clinical, and basic science knowledge published during the period March Helicobacter pylori (H pylori) is considered as the most prevalent 2019 to April 2020 in the field of H pylori and non-malignant diseases human pathogen infecting more than 50% of the worldwide pop- of the upper gastrointestinal tract. ulation. Its role in non-malignant infectious diseases of the human stomach is indisputable. The role of H pylori in esophageal diseases remains controversial and is driven by clinical observations. 2 | ESOPHAGEAL DISEASES The prevalence of H pylori associated peptic ulcer diseases (PUD) is decreasing worldwide; however, within this context many clini- 2.1 | Gastroesophageal reflux disease cal challenges still remain. Furthermore, molecular alterations induced by H pylori infection in non-malignant upper gastrointestinal Conflicting data regarding the interaction of H pylori infection and conditions remain underexplored and this field mandates further gastroesophageal reflux disease (GERD) were published during research. the last decades. The group of Yalaki et al studied the influence

Helicobacter. 2020;25(Suppl. 1):e12738. wileyonlinelibrary.com/journal/hel © 2020 John Wiley & Sons Ltd | 1 of 6 https://doi.org/10.1111/hel.12738 2 of 6 | SCHULZ and KUPČINSKAS of different locations of H pylori infection and the histopathologi- an increased risk of Barrett's esophagus or esophageal cancer after cal findings related to reflux disease. As expected, the incidence of H pylori eradication treatment.5 Furthermore, a Brazilian cohort was H pylori infection in patients with GERD was lower than in controls. analysed retrospectively to determine the impact of H pylori infec- A significantly lower amount of H pylori infection was found in the tion on the development of Barrett's esophagus. No significant dif- corpus of subjects presenting with erosive reflux disease compared ference between patients with and without H pylori infection with to controls whereas no differences were detected in antrum pre- respect to the risk of Barrett's esophagus was detected in 235 pa- dominant gastritis and atrophic lesions. The authors concluded that tients with Barrett's esophagus out of total 373 subjects.6 Focusing hypoacidity driven by corpus predominant gastritis was the reason on the ethnic distribution of Barrett's esophagus, Sonnenberg for these observations.1 Screening by esophagogastroduodenos- et al performed a case control study including 52 096 cases with copy (EGD) before bariatric surgery is frequently applied to detect Barrett's esophagus, 189 235 cases with reflux esophagitis, and contraindications which may change the planned surgical procedure. 152 322 controls without any clinical symptom suggesting the pres- Also, screening for H pylori infection is recommended to reduce post- ence of reflux disease. Assessing the impact of age, gender, ethnic- operative complications driven by the infection. AlEid et al analysed ity and H pylori status, Barrett metaplasia was less frequent in East the findings in 356 patients suffering from obesity who were sched- Asians (odds ratio (OR): 0.48; 95% CI: 0.44-0.53) and Hispanics (OR: uled for bariatric surgery. Forty-one percent of their cohort tested 0.60, 0.57-0.63) compared to the other ethnic groups analysed.7 positive for H pylori infection and 4% presented reflux esophagitis.2 Esophageal reflux disease and Barrett's esophagus were associated An increasing number of patients take acid suppressive thera- with a lower prevalence rate of H pylori infection than controls (OR: pies in a regular manner. To determine the appropriateness of pre- 0.48, 0.44-0.53 for Barrett's metaplasia and OR: 0.60, 0.57-0.63 for scribing these drugs, Franchi et al analysed data from 101 medical reflux esophagitis). Data from Azerbaijan, a high incidence area of and geriatric wards in Italy. Appropriateness was defined for specific H pylori infection, challenged the theory of an inverse association clinical findings such as history of peptic ulcer, history of gastro- between H pylori infection and Barrett's esophagus. The authors did intestinal hemorrhages, advanced age, use of specific medications not detect a significant difference in the prevalence of H pylori in for acid suppression or H pylori infection. For nearly half of the pa- Barrett cases compared to controls in their retrospective matched tients (n = 1776, 45.6%, 95% confidence interval (CI): 44.0%-47.1%), control study in 250 patients who underwent upper gastrointestinal acid suppressive drugs for a given indication were inappropriately endoscopy.8 prescribed or even not prescribed. Sixty percent of acid suppressive therapies were overprescribed and in the subgroup of non-prescribed patients; 22% required acid suppressive treatment in line 2.3 | Eosinophilic esophagitis with current guidelines.3 The characteristics leading to the prescription of antisecretory Eosinophilic esophagitis (EOE) remains the most common immune- drugs in patients without macroscopic lesions of the upper gastro- and allergen-mediated disorder of the upper gastrointestinal tract. intestinal tract and no evidence of H pylori infection were analysed During the last decades, growing experimental and clinical data in 472 patients. Hiatus hernia, age and the intake of calcium chan- have suggested an inverse relationship between H pylori infection nel blockers were associated with the new onset of acid suppressive and different immune-related and allergen-driven diseases such as drugs.4 asthma, inflammatory bowel diseases and also food allergies.9-12 Animal studies demonstrated a relationship between transmaternal or postpartum H pylori exposure and the expansion of regulatory 2.2 | Barrett's esophagus T-cell subsets expressing CXCR3 or retinoic acid-related orphan receptor γt, and demethylation of the forkhead box P3 (FOXP3) locus. Clinical observations show that H pylori infection seems to reduce As in non-IgE-related diseases, the mechanisms of food allergy in the risk of esophageal adenocarcinoma. The Swedish group led by EOE are mediated by Th2 cell activation by food and environmental Doorakkers and Brusselaers performed a nationwide population- antigens.13 Varying data regarding the association between H pylori based cohort study on 81 919 patients to test the opposing hypoth- exposure and risk of EOE or esophageal eosinophilia led Shah et al to esis of an increasing risk of Barrett's esophagus and esophageal perform a systematic review and meta-analysis including 11 obser- adenocarcinoma after H pylori eradication. In the study cohort, 178 vational studies with data from 377 795 individuals from different cases of Barrett's esophagus presented with an increased over- regions all over the world. Exposure to H pylori caused a 37% re- all standardized incidence ratio (SIR) (SIR: 3.67, 95% CI 3.15- 4.25) duction in EOE(OR: 0.63; 95% CI: 0.51-0.78) and a 38% reduction in compared to the corresponding Swedish background population esophageal eosinophilia (OR: 0.62; 95% CI: 0.52-0.76). Interestingly but with a slightly decrease over time after H pylori eradication. the association was significant only in prospective trials independent Esophageal adenocarcinoma was reported in 11 cases, the overall of location, cohort, time period or regional H pylori prevalence. This SIR was constant 1.26 (95% CI: 0.62-2.26). The SIRs of esophageal analysis supports the concept of evolutionarily expected positive squamous cell carcinoma (n = 10) were not influenced by eradica- and protective effects of H pylori exposure. This protection might be tion treatment. The authors conclude that there is no evidence of triggered by H pylori -induced alterations of immunological pathways SCHULZ and KUPČINSKAS | 3 of 6 with weakening of Th1/17 and consecutive effects, eg on regulatory bleeding was more frequent than upper GI bleeding in aspirin users T-cell response.14 after H pylori eradication.20

3 | GASTRIC DISEASES 3.2 | Helicobacter pylori gastritis

3.1 | Peptic ulcer disease As gastric cancer is usually diagnosed at late critical stages, there is still the need for novel biomarkers and perception of molecular The debate about the cost-effectiveness of a test and treat strat- pathways involved in early detection of H pylori gastritis patterns egy for prevention of PUD and other H pylori associated diseases that carry a high risk profile for malignant transformation. A group is still ongoing. Høgh et al performed a randomised controlled trial of scientists performed a study that demonstrated increased Th9, with a 13-year follow-up in order to evaluate the cost-effectiveness Th17/9, Tc9 and Tc17/9 cells in H pylori infection and their interac- of H pylori population screening and eradication in Denmark. The tion during the immunopathological responses. They stated that an study showed no long-term effect of Danish population screening increased number of these cells may be influential in the progres- for H pylori when compared to usual care – neither on quality of life, sion and severity of H pylori infection. In addition, increased levels PUD incidence, dyspepsia prevalence, nor on use of health care re- of IL-9 and IL-4, and Tc17/9 and Th17/9 were observed in chronic sources.15 Nevertheless, the idea of population-based screening and active gastritis patients.21 INS-GAS mice showed a gender specific eradication of H pylori remains an attractive option in some regions. miR-20b expression pattern following H pylori infection. There was a The analysis of a 10 million asymptomatic 20-year-old Chinese co- stepwise increase in miR-20b expression at the different time points hort showed that this strategy saved 1854 deaths from PUD dur- from 12 to 50 weeks with the highest difference at 50 weeks, that ing life expectancy. The authors concluded that, compared with a appear to occur in parallel with the progression of H pylori gastri- no-screen strategy, H pylori screen-and-treat strategy for the gen- tis.22 Another international research group demonstrated that levels eral Chinese population is cheaper and more effective in preventing of specific miRNA – miR130b increase in gastric myeloid-derived 16 H pylori -associated diseases. suppressor cells (MDSCs), which express Schlafen4 factor (SLFN4+). An American study showed that among patients hospitalised As miR130b plays an essential role in MDSC function and the levels for bleeding PUD, admission to the intensive care unit (ICU) was the in the blood correlate with metaplastic changes in the stomach, this factor most frequently associated with non-adherence to H pylori miRNA has the potential to be an early non-invasive biomarker for testing guidelines (66% of patients in the ICU were tested vs 90% pa- gastric metaplastic changes and early-stage gastric cancer.23 tients not in the ICU, P < .01). Considering this problem, which may The gastric microbiota has received a lot of attention over recent also occur in other countries, new strategies might be required for years and there are continuous emerging data on its role in H py- proper H pylori testing.17 Recent data suggest that the proportion of lori gastritis.24 Sung et al investigated gastric microbiota changes gastroduodenal erosions/ulcers associated with H pylori infection in one year after H pylori eradication and their relationship with gas- the paediatric population is lower than expected. However, a Belgian tric precancerous states. Their study showed that some bacteria retrospective study showed that the proportion between H pylori (Peptostreptococcus, Streptococcus, Parvimonas, Prevotella, Rothia -positive and -negative ulcers in children did not significantly change and Granulicatella) were associated with development and per- over the past two decades.18 On the other hand, H pylori infection sistence of gastric atrophy and intestinal metaplasia after H pylori prevalence continues to fall in the general population. Sonnenberg eradication.25 Gastric microbiota has been mainly analysed in adults, et al once again showed this tendency in the US general population: while paediatric populations have been less explored. In accordance between 2009 and 2018 the general H pylori infection prevalence fell with the results from adult studies, the diversity and richness of gas- significantly from 11% to 9% with a decline in the fraction of H py- tric microbiota were in inverse correlation with H pylori gastritis in lori -positive gastric ulcers from 17% to 14% and H pylori -positive children, while H pylori eradication was helpful to restore the shifted duodenal ulcers from 25% to 21%. A higher H pylori infection prev- gastric microbiota.26 alence remains among East Asians and Hispanics.19 Guo et al identified all patients from Hong Kong who received the first course of clarithromycin-based triple therapy between 2003 and 2012, and 4 | FUNCTIONAL DISORDERS OF THE divided them into three cohorts according to aspirin use: new users UPPER GI TRACT (aspirin commenced after H pylori eradication) (n = 6985), chronic users (n = 5545) and non-users (n = 48 908). Compared with chronic A connection between H pylori infection and functional gastro- users, new users had a higher risk of GI bleeding (hazard ratio (HR): intestinal disorders is generally accepted since effects of H pylori 1.89, 95% CI: 1.29-2.70). The study showed that the increased risk eradication on dyspeptic symptoms have been shown in different in new aspirin users was only observed in the first 6 months for all clinical trials.27 Based on current recommendations, patients with GI bleeding (HR: 2.10, 95% CI: 1.41-3.13) and upper GI bleeding (HR: H pylori -associated dyspepsia should be considered as a separate 2.52, 95% CI: 1.38-4.60), but not for lower GI bleeding. Lower GI group of patients with functional dyspepsia. These patients should 4 of 6 | SCHULZ and KUPČINSKAS receive H pylori eradication treatment as a proof of entity. Several spectrum, a group from Iran studied the effect of ginger (Zingiber of- guidelines and consensus reports are available guiding the manage- ficinale Roscoe) on H pylori eradication and on dyspeptic symptoms. ment of functional dyspepsia and H pylori infection. Facing the fact In this pilot study, 53.3% of H pylori infected patients had a nega- that the majority of patients are treated by primary care physicians, tive stool antigen test after four weeks of ginger supplementation. McNicholl et al performed an open on-line survey to evaluate the ad- Severe dyspeptic symptoms decreased significantly after treatment, herence and also limitations, perceptions and attitudes to guidelines eg fullness, early satiety, nausea, belching, gastric burn and gastric among Spanish primary care physicians. Analysing 1445 responses, pain. The authors considered ginger as a potential complementary only 40% of the physicians had read at least one Maastricht con- therapy for patients with H pylori -induced functional dyspepsia.34 sensus report. Sixteen percent reported no access at all to validated An association between eosinophilic infiltration of the duode- H pylori diagnostics and 33% of the responders do not systemati- num and dyspeptic symptoms was reported, but the influence of cally refer to eradication confirmation tests.28 In conclusion, there H pylori infection on eosinophilic infiltrates in the duodenum has is a clear need to improve the perception/availability and adherence not been well studied. A group from Brazil enrolled 63 patients with to current guidelines. To define a cost-effectiveness strategy to di- and without dyspeptic symptoms and with and without evidence agnose and treat dyspeptic patients, Beresniak et al compared a Test of H pylori infection. The duodenal eosinophilic count in five high and Treat strategy with symptomatic treatment and upfront upper power fields was significantly higher in H pylori infected subjects gastrointestinal endoscopy focusing on cost-effectiveness based than in uninfected controls (P = .005) but similar in those with or on Spanish medical resources. The Test and Treat strategy based on without dyspeptic symptoms.35 urea breath test was shown to be the most cost-effective approach for the management of dyspeptic patients and also in prevention of H pylori complications.29 Simplifications of participation in Test and 5 | HELICOBACTER PYLORI AND CELIAC Treat strategies are needed to improve test frequency in dyspeptic DISEASE patients. Therefore, Canadian pharmacists in a community setting offered H pylori antibody screening using a rapid response serologi- The possible relationship between celiac disease (CD) and H pylori cal test to patients under acid-suppressive therapy for longer than infection is still under debate for more than 20 years. Conflicting six weeks. data regarding associations between H pylori infection and CD are This Test and Treat strategy involving easily accessible struc- published mainly from pediatric cohorts.36-40 Different mechanisms tures such as pharmacies had a positive impact on the detection to explain a potential protective effect of H pylori against CD includ- and treatment of undiagnosed H pylori infections.30 Depending on ing altered T-cell response in H pylori infected subjects and regula- local structures, prevalence of H pylori infection or parasitic gastric tory T-cell involvement which leads to a reduced risk of allergic and infection and the prevalence of gastric cancer diagnostic pathways atopic diseases.41,42 differ strongly. A Cambodian cohort with 1231 dyspeptic patients, Narang et al performed a clinical trial on 324 children with con- analysed retrospectively and divided into three subtypes according firmed MARSH grade III CD and examined H pylori infection histo- to their symptom-profile, underwent upper gastrointestinal endos- logically. Compared to non-CD children the prevalence of H pylori copy: 1065 (86.5%) patients demonstrated normal findings whereas was significant higher in non-CD children (50% vs 11.4%, P < .001). 13.5% revealed macroscopic findings including 19 upper gastroin- The inverse relationship shown in this study exclude H pylori to testinal tumours which were not detected using the Test and Treat be a risk factor for CD. It might exist a protective effect of CD strategy.31 An updated guideline of diagnostic algorithms was pub- against H pylori infection but a pathophysiological explanation is lished in 2019 in Korea. With a weak grade of recommendation, not given.43 the use of the Test and Treat approach for H pylori is considered for dyspeptic patients under 40 years without alarm symptoms who are ACKNOWLEDGEMENTS not responding to acid suppressants or prokinetics.32 Due to the None. variety of different management strategies for uninvestigated dyspepsia, Eusebi et al performed a systematic review and meta-analy- CONFLICTS OF INTEREST sis regarding the effectiveness of different management strategies. The authors have no potential conflicts of interest to declare. Identifying 15 eligible randomised controlled trials, data from 6162 patients were included. The authors ranked the Test and Treat first, REFERENCES but with a similar relative risk (RR) of remaining symptoms compared 1. Yalaki S, Pulat H, Ilhan A. Localization of Helicobacter pylori gastritis to the prompt endoscopy approach (RR 0.89 vs 0.90). In general, no and the relation of existing histopathological features with reflux esophagitis. Scand J Gastroenterol. 2020;55(1):27-33. approach tested was significantly less effective than Test and Treat. 2. AlEid A, Al Balkhi A, Hummedi A, et al. The utility of esophago- From the patients' viewpoint, dissatisfaction with the management gastroduodenoscopy and Helicobacter pylori screening in the pre- approach chosen was significantly lower in the prompt endoscopy operative assessment of patients undergoing bariatric surgery: cohort than in the Test and Treat cohort, and in patients empirically A cross-sectional, single-center study in Saudi Arabia. Saudi J Gastroenterol. 2020;26(1):32-38. treated with acid suppressive agents.33 To enlarge the therapeutic SCHULZ and KUPČINSKAS | 5 of 6

3. Franchi C, Mannucci P, Nobili A, Ardoino I. Use and prescription chronic low-dose aspirin users after treatment for Helicobacter py- appropriateness of drugs for peptic ulcer and gastroesophageal lori: a territory-wide cohort study. Gut. 2020;69(3):445-452. reflux disease in hospitalized older people. Eur J Clin Pharmacol. 21. Shamsdin SA, Alborzi A, Ghaderi A, Lankrani KB, Pouladfar G. 2020;76(3):459–465. Significance of TC9 and TH9 in Helicobacter pylori-induced gastritis. 4. Matsunaga T, Endo H, Takamori A, et al. Lifestyle- and comorbid- Helicobacter. 2020;25(1):1-12. ity-related risk factors associated with prescription of gastric acid 22. Streleckiene G, Inciuraite R, Juzenas S, et al. miR-20b and miR-451a secretion inhibitors to japanese patients who were Helicobacter py- are involved in gastric carcinogenesis through the PI3K/AKT/mTOR lori negative and had no upper gastrointestinal lesions. Digestion. signaling pathway: data from gastric cancer patients, cell lines and 2020. ins-gas mouse model. Int J Mol Sci. 2020;21(3):877. 5. Doorakkers E, Lagergren J, Santoni G, Engstrand L, Brusselaers N. 23. Ding L, Li Q, Chakrabarti J, et al. MiR130b from Schlafen4+ MDSCs Helicobacter pylori eradication treatment and the risk of Barrett’s stimulates epithelial proliferation and correlates with preneoplas- esophagus and esophageal adenocarcinoma. Helicobacter. tic changes prior to gastric cancer. Gut. 2020;1-12. [Epub ahead of 2020;25(3):e12688. print]. 6. Degiovani M, Ribas CAPM, Czeczko NG, Parada AA, de Fronchetti 24. Rajilic-Stojanovic M, Figueiredo C, Smet A, et al. Systematic review: J, Malafaia O. Is there a relation between Helybacter pylori and in- gastric microbiota in health and disease. Aliment Pharmacol Ther. testinal metaplasia in short column epitelization up to 10 mm in the 2020;51(6):582-602. distal esophagus? Arq Bras Cir Dig. 2019;32(4):e1480. 25. Sung JJY, Coker OO, Chu E, et al. Gastric microbes associated with 7. Sonnenberg A, Turner KO, Genta RM. Interaction between ethnic- gastric inflammation, atrophy and intestinal metaplasia 1 year after ity and Helicobacter pylori infection in the occurrence of reflux dis- Helicobacter pylori eradication. Gut. 2020;1-10. [Epub ahead of print]. ease. J Clin Gastroenterol. 2020;54(7):614-619. 26. Miao R, Wan C, Wang Z. The relationship of gastric microbiota and 8. Aghayeva S, Mara KC, Katzka DA. The impact of Helicobacter pylori Helicobacter pylori infection in pediatrics population. Helicobacter. on the presence of Barrett’s esophagus in Azerbaijan, a high-prev- 2020;25(1):13-22. alence area of infection. Dis Esophagus Off J Int Soc Dis Esophagus. 27. Sugano K, Tack J, Kuipers EJ, et al. Kyoto global consensus report 2019;32(11):1-5. on Helicobacter pylori gastritis. Gut. 2015;64(9):1353-1367. 9. Rokkas T, Gisbert JP, Niv Y, O’Morain C. The association between 28. McNicholl AG, Amador J, Ricote M, et al. Spanish primary care Helicobacter pylori infection and inflammatory bowel disease based survey on the management of Helicobacter pylori infection and on meta-analysis. United Eur Gastroenterol J. 2015;3(6):539-550. dyspepsia: Information, attitudes, and decisions. Helicobacter. 10. Arnold IC, Hitzler I, Muller A. The immunomodulatory properties 2019;24(4):e12593. of Helicobacter pylori confer protection against allergic and chronic 29. Beresniak A, Malfertheiner P, Franceschi F, Liebaert F, Salhi H, inflammatory disorders. Front Cell Infect Microbiol. 2012;2:10. Gisbert JP. Helicobacter pylori “Test-and-Treat” strategy with urea 11. Kyburz A, Fallegger A, Zhang X, et al. Transmaternal Helicobacter breath test: A cost-effective strategy for the management of dys- pylori exposure reduces allergic airway inflammation in offspring pepsia and the prevention of ulcer and gastric cancer in Spain- through regulatory T cells. J Allergy Clin Immunol. 2019;143(4):1496- Results of the Hp-Breath initiative. Helicobacter. 2020;25:e12693. 1512.e11. 30. Papastergiou J, Donnelly M, Yuen T, Li W. van den Bemt B. 12. Kyburz A, Urban S, Altobelli A, et al. Helicobacter pylori and Community pharmacy-based H. pylori screening for patients with its secreted immunomodulator VacA protect against anaphy- uninvestigated dyspepsia. Can Pharm J (Ott). 2020;153(2):101-107. laxis in experimental models of food allergy. Clin Exp Allergy. 31. Oung B, Chea K, Oung C, Saurin J-C, Ko CW. Endoscopic yield of 2017;47(10):1331-1341. chronic dyspepsia in outpatients: A single-center experience in 13. Furuta GT, Katzka DA. Eosinophilic esophagitis. N Engl J Med. Cambodia. J Gastroenterol Hepatol. 2020;4(1):61-68. 2015;373(17):1640-1648. 32. Oh JH, Kwon JG, Jung H-K, et al. Clinical Practice Guidelines 14. Shah SC, Tepler A, Peek RMJ, Colombel J-F, Hirano I, Narula N. for Functional Dyspepsia in Korea. J Neurogastroenterol Motil. Association between Helicobacter pylori exposure and decreased 2020;26(1):29-50. odds of eosinophilic esophagitis-a systematic review and me- 33. Eusebi LH, Black CJ, Howden CW, Ford AC. Effectiveness of man- ta-analysis. Clin Gastroenterol Hepatol. 2019;17(11):2185-2198.e3. agement strategies for uninvestigated dyspepsia: systematic review 15. Høgh MB, Kronborg C, Hansen JM, Schaffalitzky de Muckadell OB. and network meta-analysis. BMJ. 2019;367:l6483. The cost effectiveness of Helicobacter pylori population screening— 34. Ebrahimzadeh Attari V, Somi MH, Asghari Jafarabadi M, economic evaluation alongside a randomised controlled trial with Ostadrahimi A, Moaddab S-Y, Lotfi N. The gastro-protective effect 13-year follow-up. Aliment Pharmacol Ther. 2019;49(8):1013-1025. of ginger (Zingiber officinale Roscoe) in Helicobacter pylori positive 16. Chen Q, Liang X, Long X, Yu L, Liu W, Lu H. Cost-effectiveness functional dyspepsia. Adv Pharm Bull. 2019;9(2):321-324. analysis of screen-and-treat strategy in asymptomatic Chinese for 35. Leite C, Mazzoleni LE, de Uchoa DM, Castanho JA, Mazzoleni F, preventing Helicobacter pylori-associated diseases. Helicobacter. Sander GB. Association of duodenal eosinophilic infiltrate with 2019;24(2):1-13. Helicobacter pylori infection, but not with functional dyspepsia. Arq 17. Hung KW, Knotts RM, Faye AS, et al. Factors associated with adher- Gastroenterol. 2020;57(1):74-48. ence to Helicobacter pylori testing during hospitalization for bleeding 36. Lebwohl B, Blaser MJ, Ludvigsson JF, et al. Decreased risk of ce- peptic ulcer disease. Clin Gastroenterol Hepatol. 2020;18(5):1091- liac disease in patients with Helicobacter pylori colonization. Am J 1098.e1. Epidemiol. 2013;178(12):1721-1730. 18. Burgard M, Kotilea K, Mekhael J, et al. Evolution of Helicobacter 37. Diamanti A, Maino C, Niveloni S, et al. Characterization of gastric pylori associated with gastroduodenal ulcers or erosions in chil- mucosal lesions in patients with celiac disease: a prospective con- dren over the past 23 years: Decline or steady state? Helicobacter. trolled study. Am J Gastroenterol. 1999;94(5):1313-1319. 2019;24(5):1-9. 38. Rostami-Nejad M, Villanacci V, Mashayakhi R, et al. Celiac disease 19. Sonnenberg A, Turner KO, Genta RM. Low prevalence of Helicobacter and Hp infection association in Iran. Rev Esp enfermedades Dig or- pylori-positive peptic ulcers in private outpatient endoscopy cen- gano Of la Soc Esp Patol Dig. 2009;101(12):850-854. ters in the United States. Am J Gastroenterol. 2020;115(2):244-250. 39. Aydogdu S, Cakir M, Yuksekkaya HA, et al. Helicobacter pylori in- 20. Guo CG, Cheung KS, Zhang F, et al. Incidences, temporal trends fection in children with celiac disease. Scand J Gastroenterol. and risks of hospitalisation for gastrointestinal bleeding in new or 2008;43(9):1088-1093. 6 of 6 | SCHULZ and KUPČINSKAS

40. Luzza F, Mancuso M, Imeneo M, et al. Helicobacter pylori infection in children with celiac disease: prevalence and clinicopathologic fea- How to cite this article: Schulz C, Kupčinskas J. Review - tures. J Pediatr Gastroenterol Nutr. 1999;28(2):143-146. Helicobacter pylori and non-malignant upper gastro-intestinal 41. Chen Y, Blaser MJ. Inverse associations of Helicobacter pylori with diseases. Helicobacter. 2020;25(Suppl. 1):e12738. https://doi. asthma and allergy. Arch Intern Med. 2007;167(8):821-827. 42. Arnold IC, Dehzad N, Reuter S, et al. Helicobacter pylori infection org/10.1111/hel.12738 prevents allergic asthma in mouse models through the induction of regulatory T cells. J Clin Invest. 2011;121(8):3088-3093. 43. Narang M, Puri AS, Sachdeva S, Singh J, Kumar A, Saran RK. Celiac disease and Helicobacter pylori infection in children: Is there any Association? J Gastroenterol Hepatol. 2017;32(6):1178-1182.

DOI: 10.1111/hel.12739

REVIEW ARTICLE

Review: Gastric cancer: Basic aspects

Carlos Resende1 | Carla Pereira Gomes1 | Jose Carlos Machado1,2

1i3S – Institute for Research and Innovation in Health and IPATIMUP, Institute of Abstract Molecular Pathology and Immunology, Gastric cancer is still one of the most prevalent and deadliest cancers in the world. University of Porto, Porto, Portugal Although our knowledge about the disease has progressed extraordinarily, this has 2Department of Pathology, Faculty of Medicine, University of Porto, Porto, not been accompanied by our capacity to effectively treat the disease. In the last Portugal years, immunotherapy made its way into the cancer field and was responsible for

Correspondence major changes in the treatment success rates for several cancer types. Although gas- Jose Carlos Machado, IPATIMUP, Rua tric cancer was not among the first successful targets of this type of therapy, the Dr. Roberto Frias, S/N 4200-465 Porto, Portugal. relationship between this type of cancer, immunosurveillance and immunotherapy Email: [email protected] is now being actively researched. In this article, we review the literature of the past

Funding information year regarding the relationship between gastric cancer, its immune microenviron- FEDER - Fundo Europeu de ment and response to immunotherapy. Published data indicate that the immune mi- Desenvolvimento Regional; FCT - Fundação para a Ciência e a Tecnologia croenvironment influences the clinical behaviour of gastric cancer, and is correlated with its histologic and molecular subtypes with an emphasis on the microsatellite- and EBV-positive tumour subgroups. Although the literature regarding response to immunotherapy is scarce, there is good evidence that patient stratification for immunotherapy is going to become a reality in gastric cancer.

KEYWORDS EBV, gastric cancer, immunosurveillance, immunotherapy, microsatellite instability, tumor microenvironment

1 | INTRODUCTION between GC, its immune microenvironment and response to immunotherapy. Cancer immunotherapy, which impairs cancer evasion from immunosurveillance, has been recently explored as an effective therapeutic strategy for cancer treatment. In fact, inhibition of immune 2 | IMMUNE MICROENVIRONMENT checkpoint proteins, programmed death ligand 1 (PD-1) and its ligand (PD-L1), has created a paradigm shift in cancer treatment.1 The expression of PD-1 and PD-L1 in GC and its association with pa- Cancer cells manage to escape immunosurveillance by up-regulating tients-survival rate was recently addressed. Ji-Hyun et al4 reported immune checkpoint proteins, such as PD-L1.2 However, this escape that 60% of GC cases expressed PD-L1 and found the expression to mechanism can be prevented with immune checkpoint inhibitors be significantly higher in patients with advanced disease stages. The (ICI), which block the physical interaction between PD-1 and PD-L1. authors also found that patients with positive PD-L1 expression had ICI have been recently approved for the treatment of patients with shorter disease-free survival time and poor prognosis. advanced or metastatic gastric cancer (GC), whose tumours express Microsatellite instability (MSI) is also a predictor of response to PD-L1 detected by immunohistochemistry (IHC).3 Nevertheless, the ICI.5 Due to impaired DNA-mismatch repair, MSI tumours typically response rates are low, highlighting the need to elucidate the mech- present an increased mutation burden, which can result in the emer- anisms underlying treatment resistance. In this review, we focus on gence of mutation-associated neoantigens that will trigger an in- the articles published in the past year concerning the relationship crease in tumour lymphocyte infiltration.6 However, MSI status has

Helicobacter. 2020;25(Suppl. 1):e12739. wileyonlinelibrary.com/journal/hel © 2020 John Wiley & Sons Ltd | 1 of 5 https://doi.org/10.1111/hel.12739 2 of 5 | RESENDE et al. rarely been evaluated in the context of both systemic immune re- MSI molecular subtypes, considered subtypes with better prognosis, sponse and tumour lymphocyte infiltration. Shin et al7 looked at the were significantly associated with increased tumour lymphocyte in- MSI status of a cohort of GC cases and its association with tumour filtration (namely CD3+ and CD8+ T cells). immune infiltration and systemic immune response to evaluate its Gullo et al15 analysed 24 GC with lymphoid stroma (GCLS) prognostic value. They found that the stroma of MSI tumours shows samples, according to the 2010 World Health Organization classi- a significant increase in the number and activation status of cyto- fication. They found that 16 of these cases were EBV+/MSS (micro- toxic T lymphocytes (CD8+ T cells). On the other hand, only a weak satellite stable), 4 were EBV-/MSI-high and 4 were EBV-/MSS. All association was observed between the systemic immune response EBV+ cases showed a significantly higher number of CD3+ T cells and and local immune infiltration. Pernot et al8 also performed an anal- CD8+ T cells. Additional characterisation of the T cell profile showed ysis of tumour infiltrating and peripheral immune cell composition an enrichment of genes related to cytotoxic T cells, Th1 cells and in a cohort of advanced GC cases. They found that the percentage pro-inflammatory factors, along with genes indicative of activation of circulating natural killer (NK) and regulatory T cells (Treg) were of regulatory T cells (Tregs) and immune inhibitory checkpoints in significantly lower in patients with a diffuse/mixed histological type EBV+ GCLS samples. They also found PD-L1 expression to be fre- than in patients with an intestinal histological type. Regarding tu- quent in cancer and stromal immune cells and restricted to EBV+ and mour-infiltrating cells, they found less CD8+ T cells in the diffuse/ MSI molecular subtypes.16 High levels of PD-L1 were also observed mixed-type. Moreover, they observed that patients with an elevated in EBV+ GC cell lines, being responsible for the suppression of T cell 17 number of circulating NK cells and patients with increased tumour proliferation through modulation via the IFN-γ signaling pathway, infiltrating CD8+ T cells had a significantly longer overall survival. highlighting the role of EBV infection in promoting an inflamed tu- These results suggest that the low number of tumour infiltrating mour microenvironment, which may be a potential predictive bio- CD8+ T cells and circulating NK cells can account for the worse prog- marker of response to targeted immunotherapies. Another study nosis observed in diffuse/mixed-type GC. examined the RNA expression profiles of 94 gastroscopic biopsies Using transcriptome analysis and deconvolution algorithms, Li from 47 patients, including gastric precancerous lesions. They de- et al9 found that increased tumour infiltration by CD8+ T cells and tected that the immune microenvironment was more active in ear- memory CD4+ T cells, independent of the tumour histological type, ly-stage GC than in precancerous lesions, with a significantly higher predicted a favourable prognosis in GC patients. However, the oppo- infiltration score. Among the immune cells present in the infiltrate, site result was observed for increased tumour infiltration by M2 mac- monocytes and M1 macrophages were the most abundant, although rophages. These observations between tumour infiltrating CD8+ T lymphocytes were also detected.18 cells and M2 macrophages and GC patients’ prognosis were also ob- Increased levels of CXCL8 (also known as interleukin 8), predomi- served and reported by another group.10 A different group described nantly secreted by macrophages, were identified to be indicative of a that tumour infiltrating CD8+ T cells were present at higher densities poor prognosis in GC patients. High CXCL8 secretion was associated but were less functional in the diffuse histological type when com- with decreased CD8+ T cell infiltration, proliferation and function pared with the intestinal histological type.11 Moreover, the diffuse by inducing the expression of PD-L1 on macrophages. The authors type-associated CD8+ T cell pattern was characterised by levels of found that the small molecule CXR2 inhibitor (reparixin) drives the immunosuppressive mediators, such as transforming growth factor decreased PD-L1+ macrophages and promotes antitumour immunity, 19 (TGF)-β1. providing potential therapeutic effects for GC patients. Gastric cancer is a heterogeneous disease, with several histo- As the tumour microenvironment (TME) is a critical component logical and molecular subtypes. Thus, effective stratification strat- of tumour tissues and is not only composed of immune cells, recent egies and selection of predictive biomarkers for immunotherapy research work emerged to clarify the impact of TME composition are required. To better dissect the immune infiltrate of GC patients and prognosis stratification in GC. In a study by Wang et al,20 gene according to their histological subtype, Kim et al12 retrospectively expression data were analysed to estimate tumour infiltration by investigated the immune infiltrate of 43 patients classified accord- stromal (non-immune) and immune cells, resulting in the generation ing to the classification of The Cancer Genome Atlas (TCGA), which of two signature scores: the stromal score and the immune score. identifies Epstein–Barr virus positive (EBV+), MSI, genomically sta- The authors demonstrated that both stromal and immune scores ble, and chromosomal unstable GCs. The most prevalent immune were unfavourable factors for survival outcome and could be used cells were CD8+ T lymphocytes and CD68+ macrophages. EBV and to stratify patient prognoses and improve the prediction accuracy of MSI tumours were the most infiltrated, harboring 30%-50% T cells the TNM staging system. In another study, Ren et al21 explored the and 20% macrophages. Intestinal tumours contained fewer T cells clinical significance of non-immune cells in the TME and their po- but disproportionately more macrophages. Diffuse tumours were tential as biomarkers for PD-1/PD-L1 immunotherapy. The stromal the least infiltrated. PD-1 was most frequently expressed in intesti- score showed significant differences for different tumour stages and nal tumours, whereas 70% of EBV and MSI tumours expressed PD- molecular subtypes. They observed that patients in the low stromal L1.13 In another study, Kim et al14 also demonstrated a correlation score group have a survival advantage and are the ones who could between the molecular subtype and the immune composition within benefit most from ICI. Additionally, Zeng et al22 estimated the TME the tumour microenvironment. The authors observed that EBV+ and composition of a large cohort of GC cases and correlated the TME RESENDE et al. | 3 of 5 phenotypes with different genomic and clinicopathologic character- immunotherapies.28 However, there is an urgent need to identify istics of tumours. From the three TME score groups defined by the additional predictive biomarkers to improve patient selection for authors, they observed that the low TME score subtype, character- ICI. Kim et al29 used a gene panel-based sequencing approach to ised by activation of transforming growth factor β, epithelial-mes- demonstrate that, in addition to MSI and PD-L1 expression, the enchymal transition and angiogenesis pathways, was significantly tumour mutation burden can be used as a predictive biomarker in associated with a worse prognosis. GC patients treated with ICI. They showed that patients with a high In an attempt to systematically identify predictive molecu- tumour mutation burden have prolonged progression-free survival. lar networks and key regulators that could identify biomarkers for Moreover, Jiang et al30 found mutated ARID1A to be associated with immunotherapies in GC, several studies relied on high-throughput higher tumour mutation burden across different cancer types, and to transcriptomic analysis of different cohorts. Ren et al evaluated confer prolonged overall survival in advanced cancers treated with the most differentially expressed genes (DEGs) from two datasets ICI. These results suggest that ARID1A mutational status can be used (tumour vs normal gastric tissue) of the Gene Expression Omnibus to predict a survival benefit from immunotherapy across multiple database. A Kaplan-Meier survival analysis was also performed to cancer types, including GC. identify the genes with the strongest correlation with patient sur- New advances in high-throughput technologies have pro- vival. GPNMB, which encodes a cell surface glycoprotein, emerged as vided many insights into the molecular characterisation of GC. one of the strongest candidates, being significantly associated with Nevertheless, reliable biomarkers for therapy response, especially in immunosuppressive cell-related markers. Further in vitro experi- diffuse-type GC, are largely unknown. Based on transcriptome pro- ments revealed that GPNMB could activate the PI3K/AKT signaling filing analyses, Kim et al31 identified a molecular signature of distinct pathway and induce CCL4 expression (a chemoattractant for NK prognostic subtypes in diffuse-type GC: the intestinal-like (INT) and cells). Overall, their results suggest the potential value of GPNMB core diffuse-type (COD) subtypes. By integrating gene expression blockade as a new immunotherapy against GC.23 Using single-cell and mutational profiles, they showed that patients with the COD gene expression analysis, Sathe et al24 demonstrated that GC TME subtype benefit from standard chemotherapy, while patients with suffers from a series of cellular changes compared to matched stom- the INT subtype are responsive to ICI. With this approach, the au- ach mucosa. They reported an increased number of Tregs, which thors unraveled a molecular signature that allows the identification contribute to an immunosuppressive microenvironment and iden- of diffuse-type GC patients who will benefit the most from ICI. tified transcriptional cell states unique to GC in dendritic cells and Finally, in approximately 10% of advanced GC patients, the PD-1 two subclasses of exhausted cytotoxic T lymphocytes. More inter- blockade leads to rapid cancer progression, a phenomenon known estingly, they found that macrophages from the GC TME exhibited as hyperprogressive disease (HPD). Kamada et al analysed tumour a heterogeneous gene expression profile that was not confined to samples from HPD patients and observed that, in the majority of a binary M1/M2 designation. Moreover, in this study, immune cell them, tumour-infiltrating FoxP3highCD45RA−CD4+ T cells [effector subtypes did not cluster clearly according to the samples' MSI/ Tregs (eTreg)] expressed PD-1 at equivalent levels as CD4+ or CD8+ MSS status.24 In a different study, Xiang et al25 identified IDO1 to effector/memory T cells. Comparison of GC tissue samples before be highly expressed in 4 GC cell lines (AGS, Hs746T, SGC-7901 and and after anti–PD-1 therapy revealed that the treatment markedly MKN-45) and to be positively associated with extracellular matrix increased proliferative (Ki67+) eTreg cells in HPD patients, con- formation and collagen processing. Expression of collagens in tu- trasting with their reduction in non-HPD patients. These cells were mour tissues could not only ignite tumour invasion and metastasis highly activated, with a high expression of CTLA-4, and therefore but also prevent T cells from entering into the tumour tissue and highly suppressive. They also showed that genetic ablation or anti- impair a proper antitumour immune response. body-mediated blockade of PD-1 increased eTreg proliferation and suppressive capacity of antitumour immune responses in mice.32 This study suggests that the presence of actively proliferating PD-1+ 3 | RESPONSE TO IMMUNOTHERAPY eTreg cells in tumours is a reliable marker for HPD.

In a study aiming at determining the predictive value of MLH1 and PD-L1 expression for prognosis and response to preoperative 4 | CONCLUSIONS chemotherapy in gastric cancer, Hashimoto et al26 demonstrated that patients with resectable MSI GC, due to loss of mutL homolog Immunotherapy has been revolutionising the oncology field in re- 1 (MHL1), exhibit a good prognosis and negative response to fluoro- cent years. Although GC was not among the first successful targets uracil-based chemotherapy. In a similar study, Di Bartolomeo et al27 of this therapeutic approach, it has been slowly making its way into showed that MSI status was independently associated with increased the realm of immunotherapy. In the past year, several studies were disease-free survival and overall survival in GC patients randomised published showing that the expression of immune-related proteins for an intensive sequential chemotherapy regimen vs fluorouracil/ by GC cells as well as the abundance and nature of the immune in- leucovorin monotherapy as adjuvant treatment. It is noteworthy that filtrate influence the behaviour of GC. The expression of immune MSI tumours are also the ones with a better response to current checkpoint proteins tends to correlate with worse survival, whereas 4 of 5 | RESENDE et al. tumour infiltration with immune effector cells such as CD8+, CD4+, 11. Li R, Zhang H, Cao Y, et al. Lauren classification identifies distinct prognostic value and functional status of intratumoral CD8+ T cells in and NK cells tends to correlate with better survival. It is also inter- gastric cancer. Cancer Immunol Immunother. 2020;69(7):1327-1336. + + esting that MSI and EBV positive tumours tend to be associated 12. Cancer Genome Atlas Research. Comprehensive molec- with immunologically active tumours, indicating that these tumours ular characterization of gastric adenocarcinoma. Nature. might benefit from immunotherapy approaches. 2014;513(7517):202-209. Regarding GC response to immunotherapy the literature is 13. Kim TS, da Silva E, Coit DG, et al. Intratumoral immune response to gastric cancer varies by molecular and histologic subtype. Am J Surg scarcer. However, the few studies published are good indicators Pathol. 2019;43(6):851-860. that the same biomarkers used successfully in other tumour types 14. Kim JY, Kim WG, Kwon CH, et al. Differences in immune contex- will also be effective for GC. Finally, several studies suggest that GC tures among different molecular subtypes of gastric cancer and histological/molecular subtypes should be considered in therapeutic their prognostic impact. Gastric Cancer. 2019;22(6):1164-1175. 15. Nagtegaal ID, Odze RD, Klimstra D, et al. The 2019 WHO clas- decisions, particularly for immunotherapeutic eligibility. sification of tumours of the digestive system. Histopathology. 2020;76(2):182-188. ACKNOWLEDGEMENTS 16. Gullo I, Oliveira P, Athelogou M, et al. New insights into the inflamed Work in JCM's laboratory is supported in part by: FEDER - Fundo tumor immune microenvironment of gastric cancer with lymphoid stroma: from morphology and digital analysis to gene expression. Europeu de Desenvolvimento Regional through the COMPETE Gastric Cancer. 2019;22(1):77-90. 2020 - Operacional Programme for Competitiveness and 17. Sasaki S, Nishikawa J, Sakai K, et al. EBV-associated gastric cancer Internationalisation (POCI), Portugal 2020; and by FCT - Fundação evades T-cell immunity by PD-1/PD-L1 interactions. Gastric Cancer. para a Ciência e a Tecnologia/Ministério da Ciência, Tecnologia e 2019;22(3):486-496. 18. Zhang Y, Wu X, Zhang C, et al. Dissecting expression profiles of gas- Inovação in the framework of the projects "Institute for Research and tric precancerous lesions and early gastric cancer to explore crucial Innovation in Health Sciences" (POCI-01-0145-FEDER-007274), and molecules in intestinal-type gastric cancer tumorigenesis. J Pathol. "Tregs in cancer immune response" (PTDC/MED-PAT/32462/2017). 2020;251(2):135-146. 19. Lin C, He H, Liu H, et al. Tumour-associated macrophages-derived CXCL8 determines immune evasion through autonomous PD-L1 CONFLICT OF INTERESTS expression in gastric cancer. Gut. 2019;68(10):1764-1773. The authors have no competing interests. 20. Wang H, Wu X, Chen Y. Stromal-immune score-based signature: a prognosis stratification tool in gastric cancer. Front Oncol. REFERENCES 2019;9:1212. 21. Ren Q, Zhu P, Zhang H, et al. Identification and validation of stro- 1. Nishino M, Ramaya NH, Hatabu H, et al. Monitoring immune-check- mal-tumor microenvironment-based subtypes tightly associated point blockade: response evaluation and biomarker development. with PD-1/PD-L1 immunotherapy and outcomes in patients with Nat Rev Clin Oncol. 2017;14(11):655-668. gastric cancer. Cancer Cell Int. 2020;20:92. 2. Budczies J, Allgäuer M, Litchfield K, et al. Optimizing panel-based 22. Zeng D, Li M, Zhou R, et al. Tumor microenvironment charac- tumor mutational burden (TMB) measurement. Ann Oncol. terization in gastric cancer identifies prognostic and immuno- 2019;30:1496-1506. therapeutically relevant gene signatures. Cancer Immunol Res. 3. Fashoyin-Aje L, Donoghue M, Chen H, et al. FDA approval sum- 2019;7(5):737-750. mary: Pembrolizumab for recurrent locally advanced or metastatic 23. Ren F, Zhao Q, Liu B, et al. Transcriptome analysis reveals GPNMB gastric or gastroesophageal junction adenocarcinoma expressing as a potential therapeutic target for gastric cancer. J Cell Physiol. PD-L1. Oncologist. 2019;24(1):103-109. 2020;235(3):2738-2752. 4. Ji-Hyun K, Shinn-Young K, Eun-Young S, et al. Expression patterns 24. Sathe A, Grimes SM, Lau BT, et al. Single-cell genomic characteriza- of programmed death-1 and programmed death-1 ligand-1 on T tion reveals the cellular reprogramming of the gastric tumor micro- cells in gastric cancer. Oncol Lett. 2019;18(3):2661-2669. environment. Clin Cancer Res. 2020;26(11):2640-2653. 5. Ganesh K, Stadler ZK, Cercek A, et al. Immunotherapy in colorectal 25. Xiang Z, Li J, Song S. A positive feedback between IDO1 metabolite cancer: Rationale, challenges and potential. Nat Rev Gastroenterol and COL12A1 via MAPK pathway to promote gastric cancer metas- Hepatol. 2019;16(6):361-375. tasis. J Exp Clin Cancer Res. 2019;38(1):314. 6. McGranahan N, Furness AJ, Rosenthal R, et al. Clonal neoantigens 26. Hashimoto T, Kurokawa Y, Takahashi T, et al. Predictive value elicit T cell immunoreactivity and sensitivity to immune checkpoint of MLH1 and PD-L1 expression for prognosis and response to blockade. Science. 2016;351:1463-1469. preoperative chemotherapy in gastric cancer. Gastric Cancer. 7. Shin SJ, Kim SS, Choi YY, et al. Mismatch repair status of gastric 2019;22(4):785-792. cancer and its association with the local and systemic immune re- 27. Di Bartolomeo M, Morano F, Raimondi A, et al. Prognostic and sponse. Oncologist. 2019;24(9):e835-e844. predictive value of microsatellite instability, inflammatory reaction 8. Pernot S, Terme M, Radosevic-Robin N, et al. Infiltrating and pe- and PD-L1 in gastric cancer patients treated with either adjuvant ripheral immune cell analysis in advanced gastric cancer according 5-FU/LV or sequential FOLFIRI followed by cisplatin and docetaxel: to the Lauren classification and its prognostic significance. Gastric a translational analysis from the ITACA-S Trial. Oncologist. Cancer. 2020;23(1):73-81. 2020;25(3):e460-e468. 9. Li L, Ouyang Y, Wang W, et al. The landscape and prognostic 28. Kim ST, Cristescu R, Bass AJ, et al. Comprehensive molecular char- value of tumor-infiltrating immune cells in gastric cancer. PeerJ. acterization of clinical responses to PD-1 inhibition in metastatic 2019;7:e7993. gastric cancer. Nat Med. 2018;24:1449-1458. 10. Liu X, Xu D, Huang C, et al. Regulatory T cells and M2 macrophages 29. Kim J, Kim B, Kang SY, et al. Tumor mutational burden determined present diverse prognostic value in gastric cancer patients with dif- by panel sequencing predicts survival after immunotherapy in pa- ferent clinicopathologic characteristics and chemotherapy strate- tients with advanced gastric cancer. Front Oncol. 2020;10:314. gies. J Transl Med. 2019;17:192. RESENDE et al. | 5 of 5

30. Jiang T, Chen X, Su C, et al. Pan-cancer analysis of ARID1A alterations as biomarkers for immunotherapy outcomes. J Cancer. How to cite this article: Resende C, Gomes CP, Machado JC. 2020;11(4):776-780. Review: Gastric cancer: Basic aspects. Helicobacter. 31. Kim SY, Kim HJ, Park JL, et al. Identification of a molecular signa- 2020;25(Suppl. 1):e12739. https://doi.org/10.1111/hel.12739 ture of prognostic subtypes in diffuse-type gastric cancer. Gastric Cancer. 2020;23(3):473-482. 32. Kamada T, Togashi Y, Tay C, et al. PD-1(+) regulatory T cells amplified by PD-1 blockade promote hyperprogression of cancer. Proc Nat Acad Sci U S A. 2019;116(20):9999-10008.

DOI: 10.1111/hel.12740

REVIEW ARTICLE

Review: Prevention and management of gastric cancer

Marino Venerito1 | Alexander C. Ford2,3 | Theodoros Rokkas4 | Peter Malfertheiner1,5

1Department of Gastroenterology, Hepatology and Infectious Diseases, Abstract Otto-von-Guericke University Hospital, Gastric cancer (GC) is still the fifth most frequently diagnosed cancer and the third Magdeburg, Germany leading cause of cancer deaths in both sexes worldwide. Although the incidence of 2Leeds Gastroenterology Institute, St. James's University Hospital, Leeds, UK GC is predicted to continue declining in a growing number of countries in the future, 3Leeds Institute of Medical Research at St. on a global scale the number of newly diagnosed GC cases will remain high, or in- James’s, University of Leeds, Leeds, UK crease even further, due to changes in population size and increasing risks observed 4Gastroenterology Clinic, Henry Dunant Hospital, Athens, Greece in younger generations. In a retrospective cohort study, collecting data from the 5Department of Internal Medicine II, Ludwig Veterans Health Administration, treatment of Helicobacter pylori infection decreased Maximilians University Hospital of Munich, GC risk only if eradication was successful. In a German case-control study, among GC Munich, Germany patients with autoimmune gastritis, pernicious anemia was associated with earlier Correspondence detection of GC, which translated into a significantly better 5-year survival. In an up- Marino Venerito, DepartCapacitive Deionizationment of Gastroenterology, dated meta-analysis, H. pylori eradication therapy in healthy individuals significantly Hepatology and Infectious Diseases, Otto- reduced both GC incidence and mortality from GC with a number needed to treat von-Guericke University Hospital, 39120 Magdeburg, Germany. of 72 and 135, respectively. In Korea, successful H. pylori eradication substantially Email: [email protected] reduced GC incidence in first-degree relatives of GC patients as well. A meta-analysis of four trials including 1,556 patients with resectable GC reported that the patient subgroup tumors with high microsatellite instability undergoing surgery did not benefit from perioperative or adjuvant chemotherapy.

KEYWORDS autoimmune gastritis, epidemiology, gastric cancer, Helicobacter pylori, prevention, therapy

1 | INTRODUCTION 2 | METHODS

Helicobacter pylori infection is the principal risk factor for gas- The authors performed an independent search on PubMed on April tric cancer (GC). During the past year, new important epidemi- 2020 for publications on GC during the previous year. The only fil- ological data indicated that the prevalence of GC is changing. ter applied to the searches was the “custom date range” for articles Retrospective studies and randomized controlled trials (RCTs) published between April 2019 and March 2020. The Boolean op- stressed the importance of the success of H. pylori eradication for erator ‘AND” was used to narrow the search results. The following effective GC prevention. Microsatellite instability (MSI)-high sta- search term combinations were used: “gastric cancer” [All Fields] tus is gaining attention for its role as a prognostic, and possibly AND "epidemiology" [All Fields]; “gastric cancer” [All Fields] AND predictive biomarker in patients with GC. This review summarizes "prevention" [All Fields]; “gastric cancer” [All Fields] AND "therapy" recent epidemiological aspects and clinical advances in the field [All Fields]. Studies included and discussed in the present review of GC prevention and therapy published between April 2019 and were selected by the authors for their relevance and importance to March 2020. the field of GC.

3 | EPIDEMIOLOGICAL ASPECTS ethnic groups, respectively. The non-cardia GC risk was still slightly increased in patients who received H. pylori eradication treatment GC still ranks as the fifth most frequently diagnosed cancer and is (SHR: 1.16; 95% CI: 0.74-1.83) but substantially reduced in the sub- the third leading cause of cancer death in both sexes worldwide. group of patients with successfully confirmed H. pylori eradication However, GC incidence is steadily decreasing globally, and in some (SHR: 0.24; 95% CI: 0.15-0.41). populations is now regarded as a rare disease. H. pylori infection increases the risk of non-cardia GC unequivocally, In a registry-based study, Arnold et al extracted data on GC inci- whereas its protective role against esophageal adenocarcinoma and dence by year of diagnosis, sex, and age from 92 cancer registries in proximal GC is debatable. In a retrospective study, Kumar et al aimed 34 countries, based on the International Classification of Diseases, to identify, in the aforementioned Veterans Health Administration co- 10th revision: C16.1 The numbers of new cases and age-standard- hort of patients with previously diagnosed H. pylori, the risk factors ized incidence rates per 10,000 by country, sex, and age, beginning for future esophageal adenocarcinoma and cardia GC.3 Compared in 2012, were extrapolated to 2035 and fitted to recent trends using with whites as the reference population, the risk of future esophageal a log-linear age-period-cohort model that levels off exponential adenocarcinoma or cardia GC was similar among African Americans growth and limits linear trend projection. According to their analysis, (SHR: 0.87, 95% CI: 0.57-1.43) and American Indians (SHR 1.31; 95% overall GC incidence rates will fall further in both high- and low-in- CI, 0.18-9.60) but substantially reduced in Asians (no cases among cidence countries (ie, Japan and Australia, respectively). They also 213 H. pylori-positive) or native Hawaiian origin (no cases among 295 predict that, by 2035, GC incidence rates will fall below the rare dis- H. pylori-positive). Increasing age and smoking were confirmed as risk ease threshold (defined as 6 per 100 000 person-years) in 16 out of factors for esophageal adenocarcinoma and cardia GC (SHR: 1.17, 95% the 34 evaluated countries. In contrast, alarming incidence increases CI: 1.09-1.25 and SHR: 2.06, 95% CI: 1.33-3.18, respectively). Neither will be observed in younger age groups (below 50 years of age) in prescription of H. pylori treatment, nor eradication status, were associ- both low-incidence and high-incidence populations. On a global ated with future esophageal adenocarcinoma or cardia GC. scale, they predicted that the number of newly diagnosed cases will Although H. pylori gastritis is the main risk factor for GC, pa- remain high or increase even further. Changes in the population size tients with autoimmune gastritis (AIG) may develop GC as well. In a and structure, as well as in the prevalence of risk factors, especially case-control study from the German centers of the staR project on in those aged below 50 years, are likely to explain this development. GC research, Weise et al assessed the characteristics and outcomes Thus, while in some regions GC will become a rare disease, in others of GC patients with AIG.4 From 2013 through 2017, they recruited it will remain a major public health challenge. 759 patients with GC and documented presenting symptoms using Helicobacter pylori infection is the most well-known risk factor a self-administered questionnaire. Histological assessment of gas- for GC. Based on a cohort of 371,813 patients (median age 62 years; tric mucosa was available for 572 of 759 GC patients. Overall, 28 92.3% male) from the Veterans Health Administration in the United (4.9%) GC patients had AIG (mean age 67.9 years, female-to-male States, who received a diagnosis of H. pylori infection from 1994 to ratio 1.3:1). Patients with AIG were matched in a 1:2 fashion for age 2018, Kumar et al aimed to calculate the incidence of and risk fac- and gender to GC patients with no AIG. Paraffin-embedded speci- tors for non-cardia gastric adenocarcinoma after detection of H. py- mens of gastric mucosa from GC patients with and without AIG were lori and to identify how treatment and eradication affect cancer risk assessed centrally by a reference gastrointestinal (GI) pathologist. In using a time to event (ie, diagnosis of cancer) with competing risk patients with AIG, GC was more likely to be localized in the proxi- analysis (with death before cancer as a competing risk).2 mal stomach (ie, cardia, fundus, corpus) (OR: 2.7, 95% CI: 1.0-7.1). Patients with H. pylori infection were identified based on results of In GC patients with AIG, pernicious anemia was the leading clinical endoscopic pathology, stool antigen test, urea breath test, prescription sign (OR: 22.0, 95% CI: 2.6-187.2) and represented the most com- for one of 11 accepted H. pylori eradication regimens, as recommended mon indication for esophagogastroduodenoscopy (OR: 29.0, 95% CI: by the American College of Gastroenterology, or H. pylori-associated 7.2-116.4). GC patients with AIG were more likely to present with- International Classification of Diseases (ICD), Revision 9/10 codes. For out distant metastases (OR: 6.2, 95% CI: 1.3-28.8) and to be treated patients with multiple criteria, the criterion with the earliest date was with curative intention (OR: 3.0, 95% CI: 1.0-9.0). The 5-year survival used. Patients with non-cardia GC were identified using the Veterans rates with 95% CI in GC patients with and without AIG were 84.7% Affairs Central Cancer Registry and/or ICD 9/10 codes. (83.8%–85.6%) and 53.5% (50.9%–56.1%), respectively (OR: 0.25, With respect to non-cardia GC, the cumulative incidence of can- 95% CI: 0.08-0.75, P = .001). The authors concluded that in AIG pa- cer was 0.37% at 5 years and increased to 0.5% and 0.65% after tients, pernicious anemia was associated with earlier detection of 10 and 20 years post-detection of H. pylori infection, respectively. GC, which was associated with significantly better clinical outcomes. Older age and a history of smoking both slightly increased the cancer risk, with a sub-hazard ratio [SHR] and 95% confidence interval [CI], of 1.13 (1.11-1.15) and 1.38 (1.25-1.52), respectively. The risk of 4 | PREVENTION STRATEGIES GC was roughly doubled in racial and ethnic minorities, with a SHR and respective 95% CI of 2.52 (1.64-3.89), 2.00 (1.80-2.22), and 1.59 New data have accumulated on the effect of H. pylori eradication in (CI, 1.34-1.87) in Asian, African American, and Hispanic, or Latino preventing GC in H. pylori-positive healthy individuals and in patients VENERITO et al. | 3 of 4 with gastric neoplasia undergoing endoscopic mucosal resection. In population. During a median follow-up of 9.2 years, GC developed an updated meta-analysis, with a literature search date through to in 10 participants (1.2%) in the treatment group and in 23 (2.7%) in February 2020, Ford et al identified 10 RCTs, comparing the effect the placebo group (HR: 0.45; 95% CI: 0.21-0.94; P = .03 by log-rank of H. pylori eradication therapy vs. placebo or no treatment on future test). In the treatment group, five out of the 10 participants in whom GC incidence.5 Participants were comprised of 8,323 healthy H. py- GC developed (50.0%) had persistent H. pylori infection. Thus, GC lori-positive adults and 1,841 H. pylori-positive patients with gastric developed in 0.8% of participants (5 of 608) with confirmed H. pylori neoplasia undergoing endoscopic mucosal resection. All but one of eradication and in 2.9% of participants (28 of 979) with persistent the trials were conducted in East Asia. Follow-up lasted 2 years or infection (HR: 0.27; 95% CI: 0.10-0.70). longer. In the pooled analysis, H. pylori eradication therapy reduced GC incidence (RR = 0.54; 95% CI: 0.40-0.72) with 72 as the number of healthy individuals needed to treat (NNT) to prevent one GC. 5 | TREATMENT Mortality from GC was also reduced (RR = 0.61; 95% CI: 0.40-0.92, NNT = 135), whereas all-cause mortality was not affected. According Mismatch repair deficiency (dMMR)-/microsatellite instability (MSI)- to these data, 8 743 815 disability-adjusted life years (DALYs) would high status is gaining attention for its possible role as a prognostic be gained if population screening and treatment were implemented and possibly predictive biomarker in patients with GC. However, globally (95% CI: 5 646 173-11 847 456), with the highest and low- GCs with dMMR-/MSI-high status represent only 9% to 22% of all est impact expected in East Asia and Australasia, respectively. A diagnosed GC cases, and thus large data sets are needed to draw significant reduction in future GC incidence was also demonstrated robust evidence concerning its prognostic/predictive value. in patients already harboring gastric neoplasia (RR = 0.49; 95% CI: In an individual patient data meta-analysis of four prospective 0.34-0.70, NNT = 21) but undergoing H. pylori eradication therapy trials, Pietrantonio et al investigated the value of MSI as a biomarker after endoscopic mucosal resection. in 1,556 patients with resectable GC.7 Briefly, in the MAGIC and First-degree relatives of GC patients with H. pylori infection are CLASSIC trials, patients were randomized to receive or not receive themselves at increased risk of developing GC. In a single-center, perioperative or adjuvant chemotherapy, respectively, whereas in the double-blind RCT, Choi et al demonstrated that successful H. pylori ITACA-S and ARTIST trials, patients were randomized to receive two eradication therapy reduced GC risk among first-degree relatives of different schedules of adjuvant chemotherapy and chemotherapy, patients with GC. They randomly assigned H. pylori-infected first-de- with or without concurrent irradiation, respectively. The 5-year overall gree relatives of patients with GC to receive either eradication ther- survival (OS) of patients with MSI-high tumors was significantly higher apy (lansoprazole (30 mg), amoxicillin (1000 mg), and clarithromycin compared with patients with MSI-low/microsatellite stable (MSS) tu- (500 mg), each taken twice daily for 7 days) or placebo.6 Overall, mors (77.5% vs. 59.3%, respectively). A 9% increase in 5-year OS was 1,676 participants were included in the modified intention-to-treat confirmed in the subgroup of MSI-low/MSS GC patients receiving

TABLE 1 Biomarker-driven approved strategies for patients with advanced inoperable or metastatic gastric/esophagogastric junction cancer*

Group 3 Group 2 MMRd/MSI-H Group 1 HER-2 positive, MMRp/ or HER-2 negative, MMRp/MSS, PD-L1 CPS < 1 MSS, PD-L1 CPS < 1 PD-L1 CPS ≥ 1

First-line • FP + Platin (doublet), or • FP + Cisplatin • Treatment depending on HER-2 status (refer • FP + Irinotecan (doublet), or +Trastuzumab to group 1 or 2) a,b • FP + Platin +Docetaxel (triplet) • Pembrolizumab Second-line • Paclitaxel + Ramucirumab, or • Treatment as in group • Treatment as in group 1 • Docetaxel, or 1 • Pembrolizumaba,b • Irinotecan, or • Paclitaxel, or • Ramucirumab Third-line • Trifluridine/tipiracil, or • Treatment as in group • Pembrolizumabb or treatment as in group 1 • Irinotecan (if not received in previous lines) 1 • Nivolumabb

Abbreviations: CPS: combined positive score, defined as the number of PD-L-1-positive cells (tumor cells, lymphocytes and macrophages) out of the total number of tumor cells x 100;FP, fluoropyrimidine (infusional 5-FU, capecitabine or S-1); HER-2, human epidermal growth factor receptor 2 (also HER2/neu or ERBB2); MMRp/MMRd, mismatch repair proficient/deficient; MSS/MSI-H, microsatellite stability/high microsatellite instability; PD-L-1: programmed cell death 1 ligand 1. aFor patients who have no satisfactory alternative treatment options. bApplication for healthy insurance reimbursement may be required. Studies with pembrolizumab in earlier treatment lines are ongoing. *Approval status may differ according to regulatory authorities for drug safety. 4 of 4 | VENERITO et al. chemotherapy plus surgery, compared with surgery alone (62% versus REFERENCE 53%, respectively, HR: 0.75, 95% CI: 0.60 - 0.94). Conversely, patients 1. Arnold M, Park JY, Camargo MC, Lunet N, Forman D, Soerjomataram with MSI-high GC did not benefit from chemotherapy (5-year OS: I. Is gastric cancer becoming a rare disease? A global assessment of predicted incidence trends to 2035. Gut. 2020;69(5):823-829. 75% versus 83%, respectively). Thus, for patients undergoing surgery 2. Kumar S, Metz DC, Ellenberg S, Kaplan DE, Goldberg DS. Risk factors with curative intention for GC, MSI is a robust prognostic marker that and incidence of gastric cancer after detection of Helicobacter pylori should be adopted as a stratification factor in future trials. Prospective infection: A large cohort study. Gastroenterology. 2020;158(3):527- trials investigating the role of perioperative chemotherapy omission 536.e7. 3. Kumar S, Metz DC, Ginsberg GG, Kaplan DE, Goldberg DS. and/or immune checkpoint blockade in MSI-high GCs are warranted. Oesophageal and proximal gastric adenocarcinomas are rare after No new treatment emerged for patients with advanced non-re- detection of Helicobacter pylori infection. Aliment Pharmacol Ther. 8,9 sectable GC in the last year (Table 1). 2020;51(8):781-788. 4. Weise F, Vieth M, Reinhold D, et al. Gastric cancer in autoimmune gastritis: A case-control study from the German centers of the staR project on gastric cancer research. United Eur Gastroenterol J. 6 | CONCLUSIONS 2020;8(2):175-184. 5. Ford AC, Yuan Y, Moayyedi P Helicobacter pylori eradication therapy Although in the near future GC incidence rates will fall below the to prevent gastric cancer: systematic review and meta-analysis. Gut. rare disease threshold in many countries, on a global scale the 2020. https://doi.org/10.1136/gutjnl-2020-320839 6. Choi IJ, Kim CG, Lee JY, et al. Family history of gastric cancer and number of newly diagnosed GC cases will remain high, or increase Helicobacter pylori treatment. N Engl J Med. 2020;382(5):427-436. even further, due to changes in population size and increasing risks 7. Pietrantonio F, Miceli R, Raimondi A, et al. Individual patient data me- observed in younger generations. Successful eradication of H. py- ta-analysis of the value of microsatellite instability as a biomarker in lori is the key to GC prevention. Accumulating evidence suggests gastric cancer. J Clin Oncol. 2019;37(35):3392-3400. 8. Venerito M, Link A, Rokkas T, Malfertheiner P. Review: gastric cancer that, in patients with MSI-high resectable GC, chemotherapy may - Clinical aspects. Helicobacter. 2019;24(S1):1-5. be omitted. Precision oncology has become the standard of care 9. Venerito M. S -1 in patients with advanced esophagogastric adeno- for a selected group of patients, but no advances were made in sys- carcinoma: Results from the safety compliance observatory on oral temic therapy for the majority of patients with advanced GC dur- fluoropyrimidines (SCOOP) Study. Drugs R D. 2019;19(2):141-148. ing the last year, and thus, more efforts in this field are warranted.

How to cite this article: Venerito M, Ford AC, Rokkas T, CONFLICT OF INTEREST Malfertheiner P. Review: Prevention and management of MV is involved in speakers’ bureau or consulting: Nordic Pharma, Merck gastric cancer. Helicobacter. 2020;25(Suppl. 1):e12740. Serono, Bayer Vital, Lilly, and Sirtex and is a member of the advisory https://doi.org/10.1111/hel.12740 boards of Ipsen, Lilly, Nordic Pharma, BMS, MSD, Eisai, and Amgen. PM is involved in speakers’ bureau or consulting: Biocodex, Biohit, Danone, Mayoly-Spindler. AC F. and TR declare no conflict of interest.

DOI: 10.1111/hel.12741

REVIEW ARTICLE

Review: Extragastric diseases and Helicobacter pylori

Rinaldo Pellicano1 | Gianluca Ianiro2 | Sharmila Fagoonee3 | Carlo R. Settanni2 | Antonio Gasbarrini2

1Unit of Gastroenterology, Molinette-SGAS Hospital, Turin, Italy Abstract 2Digestive Disease Center, Fondazione The involvement of Helicobacter pylori infection in many extra-gastroduodenal man- Policlinico Universitario Agostino Gemelli ifestations remains a fascinating field of investigation. However, for several of these IRCCS, Catholic University of Sacred Heart, Rome, Italy supposed associations, the potential pathogenic mechanism remains unclear. The 3Institute of Biostructure and Bioimaging present review highlights the main associations of H pylori with extra-gastroduode- (CNR) c/o Molecular Biotechnology Center, Turin, Italy nal manifestations reported during the last year. We searched for the most relevant studies on this topic, published between April 2019 and March 2020, identified Correspondence Rinaldo Pellicano, Unit of Gastroenterology, using the term “Helicobacter” in the MEDLINE/Pubmed database. Consistent data Molinette-SGAS Hospital, Via Cavour 31, emerged from studies investigating metabolic syndrome and ischaemic cardiovas- 10126 Turin, Italy. Email: [email protected] cular diseases. Other reported fields of investigation were hepatology, especially focused on non-alcoholic steatohepatitis, neurology, including Parkinson’s disease and Alzheimer’s disease, as well as dermatology. Inflammatory bowel disease (IBD), that comprises Crohn’s disease and ulcerative colitis, may originate from a dysregulation of the host’s immune response to commensal bacteria in individuals with genetic predisposition. The reduction of biodiversity and other specific imbalances in the faecal microbiome composition of IBD patients compared to that of healthy controls support this hypothesis. In this context, an inverse correlation between H pylori infection and IBD prevalence has been confirmed. Similar results were found in patients with kidney diseases and allergic manifestations. There are indications of the possible involvement of H pylori infection in metabolic syndrome and ischaemic cardiovascular diseases. However, due to a series of factors linked to study designs and the multifactorial pathogenesis of some diseases, further studies are needed.

KEYWORDS cardiovascular diseases, cirrhosis, diabetes, IBD, metabolic syndrome, Parkinson disease

1 | INTRODUCTION epidemiological limitations of the studies and the multifactorial aetiology of the investigated diseases. In the last decades, a multitude of investigations have reported a This review reports the most relevant studies on this topic, link between Helicobacter pylori infection and a variety of extra-gas- published between April 2019 and March 2020, identified by troduodenal manifestations.1 However, for several of these, an searching for the term “Helicobacter” in the MEDLINE/Pubmed aetiological role of such bacteria has not been confirmed, due to database.

2 | METABOLIC DISORDERS developed DM, with an incidence unrelated to H pylori seropositivity (Hazard ratios (Hrs), 1.01; 95% CI, 0.88-1.16; P = .854). The latter 2.1 | Metabolic syndrome and obesity was not associated with impaired glucose tolerance (P = .566), dia- 11 betic nephropathy (P = .952) or poor glycaemic control (P = .535). Metabolic syndrome (MS), described in 1988 as insulin resistance In a cross-sectional study, including 58 482 Chinese adults, (IR) syndrome or syndrome X,2 includes obesity, dyslipidaemia, hy- H pylori-positive participants had a higher DM rate (7.3% vs 5.2%; perglycaemia, high blood pressure and IR. Clustering of these com- P < .001), fasting plasma glucose (P < .001) and glycated HbA1c ponents is associated with increased risk of both diabetes mellitus (P < .001) than uninfected ones. Multivariate regression analysis con- (DM) and coronary heart disease (CHD).3 firmed that H pylori infection was related to DM (OR, 1.25; 95% CI, In a Korean multicentre study, including 21 106 participants en- 1.15-1.35), especially in participants aged ≥ 44 years.12 Interestingly, rolled for a health check-up, H pylori seropositivity was associated in Japan, the risk of DM decreased from 1.36 (95% CI, 1.10-1.67) with a higher total cholesterol (TC) and low-density lipoprotein to 0.92 (95% CI, 0.79-1.07) after H pylori eradication,13 concordant cholesterol (LDL-C), and lower high-density lipoprotein (HDL-C) lev- with the findings that H pylori eradication decreased HbA1c levels in 14 els than seronegativity (P < .05). The prevalence of MS was higher diabetic patients. in H pylori-seropositive subjects than in negative ones (27.2% vs 21.0%; P < .05), and H pylori seropositivity increased the likelihood of MS (odds ratio [OR], 1.19; 95% confidence interval [CI], 1.09-1.31; 3 | CARDIOVASCULAR AND 4 P < .001). This association disappeared in subjects ≥65 years old. CEREBROVASCULAR DISEASES Another study showed that H pylori infection, detected with the urea breath test (UBT), was significantly associated with MS.5 Although knowledge about the classical risk factors for CHD has in- In contrast, in a cross-sectional, longitudinal study, no associa- creased over time, it fails to explain all of the epidemiological and tion among H pylori seropositivity, body mass index (BMI) and meta- clinical differences observed.15 bolic diseases (type 2 DM, hypertension and dyslipidaemia, gout or After the first report in 1994, on the association between H py- increased uric acid) or between H pylori seropositivity and incident lori infection and CHD,16 several studies with controversial results metabolic diseases/risk factors was found.6 were published.17 Defining whether the bacterium plays a patho- A systematic review evaluated the relationship between H pylori genic role during acute coronary syndrome (ACS) or during the grad- infection and obesity among Chinese adults. The prevalence of H py- ual, progressive increase of atherosclerotic stenosis is a crucial step. lori was 42% (95% CI, 37-47) and mean difference of BMI between Hitherto, the first pathway seems more relevant. Indeed, long-term subjects with and without H pylori infection was 0.94 (95% CI, −0.04 inflammation may raise cytokine (interleukin (IL)-6) and tumour ne- to 1.91). The OR value was 1.20 (95% CI, 1.13-1.28), confirming that crosis factor (TNF)-α levels in the bloodstream, and consequently H pylori infection could be a risk factor for obesity.7 activate fibroblast and smooth muscle cell proliferation.17 Fang et al, in a systematic review with meta-analysis, found that H pylori infection was associated with an increased risk of ACS (OR, 2.2 | Diabetes 2.03; 95% CI, 1.66-2.47), higher for developing countries than for developed countries (OR 2.58 vs OR 1.69).18 A systematic review identified 41 case-control studies investigat- Choi et al, using an evaluation of cardio-ankle vascular index ing the relationship between H pylori infection and DM. The pooled (CAVI), correlated arterial stiffness, a predictor of cardiovascular OR was 1.27 (95% CI, 1.11-1.45; P = .0001), significant only among events, to anti-H pylori IgG antibody. Median age (P < .001), systolic patients with type 2 DM (OR, 1.43; 95% CI, 1.11-1.85) and more blood pressure (P = .027), LDL-C levels (P = .016), median CAVI value 8 evident in Asians. In agreement, a meta-analysis including 35 stud- and proportion of subjects with high CAVI value (both P < .001) were ies with 4401 diabetic patients, showed that glycated haemoglobin significantly higher in case of H pylori seropositivity.19 In 198 487 A (HbA) levels were significantly higher in patients with H pylori Koreans treated for hypertension, H pylori eradication reduced the infection compared to uninfected subjects (weighted mean differ- risk of mortality due to cerebrovascular disease (P = .007) but not 20 ence = 0.50; 95% CI, 0.28-0.72; P < .001), without any difference to CHD. related to the type of DM or study design.9 Testerman et al evaluated the role of H pylori in the development In Saudi Arabia, a study included 212 type 2 DM patients of atherosclerosis in pre- and post-menopausal cynomolgus mon- aged ≥ 40 years and 209 age-matched non-diabetic subjects. H pylori keys. Ninety-four pre-menopausal animals were fed an atherogenic prevalence was significantly higher in overweight and obese non-di- diet (lactalbumin (CL)) or high isoflavone soy (SOY) for 36 months abetic subjects (P = .013). Obese participants in both groups had the followed by ovariectomy and an additional 36 months on the same highest prevalence of infection (57.9% and 54.5%). Thus, in this co- or the alternate diet. H pylori infection was found in 46% of the mon- hort, H pylori infection was associated with BMI but not with DM.10 keys with coronary atheromas, and correlated with an increased Similar results were obtained in a Korean retrospective study on intimal plaque area and thickness independent of the menopausal 16 091 non-diabetic persons. During the follow-up, 1338 subjects status and regardless of diet (P < .01). Additionally, the plasma lipid PELLICANO et al. | 3 of 8 profile was altered in infected animals, independently of diet or hor- In cirrhotic patients, the incidence of complications, such as por- monal status.21 tal vein thrombosis and HCC, has been related to H pylori infection In a prospective Chinese study, including 17 613 patients through increased inflammatory markers and vascular mediators. screened with both carotid ultrasound examination and 13C-UBT, Bacterial eradication significantly reduced this incidence.35 H pylori infection was an independent risk factor for prevalent The link between H pylori infection, biliary stones and biliary and incident carotid atherosclerosis only in males under 50 years tract cancers was also recently evaluated in Morocco. Eighty-nine 22 (P = .009 and P = .028, respectively). cases were enrolled and bile duct specimens were investigated for To support the role of H pylori infection in the pathogenesis H pylori. The bacterium was detected in 54% of the samples and was 36 of CHD via endothelial damage, Li et al showed that the presence significantly associated with the presence of stones (P < .001). of this microorganism increased the expression of miR-25 in gastric epithelial cells as well as in human peripheral blood. The exosome-associated miR-25, through targeting of Kruppel-like factor 5 | NEUROLOGIC AND PSYCHIATRIC 2 (KLF2) in vascular endothelial cells, was involved in the regula- DISEASES tion of the nuclear factor (NF)-κB signaling pathway, resulting in increased expression of IL-6, monocyte chemoattractant protein-1 An Iranian study evaluated the association of H pylori infection, (MCP-1), vascular cell adhesion molecule-1 (VCAM-1), and inter- gastroesophageal reflux disease (GERD), gastric ulcer and duode- cellular adhesion molecule-1 (ICAM-1), all markers of endothelial nal ulcer (DU) with migraine in 341 patients who underwent upper damage.23 gastrointestinal (GI) endoscopy due to refractory dyspepsia. H pylori infection (P < .001), GERD (P < .001) and DU (P = .001) were significantly associated with migraines.37 4 | HEPATOBILIARY DISEASES Previous studies suggested that H pylori infection could be a risk factor for Parkinson's disease (PD) and Alzheimer's disease (AD). In Different Helicobacter species can colonise the hepatobiliary tract as a meta-analysis, including studies on the relationship between in- well as cause chronic active hepatitis and induce a striking increase testinal disorders and PD or AD, the OR for H pylori infection in PD in hepatocellular tumours.24 Interestingly, sequences belonging to and AD patients was 1.65 (95% CI, 1.43-1.91) and 1.40 (95% CI, 1.12- Helicobacter species were found in liver samples from humans with 1.76), respectively.38 cirrhosis and hepatocellular carcinomas (HCC).24 Cardenas et al examined data on participants ≥60 years old, Recently, Cao et al in a preclinical study in mice confirmed in the Third National Health and Nutrition Examination Survey that H hepaticus infection was associated with the development of (NHANES), to assess the relationship between H pylori infection and chronic hepatitis and liver cancer. Necrosis or cirrhosis developed in results of the Mini-Mental State Examination (MMSE). Moreover, the H hepaticus-infected livers at 24 weeks post-infection. Moreover, they examined performance on the digit-symbol substitution test expression of pro-inflammatory mediators and signaling pathways of (DSST) of participants in the 1999-2000 NHANES according to their inflammation were significantly induced by H hepaticus.25 H pylori infection status. In 1988-1991, older adults infected with Considering the recent marked reduction in viral hepatitis and CagA strains of H pylori had a borderline increased level of cognitive the increase in non-alcoholic fatty liver disease (NAFLD) preva- impairment, as measured by MMSE scores (OR: 1.5, 95% CI, 1.0-2.0). lence,26 the association between H pylori infection and NAFLD has In 1999-2000, older adults infected with H pylori scored 2.6 points also been evaluated. Four recently published meta-analyses27-30 lower in the DSST than uninfected adults. Thus, H pylori infection showed a significant association between H pylori infection and might be a risk factor for cognitive decline in the elderly, associated NAFLD. This finding was confirmed in a cross-sectional study includ- with low cobalamin and elevated homocysteine levels.39 ing 646 patients. NAFLD (diagnosed by both ultrasonography and Guillain-Barré’s syndrome (GBS) is a demyelinating disorder of Fibroscan with controlled attenuation parameter) was significantly peripheral nerves. About 30% of GBS cases have been attributed to higher in the H pylori-positive group than in H pylori negative group Campylobacter jejuni, leading to a search for other infectious agents. and this difference remained after linear regression.31 In a study in- A recent meta-analysis included studies assessing anti-H pylori IgG cluding 91 patients with NAFLD, overweight/visceral obesity and positivity in the cerebrospinal fluid or in the serum of GBS patients. dyslipidaemia were closely associated with the severity of NAFLD Anti-H pylori IgG were significantly more prevalent in patients com- and H pylori infection. The latter correlated with the severity of ste- pared to controls, in both cerebrospinal fluid (CSF) (P < .00001) and 32 40 atosis by altering the occurrence of MS. In another study, including serum (P = .004). obese patients who were candidates for bariatric surgery, H pylori infection was independently associated with NASH (P = .002), severe 33 NASH (P = .018) and presence of fibrosis (P = .001). Nevertheless, 6 | SKIN DISEASES in an Iranian case-control study, H pylori tests (both IgG antibodies in serum and faecal antigen) did not reveal significant differences A systematic review with meta-analysis evaluated the relationship 34 between NAFLD patients and controls (P = .37). between H pylori infection and psoriasis. The prevalence of H pylori 4 of 8 | PELLICANO et al. infection was significantly higher in the psoriasis group vs controls responses. Indeed, H pylori exerts immunomodulatory effects by in- (OR, 1.19; 95% CI, 1.15-2.52; P = .008). Moreover, H pylori preva- creasing the number of regulatory T cells, which suppress excessive lence increased significantly in patients with moderate and severe inflammatory T-cell responses through the secretion of IL-10 and 41 54 psoriasis (OR, 2.27; 95% CI, 1.42-3.63). TGF-β. However, H pylori may protect against IBD development Another recent meta-analysis found that in H pylori-positive pa- through mucus production enhanced by IL-18 release and NLRP3 in- tients, antibiotic treatment induced chronic spontaneous urticaria flammasome activation, as assessed by a study on mouse models.55 remission independently of H pylori eradication.42 H pylori may also counteract intestinal inflammation by suppressing In a prospective study, 57 consecutive patients (27 pityriasis type I IFN and IL-12 responses from human plasmacytoid dendritic versicolor, 30 telogen effluvium) screened for anti-H pylori and an- cells.56 Moreover, higher gut microbiota diversity and complexity, ti-CagA IgG, showed significantly higher rates of H pylori positivity which are pivotal for the intestinal barrier integrity, were reported in the pityriasis versicolor group than in the telogen effluvium group among H pylori infected individuals vs uninfected subjects.57 In ac- (P < .05). The number of patients with dyspeptic complaints was also cordance, widespread use of eradication therapy and the reduced higher in the pityriasis versicolor group than in the telogen effluvium incidence of H pylori infection in countries with improved hygienic group.43 conditions have followed the trend of the increased IBD incidence during the last decades.46

7 | INFLAMMATORY BOWEL DISEASE 8 | KIDNEY DISEASES Inflammatory bowel disease (IBD), which includes Crohn´s Disease (CD) and ulcerative colitis (UC), are chronic disorders of the di- A systematic review with meta-analysis, including 47 studies, re- gestive system, still with an unclear aetiology. The presence of cently reported a prevalence of H pylori infection in 48% of patients dysbiosis, with a significant reduction of biodiversity and other with chronic kidney disease (CKD) compared to 59% of healthy con- specific imbalances in the faecal microbiome composition of IBD trols, with an OR of 0.64 (95% CI, 0.52-0.79).58 In a cross-sectional patients compared to that of healthy controls, supports the hy- study including 293 Iranian patients undergoing kidney transplant, pothesis that IBD may originate from a dysregulation of the host's 50% of them were H pylori positive by gastric biopsy testing.59 immune response to commensal bacteria in genetically predis- Interestingly, H pylori infection could be a potential risk factor for posed individuals.44 renal damage in patients with peptic ulcer, as a positive associa- The role of H pylori infection as a potential IBD risk factor was tion between this bacterium and altered albumin-to-creatinine ratio initially proposed due to the similarities of their immuno-biological (P = .025) was found, and a significant decrease of the latter oc- 45 60 pathogenesis. Indeed, preclinical studies provide evidence that curred after H pylori eradication (P < .01). non-pylori enterohepatic Helicobacter species can enhance an IBD- like bowel inflammation.46 An association between the presence of H pylori in the intestinal mucosa, identified by 16S rRNA gene se- 9 | IMMUNE-MEDIATED DISEASES quencing, and a UC-like pattern of patients with CD was observed.47 A pilot study reported that 40% and 56.6% of the histologic samples 9.1 | Autoimmune diseases from the colon of newly diagnosed patients with UC were positive for H pylori by Giemsa and immunohistochemistry staining, respec- Autoimmune diseases (ADs) are multifactorial disorders in which an tively. Results were significantly higher when compared to the con- abnormal immune response against self-antigens occurs because trol group.48 of a break in immunological tolerance mechanisms. Several infec- However, more recent evidence shows an inverse correlation tious agents, together with environmental and hormonal factors, between H pylori and IBD, independently of the type of IBD con- in subjects with predisposing genetic background, may trigger au- sidered, suggesting a potential protective role of this bacterium.45 toimmunity by different strategies. These include molecular mim- For instance, a lower frequency of IBD was observed among indi- icry, microbial super-antigens, MHC class Ⅱ molecules expression on viduals with a positive result for IgG antibodies against H pylori non-immune cells, immune complex formation, bystander activation, when compared to subjects with negative results.49 A meta-analysis, epitope spreading, and polyclonal activation.61,62 including 80 789 individuals, reported a significant negative asso- H pylori may be involved in the induction of gastric autoimmunity, ciation between H pylori infection and IBD, regardless of age, na- since this bacterium is associated with an atrophic pattern which is tionality, H pylori detection test and IBD subtype, with a pooled OR similar to autoimmune gastritis (AIG). Indeed, it is plausible that H py- of 0.43 (P < .01); of interest, enterohepatic Helicobacter spp were lori can trigger a mechanism of molecular mimicry with formation of associated with an increased IBD risk.50 These data support a likely serum anti-parietal cell auto-antibodies (PCA) targeting the gastric 63 protective effect of H pylori on IBD as reported by other meta-anal- H+, K+–adenosine triphosphatase. Accordingly, following H pylori yses,51-53 possibly caused by the bacterium's ability to promote im- eradication, a significant decrease in anti-PCA in patients suffering mune system maturation and prevent the onset of aberrant immune from AIG with corpus atrophy was observed.64 PELLICANO et al. | 5 of 8

Interestingly, there is evidence supporting a role of H pylori in the H pylori might be an aetiological factor for Behcet's disease (BD). pathogenesis of various autoimmune extragastric disorders. For in- It has been reported that active H pylori infection, as diagnosed with stance, in the case of immune thrombocytopenia purpura (ITP) an in- UBT, was 3.1 times more prevalent among patients with BD than in crease in the platelet count of patients affected by ITP was observed controls.88 Moreover, in a small cohort of patients with BD, a signif- after H pylori eradication therapy.65 A molecular mimicry between icant improvement in the number and size of oral and genital ulcers platelet surface glycoproteins (IIb/IIIa or Ib) and H pylori CagA and was observed after H pylori eradication.89 These findings were con- VacA proteins could be responsible for ITP induction.66 Even if the firmed in a recent meta-analysis, reporting that BD patients were associative mechanism is still under debate, literature reviews and more susceptible to H pylori infection, with an OR of 1.39 (95% CI, meta-analyses have shown that H pylori eradication has a significant 1.03-1.87).90 effect in increasing platelet counts, with variable responses, in patients with ITP.66-68 Environmental influencers, such as bacteria and viruses, are ca- 9.2 | Allergic disorders pable of mimicking the antigenic profile on the thyroid cell membrane, suggesting a plausible role in the onset of autoimmune thyroid Recently, the association between asthma or other allergic diseases diseases.69 Indeed, a significantly increased rate of H pylori infection and H pylori has been intensively investigated. In a case-control study, was reported among patients with Graves' disease,70 with a correla- including more than 10 000 patients, H pylori infection was found in tion between CagA positive H pylori strains and this disease.71 Even 31%, asthma in 10.4%, and allergic rhinitis in 16% of the patients, if H pylori infection, especially CagA positive strains, has been also but without any significant association; however, in patients with ab- associated with Hashimoto's thyroiditis (HT),72 and the prevalence dominal obesity, H pylori infection was associated with a 30%-40% of anti-thyroid peroxidase (TPO) antibodies seems higher in subjects reduced OR of asthma and a 25% reduced OR of allergic disorders.91 with H pylori infection,73 a solid correlation between H pylori infec- Moreover, in a case-control study of 27 paediatric patients with tion and HT was not confirmed by more recent evidence.74-76 asthma and 54 controls, an inverse association between H pylori and 92 A possible role of H pylori in autoimmune pancreatitis (AIP) has asthma was found (OR 0.1, 95% CI, 0.039-0.305; P = .026). In a also been proposed. Molecular mimicry through a sequence similar- cohort study, 16% of children who were uninfected at 2 and 10 years ity between H pylori α-CA and human CA type II antigen located in of age developed asthma at 16 years vs none of those with H pylori the ductal epithelium of the pancreas, and between H pylori plas- infection at 2 years of age.93 In another study, including 274 patients minogen-binding protein and human ubiquitin-protein ligase E3 with various allergies or non-allergic rhinitis with eosinophilic syn- component n-recognin 2, present in pancreatic ductal and acinar drome and 75 controls, a significantly positive association was found cells, may trigger autoimmunity.77 Moreover, a homology between between H pylori and allergies in adults but not in children.94 These α-???carbonic anhydrase of H pylori and human carbonic anhydrase II conflicting findings warrant larger prospective studies. (the auto-antibodies play a possible pathogenic role in AIP) has been The role of H pylori has also been investigated in other allergic-like observed.78 disorders. In a systematic review with meta-analysis, including 11 H pylori infection has been associated with various systemic studies and 377 795 patients, H pylori was found to be associated rheumatic diseases. This is in line with the capacity of H pylori ure- with a decreased risk of eosinophilic oesophagitis (OR 0.63; 95% CI, ase to stimulate B-1 cells in vitro to produce self-reactive antibod- 0.51-0.78).95 ies, eg IgG3, IgM-type rheumatoid factors, and anti- single stranded The relationship between allergy and H pylori was also investi- DNA (ssDNA), thus promoting AD onset.79 Patients with rheuma- gated in preclinical models. Perinatal exposure to H pylori extract or toid arthritis (RA) have a higher prevalence of H pylori infection than to VacA was found to protect mice against allergic airway inflamma- controls.80 Moreover, the eradication of this pathogen can induce tion.96 Moreover, H pylori extract was also able to decrease mucus a significant long-lasting improvement in clinical and laboratory production and inflammation in mice challenged with house dust indices.81,82 mites.97 H pylori infection may also be involved in the pathogenesis of systemic sclerosis (SSc), albeit with contrasting results.83 A recent ACKNOWLEDGEMENTS meta-analysis reported an increased rate of a previous H pylori This work was not supported. infection in patients affected by SSc.84 In this context, a possible role of H pylori in enhancing production of antibodies against my- CONFLICT OF INTEREST cobacterial heat shock protein (HSP)65 was proposed as a trigger of We declare no conflicts of interest. autoimmunity.85 A meta-analysis including 619 patients with Sjögren's syndrome REFERENCES (SS) reported an H pylori infection prevalence of 63.65% in pa- 1. de Korwin J-D, Ianiro G, Gibiino G, Gasbarrini A Helicobacter pylori tients with SS, which was significantly higher compared to controls and extragastric diseases in 2017. Helicobacter. 2017;22(S1):e12411. 2. Reaven GM. Banting lecture 1988. Role of insulin resistance in (49.29%).86 A 60 kDa HSP, enhanced by H pylori infection, could play human diseases. Diabetes. 1988;1988(37):1595-1607. a role in the development of SS.87 6 of 8 | PELLICANO et al.

3. De Sensi F, Costantino S, Limbruno U, Paneni F. Atrial fibrillation in 23. Li N, Liu SF, Dong K, et al. Exosome-transmitted miR-25 induced by the cardiometabolic patient. Minerva Med. 2019;110:157-167. H pylori promotes vascular endothelial cell injury by targeting KLF2. 4. Lim SH, Kim N, Kwon JW, et al. Positive association between Front Cell Infect Microbiol. 2019;9:366. Helicobacter pylori infection and metabolic syndrome in a 24. Pellicano R, Ménard A, Rizzetto M, Mégraud F Helicobacter spe- Korean population: a Multicenter Nationwide Study. Dig Dis Sci. cies and liver diseases: association or causation? Lancet Infect Dis. 2019;64:2219-2230. 2008;8:254-260. 5. Yu Y, Cai J, Song Z, Wang J, Wu L. Association of Helicobacter pylori 25. Cao S, Zhu C, Feng J, et al. Helicobacter hepaticus infection induces infection with metabolic syndrome in aged Chinese females. Exp chronic hepatitis and fibrosis in male BALB/c mice via the activa- Ther Med. 2019;17:4403-4408. tion of NF-κB, Stat3, and MAPK signaling pathways. Helicobacter. 6. Wawro N, Amann U, Butt J, et al. Helicobacter pylori seropositivity: 2020;25:e12677. prevalence, associations, and the impact on incident metabolic dis- 26. Saracco GM, Evangelista A, Fagoonee S, et al. Etiology of chronic eases/risk factors in the population-based KORA Study. Front Public liver diseases in the Northwest of Italy, 1998 through 2014. World J Health. 2019;7:96. Gastroenterol. 2016;22:8187-8193. 7. Xu X, Li W, Qin L, Yang W, Yu G, Wei Q. Relationship between 27. Liu R, Liu Q, He Y, et al. Association between Helicobacter pylori Helicobacter pylori infection and obesity in Chinese adults: a sys- infection and nonalcoholic fatty liver: a meta-analysis. Medicine. tematic review with meta-analysis. PLoS One. 2019;14:e0221076. 2019;98:e17781. 8. Mansori K, Moradi Y, Naderpour S, et al. Helicobacter pylori infec- 28. Mantovani A, Turino T, Altomari A, et al. Association between tion as a risk factor for diabetes: a meta-analysis of case-control Helicobacter pylori infection and risk of nonalcoholic fatty liver dis- studies. BMC Gastroenterol. 2020;20(1):77. ease: an updated meta-analysis. Metabolism. 2019;96:56-65. 9. Chen J, Xing Y, Zhao L, Ma H. The association between Helicobacter 29. Zhou BG, Yang HJ, Xu W, Wang K, Guo P, Ai YW. Association be- pylori infection and glycated hemoglobin A in diabetes: a meta-anal- tween Helicobacter pylori infection and nonalcoholic fatty liver ysis. J Diabetes Res. 2019;2019:3705264. disease: a systematic review and meta-analysis of observational 10. Alzahrani AM, Al Zaidi AA, Alzahrani SM, Binmahfouz SA, Farahat studies. Helicobacter. 2019;24:e12576. FM. Association between type 2 diabetes mellitus and Helicobacter 30. Ning L, Liu R, Lou X, et al. Association between Helicobacter pylori pylori infection among Saudi patients attending National Guard infection and nonalcoholic fatty liver disease: a systemic review and Primary Health Care Centers in the Western Region, 2018. J Family meta-analysis. Eur J Gastroenterol Hepatol. 2019;31:735-742. Community Med. 2020;27:8-14. 31. Abo-Amer YE, Sabal A, Ahmed R, et al. Relationship between 11. Pyo JH, Lee H, Choi SC, et al. Lack of association between past Helicobacter pylori infection and nonalcoholic fatty liver disease Helicobacter pylori infection and diabetes: a two-cohort study. (NAFLD) in a developing country: a cross-sectional study. Diabetes Nutrients. 2019;11(8):E1874. Metab Syndr Obes. 2020;13:619-625. 12. Wan Z, Song L, Hu L, et al. Helicobacter pylori infection is asso- 32. Chen C, Zhang C, Wang X, et al. Helicobacter pylori infection may ciated with diabetes among Chinese adults. J Diabetes Invest. increase the severity of nonalcoholic fatty liver disease via promot- 2020;11:199-205. ing liver function damage, glycometabolism, lipid metabolism, in- 13. Kato M, Toda A, Yamamoto-Honda R, Arase Y, Sone H. Association flammatory reaction and metabolic syndrome. Eur J Gastro Hepatol. between Helicobacter pylori infection, eradication and diabetes mel- 2020;32(7):857-866. litus. J Diabetes Investig. 2019;10:1341-1346. 33. Doulberis M, Srivastava S, Polyzos SA, et al. Active Helicobacter py- 14. Cheng KP, Yang YJ, Hung HC, et al. Helicobacter pylori eradication lori infection is independently associated with nonalcoholic steato- improves glycemic control in type 2 diabetes patients with as- hepatitis in morbidly obese patients. J Clin Med. 2020;9(4):933. ymptomatic active Helicobacter pylori infection. J Diabetes Investig. 34. Mohammadifard M, Saremi Z, Rastgoo M, Akbari E. Relevance be- 2019;10:1092-1101. tween Helicobacter pylori infection and non-alcoholic fatty liver dis- 15. Aiello AE, Diez-Roux A, Noone A-M, et al. Socioeconomic and psy- ease in Birjand, Iran. J Med Life. 2019;12:168-172. chosocial gradients in cardiovascular pathogen burden and immune 35. Abdel-Razik A, Mousa N, Elhelaly R, et al. Helicobacter pylori as an response: the multi-ethnic study of atherosclerosis. Brain Behav initiating factor of complications in patients with cirrhosis: a sin- Immun. 2009;23:663-671. gle-center observational study. Front Med (Lausanne). 2020;7:96. 16. Mendall MA, Goggin PM, Molineaux N, et al. Relation of 36. Cherif S, Rais H, Hakmaoui A, Sellami S, Elantri S, Amine A. Linking Helicobacter pylori infection and coronary heart disease. Br Heart J. Helicobacter pylori with gallbladder and biliary tract cancer in 1994;71:437-439. Moroccan population using clinical and pathological profiles. 17. Pellicano R, Fagoonee S, Rizzetto M, Ponzetto A Helicobacter pylori Bioinformation. 2019;15:735-743. and coronary heart disease: which directions for future studies? Crit 37. Hormati A, Akbari N, Sharifipour E, et al. Migraine and gastric disor- Rev Microbiol. 2003;29:351-359. ders: are they associated? J Res Med Sci. 2019;24:60. 18. Fang Y, Fan C, Xie H. Effect of Helicobacter pylori infection on the 38. Fu P, Gao M, Yung KKL. Association of intestinal disorders with risk of acute coronary syndrome: a systematic review and me- Parkinson's disease and Alzheimer's disease: a systematic review ta-analysis. Medicine. 2019;98:e18348. and meta-analysis. ACS Chem Neurosci. 2020;11:395-405. 19. Choi JM, Lim SH, Han YM, et al. Association between Helicobacter 39. Cárdenas VM, Boller F, Román GC Helicobacter pylori, vascular risk pylori infection and arterial stiffness: results from a large cross-sec- factors and cognition in U.S. older adults. Brain Sci. 2019;9(12):E370. tional study. PLoS One. 2019;14(8):e0221643. 40. Dardiotis E, Sokratous M, Tsouris Z, et al. Association between 20. Kim YI, Kim YA, Lee JW, et al. Effect of Helicobacter pylori treat- Helicobacter pylori infection and Guillain-Barré syndrome: a me- ment on long-term mortality in patients with hypertension. Gut Liv. ta-analysis. Eur J Clin Invest. 2020;2:e13218. 2020;14:47-56. 41. Yu M, Zhang R, Ni P, Chen S, Duan G Helicobacter pylori infection 21. Testerman TL, Semino-Mora C, Cann JA, et al. Both diet and and psoriasis: a systematic review and meta-analysis. Medicina Helicobacter pylori infection contribute to atherosclerosis in (Kaunas). 2019;55(10):E645. pre- and postmenopausal cynomolgus monkeys. PLoS One. 42. Kim HJ, Kim YJ, Lee HJ, et al. Systematic review and meta-analysis: 2019;14(9):e0222001. effect of Helicobacter pylori eradication on chronic spontaneous ur- 22. Zhang L, Chen Z, Xia X, et al. Helicobacter pylori infection selec- ticaria. Helicobacter. 2019;24(6):e12661. tively increases the risk for carotid atherosclerosis in young males. 43. Kutlu Ö, Doğan Z, Ekşioğlu HM, Kekilli M. Relationship be- Atherosclerosis. 2019;291:71-77. tween Helicobacter pylori infection and pityriasis versicolor: can PELLICANO et al. | 7 of 8

Helicobacter pylori infection be a new etiologic factor for pityriasis triphosphatase in human gastric autoimmunity. J Exp Med. versicolor? Turk J Med Sci. 2020;50(4):771-775. 2003;198:1147-1156. 44. Zhang Y-Z, Li Y-Y. Inflammatory bowel disease: pathogenesis. World 64. Faller G, Winter M, Steininger H, et al. Decrease of antigastric au- J Gastroenterol. 2014;20:91-99. toantibodies in Helicobacter pylori gastritis after cure of infection. 45. Kayali S, Gaiani F, Manfredi M, et al. Inverse association between Pathol Res Pract. 1999;195:243-246. Helicobacter pylori and inflammatory bowel disease: myth or fact? 65. Gasbarrini A, Franceschi F, Tartaglione R, Landolfi R, Pola P, Acta Bio-Medica. 2018;89(9-S):81-86. Gasbarrini G. Regression of autoimmune thrombocytopenia after 46. Yu Y, Zhu S, Li P, Min L, Zhang S Helicobacter pylori infection and eradication of Helicobacter pylori. Lancet. 1998;352(9131):878. inflammatory bowel disease: a crosstalk between upper and lower 66. Kim BJ, Kim HS, Jang HJ, Kim JH Helicobacter pylori eradication in digestive tract. Cell Death Dis. 2018;9:961. idiopathic thrombocytopenic purpura: a meta-analysis of random- 47. Oliveira AG, Rocha GA, Rocha AMC, et al. Isolation of Helicobacter ized trials. Gastroenterol Res Pract. 2018;2018:6090878. pylori from the intestinal mucosa of patients with Crohn’s disease. 67. Santambrogio E, Orsucci L Helicobacter pylori and hematological Helicobacter. 2006;11:2-9. disorders. Minerva Gastroenterol Dietol. 2019;65:204-213. 48. Mansour L, El-Kalla F, Kobtan A, et al. Helicobacter pylori may be 68. Vanegas YAM, Vishnu P. Management of Helicobacter pylori an initiating factor in newly diagnosed ulcerative colitis patients: a in patients with immune thrombocytopenia. Hamostaseologie. pilot study. World J Clin Cases. 2018;6:641-649. 2019;39:279-283. 49. Sayar R, Shokri Shirvani J, Hajian-Tilaki K, Vosough Z, Ranaei 69. Davies TF. Infection and autoimmune thyroid disease. J Clin M. The negative association between inflammatory bowel dis- Endocrinol Metab. 2008;93:674-676. ease and Helicobacter pylori seropositivity. Caspian J Intern Med. 70. Shi W-J, Liu W, Zhou X-Y, Ye F, Zhang G-X. Associations of 2019;10:217-222. Helicobacter pylori infection and cytotoxin-associated gene A sta- 50. Castaño-Rodríguez N, Kaakoush NO, Lee WS, Mitchell HM. Dual tus with autoimmune thyroid diseases: a meta-analysis. Thyroid. role of Helicobacter and Campylobacter species in IBD: a systematic 2013;23:1294-1300. review and meta-analysis. Gut. 2017;66(2):235-249. 71. Bassi V, Santinelli C, Iengo A, Romano C. Identification of a cor- 51. Rokkas T, Gisbert JP, Niv Y, O’Morain C. The association be- relation between Helicobacter pylori infection and Graves’ disease. tween Helicobacter pylori infection and inflammatory bowel Helicobacter. 2010;15:558-562. disease based on meta-analysis. United Eur Gastroenterol J. 72. Figura N, Di Cairano G, Moretti E, et al. Helicobacter pylori infec- 2015;3:539-550. tion and autoimmune thyroid diseases: the role of virulent strains. 52. Tepler A, Narula N, Peek RMJ, et al. Systematic review with me- Antibiotics. 2019;9(1):12. ta-analysis: association between Helicobacter pylori CagA seroposi- 73. Choi YM, Kim TY, Kim EY, et al. Association between thyroid au- tivity and odds of inflammatory bowel disease. Alim Pharmacol Ther. toimmunity and Helicobacter pylori infection. Kor J Intern Med. 2019;50:121-131. 2017;32:309-313. 53. Piovani D, Danese S, Peyrin-Biroulet L, Nikolopoulos GK, Lytras 74. Bassi V, Marino G, Iengo A, Fattoruso O, Santinelli C. Autoimmune T, Bonovas S. Environmental risk factors for inflammatory bowel thyroid diseases and Helicobacter pylori: the correlation is present diseases: an umbrella review of meta-analyses. Gastroenterology. only in Graves’s disease. World J Gastroenterol. 2012;18:1093-1097. 2019;157:647-659. 75. Hou Y, Sun W, Zhang C, et al. Meta-analysis of the correlation be- 54. Arnold IC, Hitzler I, Müller A. The immunomodulatory properties tween Helicobacter pylori infection and autoimmune thyroid dis- of Helicobacter pylori confer protection against allergic and chronic eases. Oncotarget. 2017;8:115691-115700. inflammatory disorders. Front Cell Infect Microbiol. 2012;2:10. 76. Thiyagarajan S, Saini AMR, Alruwaili J Helicobacter pylori-induced 55. Engler DB, Leonardi I, Hartung ML, et al. Helicobacter pylo- autoimmune thyroiditis: is the pathogenic link concluded or still a ri-specific protection against inflammatory bowel disease re- hypothesis? Rev Med Microbiol. 2018;29:64-72. quires the NLRP3 inflammasome and IL-18. Inflamm Bowel Dis. 77. Bulajic M, Panic N, Löhr JM Helicobacter pylori and pancreatic dis- 2015;21:854-861. eases. World J Gastrointest Pathophysiol. 2014;5:380-383. 56. Luther J, Owyang SY, Takeuchi T, et al. Helicobacter pylori DNA 78. Guarneri F, Guarneri C, Benvenga S Helicobacter pylori and autoim- decreases pro-inflammatory cytokine production by dendritic mune pancreatitis: role of carbonic anhydrase via molecular mim- cells and attenuates dextran sodium sulphate-induced colitis. Gut. icry? J Cell Mol Med. 2005;9:741-744. 2011;60:1479-1486. 79. Yamanishi S, Iizumi T, Watanabe E, et al. Implications for induction 57. Dash NR, Khoder G, Nada AM, Al Bataineh MT. Exploring the im- of autoimmunity via activation of B-1 cells by Helicobacter pylori pact of Helicobacter pylori on gut microbiome composition. PLoS urease. Infect Immun. 2006;74:248-256. One. 2019;14:e0218274. 80. Wen H, Luo J, Li J, Li X Helicobacter pylori infection in rheumatic 58. Shin SP, Bang CS, Lee JJ, Baik GH Helicobacter pylori infection in diseases. Arthritis Res Ther. 2012;14(1):P74. patients with chronic kidney disease: a systematic review and me- 81. Zentilin P, Savarino V, Garnero A, Accardo S, Seriolo B. Is Helicobacter ta-analysis. Gut Liv. 2019;13:628-641. pylori infection a risk factor for disease severity in rheumatoid ar- 59. Niknam R, Barfei M, Mahmoudi L Helicobacter pylori, endoscopic, thritis? Gastroenterology. 1999;116:503-504. and histologic features among kidney transplant candidates in 82. Zentilin P, Seriolo B, Dulbecco P, et al. Eradication of Helicobacter Southern Iran. Infect Drug Resist. 2019;12:3687-3693. pylori may reduce disease severity in rheumatoid arthritis. Alim 60. Pan W, Zhang H, Wang L, Zhu T, Chen B, Fan J. Association be- Pharmacol Ther. 2002;16:1291-1299. tween Helicobacter pylori infection and kidney damage in patients 83. Radić M, Kaliterna DM, Radić J Helicobacter pylori infection and sys- with peptic ulcer. Ren Fail. 2019;41:1028-1034. temic sclerosis–is there a link? Joint Bone Spine. 2011;78:337-340. 61. Shamriz O, Shoenfeld Y. Infections: a double-edge sword in autoim- 84. Yong WC, Upala S, Sanguankeo A Helicobacter pylori infection in munity. Curr Opin Rheumatol. 2018;30:365-372. systemic sclerosis: a systematic review and meta-analysis of obser- 62. Smyk DS, Koutsoumpas AL, Mytilinaiou MG, Rigopoulou EI, Sakkas vational studies. Clin Exp Rheumatol. 2018;36 Suppl 113(4);168-174. LI, Bogdanos DP Helicobacter pylori and autoimmune disease: cause 85. Kalabay L, Fekete B, Czirják L, et al. Helicobacter pylori infection in or bystander. World J Gastroenterol. 2014;20:613-629. connective tissue disorders is associated with high levels of antibod- 63. Amedei A, Bergman MP, Appelmelk BJ, et al. Molecular mim- ies to mycobacterial hsp65 but not to human hsp60. Helicobacter. icry between Helicobacter pylori antigens and H+, K+–adenosine 2002;7:250-256. 8 of 8 | PELLICANO et al.

86. Chen Q, Zhou X, Tan W, Zhang M. Association between Helicobacter 94. Akiner U, Yener HM, Gozen ED, Kuzu SB, Canakcioglu S Helicobacter pylori infection and Sjögren syndrome: a meta-analysis. Medicine. pylori in allergic and non-allergic rhinitis does play a protective or 2018;97:e13528. causative role? Eur Arch Otorhinolaryngol. 2020;277:141-145. 87. Aragona P, Magazzù G, Macchia G, et al. Presence of antibod- 95. Shah SC, Tepler A, Peek RM Jr, Colombel JF, Hirano I, Narula N. ies against Helicobacter pylori and its heat-shock protein 60 in Association between Helicobacter pylori exposure and decreased the serum of patients with Sjögren’s syndrome. J Rheumatol. odds of eosinophilic esophagitis-A systematic review and me- 1999;26:1306-1311. ta-analysis. Clin Gastroenterol Hepatol. 2019;17:2185-2198. 88. Lankarani KB, Ravanbod MR, Aflaki E, Nazarinia MA, Rajaee A. High 96. Kyburz A, Fallegger A, Zhang X, et al. Transmaternal Helicobacter prevalence of Helicobacter pylori infection in Behcet’s disease. BMC pylori exposure reduces allergic airway inflammation in off- Gastroenterol. 2014;14:58. spring through regulatory T cells. J Allergy Clin Immunol. 89. Avcı O, Ellidokuz E, Şimşek I, Büyükgebiz B, Güneş AT Helicobacter 2019;143:1496-1512. pylori and Behçet’s disease. Dermatology. 1999;199:140-143. 97. van Wijck Y, John-Schuster G, van Schadewijk A, et al. Extract of 90. Yu Y, Yao X, Liang J, Lu C, Yan T, Lin J. Is Helicobacter pylori asso- Helicobacter pylori ameliorates parameters of airway inflammation ciated with Behçet’s syndrome? A meta-analysis. Helicobacter. and goblet cell hyperplasia following repeated allergen exposure. 2019;24(6):e12663. Int Arch Allergy Immunol. 2019;180:1-9. 91. Ness-Jensen E, Langhammer A, Hveem K, Lu Y Helicobacter pylori in relation to asthma and allergy modified by abdominal obesity: the HUNT study in Norway. World Allergy Organ J. 2019;12:100035. How to cite this article: Pellicano R, Ianiro G, Fagoonee S, 92. Tsigalou C, Konstantinidis TG, Cassimos D, et al. Inverse associa- Settanni CR, Gasbarrini A. Review: Extragastric diseases and tion between Helicobacter pylori infection and childhood asthma in Greece: a case-control study. Germs. 2019;9:182-187. Helicobacter pylori. Helicobacter. 2020;25(Suppl. 1):e12741. 93. Melby KK, Carlsen KL, Håland G, Samdal HH, Carlsen KH https://doi.org/10.1111/hel.12741 Helicobacter pylori in early childhood and asthma in adolescence. BMC Res Notes. 2020;13(1):79.

DOI: 10.1111/hel.12742

REVIEW ARTICLE

Review: Helicobacter pylori infection in children

Ji-Hyun Seo1 | Kristen Bortolin2 | Nicola L. Jones3

1Department of Pediatrics, Gyeongsang National Institute of Health Sciences, Abstract Gyeongsang National University College of Helicobacter pylori infection in children and adolescents differs in comparison to Medicine, Jinju, Korea adults with respect to epidemiology, host responses, and disease manifestations. 2Department of Paediatrics, Division of Gastroenterology Hepatology and Nutrition, Furthermore, treatment options are limited in this population and antibiotic resist- University of Toronto, SickKids, Toronto, ance rates continue to increase. Therefore, ongoing research is vital to understand Canada 3Departments of Paediatrics and Physiology, disease pathogenesis and provide optimal management of children with infection. Division of Gastroenterology Hepatology This review summarizes relevant publications from April 2019 to March 2020. Similar and Nutrition, Cell Biology Program, SickKids Research Institute, University of to adults, recent studies show a decreasing prevalence of infection in the pediatric Toronto, SickKids, Toronto, Canada population. Studies of pathogenesis investigated serum immune responses and the

Correspondence potential inverse association of infection and allergy. Several studies investigated the Nicola L. Jones, Peter Gilgan Centre for effect of H pylori and related inflammation on the gut microbiome. The recommenda- Research and Learning, Room 19.9701, 686 Bay St. Toronto, ON, Canada M5G 0A4. tion of endoscopy-based testing to identify the cause of symptoms and not just H py- Email: [email protected] lori, reserving noninvasive UBT or stool antigen tests for post-eradication follow-up, was supported by the current literature.

KEYWORDS antibiotic resistance, diagnosis, epidemiology, microbiome, stool antigen test

1 | INTRODUCTION was approximately 10% in individuals born in 1985 but decreased to 3% in individuals born in 2011.1 This declining prevalence was Helicobacter pylori infection in children differs from adults in that explained by the steady improvements in sanitation and living con- children rarely develop complications of infection. Furthermore, ditions from the 1950s and onwards, and it was speculated that the treatment options are more limited. Therefore, H pylori-focused decreasing birth rate might have led to fewer children per family, research in the pediatric population provides a unique opportunity thus decreasing the risk of intra-familial infection.1 In a study from to address these potential differences with respect to pathogen- Korea, the seroprevalence of H pylori infection decreased from 50%- esis and to optimize management. The objective of this review is 70% in children aged 5-7 years in 1988-1989 to 15% in children aged to provide an update of the relevant pediatric literature focused 5-14 years in 2014-2015.2 In Hong Kong, only 10.3% of children with on H pylori infection that was published from April 2019 to March gastritis and 39.5% of children with peptic ulcer disease (PUD) had 2020. an H pylori infection.3 In Africa, the seroprevalence rates of H pylori infection in 360 Nigerian children aged 6 months to 5 years and 304 Uganda children aged 1 to 15 years were 32.8% and 24.3%, 2 | EPIDEMIOLOGY OF INFECTION respectively.4,5 Similarly, studies of children with gastrointestinal symptoms in Bulgaria 6 and Poland 7 showed a reduction in H pylori Studies published in the past year continue to demonstrate a de- infection rates over time. Potential explanations for this decrease crease in prevalence of H pylori infection in children. A comprehen- include overall socioeconomic improvement, recognition of the re- sive review of data on Japanese children and adolescents between lationship between H pylori infection and gastric cancer, as well as 1997 and 2017 showed that the prevalence of H pylori infection early diagnosis and treatment in adults.

3 | PATHOPHYSIOLOGY OF DISEASE IN 5 | CLINICAL MANIFESTATIONS OF CHILDREN H PYLORI

Children rarely develop complications of infection such as PUD.8 5.1 | Gastrointestinal manifestations In addition, epidemiological studies show an inverse association between infection and allergy/atopy suggesting that the host im- With the decrease in H pylori prevalence, a reduction in H pylori- mune response during infection in children may differ from adults. related ulcers has been suggested. However, in a retrospective Although studies in pediatric patients are limited, a few publications Belgium study of 5,618 children undergoing diagnostic endoscopy, addressing the effect of infection on host immune responses in the proportion of H pylori-associated lesions remained stable over children were published this past year. A study of 29 Chilean chil- the time periods from 1990 to 2012.13 Thus, H pylori remains an im- dren undergoing upper endoscopy compared serum dendritic and T portant risk factor for duodenal ulcers and duodenal and gastric ero- regulatory cells in children with and without infection.9 The authors sions in children. found an increased expression of the high-affinity IgE receptor in cir- A number of studies identified correlations of H pylori infection culating dendritic cells, and FoxP3 and latency-associated peptide in in children with a variety of gastrointestinal diseases including au- circulating T regulatory cells in serum from children with an H pylori toimmune gastritis,14 celiac disease,15,16 and parasitic infection.17 infection. Furthermore, incubation of H pylori ATCC 26 695 strain However, association does not prove causation and confounding with monocyte-derived dendritic cells generated from pediatric pa- factors likely account for these associations. tients resulted in upregulation of high-affinity IgE receptor and IL-10 secretion, in comparison with untreated cells. However, co-culture of H pylori-treated dendritic cells with naive CD4 + T cells was not able 5.2 | Extra-intestinal manifestations to generate an increase in T regulatory cells. The exact mechanisms responsible for these observations and the effect of eradication in Previous epidemiologic studies suggest that early acquisition of these patients were not delineated. In addition, whether these ob- H pylori may be protective against allergy and atopic diseases.8 Three servations differ in H pylori-infected adults was not determined. studies examined this relationship in this time period with conflicting Previous studies suggest that innate toll-like receptor (TLR) poly- results. In a case-control study from Greece, 11% of children with morphisms may influence disease outcome. A cross-sectional study asthma had a positive H pylori stool antigen test (SAT), while 29.6% 18 of Romanian children with gastritis found no association with spe- of nonasthmatic children were found to be infected (P = .026). A cific TLR4 polymorphisms and the presence of H pylori infection.10 Norwegian study assessed whether the presence of H pylori IgG at However, the study included a small number of children. Therefore, 2-10 years of age was associated with asthma in adolescence.19 Of additional studies are needed to determine if these TLR4 polymor- 197 children, none of the 12 seropositive children developed asthma phisms are involved in susceptibility to infection. in adolescence. In contrast, 16% of patients with negative serology had asthma by 16 years old. However, these findings were not statistically significant. A cross-sectional study in Istanbul enrolled 274 4 | H PYLORI AND MICROBIOTA patients 3-76 years old to estimate H pylori prevalence in patients with allergic and nonallergic nasal conditions compared to controls. Previous studies in both adults and children demonstrate changes in No association between H pylori infection and prevalence of allergic the gastric microbiota in association with H pylori infection. A small disease was detected in the pediatric group.20 study of symptomatic Chinese children undergoing upper endos- The current European Society for Paediatric Gastroenterology, copy investigated the effect of H pylori infection and the presence of Hepatology and Nutrition and the North American Society for ulceration on the gastric microbiome.11 The authors found a reduc- Paediatric Gastroenterology, Hepatology and Nutrition (ESPGHAN/ tion in bacterial diversity in the presence of H pylori infection in com- NASPGHAN) guidelines conclude that there is no association with parison with children with gastritis alone, which was not influenced iron deficiency anemia (IDA), and a weak association between re- by the presence of duodenal or gastric ulceration. In a small subset fractory IDA and H pylori infection.8 A recent study of Iranian chil- who underwent follow-up endoscopy 4 weeks after receiving a vari- dren found no association with H pylori infection and IDA, supporting ety of eradication therapies, the gastric bacterial diversity was closer previous findings.21 Based on weak evidence, current ESPGHAN/ to that observed in the group of uninfected children with gastritis. NASPGHAN guidelines suggest that chronic idiopathic thrombocy- These findings are consistent with previous studies demonstrating topenic purpura (ITP) is an indication to test for H pylori infection alterations in the gastric microbiome associated with infection. A and treat if positive. A study from Turkey assessed the mean plate- Chinese study investigated the effect of gastritis and H pylori on the let volume in children undergoing upper endoscopy for dyspeptic fecal microbiome.12 The fecal microbiome obtained from both chil- symptoms and found no difference between H pylori-infected pa- dren with gastritis alone and H pylori-related gastritis was altered in tients and controls.22 comparison to healthy controls suggesting that gastric inflammation Studies continue to investigate the association between H pylori may impact the gut microbiota. infection and stunted growth. Studies in Riyadh, Saudi Arabia,23 and SEO et al. | 3 of 5

Lagos, Nigeria,24 show a correlation between H pylori infection and H pylori is recommended, and treatment should be advised for con- short stature. Similarly, a large cross-sectional study carried out in firmed cases.8 According to the updated ESPGHAN/NASPGHAN China on 6,896 apparently healthy patients 6-36 months old deter- guidelines, therapy should be based on the results of antimicrobial mined that H pylori seropositive children were more likely to be vita- susceptibility testing (AST) where available. If antibiotic sensitivity min D deficient and had a lower weight and height.25 However, these is unknown, then a 14-day bismuth-based therapy is the first choice studies do not provide evidence of causation. Both short stature and for H pylori eradication in children where bismuth is available or high- infection are increased with poor socioeconomic status which is as- dose triple therapy if bismuth is not available.8 The recommended sociated with poor nutritional status. dose of antibiotics and proton pump inhibitor are based on weight, while for bismuth the recommended dose is based on age (<10 years old 262 mg QID, >10 years old 524 mg QID). In Europe and North 6 | DIAGNOSIS America, treatment failure, side effects, and alteration of the gut microbiome have been highlighted as potentially outweighing the The current ESPGHAN/NASPGHAN guidelines recommend that di- possible benefit of preventing future peptic ulcers or gastric cancer.8 agnosis be based on culture or histopathology along with one other The therapeutic strategies for children and adolescents with positive biopsy-based test and at least six gastric biopsies.8 The H pylori infection developed in Europe and North America may not guidelines also recommended follow-up testing with either the urea be appropriate for treating children and adolescents in all countries breath test (UBT) or SAT. A variety of studies addressed diagnostic in the world because of the differences in the epidemiological char- testing for H pylori infection in the last year. A retrospective study acteristics of H pylori between regions.8 In Japan, adolescents were of Romanian children compared the endoscopic and histopathologic included in the guidelines revised in 2016 for the management of findings in 166 H pylori-negative children and 82 H pylori-positive H pylori infection to prevent gastric cancer and to prevent intra-fa- children and showed a good agreement between endoscopic and milial transmission, and they have also been included in the screen- histologic findings.26 However, some H pylori-infected children had ing test-endoscope-treatment strategy.30,31 In Korea, pediatric a normal appearance of the gastric mucosa on endoscopy. gastroenterologists treat children with H pylori infection according Various noninvasive diagnostic tests are available for post-treat- to the guidelines of Europe and North America and treat children ment evaluation of H pylori infection. H pylori SAT (HpSA) is one of when the parents want their child treated.32 the noninvasive tests recommended for follow-up post-treatment. Treatment failure is expected to increase worldwide because of Several studies assessed the performance of the test in this time pe- a general increase in the antimicrobial resistance of H pylori. Korean riod.27-29 In a study cohort of 101 Algerian children aged 5-15 years, guidelines recommend an endoscopy be performed to determine the IDEIA HpStAR SAT (Oxoid, Cambridge, UK) was shown to have AST if treatment fails. Based on results of susceptibility testing, two high sensitivity (93.6%) and specificity (100%) in both pre-treatment appropriate antibiotics are administered at maximal tolerable doses and post-treatment conditions using culture or histology and rapid with the double-dose proton pump inhibitor (PPI) bid and bismuth urease test (RUT) as reference.27 In a prospective cross-sectional qid for at least 14 days.32 The existence of clarithromycin-resistant study with 303 symptomatic children, the sensitivity values of an- H pylori is an important factor involved in eradication failure. In 222 tral nodularity (AN), HpSA, and RUT were 62%, 69%, and 87%, and H pylori strains isolated from 1,887 Swedish children from 2005 to the specificity values of AN, HpSA, and RUT were 88%, 89%, and 2016, 21% (46/222) were clarithromycin-resistant.33 In a prospec- 65%, respectively, using culture as the reference method.28 A study tive, open, comparative, and cross-sectional study of 228 Chinese comparing the results of endoscopic biopsy and the results of the children aged 6 to 18 years, the eradication rates were 74.1% for HpSA, salivary IgG, serum IgG, and serum IgM tests in a group of standard triple therapy, 69.5% for sequential therapy (41/59), 89.9% 37 Indonesian children confirmed that serologic and salivary assays for bismuth-based quadruple therapy (53/59), and 84.6% for con- should not be used for detection of H pylori due to poor specificity.29 comitant therapy (44/52). Bismuth-based therapy was superior to In summary, diagnosis of H pylori infection should be based on triple therapy, whereas sequential therapy and concomitant therapy endoscopic biopsies in children who are highly suspected of H pylo- were not superior to triple therapy.34 ri-related gastroduodenal disease. Noninvasive tests can be chosen The efficacy of addition of probiotics as an adjunct to ther- according to the clinical setting or study purpose. Further compar- apy was investigated in a recent meta-analysis. Lactobacilli, as an ative studies of high methodological quality are required to obtain adjunct to triple therapy, increased H pylori eradication rates by more reliable evidence of relative accuracy of the tests used for di- approximately 13% as well as reduced the incidence of therapy-re- agnosing H pylori infection in children. lated diarrhea in children.35 The eradication rates increased sig- 9 nificantly in the high-dose group (≥5 × 10 CFU/day) and long-term 9 group (≥4 weeks), but not in the low-dose group (<5 × 10 CFU/ 7 | TREATMENT day) and short-term group (≤2 weeks), which indicated that a higher dose and a longer duration of Lactobacilli supplementation may H pylori eradication in children should be supported by a clear ben- improve eradication efficacy. However, these studies involved a efit. For those with PUD, chronic ITP, or refractory IDA, testing for variety of different probiotics. Therefore, it is not possible to make 4 of 5 | SEO et al. any specific recommendation regarding addition of probiotics as 9. León MA, Palma C, Hernández C, et al. Helicobacter pylori pediatric infection changes Fc RI expression in dendritic cells and Treg pro- an adjunct to therapy. ε file in vivo and in vitro. Microbes Infect. 2019;21(10):449-455. In summary, clarithromycin resistance is increasing worldwide, 10. Meliţ LE, Mărginean CO, Bănescu C, Bogliş A, Mocan S, Iancu M. and the use of bismuth-based triple or quadruple therapy instead of The relationship between TLR4 rs4986790 and rs4986791 gene the PPI-based triple therapy is increasingly used as a first-line ther- polymorphisms and Helicobacter pylori infection in children with apy. Additional studies are required to determine specific probiotics gastritis. Pathol Res Pract. 2019;215(12):152692. 11. Miao R, Wan C, Wang Z. The relationship of gastric microbiota and that might be helpful in increasing the eradication rate and in de- Helicobacter pylori infection in pediatrics population. Helicobacter. creasing the side effects of eradication therapy. Physicians should 2020;25(1):e12676. understand the mechanisms underlying eradication therapy and ex- 12. Yang L, Zhang J, Xu J, et al. Helicobacter pylori infection aggravates plain drug prescription in detail to both parents and children with a dysbiosis of gut microbiome in children With gastritis. Front Cell Infect Microbiol. 2019;7(9):375. view to increasing adherence. 13. Burgard M, Kotilea K, Mekhael J, et al. Evolution of Helicobacter pylori associated with gastroduodenal ulcers or erosions in children over the past 23 years: Decline or steady state? Helicobacter. 8 | CONCLUSIONS 2019;24(5):e12629. https://doi.org/10.1111/hel.12629 14. Moreira-Silva H, Silva G, Costa E, et al. Insights into pediatric autoimmune gastritis: Is there a role for Helicobacter pylori infection? Recent publications of H pylori infection in children highlight the J Pediatr Gastroenterol Nutr. 2019;68(6):e99-e104. https://doi. distinct clinical and pathophysiologic features associated with in- org/10.1097/MPG.0000000000002278 fection, the decreasing prevalence of infection, and increasing chal- 15. Agin M, Batun I, Ozdemir S, Doran F, Tumgor G. Prevalence of Helicobacter pylori in Turkish children with celiac disease and its effect lenge with eradication rates due to antibiotic resistance. Ongoing on clinical, histopathological, and laboratory parameters. Arch Med Sci. studies in children will continue to unravel key factors involved in 2019;15(6):1475-1481. https://doi.org/10.5114/aoms.2019.83699 disease. Larger well-designed studies will be required to identify op- 16. Bayrak NA, Tutar E, Volkan B, et al. Helicobacter pylori infection in timal treatment options. children with celiac disease: Multi-center, cross-sectional study. Helicobacter. 2020;25(3):e12691. 17. Ibrahim A, Ali YBM, Abdel-Aziz A, El-Badry AA Helicobacter pylori DISCLOSURES OF INTEREST and enteric parasites co-infection among diarrheic and non-diar- The authors have no disclosures of interest. rheic Egyptian children: seasonality, estimated risks, and predictive factors. J Parasit Dis. 2019;43(2):198-208. https://doi.org/10.1007/ s12639-018-1075-y REFERENCES 18. Tsigalou C, Konstantinidis TG, Cassimos D, et al. Inverse associa- 1. Miyamoto R, Okuda M, Lin Y, Murotani K, Okumura A, Kikuchi tion between Helicobacter pylori infection and childhood asthma in S. Rapidly decreasing prevalence of Helicobacter pylori among Greece: a case-control study. Germs. 2019;9(4):182-187. Japanese children and adolescents. J Infect Chemother. 19. Melby KK, Carlsen KL, Håland G, Samdal HH, Carlsen KH 2019;25:526-530. Helicobacter pylori in early childhood and asthma in adolescence. 2. Seo JH, Park JS, Rhee KH, Youn HS. Diagnosis of Helicobacter pylori BMC Res Notes. 2020;13(1):79. infection in children and adolescents in Korea. Pediatr Gastroenerol 20. Akiner U, Yener HM, Gozen ED, Kuzu SB, Canakcioglu S Helicobacter Hepatol Nutr. 2019;21:219-233. pylori in allergic and non-allergic rhinitis does play a protective or 3. Tang MYL, Cunng PHY, Chan HY, Tam PKH, Wong KKY. Recent causative role? Eur Arch Otorhinolaryngol. 2020;277(1):141-145. trends in the prevalence of Helicobacter pylori in symptomatic chil- 21. Zahmatkeshan M, Karimi M, Geramizadeh B, Eslaminasab S, dren: a 12-year retrospective study in a tertiary centre. J Pediatr Esmailnejad A, Safarpour AR. Association between Helicobacter Surg. 2019;54:255-257. pylori infection and iron deficiency anemia in school-aged Iranian 4. Babatola AO, Akinbami F, Adeodu O, Ojo T, Efere M, Olatunya children. Indian Pediatr. 2019;56(5):387-389. OS. Seroprevalence and determinants of Helicobacter pylori in- 22. Agin M, Kayar Y, Dertli R. The relationship between mean platelet fection among asymptomatic under-five children at a tertiary volume and platelet levels of children with Helicobacter pylori and hospital in the South-Western region of Nigeria. Afr Health Sci. gastritis. Prz Gastroenterol. 2019;14(3):198-201. 2019;19:2082-2090. 23. Al-Hussaini AA, Al Jurayyan AN, Bashir SM, Alshahrani D. Where 5. Aitila P, Mutyaba M, Okeny S, et al. Prevalence and risk factors of are we today with Helicobacter pylori infection among healthy chil- Helicobacter pylori infection among children aged 1 to 15 years dren in Saudi Arabia? Saudi J Gastroenterol. 2019;25(5):309-318. at Holy Innocents Children’s Hospital, Mbarara, South Western 24. Adeniyi OF, Fajolu IB, Temiye E, Esezobor CI, Mabogunje CA Uganda. J Trop Med 2019;2019:9303072. Helicobacter pylori infection in malnourished children in Lagos. Niger 6. Boyanova L, Hadzhiyski P, Markovska R, et al. Prevalence of Med J. 2019;60(4):205-210. Helicobacter pylori is still high among symptomatic Bulgarian chil- 25. Gao T, Zhao M, Zhang C, et al. Association of Helicobacter pylori in- dren. Acta Microbiol Immunol Hung. 2019;66:255-260. fection with vitamin D deficiency in infants and toddlers. Am J Trop 7. Chobot A, Poreska J, Krzywicka A, et al. No association between Med Hyg. 2020;102(3):541-546. Helicobacter pylori infection and gastrointestinal complaints in large 26. Domsa AT, Lupusoru R, Gheban D, Serban R, Borzan CM cohort of symptomatic children. Acta Paediatr. 2019;108:1535-1540. Helicobacter pylori gastritis in children-the link between endoscopy 8. Jones NL, Koletzko S, Goodman K, et al. Joint ESPGHAN/ and histology. J Clin Med. 2020;9:784. NASPGHAN guidelines for the management of Helicobacter pylori 27. Moubri M, Buruoca C, Kalach N, et al. Performances of the IDEIA in children and adolescents (Update 2016). J Pediatr Gastroenterol HpStAR stool antigen test in detection of Helicobacter pylori Nutr. 2017;64:991-1003. SEO et al. | 5 of 5

infection before and after eradication treatment in Algerian chil- 33. Jansson L, Agardh D. Prevalence of clarithromycin-resistant dren. J Tropic Pediatr. 2019;65:210-216. Helicobacter pylori in children living in south of Sweden: a 12-year 28. Hasosah M. Accuracy of invasive and noninvasive methods of follow-up. Scand J Gastroenterol. 2019;54:838-842. Helicobacter pylori infection diagnosis in Saudi children. Saudi J 34. Zhou Y, Ye Z, Wang Y, et al. Comparison of four different regimens Gastroenterol. 2019;25:126-131. against Helicobacter pylori as a first-line treatment: A prospec- 29. Darma A, Samsu B, Nugroho T, et al. Comparison of Helicobacter tive, cross-sectional, comparative, open-trial in Chinese children. pylori stool antigen, salivary IgG, serum IgG, and serum IgM as diag- Helicobacter. 2020;25:e12679. nostic markers of H pylori infection in children. Iranian. J Microbiol. 35. Fang HR, Zhang GQ, Cheng JY, Li ZY. Efficacy of Lactobacillus- 2019;11:206-211. supplemented triple therapy for Helicobacter pylori infection in 30. Kato M, Ota H, Okuda M, et al. Guidelines for the management children: a meta-analysis of randomized controlled trials. European J of Helicobacter pylori infection in Japan: 2016 revised edition. Pediatr. 2019;178:7-16. Helicobacter. 2019;24:e12597. 31. Honma H, Nakayama Y, Kato S, et al. Clinical features of Helicobacter pylori antibody-positive junior high school students in Nagano How to cite this article: Seo J-H, Bortolin K, Jones NL. Prefecture. Japan. Helicobacter. 2019;24:e12559. Review: Helicobacter pylori infection in children. Helicobacter. 32. Jun JS, Seo JH, Park JS, Rhee KH, Youn HS. Changes in treatment strategies for Helicobacter pylori infection in children and adoles- 2020;25(Suppl. 1):e12742. https://doi.org/10.1111/hel.12742 cents in Korea. Pediatr Gastroenterol Hepatol Nutr. 2019;22:417-430.

DOI: 10.1111/hel.12743

REVIEW ARTICLE

Review – Treatment of Helicobacter pylori infection 2020

Anthony O'Connor1 | Takahisa Furuta2 | Javier P. Gisbert3 | Colm O'Morain1

1Department of Gastroenterology, Tallaght University Hospital/Trinity College, Dublin, Abstract Ireland This review summarizes important studies regarding Helicobacter pylori therapy pub- 2 The Center for Clinical Research, lished from April 2019 to April 2020. The main themes that emerge involve stud- Hamamatsu University School of Medicine, Hamamatsu, Japan ies assessing antibiotic resistance, and there is also growing momentum behind the 3Gastroenterology Unit, Hospital utility of vonoprazan as an alternative to proton pump inhibitor (PPI) therapy and Universitario de La Princesa, Instituto de Investigación Sanitaria Princesa (IIS-IP), also bismuth-based regimens as a first-line regimen. Antibiotic resistance is rising Universidad Autónoma de Madrid (UAM), wherever it is being assessed, and clarithromycin resistance in particular has reached Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas a point where it may no longer be a viable therapy without previous testing in many (CIBEREHD), Madrid, Spain regions of the world. The evidence for the efficacy of a bismuth-based quadruple

Correspondence therapy as a first-line therapy is now very clearly established, and there is substantial Anthony O’Connor, Department of evidence that it is the best performing first-line therapy. The utility of vonoprazan as Gastroenterology, Tallaght University Hospital, Belgard Road, Tallaght, Dublin an alternative to PPI therapy, especially in resistant and difficult-to-treat groups, has D24NR0A, Ireland. also been considered in great detail this year, and it may offer an opportunity in the Email: [email protected] near future to reduce the problem of antibiotic resistance.

KEYWORDS antibiotic resistance, bismuth, dual therapy, hybrid therapy, sequential therapy, triple therapy, vonoprazan

1 | INTRODUCTION compliance and eradication rates. One study on a 14-day high-dose dual therapy in a region of high antibiotic resistance prevalence in The past year has been another busy period for research publications on China showed that it was both effective and safe for first-line treat- the treatment of Helicobacter pylori. This review summarizes important ment with an eradication rate of 92.5% and a low adverse event rate studies regarding H pylori therapy published from April 2019 to April 2020. of 7.5%.1 The addition of bismuth was not helpful in this study other The epicenter of studies has continued to shift from Europe to Asia and than for smokers. A similar study also from China reported 88% now Africa also. The main themes that emerge involve studies assessing an- eradication with 21% adverse events.2 In Turkey, the eradication tibiotic resistance, and there is also growing momentum behind the utility rate for a 14-day dual therapy was 91% with no adverse events.3 of vonoprazan as an alternative to proton pump inhibitor (PPI) therapy and also bismuth-based regimens as a first-line regimen. Data regarding specific regimens are explored in greater detail below. Certain aspects regarding the 3 | TRIPLE THERAPY safety of treatments for H pylori infection such as the potential increase in resistance to bacteria other than H pylori and the impact of eradication ther- Triple therapy (TT) remains the standard of care in the published in- apy on the gut microbiota are outside the scope of this review. ternational guidelines of the European Helicobacter and Microbiota Study Group (EHMSG) in areas of low clarithromycin resistance.4 Two studies from the Americas looked at the outcomes and both 2 | DUAL THERAPY showed poor eradication rates albeit with divergent results for TT with clarithromycin compared to levofloxacin.5,6 In the US, 78% of It has been proposed that giving longer courses of less complex dual patients receiving clarithromycin-based TT achieved eradication, therapies, eg PPI and amoxicillin four times a day, can also improve compared to 49% with levofloxacin-based TT.5 On the other hand,

Helicobacter. 2020;25(Suppl. 1):e12743. wileyonlinelibrary.com/journal/hel © 2020 John Wiley & Sons Ltd | 1 of 9 https://doi.org/10.1111/hel.12743 2 of 9 | O'CONNOR et al. in Argentina 75% of patients were cured with clarithromycin TT eradication rate, which did not improve when treatment was ex- but 93% achieved eradication with levofloxacin TT.6 Interestingly, tended to 14 days.21 The reverse hybrid therapy (PPI plus amoxi- a Japanese study, where eradication rates with clarithromycin TT cillin for 14 days, with clarithromycin plus metronidazole added were evaluated over time during the period 2013-2018, showed that for the initial 7 days) is considered to be a means of combining treatment success improved markedly over that time period, coin- the benefits of the sequential and concomitant regimens. A trial ciding with the use of the potassium competitive acid blocker (P- from Taiwan this year compared this to concomitant therapy and CAB), vonoprazan, becoming the preferred means of acid inhibition reported comparable eradication rates (95% vs 93%) with a lower over PPI.7 This will be explored in more detail later in this review. frequency of adverse events.22 Ten-day concomitant therapy Increasing treatment duration has been proposed as a means of performs well on cost-effectiveness analysis with esomeprazole, improving eradication rates with TT but this was not borne out in as characterised by the lowest cost-effectiveness analysis ratio a Korean trial comparing 7- with 14-day regimens which reported (CEAR) (179€), followed by the same regimen using pantoprazole similar poor success rates of 64% and 66%, respectively.8 A me- (183€) compared to a hybrid regimen which, although equivalent ta-analysis of 45 studies from Turkey was in agreement with just in eradication rate, had a slightly higher CEAR (187€). In contrast, 60% achieving eradication with both 7- and 14-day regimens.9 In the sequential regimen was not considered cost-effective (CEAR: Indonesia, however, a 14-day TT regimen was significantly more 216€).23 effective than a 10 day TT (87% vs 68%).10 Two meta-analyses addressed the question of whether TT with clarithromycin or metronidazole was more effective.11,12 Both concluded that the regimens 5 | ANTIBIOTIC RESISTANCE were equally, poorly efficacious with a trend in more recent years in favour of metronidazole TT since it is more effective following An unprecedented number of studies last year reported on the the rise in clarithromycin resistance. A study of 7896 subjects from important topic of antimicrobial resistance of H pylori strains.24-60 Israel examined the different PPIs used for eradication therapy and These are outlined in Table 1. A great degree of divergence was ob- found esomeprazole to be associated with a greater proportion of served in antibiotic resistance rates throughout the world with an successful eradication than other PPIs (85% vs. 77%).13 Data from unacceptably high level of clarithromycin resistance, however, being Tanzania suggested that antibiotic resistance and poor adherence a recurring theme, with only 8 of 33 studies reporting a resistance are the two factors most closely associated with TT failure.14 Again rate less than the 15% threshold at which the Maastricht guidelines in Africa, in Ethiopia, a study showed that developing an adverse recommend clarithromycin-based TT to be abandoned.4 A meta- drug reaction on TT reduced the chances of eradication, most likely analysis of 27 studies, including 4825 patients treated with both via an inhibiting effect on adherence to therapy.15 The presence of clarithromycin- and metronidazole-containing regimens illustrated type 2 diabetes was shown in another study to also be associated the clinical importance of monitoring resistance rates, noting low with TT failure with 74% eradication in the diabetes mellitus group overall eradication rates for both regimens, 75% for clarithromy- compared to 85% in the non-diabetic group.16 cin and 72% for metronidazole.11 In areas with low metronidazole and high clarithromycin resistance rates, metronidazole had a significantly higher eradication rate (92% vs. 71%), while even in areas 4 | HYBRID, SEQUENTIAL AND with high metronidazole and low clarithromycin resistance rates, CONCOMITANT NON-BISMUTH THERAPIES the eradication rate with clarithromycin-based TT was only 73%. Together, these data call into question the continuing viability of Original research on concomitant, sequential, and hybrid thera- clarithromycin as a mainstay of H pylori eradication treatment with- pies has been sparse this year. In Egypt, one study showed very out previous testing. high eradication rates of: 90% with 10-day sequential therapy, 97% with 14-day sequential therapy, and 63% for standard 7-day TT.17 Elsewhere, in Myanmar, 10-day sequential therapy was 6 | PERSONALISED TREATMENT compared to 14-day concomitant therapy and found to be equally efficacious (82% vs 79% eradication) with lower costs 18). Again A series of articles published in the journal Helicobacter this year ad- with a view to foresee cost control, safety and adherence, a study dressed the question of personalised or tailored treatment, which from one Italian group who pioneered sequential therapy showed had hitherto been considered in a second-line context but is now 10-day regimens to be of equal efficacy to 14-day regimens (87% gaining interest as a first-line intervention. A meta-analysis looked vs 90% eradication).19 Data from Korea collated over the course at 2,890 patients submitted to endoscopy and H pylori culture, re- of the last decade suggested a much lower eradication rate of porting cure rates using the antibiotic to which susceptibility was 70% although it is notable that this rate did not decline in spite detected, with 72% in patients harbouring clarithromycin-suscep- of rising antibiotic resistance rates.20 A non-bismuth concomi- tible strains, 93% in patients harbouring metronidazole-susceptible tant quadruple therapy (QT) where three antibiotics are given at strains, and 84% in patients harbouring a levofloxacin-susceptible once for 10 days was used in Greece and found to have an 87% strain.61 In Korea, a study used personalised treatment, after testing O'CONNOR et al. | 3 of 9

TABLE 1 Helicobacter pylori resistance to antibiotics in the studies published during the last year worldwide

Author N Region AMO % CLA % MET % QUINOLONE % TET % RIF % FUR %

Europe Saracino24 739 Italy - 37.8 33.6 (LVX) 25.6 - - - Palmitessa25 92 Italy - 37.7 26.2 (LVX) 16.4 - - - Fernández-Reyes26 99 Spain 0 12.1 24.2 (LVX) 13.1 0 - - Morilla27 1604 Spain - 19 40 (LVX) 17 - Bluemel28 1851 Germany - 11.3 - (LVX) 13.4 2.5 - - Dumitru29 90 Romania - 20 - 30 - - - Gemilyan30 55 Armenia - 3.6 79.4 - - - - Korona-Glowniak31 35 Poland - 14.3 31.4 (LVX) 11.4 - 25.7 - Asia Hashemi32 157 Iran 14.6 24.2 43.9 (CIP) 21.7 20.4 - - Kageyama33 208 Japan 13 48 49 - - - - Eed34 200 Saudi Arabia - 39.9 - 8.4 - - - Lee35 580 Korea 9.5 17.8 29.5 (LVX) 37 (CIP) 37 0 - - Tuan36 55 Cambodia 9.1 25.5 96.4 (LV X) 67.3 0 - - Haddadi37 128 Iran 35.5 7.2 70.1 - 8.2 - - Hamidi38 80 Iran 30 22 68 (LVX) 28 16 50 - Shoosanglertwijit39 1894 Thailand 0 10.7 14.2 (CIP) 21.43 (LVX) 0 0 - - Gao40 111 China 5.5 42.1 - 41.7 12.9 - - Rezaei41 73 Iran - 23 45 - - - - Mujtaba42 40 Pakistan 11.1 22.2 33.3 (CIP) 55.5 - - - Seo43 431 Korea - 21.3 - - - - - Liu44 804 China 1.2 19.0 78.4 (LVX) 23.3 2.3 1.7 - Farzi45 68 Iran 30.9 33.8 82.4 (LV X) 27.9 4.4 - - Hanafiah46 59 Malaysia - 35.6 59.3 (LVX) 25.4 - - - Wang47 100 China 9.0 31.0 78.0 (LVX) 56.0 15.0 - - Chang48 203 Korea - 17.4 - - - - - Shetty49 113 India 7.1 20.4 81.4 (LVX) 54.9 5.3 - - Auttajaroon50 100 Thailand - 13 62.8 26.0 - - - Kwon51 31 Korea - 16.1 6.5 - - - - Lee52 69 Korea 6.7 31.0 41.8 (MOX) 39.2 - - - Pan53 467 China - 26.1 96.8 (LVX) 28.7 - - - Africa Mabeku54 140 Cameroon 97.1 13.6 97.9 - 2.9 - - North, Central and South America Miftahussurur55 63 Dominican 1.6 3.1 82.8 (LVX) 35.9 Republic (SIT) 0 0 0 0 Ortiz56 189 Honduras 10.7 11.2 67.9 (LVX) 20.9 - - - Arévalo-Jaimes57 126 Colombia - 38.1 - - - - - Arenas58 69 Chile - 26 - - - - - Parra-Sepúlveda59 1435 Chile 4.2 29.2 37.5 (LVX) 20.8 1.4 - - Oporto60 44 Chile 11.3 40.9 81.8 (LVX) 43.1 13.6 - -

Abbreviations: AMO, amoxicillin; CIP, ciprofloxacin; CLA, clarithromycin; FUR, furazolidone; LVX, levofloxacin; MET, metronidazole; MOX, moxifloxacin; RIF, rifabutin; SIT, sitafloxacin; TET, tetracycline. aMeta-analysis. 4 of 9 | O'CONNOR et al. with dual priming oligonucleotide (DPO) polymerase chain reaction Two studies compared such therapies with standard concomitant (PCR) and asking for a previous antibiotic exposure in order to pre- QTs and found comparable results between the two regimes. A study dict resistance. The tailored first-line treatment based on antibiotic from Spain compared a 10-day BQT with a 14-day standard QT arm, susceptibility, reported an eradication rate of 92%.51 Another first- and found a slightly superior eradication for the bismuth group, 88% line study also conducted in Korea involved administration of either vs 86%.68 A Korean cohort where both arms received a 14-day ther- a 7-day clarithromycin-containing TT, a 7-day moxifloxacin-contain- apy reported 88% eradication in the bismuth group and 79% in the QT ing TT, or a 7- or 14-day bismuth quadruple therapy (BQT) based group.69 Two trials compared BQT to susceptibility-guided treatment on the MIC of the various antibiotics and reported 93% eradication and revealed very high levels of eradication in both arms in both trials, with common adverse events such as epigastric pain, nausea, and ie a study of 150 patients in Korea reporting 96% eradication for pa- vomiting occurring less commonly than with empirical therapies.52 tients both with a tailored treatment and a BQT, and a separate group A multicentre study of 467 H pylori-positive patients assigned to in China reported 97% for both regimens.70,71 A study in China looking receive tailored therapy vs. empirical therapy, revealed eradication at minocycline in combination with amoxicillin vs metronidazole found rates for tailored TT, traditional bismuth-containing QT, and tai- the best cure rates for amoxicillin with 86% eradication in a 14-day lored bismuth-containing QT of 67%, 64%, and 86%, respectively.53 BQT compared to 77% when metronidazole was used and 72% when Beyond susceptibility-guided treatment, another means of personal- amoxicillin and clarithromycin were used in BQT without minocy- ising treatment is based on the CYP2C19 status. Genetic differences cline.72 The duration of therapy has obvious implications in matters like in the activity of the enzyme CYP2C19 (the homozygous EM, het- cost of and adherence to therapy, and a study in Turkey showed that erozygous EM (HetEM), and poor metabolizer) dictate how effective BQT could be shortened from 14 to 10 days without weakening the PPI will be. A group in Colombia found cure rates to improve from success rate.73 Another factor influencing adherence is whether or not 84% to 92% in a group consisting mainly of rapid metabolisers when the tablets can be taken once daily, and in the ONCE trial in Thailand, omeprazole doses were chosen based on the CYP2C19 polymor- a once-daily treatment regimen containing levofloxacin, modified-re- phism, which may be useful particularly in populations with a broad lease clarithromycin, bismuth and PPI reported 94% eradication when spread of CYP2C19 polymorphisms.62 used for 14 days compared to 84% for a 7-day therapy.50 A novel and very interesting use of bismuth has been as an adjunct to standard TT. A large, high-quality study from the European 7 | BISMUTH-BASED THERAPY Registry on H pylori Management (Hp-EuReg) on 1,141 patients receiving this regimen showed cure in 93% of the patients, with 36% Bismuth-based therapies were looked at in great detail this year both reporting adverse events, three-quarters of which were mild and as primary and second-line therapies. Most of the studies examined self-limiting.74,75 A smaller Chinese study on 216 patients compared bismuth as part of a BQT regime with a PPI, a tetracycline-class anti- standard TT with and without bismuth and reported similar eradica- biotic and another antibiotic. One study of 118 patients treated with tion rates, 98% for the group with bismuth and 95% without.76 a BQT regimen containing amoxicillin and doxycycline reported 90% Bismuth remains a useful second-line option and a study in Korea eradication with 97% adherence to therapy.63 A retrospective analy- looking at 15 years of data for the drug in treatment failures sug- sis of American patients suggested a 14-day regimen with bismuth gests an overall eradication rate of 79% with no significant changes and tetracycline to be the most effective first-line eradication treat- over the period in question (2003 to 2018) and adverse events in ment in that country, with an 87% eradication rate.64 A three-in-one 57% of patients.77 Another Korean study showed even better results single capsule formulation containing bismuth subcitrate, metroni- with 93% of second-line patients using bismuth-based therapy with dazole and tetracycline (Pylera®) may be used with PPI for H pylori twice-daily dosing being equally efficacious as four times daily dos- eradication purposes, and a Spanish study of 200 patients using this ing.78 In China, a study on BQT used as a rescue therapy comparing treatment achieved cure in 91% of patients with 96% adherence.65 amoxicillin plus berberine vs. tetracycline plus furazolidone found A systematic review and meta-analysis on Pylera® concluded that similar eradication rates (76% vs 77%) with a significantly lower a 10-day treatment achieved an effective eradication rate of ap- rate of adverse events in the amoxicillin and berberine group.79 The proximately 90% both in first- and second-line therapy, regardless European Registry on H pylori Management (Hp-EuReg) reported of the type and dose of the PPI, in patients with clarithromycin- or on penicillin-allergic patients and found excellent eradication rates metronidazole-resistant strains, and in those previously treated with for bismuth as both first-line (91%), second-line (78%) and third- 66 80 clarithromycin. It has been proposed that H2-receptor antagonists line (75%) therapies in this cohort. A Chinese study also on pen- induce less bismuth absorption and, as a consequence, less systemic icillin-allergic patients reported 87% eradication for bismuth-based toxicity than PPIs. With this in mind, a pilot randomised clinical trial therapy with tetracycline and metronidazole.81 The antibiotic fura- was conducted looking at eradication rates for patients receiving razolidone, to which resistance remains uncommon, may also be used nitidine rather than a PPI alongside Pylera® and found similar eradi- as part of a QT with a Chinese group reporting 10-day and 14-day cation rates (91%) compared to 94% in those receiving PPI although regimens achieving eradication rates of 94% and 98% respectively, intolerance levels were the same in this small pilot cohort.67 with adverse drug reactions seen in 8.2%.82 O'CONNOR et al. | 5 of 9

8 | VONOPRAZAN that vonoprazan is equal or superior to PPIs in second- and third-line therapies. Vonoprazan is the first clinically available P-CAB.83 Vonoprazan Dual therapy with PPI and amoxicillin has been recently proposed can attain more potent gastric acid inhibition in comparison to to improve eradication rates. In this dual therapy, amoxicillin and PPI PPIs.84,85 The pH ≥4 and ≥5 holding-time ratios achieved by vono- are prescribed three (t.i.d.) or four (q.i.d.) times daily for at least two prazan (20 mg twice daily on day 7 of the treatment) were 100% weeks.97-102 However, b.i.d. dosing of vonoprazan (20 mg) could attain and 99%, respectively.82 Moreover, vonoprazan can attain pH 7 in the potent acid inhibition from day 1 as noted above.93,94 Furuta et al re- the stomach within approximately 3 hours of the initial dosing of ported that dual therapy with vonoprazan (20 mg) b.i.d. and amoxicillin 20 mg.85 Therefore, vonoprazan can create the ideal pH condition in (500 mg) t.i.d. for 1 week attained a 93% eradication rate, which was the stomach for eradication of H pylori from day 1 of the eradication not inferior to the TT with vonoprazan (20 mg), amoxicillin (750 mg) and therapy. Since 2015, when vonoprazan was used clinically in Japan, clarithromycin (200 mg) b.i.d. for 1 week.103 Suzuki et al showed that the eradication therapy has dramatically changed. The current most dual therapy with vonoprazan (20 mg) and amoxicillin (750 mg) b.i.d. popular standard regimen for H pylori eradication in Japan is the tri- for 7 days attained almost the same eradication rate as vonoprazan ple regimen with vonoprazan (20 mg b.i.d.), amoxicillin (750 mg b.i.d.) (20 mg), amoxicillin (750 mg), and clarithromycin (200 mg) b.i.d. for and clarithromycin (200 mg or 400 mg b.i.d.) for 7 days, while regi- 7 days.104 Therefore, when vonoprazan is used as the acid inhibitor, dual mens used outside of Japan have been changed from the TT to non- therapy with amoxicillin can be one of the standard therapies in Japan. bismuth quadruple therapies or BQTs.86,87 There are clinically important merits for dual therapy with vo- As the first-line therapy, Ashida et al reported that the eradication noprazan and amoxicillin, especially because it allows to avoid clar- rate attained by a triple regimen with vonoprazan (20 mg), amoxicil- ithromycin. First, because clarithromycin is a well-known inhibitor lin (750 mg), and clarithromycin (200-400 mg) twice daily for 7 days of p-glycoprotein (p-Gp) and cytochrome P450 3A4 (CYP3A4), the was 91% (427/468).88 Kusunoki et al reported an eradication rate of interaction between clarithromycin and substrates of P-Gp and 92% (384/415) with the same vonoprazan-containing regimen, while CYP3A4 is of concern.105,106 Furthermore, clarithromycin increases eradication rates attained by the PPI-containing regimens were 85% plasma levels of the substrates of CYP3A4 and MDR1, such as (57/67) when esomeprazole was used, 85% (384/454) when lanso- statins, cyclosporine, warfarin and triazolam.107-110 Clarithromycin is prazole was used, and 82% (341/415) when rabeprazole was used.89 also known to increase the risk of elongation of the QT interval,111 Saito et al compared vonoprazan and esomeprazole as first-line thera- which constitutes a risk of sudden death by arrhythmia.112 Thirdly, pies and reported that the vonoprazan-based regimen attained higher macrolide antibiotics are known to stimulate the intestinal peristal- eradication rates than the esomeprazole-based regimen.90 Takara sis, which may lead to diarrhoea during the eradication treatment.113 et al also reported the superiority of vonoprazan as first-line ther- Although these adverse events are relatively infrequent, the avoid- apy in comparison to PPIs.91 Lyu et al performed a systematic search ance of clarithromycin might contribute to their reduction. and reported that the efficacy of vonoprazan-based TT was superior As noted above, the potent acid inhibition attained by vono- to that of PPI-based TT for first-line H pylori eradication.92 Ierardi prazan improves the eradication rates of H pylori infection in com- et al summarised three prospective studies comparing vonoprazan parison with PPIs. However, current data about vonoprazan have and PPI as first-line therapies and confirmed that vonoprazan was come only from Eastern Asia. Therefore, its strong power needs to better than conventional PPIs for H pylori treatment in every case.93 be confirmed outside this geographic area in Western countries and Deguchi et al demonstrated that a change of acid inhibitor from PPI to should be related to the different local antibiotic resistance rates.93 vonoprazan increased the eradication rates of H pylori in Japan based Usefulness of vonoprazan in other regimens should also be tested. on the analysis of a nationwide claims database including >1.6 million patients.94 In summary, it can be concluded that vonoprazan is superior to PPI as first-line therapy with amoxicillin and clarithromycin. 9 | REINFECTION Finally, Shinmura et al reported that the eradication rates by the vonoprazan-based regimens could be further improved when antimicrobial A large-scale multicentre, prospective open cohort observational study agents were selected based on susceptibility testing.95 in China reported an annual reinfection rate after successful eradica- Concerning second-line therapy, Ashida et al reported that the tion treatment of 1.5% per person-year and this reinfection was inde- eradication rate attained by the triple regimen including vonoprazan pendently associated with several risk factors, namely membership of (20 mg), amoxicillin (750 mg)(, and metronidazole (250 mg) twice daily a minority group, a lower level of education, a family history of gastric for 7 days was 95% (42/44).88 However, Saito et al demonstrated cancer, and residence in Western or Central China.114 that there was no significant difference between vonoprazan and esomeprazole in the second-line eradication rate.90 Sue et al compared a vonoprazan-based third-line therapy consisting of vono- 10 | PROBIOTICS AND OTHER ADJUNCTS prazan (20 mg), amoxicillin (750 mg), and sitafloxacin (100 mg) b.i.d. for 7 days with a PPI-based third-line therapy and found that the In H pylori eradication regimens, probiotics are proposed to decrease vonoprazan therapy was superior.96 In summary, it can be concluded side effects, improve compliance and thereby increase eradication 6 of 9 | O'CONNOR et al. rates. A network meta-analysis of 40 studies with 8924 patients 4. Malfertheiner P, Megraud F, O'Morain CA, et al. Management of Helicobacter pylori infection - the Maastricht V/Florence performed this year showed a higher eradication rate and lower Consensus Report. Gut. 2017;66(1):6-30. incidence of total side effects in the probiotic group compared to 5. Tariq H, Patel H, Kamal MU, et al. Reevaluation of the efficacy controls. Further analysis showed that prolonged use of probiotics of first line regimen for Helicobacter pylori. Clin Exp Gastroenterol. before, throughout and after treatment improved eradication rates 2020;13:25-33. and that probiotics combined with BQT was the best combina- 6. Paz S, Florez Bracho L, Lasa JS, Zubiaurre I Helicobacter pylori infection. Frequency of first-line treatment failure. Medicina. tion.115 Lactobacilli were shown in that meta-analysis to be the best 2020;80(2):111-116. choice of probiotic strains and two studies this year even investi- 7. Mori H, Suzuki H, Omata F, et al. Current status of first- and sec- gated Lactobacillus reuteri along with PPI as an alternative to anti- ond-line Helicobacter pylori eradication therapy in the metropol- biotics for H pylori eradication. One trial in Romania, conducted on itan area: a multicenter study with a large number of patients. Therap Adv Gastroenterol. 2019;12:1756284819858511. 23 patients with functional dyspepsia, reported an eradication rate 8. Kim TH, Park JM, Cheung DY, Oh JH. Comparison of 7- and 14- 116 of 65%. However, in a group in Italy, cure was only achieved in day eradication therapy for Helicobacter pylori with first- and 3 out of 24 patients (12%).117 Aside from Lactobacilli, two other second-line regimen: randomized clinical trial. J Korean Med Sci. studies this year showed small beneficial adjuvant effects for a two- 2020;35(5):e33. 9. Sezgin O, Aydın MK, Özdemir AA, Kanık AE. Standard triple ther- bacterial-strain formula, containing Bifidobacterium animalis lactis apy in Helicobacter pylori eradication in Turkey: systematic evalu- BB12 and Enterococcus faecium L3, and another for Saccharomyces ation and meta-analysis of 10-year studies. Turk J Gastroenterol. boulardii.118,119 2019;30(5):420-435. 10. Herardi R, Syam AF, Simadibrata M, et al. Comparison of 10-day course of triple therapy versus 14-day course for eradication of Helicobacter pylori infection in an Indonesian population: dou- 11 | CONCLUSION ble-blinded randomized clinical trial. Asian Pac J Cancer Prev. 2020;21(1):19-24. There have been many studies pertaining to H pylori eradication 11. Li B, Lan X, Wang L, et al. Proton-pump inhibitor and amoxicillin-based triple therapy containing clarithromycin versus metro- treatment in the published literature over the last 12 months, often nidazole for Helicobacter pylori: a meta-analysis. Microb Pathog. with diverse results, although several broad themes have emerged. 2020;142:104075. Bismuth-based therapies continue to show a clear advantage for 12. Boltin D, Levi Z, Gingold-Belfer R, et al. Comparative effect of pro- first-line therapy. In addition, there is a crisis in rising antibiotic re- ton-pump inhibitors on the success of triple and quadruple ther- sistance rates. Clarithromycin resistance rates in almost all regions apy for Helicobacter pylori infection. Dig Dis. 2020;1–7. https://doi. org/10.1159/000504909. Online ahead of print. have now passed the point where clarithromycin-based TT cannot 13. Murata M, Sugimoto M, Mizuno H, Kanno T, Satoh K. be considered without previous testing and it is time for global clini- Clarithromycin versus metronidazole in first-line Helicobacter py- cal practice to reflect this. Vonoprazan is a very promising emerging lori triple eradication therapy based on resistance to antimicrobial option for several reasons including the fact that it may offer the op- agents: meta-analysis. J Clin Med. 2020;9(2):543. 14. Jaka H, Mueller A, Kasang C, Mshana SE. Predictors of triple ther- portunity to improve the resistance problem and should be trialled apy treatment failure among H pylori infected patients attending in more regions in the coming years. at a tertiary hospital in Northwest Tanzania: a prospective study. BMC Infect Dis. 2019;19(1):447. DISCLOSURES 15. Gebeyehu E, Nigatu D, Engidawork E Helicobacter pylori eradication rate of standard triple therapy and factors affecting eradica- Anthony O’Connor: none. Takahisa Furuta: No COI related to tion rate at Bahir Dar city administration, Northwest Ethiopia: a this manuscript. Apart from this manuscript, lecture fees from prospective follow up study. PLoS One. 2019;14(6):e0217645. AstraZeneca and Daiichi Sankyo Co., Ltd. and research funds from 16. Yao CC, Kuo CM, Hsu CN, et al. First-line Helicobacter pylori eradica- Daiichi Sankyo Co., Ltd. and Takeda Pharmaceutical Co., Ltd., Javier tion rates are significantly lower in patients with than those without type 2 diabetes mellitus. Infect Drug Resist. 2019;12:1425-1431. P. Gisbert: Dr Gisbert has served as a speaker, a consultant and ad- 17. Farhoud NS, Ibrahim OM, Ezzat SE. Efficacy and cost-effective- visory member for or has received research funding from Mayoly, ness Comparison of 10-day, 14-day sequential versus 14-day tri- Allergan and Diasorin. Colm O'Morain: none. ple therapies for treating Helicobacter pylori infection in Egyptian patients. J Clin Gastroenterol. 2020. https://doi.org/10.1097/ MCG.0000000000 001278. Online ahead of print. REFERENCES 18. Myint NPST, Zaw TT, Sain K, et al. Sequential Helicobacter pylori 1. Yu L, Luo L, Long X, et al. High-dose PPI-amoxicillin dual therapy eradication therapy in Myanmar; a randomized clinical trial of effi- with or without bismuth for first-line Helicobacter pylori therapy: a cacy and tolerability. J Gastroenterol Hepatol. 2020;35(4):617-623. randomized trial. Helicobacter. 2019;24(4):e12596. 19. Zullo A, Fiorini G, Scaccianoce G, et al. Sequential therapy for 2. Suo BJ, Tian XL, Li CL, Song ZQ. Dual therapy with rabeprazole first-line Helicobacter pylori eradication: 10- or 14-day regimen? J and amoxicillin four times daily for 14 days for the first-line erad- Gastrointestin Liver Dis. 2019;28(1):11-14. ication of Helicobacter pylori infection. Zhonghua Yi Xue Za Zhi. 20. Yoon K, Kim N. Eradication rates of 10-day sequential therapy 2019;99(48):3781-4378. for Helicobacter pylori: results of an 8-year prospective study 3. Öztürk K, Kurt Ö, Çelebi G, et al. High-dose dual therapy is effec- conducted at a tertiary Korean hospital. Korean J Gastroenterol. tive as first-line treatment for Helicobacter pylori infection. Turk J 2019;73(2):99-104. Gastroenterol. 2020;31(3):234-238. O'CONNOR et al. | 7 of 9

21. Apostolopoulos P, Ekmektzoglou K, Georgopoulos S, et al. 10-day 39. Shoosanglertwijit R, Kamrat N, Werawatganon D, Chatsuwan T, versus 14-day quadruple concomitant nonbismuth therapy for the Chaithongrat S, Rerknimitr R. Real-world data of Helicobacter py- treatment of Helicobacter pylori infection: results from a random- lori prevalence, eradication regimens, and antibiotic resistance in ized prospective study in a high clarithromycin resistance coun- Thailand, 2013–2018. JGH Open. 2019;4(1):49-53. try. J Clin Gastroenterol. 2020. https://doi.org/10.1111/jgh.15034. 40. Gao C, Du SY, Fang L, Fan YH, Song AP, Chen H. Eradication treat- Online ahead of print. ment of Helicobacter pylori infection based on molecular patho- 22. Hsu PI, Tsay FW, Kao JY, et al. Equivalent efficacies of reverse logic antibiotic resistance. Infect Drug Resist. 2020;13:69-79. hybrid and concomitant therapies in first-line treatment of 41. Rezaei S, Talebi Bezmin Abadi A, Mohabatti MA. Metronidazole- Helicobacter pylori infection. J Gastroenterol Hepatol. 2020. https:// resistant Helicobacter pylori isolates without rdxA mutations ob- doi.org/10.1111/jgh.15034. Online ahead of print. tained from Iranian dyspeptic patients. New Microbes New Infect. 23. Papaefthymiou A, Liatsos C, Georgopoulos SD, et al. Helicobacter 2019;34:100636. pylori eradication regimens in an antibiotic high-resistance 42. Mujtaba A, Masud T, Ahmad A, et al. Isolation and antimicro- European area: A cost-effectiveness analysis. Helicobacter. bial susceptibility testing of Helicobacter pylori strains from gas- 2020;25(1):e12666. tric biopsies from Pakistani patients. Pak J Pharm Sci. 2019;32(5 24. Saracino IM, Fiorini G, Zullo A, Pavoni M, Saccomanno L, Vaira D. Suppl):2279-2285. Trends in primary antibiotic resistance in H pylori strains isolated in 43. Seo SI, Do BJ, Kang JG, et al. Helicobacter pylori eradication according Italy. Antibiotics. 2020;9(1):26. to sequencing-based 23S ribosomal RNA point mutation associated 25. Palmitessa V, Monno R, Panarese A, et al. Evaluation of antibiotic with clarithromycin resistance. J Clin Med. 2019;9(1):54. resistance of Helicobacter pylori strains isolated in Bari, Southern 44. Liu DS, Wang YH, Zhu ZH, et al. Characteristics of Helicobacter Italy, in 2017–2018 by phenotypic and genotyping methods. pylori antibiotic resistance: data from four different populations. Microb Drug Resist. 2020. Online ahead of print. Antimicrob Resist Infect Control. 2019;8:192. 26. Fernández-Reyes M, Tamayo E, Rojas-Rengifo D, et al. Helicobacter 45. Farzi N, Yadegar A, Sadeghi A, et al. High prevalence of antibi- pylori pathogenicity and primary antimicrobial resistance in otic resistance in Iranian Helicobacter pylori isolates: importance Northern Spain. Eur J Clin Invest. 2019;49(8):e13150. of functional and mutational analysis of resistance genes and 27. Morilla AM, Álvarez-Argüelles ME, Duque JM, Armesto E, Villar H, virulence genotyping. J Clin Med. 2019;8(11):2004. https://doi. Melón S. Primary antimicrobial resistance rates and prevalence of org/10.3390/jcm8112004 Helicobacter pylori infection in the north of Spain. A 13-year retro- 46. Hanafiah A, Binmaeil H, Raja Ali RA, Mohamed Rose I, Lopes BS. spective study. Gastroenterol Hepatol. 2019;42(8):476-485. Molecular characterization and prevalence of antibiotic resistance 28. Bluemel B, Goelz H, Goldmann B, et al. Antimicrobial resistance of in Helicobacter pylori isolates in Kuala Lumpur, Malaysia. Infect Drug Helicobacter pylori in Germany, 2015 to 2018. Clin Microbiol Infect. Resist. 2019;12:3051-3061. 2020;26(2):235-239. 47. Wang D, Guo Q, Yuan Y, Gong Y. The antibiotic resistance of 29. Dumitru E, Alexandrescu L, Hanu AC, et al. Genetic antibiotic Helicobacter pylori to five antibiotics and influencing factors in resistance of Helicobacter pylori in South-Eastern Romania. J an area of China with a high risk of gastric cancer. BMC Microbiol. Gastrointestin Liver Dis. 2020;29(1):19-25. 2019;19(1):152. 30. Gemilyan M, Hakobyan G, Benejat L, et al. Prevalence of 48. Chang YW, Ko WJ, Oh CH, et al. Clarithromycin resistance and fe- Helicobacter pylori infection and antibiotic resistance profile in male gender affect Helicobacter pylori eradication failure in chronic Armenia. Gut Pathog. 2019;11:28. gastritis. Korean J Intern Med. 2019;34(5):1022-1029. 31. Korona-Glowniak I, Cichoz-Lach H, Siwiec R, et al. Antibiotic re- 49. Shetty V, Lamichhane B, Tay CY, et al. High primary resistance to sistance and genotypes of Helicobacter pylori strains in patients metronidazole and levofloxacin, and a moderate resistance to clar- with gastroduodenal disease in Southeast Poland. J Clin Med. ithromycin in Helicobacter pylori isolated from Karnataka patients. 2019;8(7):E1071. Gut Pathog. 2019;11:21. 32. Hashemi SJ, Sheikh AF, Goodarzi H, et al. Genetic basis for metro- 50. Auttajaroon J, Vilaichone RK, Chotivitayatarakorn P, Mahachai V. nidazole and clarithromycin resistance in Helicobacter pylori strains Once-daily rabeprazole, levofloxacin, clarithromycin-MR, and bis- isolated from patients with gastroduodenal disorders. Infect Drug muth for Helicobacter pylori eradication: a randomized study of 7 Resist. 2019;12:535-543. or 14 days (ONCE study). Helicobacter. 2019;24(5):e12615. https:// 33. Kageyama C, Sato M, Sakae H, et al. Increase in antibiotic resistant doi.org/10.1111/hel.12615 Helicobacter pylori in a University Hospital in Japan. Infect Drug 51. Kwon YH, Jeon SW, Nam SY, Lee HS, Park JH. Efficacy of tailored Resist. 2019;12:597-602. therapy for Helicobacter pylori eradication based on clarithromycin 34. Eed EM, Hawash YA, Khalifa AS, et al. Molecular diagnosis of resistance and survey of previous antibiotic exposure: A single-cen- Helicobacter pylori antibiotic resistance in the Taif region. Saudi ter prospective pilot study. Helicobacter. 2019;24(4):e12585. Arabia. Microbiol Immunol. 2019;63(6):199-205. 52. Lee JW, Kim N, Nam RH, et al. Favourable outcomes of cul- 35. Lee JH, Ahn JY, Choi KD, et al. Nationwide antibiotic resistance ture-based Helicobacter pylori eradication therapy in a region with mapping of Helicobacter pylori in Korea: a prospective multicenter high antimicrobial resistance. Helicobacter. 2019;24(2):e12561. study. Helicobacter. 2019;24(4):e12592. 53. Pan J, Shi Z, Lin D, et al. Is tailored therapy based on antibiotic sus- 36. Tuan VP, Narith D, Tshibangu-Kabamba E, et al. A next-generation ceptibility effective? A multicenter, open-label, randomized trial. sequencing-based approach to identify genetic determinants of Front Med. 2020;14(1):43-50. antibiotic resistance in Cambodian Helicobacter pylori clinical iso- 54. Kouitcheu Mabeku LB, Eyoum Bille B, Tepap Zemnou C, Tali lates. J Clin Med. 2019;8(6):858. Nguefack LD, Leundji H. Broad spectrum resistance in Helicobacter 37. Haddadi MH, Negahdari B, Asadolahi R, Bazargani A Helicobacter pylori isolated from gastric biopsies of patients with dyspepsia in pylori antibiotic resistance and correlation with cagA motifs and Cameroon and efflux-mediated multiresistance detection in MDR homB gene. Postgrad Med. 2020;12:1-9. isolates. BMC Infect Dis. 2019;19(1):880. 38. Hamidi S, Badmasti F, Sadeghpour Heravi F, et al. Antibiotic resis- 55. Miftahussurur M, Cruz M, Doohan D, et al. Five alternative tance and clonal relatedness of Helicobacter pylori strains isolated Helicobacter pylori antibiotics to counter high levofloxacin and from stomach biopsy specimens in northeast of Iran. Helicobacter. metronidazole resistance in the Dominican Republic. PLoS One. 2020;25(2):e12684. 2019;14(3):e0213868. 8 of 9 | O'CONNOR et al.

56. Ortiz V, Estevez-Ordonez D, Montalvan-Sanchez E, et al. regimens in the treatment of Helicobacter pylori. Gastroenterol Res Helicobacter pylori antimicrobial resistance and antibiotic consump- Pract. 2019;2019:9251879. tion in the low-resource Central America setting. Helicobacter. 73. Özer Etik D, Sezer S, Suna N, Öztaş E, Kılıç ZMY. Can the treat- 2019;24(4):e12595. ment duration be shortened in bismuth-containing thera- 57. Arévalo-Jaimes BV, Rojas-Rengifo DF, Jaramillo CA, de Molano pies for Helicobacter pylori eradication? Turk J Gastroenterol. BM, Vera-Chamorro JF, Del Pilar DM. Genotypic determination of 2019;30(8):667-672. resistance and heteroresistance to clarithromycin in Helicobacter 74. McNicholl AG, O'Morain CA, Megraud F, Gisbert JP. As Scientific pylori isolates from antrum and corpus of Colombian symptomatic Committee of the Hp-Eureg on behalf of the national coor- patients. BMC Infect Dis. 2019;19(1):546. dinators. Protocol of the European Registry on the manage- 58. Arenas A, Serrano C, Quiñones L, et al. High prevalence of clari- ment of Helicobacter pylori infection (Hp-EuReg). Helicobacter. thromycin resistance and effect on Helicobacter pylori eradication 2019;24(5):e12630. in a population from Santiago, Chile: cohort study and meta-analy- 75. McNicholl AG, Bordin DS, Lucendo A, et al. Combination of bis- sis. Sci Rep. 2019;9(1):20070. muth and standard triple therapy eradicates Helicobacter pylori 59. Parra-Sepúlveda C, Merino JS, Sáez-Carrillo K, González C, García- infection in more than 90% of patients. Clin Gastroenterol Hepatol. Cancino A. Antibiotic resistance surveillance of Helicobacter 2020;18(1):89-98. pylori at the Biobio region (Chile) in a decade. Arq Gastroenterol. 76. Luo L, Ji Y, Yu L, et al. 14-day high-dose amoxicillin- and metroni- 2019;56(4):361-366. dazole-containing triple therapy with or without Bismuth as first- 60. Oporto M, Pavez M, Troncoso C, et al. Prevalence of infection line Helicobacter pylori treatment. Dig Dis Sci. 2020. https://doi. and antibiotic susceptibility of Helicobacter pylori: an evaluation org/10.1007/s10620-020-06115-7. Online ahead of print. in public and private health systems of Southern Chile. Pathogens. 77. Yoon K, Kim N, Lee JW, et al. Annual eradication rate of bis- 2019;8(4):226. muth-containing quadruple therapy as second-line treatment for 61. Baylina M, Muñoz N, Sánchez-Delgado J, López-Góngora S, Helicobacter pylori infection: a 15-year prospective study at a ter- Calvet X, Puig I. Systematic review: Would susceptibility-guided tiary hospital in Korea. Helicobacter. 2020;25(3):e12685. https:// treatment achieve acceptable cure rates for second-line doi.org/10.1111/hel.12685 Helicobacter pylori therapy as currently practiced? Helicobacter. 78. Kim JY, Lee SY, Kim JH, Sung IK, Park HS. Efficacy and safety of 2019;24(3):e12584. twice a day, bismuth-containing quadruple therapy using high- 62. Arévalo Galvis A, Trespalacios Rangel AA, Otero RW. Personalized dose tetracycline and metronidazole for second-line Helicobacter therapy for Helicobacter pylori: CYP2C19 genotype effect on first- pylori eradication. Helicobacter. 2020;25(2):e12683. line triple therapy. Helicobacter. 2019;24(3):e12574. 79. Zhang J, Han C, Lu W, et al. A randomized, multicenter and non- 63. Gu L, Li S, He Y, et al. Bismuth, rabeprazole, amoxicillin, and doxy- inferiority study of amoxicillin plus berberine vs tetracycline plus cycline as first-line Helicobacter pylori therapy in clinical practice: A furazolidone in quadruple therapy for Helicobacter pylori rescue pilot study. Helicobacter. 2019;24(4):e12594. treatment. J Dig Dis. 2020;21(5):256–263. 64. Alsamman MA, Vecchio EC, Shawwa K, Acosta-Gonzales G, 80. Nyssen OP, Pérez-Aisa Á, Tepes B, et al. Helicobacter pylori first-line Resnick MB, Moss SF. Retrospective analysis confirms tetracycline and rescue treatments in patients allergic to penicillin: experience quadruple as best Helicobacter pylori regimen in the USA. Dig Dis from the European Registry on H pylori management (Hp-EuReg). Sci. 2019;64(10):2893-2898. Helicobacter. 2020:25(3):e12686. https://doi.org/10.1111/hel.12686 65. Castro Fernández M, Romero García T, Keco Huerga A, et al. 81. Gao W, Zheng SH, Cheng H, et al. Tetracycline and metronidazole Compliance, adverse effects and effectiveness of first line bis- based quadruple regimen as first line treatment for penicillin aller- muth-containing quadruple treatment (Pylera®) to eradicate gic patients with Helicobacter pylori infection. Zhonghua Yi Xue Za Helicobacter pylori infection in 200 patients. Rev Esp Enferm Dig. Zhi. 2019;99(20):1536-1540. 2019;111(6):467-470. 82. Song C, Qian X, Zhu Y, et al. Effectiveness and safety of fu- 66. Nyssen OP, McNicholl AG, Gisbert JP. Meta-analysis of three-in- razolidone-containing quadruple regimens in patients with one single capsule bismuth-containing quadruple therapy for the Helicobacter pylori infection in real-world practice. Helicobacter. eradication of Helicobacter pylori. Helicobacter. 2019;24(2):e12570. 2019;24(4):e12591. 67. Ciccaglione AF, Cellini L, Marzio L. Pylera® plus ranitidine vs 83. Inatomi N, Matsukawa J, Sakurai Y, Otake K. Potassium- Pylera® plus esomeprazole in first-line treatment of Helicobacter competitive acid blockers: advanced therapeutic option for ac- pylori infection: two pilot studies. Helicobacter. 2019;24(5):e12606. id-related diseases. Pharmacol Ther. 2016;168:12-22. 68. Alcedo J, Gracia M, García-Cámara P, et al. Prospective compara- 84. Kagami T, Sahara S, Ichikawa H, et al. Potent acid inhibition by vono- tive study between two first-line regimens for Helicobacter pylori prazan in comparison with esomeprazole, with reference to CYP2C19 eradication: Non-bismuth quadruple versus bismuth quadruple genotype. Aliment Pharmacol Ther. 2016;43(10):1048-1059. therapy. Gastroenterol Hepatol. 2020;43(6):301–309. 85. Sakurai Y, Mori Y, Okamoto H, et al. Acid-inhibitory effects of vo- 69. Kim SJ, Chung JW, Woo HS, et al. Two-week bismuth-contain- noprazan 20 mg compared with esomeprazole 20 mg or rabepra- ing quadruple therapy and concomitant therapy are effective zole 10 mg in healthy adult male subjects - a randomised open-label first-line treatments for Helicobacter pylori eradication: a pro- cross-over study. Aliment Pharmacol Ther. 2015;42(6):719-730. spective open-label randomized trial. World J Gastroenterol. 86. Murakami K, Sakurai Y, Shiino M, Funao N, Nishimura A, Asaka M. 2019;25(46):6790-6798. Vonoprazan, a novel potassium-competitive acid blocker, as a com- 70. Choi YI, Chung JW, Park DK, et al. Tailored eradication vs empirical ponent of first-line and second-line triple therapy for Helicobacter bismuth-containing quadruple therapy for first-line Helicobacter pylori eradication: a phase III, randomised, double-blind study. Gut. pylori eradication: a comparative, open trial. World J Gastroenterol. 2016;65(9):1439-1446. 2019;25(46):6743-6751. 87. Kanizaj TF, Kunac N Helicobacter pylori: future perspectives in ther- 71. Chen Q, Long X, Ji Y, et al. Randomised controlled trial: suscep- apy reflecting three decades of experience. World J Gastroenterol. tibility-guided therapy versus empiric bismuth quadruple therapy 2014;20(3):699-705. for first-line Helicobacter pylori treatment. Aliment Pharmacol Ther. 88. Ashida K, Honda Y, Sanada K, Takemura Y, Sakamoto S. The safety 2019;49(11):1385-1394. and effectiveness of vonoprazan-based Helicobacter pylori eradi- 72. Zhang L, Lan Y, Wang Q, Zhang Y, Si X. Application of mino- cation therapy; a prospective post-marketing surveillance. Expert cycline-containing bismuth quadruple therapies as first-line Opin Drug Saf. 2019;18(12):1255-1261. O'CONNOR et al. | 9 of 9

89. Kusunoki M, Yuki M, Ishitobi H, et al. Effect of age on effective- 105. Zhou S, Yung Chan S, Cher Goh B, et al. Mechanism-based in- ness of vonoprazan in triple therapy for Helicobacter pylori eradi- hibition of cytochrome P450 3A4 by therapeutic drugs. Clin cation. Intern Med. 2019;58(11):1549-1555. Pharmacokinet. 2005;44(3):279-304. 90. Saito Y, Konno K, Sato M, et al. Vonoprazan-based third-line ther- 106. Eberl S, Renner B, Neubert A, et al. Role of p-glycoprotein inhibi- apy has a higher eradication rate against sitafloxacin-resistant tion for drug interactions: evidence from in vitro and pharmacoep- Helicobacter pylori. Cancers. 2019;11(1):116. idemiological studies. Clin Pharmacokinet. 2007;46(12):1039-1049. 91. Takara Y, Endo H, Nakano R, et al. Smoking and drinking did not increase 107. Spicer ST, Liddle C, Chapman JR, et al. The mechanism of cyclo- the failure of therapeutic Helicobacter pylori eradication by vono- sporine toxicity induced by clarithromycin. Br J Clin Pharmacol. prazan, clarithromycin, and amoxicillin. Digestion. 2019;99(2):172-178. 1997;43(2):194-196. 92. Lyu QJ, Pu QH, Zhong XF, Zhang J. Efficacy and safety of vono- 108. Recker MW, Kier KL. Potential interaction between clarithromycin prazan-based versus proton pump inhibitor-based triple therapy and warfarin. Ann Pharmacother. 1997;31(9):996-998. for Helicobacter pylori eradication: a meta-analysis of randomized 109. Landesman KA, Stozek M, Freeman NJ. Rhabdomyolysis associ- clinical trials. Biomed Res Int. 2019;2019:9781212. ated with the combined use of hydroxymethylglutaryl-coenzyme 93. Ierardi E, Losurdo G, Fortezza RF, Principi M, Barone M, Leo AD. A reductase inhibitors with gemfibrozil and macrolide antibiotics. Optimizing proton pump inhibitors in Helicobacter pylori treatment: Conn Med. 1999;63(8):455-457. Old and new tricks to improve effectiveness. World J Gastroenterol. 110. Greenblatt DJ, von Moltke LL, Harmatz JS, et al. Inhibition of triazolam 2019;25(34):5097-5104. clearance by macrolide antimicrobial agents: in vitro correlates and 94. Deguchi H, Uda A, Murakami K. Current status of Helicobacter py- dynamic consequences. Clin Pharmacol Ther. 1998;64(3):278-285. lori diagnosis and eradication therapy in Japan using a nationwide 111. Simko J, Csilek A, Karaszi J, Lorincz I. Proarrhythmic potential of database. Digestion. 2020;101(4):441–449. antimicrobial agents. Infection. 2008;36(3):194-206. 95. Shinmura T, Adachi K, Yamaguchi Y, et al. Vonoprazan-based 112. Sasaoka S, Matsui T, Hane Y, et al. Time-to-onset analysis of triple-therapy could improve efficacy of the tailored ther- drug-induced long QT syndrome based on a spontaneous reporting apy of Helicobacter pylori infection. J Gastrointestin Liver Dis. system for adverse drug events. PLoS One. 2016;11(10):e0164309. 2019;28(4):389-395. 113. Nakayoshi T, Izumi M, Tatsuta K. Effects of macrolide antibiotics 96. Sue S, Shibata W, Sasaki T, et al. Randomized trial of vono- on gastrointestinal motility in fasting and digestive states. Drugs prazan-based versus proton-pump inhibitor-based third-line triple Exp Clin Res. 1992;18(4):103-109. therapy with sitafloxacin for Helicobacter pylori. J Gastroenterol 114. Xie Y, Song C, Cheng H, et al. Long-term follow-up of Helicobacter Hepatol. 2019;34(4):686-692. pylori reinfection and its risk factors after initial eradication: a 97. Furuta T, Sugimoto M, Kodaira C, et al. The dual therapy with 4 large-scale multicentre, prospective open cohort, observational times daily dosing of rabeprazole and amoxicillin as the 3rd res- study. Emerg Microbes Infect. 2020;9(1):548-557. cue regimen for eradication of H pylori. Hepatogastroenterology. 115. Shi X, Zhang J, Mo L, Shi J, Qin M, Huang X. Efficacy and safety of 2010;57(102–103):1314-1319. probiotics in eradicating Helicobacter pylori: A network meta-anal- 98. Furuta T, Shirai N, Xiao F, et al. High-dose rabeprazole/amoxicil- ysis. Medicine. 2019;98(15):e15180. lin therapy as the second-line regimen after failure to eradicate 116. Muresan IAP, Pop LL, Dumitrascu DL Lactobacillus reuteri versus H pylori by triple therapy with the usual doses of a proton pump triple therapy for the eradication of Helicobacter pylori in func- inhibitor, clarithromycin and amoxicillin. Hepatogastroenterology. tional dyspepsia. Med Pharm Rep. 2019;92(4):352-355. 2003;50(54):2274-2278. 117. Dore MP, Bibbò S, Pes GM, Francavilla R, Graham DY. 99. Miehlke S, Kirsch C, Schneider-Brachert W, et al. A prospective, Role of probiotics in Helicobacter pylori eradication: les- randomized study of quadruple therapy and high-dose dual ther- sons from a study of Lactobacillus reuteri strains DSM 17938 apy for treatment of Helicobacter pylori resistant to both metroni- and ATCC PTA 6475 (Gastrus®) and a proton-pump inhibi- dazole and clarithromycin. Helicobacter. 2003;8(4):310-319. tor. Can J Infect Dis Med Microbiol. 2019;3409820. https://doi. 100. Shirai N, Furuta T. High dose dual PPI/AMPC therapy for the treat- org/10.1155/2019/3409820. [Epub ahead of print]. ment of Helicobacter pylori infection after failure of usual standard 118. Di Pierro F, Bertuccioli A, Saponara M, Ivaldi L. Impact of a triple PPI/AMPC/CAM therapy: CYP2C19 polymorphism. Nippon two-bacterial-strain formula, containing Bifidobacterium animalis Rinsho. 2002;60(Suppl 2):439-444. lactis BB12 and Enterococcus faecium L3, administered before and 101. Furuta T, Ohashi K, Kamata T, et al. Effect of genetic differences in after triple or quadruple therapy for Helicobacter pylori eradica- omeprazole metabolism on cure rates for Helicobacter pylori infection. Minerva Gastroenterol Dietol. 2020;66(2):117–123. tion and peptic ulcer. Ann Intern Med. 1998;129(12):1027-1030. 119. Cárdenas PA, Garcés D, Prado-Vivar B, et al. Effect of Saccharomyces 102. Furuta T, Shirai N, Takashima M, et al. Effects of genotypic dif- boulardii CNCM I-745 as complementary treatment of Helicobacter ferences in CYP2C19 status on cure rates for Helicobacter py- pylori infection on gut microbiome. Eur J Clin Microbiol Infect Dis. lori infection by dual therapy with rabeprazole plus amoxicillin. 2020;39(7):1365-1372. Pharmacogenetics. 2001;11(4):341-348. 103. Furuta T, Yamade M, Kagami T, et al. Dual therapy with vonoprazan and amoxicillin is as effective as triple therapy with vonoprazan, How to cite this article: O'Connor A, Furuta T, Gisbert JP, amoxicillin and clarithromycin for eradication of Helicobacter py- O'Morain C. Review – Treatment of Helicobacter pylori lori. Digestion. 2019;21:1-9. 104. Suzuki S, Gotoda T, Kusano C, et al. Seven-day vonoprazan and infection 2020. Helicobacter. 2020;25(Suppl. 1):e12743. low-dose amoxicillin dual therapy as first-line Helicobacter py- https://doi.org/10.1111/hel.12743 lori treatment: a multicentre randomised trial in Japan. Gut. 2020;69(6):1019-1026.

DOI: 10.1111/hel.12744

REVIEW ARTICLE

Review: Other Helicobacter species

Annemieke Smet1,2 | Armelle Menard3,4

1Laboratory of Experimental Medicine and Pediatrics, Faculty of Medicine and Health Abstract Sciences, University of Antwerp, Antwerp, This review covers the most important, accessible, and relevant literature published Belgium between April 2019 and April 2020 in the field of non-Helicobacter pylori Helicobacter 2Infla-Med Research Consortium of Excellence, University of Antwerp, Antwerp, species (NHPH). The initial part of the review covers new insights regarding the pres- Belgium ence of gastric and enterohepatic NHPH in humans and animals, while the subse- 3Univ. Bordeaux, INSERM, Bordeaux Research in Translational Oncology, quent section focuses on the progress in our understanding of animal models, the BaRITOn, UMR1053, Bordeaux, France pathogenicity and omics of these species. Over the last year, the clinical relevance 4 CHU de Bordeaux, Laboratoire de of gastric NHPH infections in humans was highlighted. With regard to NHPH in Bactériologie, Centre National de Référence des Campylobacters et des Hélicobacters, animals, the ancestral source of Helicobacter suis was further established showing Bordeaux, France that Cynomolgus macaques are the common ancestor of the pig-associated H. suis

Correspondence population, and 3 novel Helicobacter species isolated from the gastric mucosa of red Annemieke Smet, Laboratorium of foxes were described. "Helicobacter burdigaliensis" sp nov. and "Helicobacter labetoulli" Experimental Medicine and Pediatrics, Department of Translational Research in sp nov. were proposed as novel enterohepatic Helicobacter species associated with Immunology and Inflammation, Faculty of human digestive diseases. An analysis of Helicobacter cinaedi recurrent infections in Medicine and Health Sciences, University of Antwerp, Wilrijk (Antwerp), Belgium. humans proposed long-term antibiotic therapies. Several studies using rodent mod- Email: [email protected] els further elucidated the mechanisms underlying the development of NHPH-related disease, as well as intestinal immunity in inflammatory bowel disease models. Omics approaches supported Helicobacteraceae taxonomy and unraveled the transcriptomic signatures of H. suis and Helicobacter heilmannii upon adherence to the human gastric epithelium. With regard to virulence, data showed that the nuclear remodeling promoted by cytolethal distending toxin of Helicobacters involves the MAFB oncoprotein and is associated with nucleoplasmic reticulum formation in surviving cells.

KEYWORDS animal disease, animal models, genomics and evolution, human disease, non-Helicobacter pylori Helicobacter, pathogenesis

1 | PRESENCE OF NON-HELICOBACTER heilmannii. No mixed Helicobacter infections were found. The au- PYLORI HELICOBACTER SPECIES IN HUMANS thors further highlighted the importance of zoonotic H. heilmannii infections in humans and emphasised the clinical relevance to test A few articles describing the presence of gastric non-Helicobacter H. pylori-negative patients with gastric complaints for the presence pylori Helicobacter species (NHPH) in humans were published this of NHPH.1 Another report compared the clinicopathological char- year. Mohammadi et al investigated the association between NHPH acteristics and the presence of NHPH in different types of muco- infection and gastroduodenal diseases in Iran by comparing biopsy sa-associated lymphoid tissue (MALT) lymphoma.2 Although gastric samples from patients positive for H. pylori with those from H. pylo- MALT lymphomas are often associated with H. pylori infection, ri-negative subjects. Of the 70 H. pylori-negative patients (36%), half nodular gastritis-like MALT lymphomas seem to be typically linked of them had gastritis and 91% of them were positive for Helicobacter with NHPH and more specifically with Helicobacter suis infection,

Helicobacter. 2020;25(Suppl. 1):e12744. wileyonlinelibrary.com/journal/hel © 2020 John Wiley & Sons Ltd | 1 of 6 https://doi.org/10.1111/hel.12744 2 of 6 | SMET and MENARD in which eradication therapy may be the first-choice treatment.2 As included the use of steroids (75.0%) and immunosuppressant drugs NHPH are difficult to culture from the human stomach, diagnosis is (37.5%). Symptoms of H. cinaedi bacteraemia included colitis (37.5%) often based on microscopic examination and molecular analysis of and cellulitis (31.3%). MLST allowed the classification of the strains biopsies. Due to the scarce data regarding antimicrobial resistance into five clusters, but none of these clusters were related to clinical among NHPH, infected patients are usually treated with antibiot- symptoms, situations at onset, and prognosis. Helicobacter cinaedi ics, like clarithromycin. A report by Pichon et al described for the infection recurred in three of seven patients who underwent an- first time a mutation associated with clarithromycin resistance in tibiotic therapy for less than 10 days. Currently, no recommended an H. suis isolate from a 43-year-old obese woman who underwent guideline is available for the treatment of H. cinaedi bacteraemia. a gastric sleeve surgery. Histological analysis confirmed the pres- This study proposed a long-term antibiotic therapy, excluding cip- ence of atrophic gastritis with moderate intensity and the presence rofloxacin and clarithromycin, to ensure healing of symptoms and of spiral-shaped bacteria, ie H. suis. Eradication of this pathogen prevent recurrence.8 Another study investigated whether recurrent was successful with a metronidazole-based treatment. This study H. cinaedi infections are relapses of former infections or reinfections highlighted the benefit to use genotypic detection of resistance to with different clones.9 Ten colonies were isolated from the blood improve therapeutic management of NHPH infections.3 NHPH in- cultures of a 69-year-old woman during each of the two episodes fections can also be associated with the aggravation of extra-gas- of a recurrent H. cinaedi bacteraemia-associated cellulitis after a 51- tric manifestations, like neurodegenerative disorders. Augustin day interval. The AST of a representative isolate was tested against et al evaluated the pathological significance of H. suis in patients with 14 antimicrobials. Whole-genome sequencing (WGS) revealed six Parkinson's disease (PD). They concluded that this zoonotic agent, single-nucleotide polymorphisms (SNPs) among the 20 isolates but for which pigs and non-human primates are the natural reservoirs, is none of these SNPs was associated with additional antibiotic resis- associated with all-cause mortality in PD. Surprisingly, this phenom- tance. Based on the six SNPs detected, five genotypes were identi- enon was not seen for H. pylori.4 Another study investigated the role fied, all detected in the first infection. However, only two genotypes of a Helicobacter felis infection in the onset of Alzheimer's disease were detected in the second infection. WGS showed that the second using a mouse model. They showed that infection with this pathogen infection was a relapse of the first infection and highlighted the im- induced a severe gastritis and an increased neuroinflammation but portance of long-term antibiotic treatment to eradicate H. cinaedi to without brain amyloid deposition or systemic inflammation.5 prevent the recurrence of this difficult-to-treat infection.9 H. cinaedi Enterohepatic Helicobacter (EHH) infections have been asso- culture and identification are challenging. Matrix-assisted laser de- ciated with several diseases in humans such as acute gastroenteri- sorption ionisation-time of flight mass spectrometry (MALDI-TOF tis, inflammatory bowel disease (IBD) and hepatobiliary diseases. MS) is currently used in clinical practice and is efficient to identify Although they are frequently detected in clinical samples by mo- some Helicobacter species from humans, dogs, cats, and hamsters. lecular methods, these fastidious organisms are rarely isolated MALDI-TOF MS was successfully applied to 54 human clinical iso- by traditional culture technique, resulting in an underestimation lates to identify H. cinaedi. 10 of the prevalence and clinical importance of these pathogens. A study compared media and growth conditions for culturing EHH, ie Helicobacter canicola, Helicobacter apodemus, Helicobacter bilis, 2 | PRESENCE OF NON-HELICOBACTER Helicobacter canis, Helicobacter equorum and other Helicobacter PYLORI HELICOBACTER SPECIES IN species.6 Regardless of the use of hydrogen, Columbia or Brucella ANIMALS media can be used for the EHH isolation. All isolates were resistant to trimethoprim but the antibiotic concentrations included in com- Gruntar et al described three novel Helicobacter species isolated from mercial supplements for Campylobacter culture are suitable for EHH the gastric mucosa of red foxes shot by hunters in the surroundings culture.6 Among EHH, Helicobacter cinaedi is most frequently associ- of Ljubljana, Slovenia, for which the names Helicobacter labacensis sp ated with human diseases. Helicobacter cinaedi was primarily identi- nov., Helicobacter mehlei sp nov. and Helicobacter vulpus sp nov. have fied in bloodstream infections of immunocompromised patients and been proposed. The canine and feline Helicobacter bizzozeronii and is now becoming an emerging pathogen in humans, with an increas- Helicobacter baculiformis were the most closely related species.11 ing number of reported cases of infections. A case of ovarian abscess It was shown before that H. suis in pigs originates from non-hu- caused by H. cinaedi was reported this year in a 38-year-old nulli- man primates via a possible host jump from macaques to pigs gravid woman with endometriosis. Helicobacter cinaedi was isolated sometime between 100 000 and 15 000 years ago, after which do- from cultures of blood and ovarian abscess fluid after oophorectomy. mestication has had a significant impact on the spread of this patho- Eradication of H. cinaedi was performed successfully with intrave- gen among pigs. De Witte et al12 further unraveled the ancestral nous ampicillin/sulbactam for 2 weeks, followed by oral amoxicillin source of H. suis and concluded that Cynomolgus macaques but not for an additional 2 weeks.7 Multilocus sequence typing (MLST) and Rhesus macaques are the common ancestor of the pig-associated antimicrobial susceptibility testing (AST) of H. cinaedi were evalu- H. suis population.12 An article from the same research group per- ated among 16 successive H. cinaedi blood clinical isolates. The most formed AST among H. suis isolates from pigs and macaques using common risk factors associated with these H. cinaedi infections a combined agar and broth dilution method.13 Two porcine isolates SMET and MENARD | 3 of 6 showed acquired resistance to fluoroquinolones which was due to in driving inflammation. They demonstrated that interferon regula- the presence of SNPs in the gyrA gene. Furthermore, one porcine tory factor 5 (IRF5), a transcription factor playing a central role in isolate showed resistance to tetracycline, one porcine and two maintaining the inflammatory phenotype of macrophages, is a crit- primate isolates to lincomycin and one primate isolate to specti- ical regulator of macrophage inflammatory potential and that IRF5 nomycin. Minimum inhibitory concentrations (MICs) of ampicillin, deficiency improves immunopathology during H. hepaticus-induced tetracycline and doxycycline were also higher for porcine isolates colitis.17 Thus, IRF5 and molecules upstream of IRF5 may constitute from which SNPs were detected in genes encoding penicillin binding potential drug targets in the treatment of human IBD. A new mouse and ribosomal proteins. Based on this study, it should be noted that model of H. hepaticus-induced liver chronic hepatitis and fibrosis porcine isolates with a zoonotic importance may thus be intrinsically was described in male BALB/c mice. In this model, H. hepaticus-as- less susceptible to beta-lactam antibiotics and tetracyclines.13 sociated hepatic inflammation and fibrosis worsened over time and these liver injuries were triggered via the activation of NF-κB, JAK- STAT, and MAPK signaling pathways.18 Male BALB/c mice infected 3 | ANIMAL MODELS with H. hepaticus presented long-term high IL-33 mRNA and protein levels. Nucleocytoplasmic shuttling of IL-33 was also observed in Enterohepatic Helicobacter induce inflammation in rodents akin to response to H. hepaticus infection, which promoted chronic hepatic human IBD. Numerous immunocompetent or compromised murine inflammation and fibrosis via the IL-33/ST2 signaling pathway.19 models are used to study inflammation induced by EHH. A gnotobi- Helicobacter hepaticus promoted the expression of the IL-33 recep- otic model of H. bilis infection confirmed that this bacterium causes tor ST2 on cell surfaces, and the expression of ST2 then activated portal hepatitis in outbred Swiss Webster (SW) mice but stimulated NF-κB, STAT3, and MAPK signaling pathways. More importantly, gut-associated lymphoid tissue (GALT) with an anti-inflammatory IL-33 knockdown attenuated H. hepaticus-induced hepatic inflam- bias. Thus, H. bilis exhibits both anti- and pro-inflammatory effects mation and fibrosis. These findings provide novel insights into the on GALT that deserve to be further evaluated in mouse models of pathogenic mechanisms of H. hepaticus infection.19 Rag2-/- Sprague- human disease.14 Helicobacter saguini was first isolated in 1999 from Dawley rats infected with H. hepaticus was reported as a colitis a cotton-top tamarin, a rare non-human primate species, with a fam- model to examine the protective effect of galacto-oligosaccharides ily history of IBD. Infection of germfree IL-10-/- mice with H. saguini (GOS). GOS pre-treatment prevented Rag2−/− rats against diarrhoea is naturally transmissible from parent to offspring and associated and inflammation promoted by H. hepaticus infection. These ef- with multigenerational IBD.15 WGS of H. saguini among mouse gen- fects were concomitant with the recovery of body weight and colon erations showed that the bacterium undergoes genomic adaptation organ weight, the decline in the diarrhoea score, and inhibition of during multigenerational transmission and chronic colonisation in its the release of pro-inflammatory cytokines. All these effects were hosts, attested by microevolutions in environmental interaction, nu- impeded upon miR-19b silencing, demonstrating the anti-colitis ef- trient metabolism, and virulence factor genes. This suggests bacte- fect of GOS.20 Several studies previously investigated the role of rial adaptation and survival in new hosts and chronic inflammatory Helicobacter infection as a cofactor of hepatitis viruses in the de- environments. These findings highlight the possible importance of velopment of liver carcinoma in mice, leading to discrepant results. multigenerational transmissible pathogenic microbiota in the aeti- Indeed, hepatitis virus-induced tumourigenesis of hepatocellular opathogenesis of IBD in humans.15 Intestinal innate lymphoid cells carcinoma (HCC) could be aggravated by bacteria. Hepatitis B virus (ILCs) are a subset of immune cells, which maintain homeostasis and (HBV) transgenic C57BL/6 mice were infected with H. hepaticus to contribute to protective immunity. The interplay of ILCs and the mi- evaluate its hepatic carcinogenic effect.21 Compared with C57BL/6 crobiota in mucosal infections plays a determining role in intestinal and HBV-infected mice without neoplasm, H. hepaticus more often immunity. Bostick et al16 showed that enteric Helicobacter species colonised the lower colon of HBV-infected mice with HCC and promoted opposing effects on ILCs in immunocompromised mouse potentiated tumour formation in the liver. ILC-derived cytokines models. Both H. apodemus and Helicobacter typhlonius activated ILCs contribute to H. hepaticus-associated HCC development in HBV and induced gut inflammation, but negatively regulated prolifera- transgenic mice. Additional data showed that H. hepaticus infection tion of ILC3s (type 3 ILCs) involved in the innate immune response promoted a detrimental immune microenvironment via the IFN-γ/p- to extracellular pathogen and diminished their proliferative capac- STAT1 axis, which can induce tumourigenesis via HBV by recruiting ity. This dichotomous regulation of ILCs by Helicobacter species in innate lymphoid cells.21 immunocompromised mice constitutes a model for future investigations of the host-microbe interactions that maintain ILC3s in the intestine16 and opens new fields of investigation regarding the viru- 4 | PATHOGENESIS OF NON- lence factor(s) of these enteric Helicobacters that may influence the HELICOBACTER PYLORI HELICOBACTER maintenance of ILC3s in the intestine. INFECTIONS Natural infection of mice with Helicobacter hepaticus is probably the most currently used model of human IBD. Corbin et al used H. he- During the past year, further evidence has emerged regarding the paticus infection of mice to study the role of intestinal macrophages pathogenicity of NHPH. De Sousa et al evaluated the expression of 4 of 6 | SMET and MENARD

HER-2 in feline gastric epithelial cells infected with H. heilmannii. A for the host. Furthermore, they also highlighted that copper levels statistically significant association between H. heilmannii infection determine the outcome of infection.31 Finally, Hong et al developed and HER-2 expression in the lateral membrane of gastric surface a live-based cell assay based on, amongst others, Helicobacter mus- cells was noted. As H. heilmannii has a tropism for parietal cells as telae α1-2 fucosyltransferase to analyse host cell glycan-mediated well, HER-2 expression was also abundantly present in the plasma influenza virus infection. They highlighted that H. mustelae α1-2 fu- membrane of this cell type.22 Another study highlighted that long- cosyltransferase is a useful tool for this application.32 term H. suis infection in mice does not only induce gastric MALT Enterohepatic Helicobacter, such as Helicobacter pullorum and lymphoma, but also hepatic and pulmonary lymphoma. Furthermore, H. hepaticus, are associated with several intestinal and hepatic dis- they showed a relationship between substance P and the mainte- eases. Their main virulence factors are a type six secretion system nance of MALT lymphoma.23 A study by De Witte et al offered more (T6SS) and a cytolethal distending toxin (CDT). Helicobacter pullorum insight into the influence of a naturally acquired H. suis infection on is an emerging zoonotic pathogen that causes digestive diseases the microbiota of the non-glandular part of the porcine stomach and in humans ingesting contaminated meat. Haemolysin coregulated the pathogenic potential of Fusobacterium gastrosuis. Infection with protein (Hcp) plays a key role in the structure of the T6SS pilus and H. suis influenced the relative abundance of several taxa, whereas acts as effector protein in certain bacteria. The presence of the Hcp F. gastrosuis, which supports gastric ulceration, induced death of gas- gene was screened via PCR in H. pullorum isolated from 156 caeca tric and oesophageal epithelial cells.24 of broiler chickens, of which 29.7% possessed the T6SS gene. During Several other reports investigated the pathogenic role of host co-culture experiments, Hcp was not associated with hepatocyte factors in H. felis-induced gastric pathologies. The H. felis mouse cell death but with greater haemolytic activity of infected erythro- model remains a good and reproducible model to study host immune cytes.33 Further studies are required to characterise the importance responses to gastric Helicobacters, as well as to examine factors of T6SS and Hcp in the virulence of H. pullorum. that promote gastric carcinogenesis. Chonwerawong et al25 showed Cytolethal distending toxin is widespread among EHH H. hepati- that NLR family CARD domain containing 5 (NLRC5) is a negative cus CDT upregulates the MAFB gene encoding the MAFB transcrip- regulator of gastric inflammation and MALT lymphoma formation tion factor, as well as MAFB target genes. MAFB silencing changed by promoting B-cell lymphomagenesis during H. felis infection. Zhao the cellular response to CDT with the formation of narrower lamelli- et al highlighted the contribution of myeloid-derived suppressor podia, a reduction of the increase in nucleus size and the formation cells (MDSCs) and γδT17 cells in the development of H. felis-induced of less γH2AX foci, the biomarker for DNA double-strand breaks. gastric MALT lymphoma by dysregulating the immune balance. The These data, obtained in intestinal and hepatic cell lines, demonstrated myeloid differentiation factor Schlafen 4 (Slfn4) marks a subset of that the cellular and nuclear remodeling induced by Helicobacter gastric MDSCs during Helicobacter-induced spasmolytic polypep- CDT, produced by H. pullorum and H. hepaticus, involves the MAFB tide expressing metaplasia (SPEM).26 The study by Ding et al identi- oncoprotein.34 These authors unveiled that the nuclear remodeling fied gene products expressed by Slfn4-MDSCs and promoting SPEM. following DNA damage induced by CDT can be associated with the Moreover, they showed that MiR130b plays an essential role in sup- formation of deep cytoplasmic invaginations in the nucleoplasm of porting metaplastic transformation and MDSC function.27 El-Zaatari giant nuclei.35 The core of these structures, also known as nucle- et al demonstrated a novel function of absent in melanoma 2 (Aim2) oplasmic reticulum (NR), concentrates protein production machin- that regulates gastric metaplastic lesions via CXCL16-mediated ery of the cell, as well as controlling elements of protein turnover. CD8+ T cells during H. felis infection.28 Another study investigated Additional data showed that insulation and concentration of these how β-catenin signaling regulates the tumour immune microenvi- adaptive ribonucleoprotein particles within CDT-induced NR are dy- ronment in the stomach using a murine gastric cancer model estab- namic, transient, reversible and allow the cell to pause and repair 35 lished by H. felis. They showed that the β-catenin-CCL28-Treg cell the DNA damage caused by CDT in order to maintain cell survival. axis serves as an essential mechanism for immunosuppression of A new type of alanine dehydrogenase (ADH; EC.1.4.1.1) with 29 the gastric tumour microenvironment. NF-κB signaling plays an high pyruvate reduced activity was isolated from Helicobacter au- essential role during Helicobacter infection and malignant transfor- rati and expressed in Escherichia coli for further biochemical mation. Deficiency of the adaptor molecule myeloid differentiation characterisation.36 primary response 88 (MyD88), which signals via NF-κB, accelerates the development of gastric pathology. Mejias-Luque et al further investigated this phenotype. They showed that, in the absence of 5 | OMICS OF NON-HELICOBACTER PYLORI MyD88, H. felis infection enhances the activation of non-canonical HELICOBACTER SPECIES NF-κB that is associated with an increased expression of Cxcl9 and Icam1 and CD3+ lymphocyte recruitment. In addition, the absence The complete genome sequence of H. suis strain SNTW101c isolated of MyD88 induced STAT3 activation.30 Copper is essential for all from a patient with nodular gastritis was recently sequenced. The living organisms. A study by Esposito et al explored the effect of genome size was 1 680 021 bp comprising 1744 coding sequences deprivation on H. felis infection in mice. They showed that this bac- (CDSs), 5 ribosomal RNAs and a GC content of 40%. Two putative terium takes advantage of gastric copper, reducing the availability plasmids encoding 6 CDSs each were also identified. As suggested SMET and MENARD | 5 of 6 before, the main H. pylori virulence factors were absent indicating 9. Sawada O, Gotoh Y, Taniguchi T, et al. Genome sequencing verifies relapsed Infection of Helicobacter cinaedi. Open Forum Infect Dis. that other factors contribute to the pathogenicity of this zoonotic 2019;6:ofz200. 37 agent. Another study performed WGS to support Helicobacteraceae 10. Endo Y, Araoka H, Baba M, et al. Matrix-assisted laser desorption taxonomy. They showed that, a strain (CNRCH 2005/566H) isolated ionization-time of flight mass spectrometry can be used to identify in a faecal sample from a patient with a HCC and gastroenteritis, and Helicobacter cinaedi. Diagn Microbiol Infect Dis. 2020;96:114964. another strain (48 519) isolated in blood sample from a patient with 11. Gruntar I, Papić B, Pate M, Zajc U, Ocepek M, Kušar D Helicobacter labacensis sp. nov., Helicobacter mehlei sp. nov., and Helicobacter vul- bacteraemia represented novel EHH species for which the names pis sp. nov., isolated from gastric mucosa of red foxes (Vulpes vul- "Helicobacter burdigaliensis" and "Helicobacter labetoulli," respec- pes). Intl J System Evol Microbiol. 2020;70:2395-2404. tively, were proposed.38 12. De Witte C, Berlamont H, Smet A, Ducatelle R, Haesebrouck Berlamont et al gained more insights into the interactions of the F. Rhesus macaques are most likely the ancestral source of Helicobacter suis infection in pigs and not Cynomolgus macaques. zoonotic H. suis and H. heilmannii species with the human gastric ep- Helicobacter. 2020;25(3):e12689 https://doi.org/10.1111/ ithelium by unraveling their transcriptomic signatures upon adher- hel.12689 ence. The differentially expressed genes of H. suis and H. heilmannii 13. Berlamont H, Smet A, De Bruykere S, et al. Antimicrobial suscepti- upon adherence belonged to multiple functional classes, indicat- bility pattern of Helicobacter suis isolates from pigs and macaques. Vet Microbiol. 2019;239:108459. ing that adhesion of both species to the gastric epithelium evoked 14. Whary MT, Wang C, Ruff CF, et al. Effects of colonization of gno- pleiotropic adaptive responses. Furthermore, the authors concluded tobiotic Swiss Webster mice with Helicobacter bilis. Comp Med. that distinct pathways are involved in human gastric colonisation of 2020;70:216-232. H. suis and H. heilmannii.39 15. Mannion A, Shen Z, Feng Y, et al. Natural transmission of Helicobacter saguini causes multigenerational inflammatory bowel Wastewater is a continuous source for agricultural irrigation. disease in C57/129 IL-10-/- mice. mSphere. 2020;5(2):e00011-20. Poor management prior to water reuse may cause risks for the envi- https://doi.org/10.1128/mSphere.00011-20 ronment but might also negatively impact human health. Hortelano 16. Bostick JW, Wang Y, Shen Z, et al. Dichotomous regulation of group et al investigated the presence of pathogens in wastewater samples 3 innate lymphoid cells by nongastric Helicobacter species. Proc Natl Acad Sci USA. 2019;116:24760-24769. using metagenomic approaches. They unveiled the presence of 17. Corbin AL, Gomez-Vazquez M, Berthold DL, et al. IRF5 guides bacteria belonging to the Helicobacter genus. More specifically, the monocytes toward an inflammatory CD11c + macrophage phe- molecular techniques used in this study identified the presence of notype and promotes intestinal inflammation. Sci Immunol. H. pylori, H. suis, H. pullorum and H. hepaticus DNA in wastewater 2020;5:eaax6085. samples, even after disinfectant treatment.40 18. Cao S, Zhu C, Feng J, et al. Helicobacter hepaticus infection induces chronic hepatitis and fibrosis in male BALB/c mice via the activation of NF-κB, Stat3, and MAPK signaling pathways. Helicobacter. DISCLOSURES OF INTERESTS 2020;25:e12677. The authors declare no conflict of interests. 19. Cao S, Zhu L, Zhu C, et al. Helicobacter hepaticus infection-induced IL-33 promotes hepatic inflammation and fibrosis through ST2 signaling pathways in BALB/c mice. Biochem Biophysl Res Comm. REFERENCES 2020;525:654–661. 1. Mohammadi M, Talebi Bezmin Abadi A, Rahimi F, Forootan M 20. Sun J, Liang W, Yang X, Li Q, Zhang G. Cytoprotective effects of Helicobacter heilmannii colonization is associated with high risk for galacto-oligosaccharides on colon epithelial cells via up-regulating gastritis. Arch Med Res. 2019;50:423-427. miR-19b. Life Sci. 2019;231:116589. 2. Takigawa H, Masaki S, Naito T, et al. Helicobacter suis infec- 21. Han X, Huang T, Han J. Cytokines derived from innate lymphoid tion is associated with nodular gastritis-like appearance of gas- cells assist Helicobacter hepaticus to aggravate hepatocellular tum- tric mucosa-associated lymphoid tissue lymphoma. Cancer Med. origenesis in viral transgenic mice. Gut Pathog. 2019;11:23. 2019;8:4370-4379. 22. de Sousa DA, da Silva KVGC, Cascon CM, et al. Epidermal 3. Pichon M, Broutin L, Touroult-Jupin P, et al. First detection in growth factor receptor 2 immunoexpression in gastric cells Helicobacter suis of a mutation conferring resistance to clarithromy- of domestic cats with H. heilmannii infection. Acta Histochem. cin in Helicobacter pylori : case report and review of the literature. 2019;121(4):413–418. Microb. Drug Resist. 2020;26:677-680. 23. Nakamura M, Kodama Y, Øverby A, et al. Helicobacter heilmannii in- 4. Augustin AD, Savio A, Nevel A, et al. Helicobacter suis is associated fection in mouse induced not only gastric, but hepatic and pulmonary with mortality in Parkinson’s disease. Front Med. 2019;6:188. MALT lymphoma: relation to substance P. CPD. 2020;26(25):3039– 5. Albaret G, Sifré E, Floch P, et al. Alzheimer’s disease and 3045. https://doi.org/10.2174/13816128266662004241 63506 Helicobacter pylori infection: Inflammation from stomach to brain? 24. De Witte C, Demeyere K, De Bruyckere S, et al. Characterization JAD. 2020;73:801-809. of the non-glandular gastric region microbiota in Helicobacter su- 6. Ochoa S, Martínez OA, Fernández H, Collado L. Comparison is-infected versus non-infected pigs identifies a potential role for of media and growth conditions for culturing enterohepatic Fusobacterium gastrosuis in gastric ulceration. Vet Res. 2019;50:39. Helicobacter species. Lett Appl Microbiol. 2019;69:190-197. 25. Chonwerawong M, Ferrand J, Chaudhry HM, et al. Innate immune 7. Sato H, Ogino A, Matsuzaka S, et al. Ovarian abscess caused by molecule NLRC5 protects mice from Helicobacter-induced forma- Helicobacter cinaedi in a patient with endometriosis. IDCases. tion of gastric lymphoid tissue. Gastroenterology. 2020;159(1):169– 2019;17:e00578. 182.e8. 8. Nukui Y, Chino T, Tani C, et al. Molecular epidemiologic and clinical 26. Zhao Y, Lu F, Ye J, et al. Myeloid-derived suppressor cells and γδT17 analysis of Helicobacter cinaedi bacteremia in Japan. Helicobacter. cells contribute to the development of gastric MALT lymphoma in H 2020;25(1):e12675. https://doi.org/10.1111/hel.12675 felis-infected mice. Front Immunol. 2020;10:3104. 6 of 6 | SMET and MENARD

27. Ding L, Li Q, Chakrabarti J, et al. MiR130b from Schlafen4 + MDSCs ribonucleoprotein nuclear invaginations in surviving cells. PLoS stimulates epithelial proliferation and correlates with preneoplastic Pathog. 2019;15:e1007921. changes prior to gastric cancer. Gut. 2020; gutjnl-2019-318817. 36. Hu X, Bai Y, Fan T-P, Zheng X, Cai Y. A novel type alanine dehy- 28. El-Zaatari M, Bishu S, Zhang M, et al. Aim2-mediated/IFN-β–inde- drogenase from Helicobacter aurati: molecular characterization and pendent regulation of gastric metaplastic lesions via CD8+ T cells. application. Int J Biol Macromol. 2020;161:636–642. JCI Insight. 2020;5:e94035. 37. Rimbara E, Suzuki M, Matsui H, et al. Complete genome se- 29. Ji L, Qian W, Gui L, et al. Blockade of β-catenin–induced CCL28 quence of Helicobacter suis strain SNTW101c, originally isolated suppresses gastric cancer progression via inhibition of Treg cell in- from a patient with nodular gastritis. Microbiol Resour Announc. filtration. Cancer Res. 2020;80:2004-2016. 2020;9(1):e0134019. https://doi.org/10.1128/MRA.01340-19 30. Mejías-Luque R, Lozano-Pope I, Wanisch A, Heikenwälder M, 38. Berthenet E, Bénéjat L, Ménard A, et al. Whole-genome sequencing Gerhard M, Obonyo M. Increased LIGHT expression and acti- and bioinformatics as pertinent tools to support Helicobacteracae vation of non-canonical NF-κB are observed in gastric lesions of taxonomy, based on three strains suspected to belong to novel MyD88-deficient mice upon Helicobacter felis infection. Sci Rep. Helicobacter species. Front Microbiol. 2019;10:2820. 2019;9:7030. 39. Berlamont H, De Witte C, Bauwens E, et al. Distinct transcrip- 31. Esposito R, Vllahu M, Morello S, et al. Low copper availability limits tome signatures of Helicobacter suis and Helicobacter heilmannii Helicobacter infection in mice. FEBS J. 2020;287(14):2948-2960. strains upon adherence to human gastric epithelial cells. Vet Res. 32. Hong S, Shi Y, Wu NC, et al. Bacterial glycosyltransferase-mediated 2020;51:62. cell-surface chemoenzymatic glycan modification. Nat Commun. 40. Hortelano I, Moreno Y, Moreno-Mesonero L, Ferrús MA. Deep- 2019;10:1799. amplicon sequencing (DAS) analysis to determine the presence of 33. Javed K, Gul F, Abbasi R, et al. Prevalence and role of Type six pathogenic Helicobacter species in wastewater reused for irrigation. secretion system in pathogenesis of emerging zoonotic patho- Environm Poll. 2020;264:114768. gen Helicobacter pullorum from retail poultry. Avian Pathol. 2019;48:557-563. 34. Péré-Védrenne C, He W, Azzi-Martin L, et al. The nuclear remod- How to cite this article: Smet A, Menard A. Review: Other eling induced by Helicobacter cytolethal distending toxin involves Helicobacter species. Helicobacter. 2020;25(Suppl. 1):e12744. MAFB oncoprotein. Toxins (Basel). 2020;12:174. 35. Azzi-Martin L, He W, Péré-Védrenne C, et al. Cytolethal dis- https://doi.org/10.1111/hel.12744 tending toxin induces the formation of transient messenger-rich

DOI: 10.1111/hel.12745

European Helicobacter and Microbiota Study Group

EHMSG – 33rd International Workshop on Helicobacter & Microbiota in Inflammation & Cancer

Virtual Conference September 12, 2020

Accepted Abstracts

The European Helicobacter and Microbiota Study Group: President

Georgina Hold, Australia Local Scientific and Organising Committee Pentti I. Sipponen, Finland Anthony Axon, Leeds, UK Torkel M. Wadström, Sweden Members and International Francesco Boccellato, Oxford, UK Scientific Committee Jan Bornschein, Oxford, UK Honorary Members Leif P. Andersen, Denmark Barry Campbell, Liverpool, UK Franco Bazzoli, Italy Lars Engstrand, Sweden Gauri Godbole, London, UK James G. Fox, United States Antonio Gasbarrini, Italy Richard Hansen, Glasgow, UK David Y. Graham, United States Javier P. Gisbert, Spain Pali Hungin, Newcastle, UK Adrian Lee, Australia Josbert Keller, The Netherlands Marnix Jansen, London, UK Barry Marshall, Australia Marcis Leja, Latvia Kenneth McColl, Glasgow, UK Guido N.J. Tytgat, The Netherlands José C. Machado, Portugal Mark Pritchard, Liverpool, UK Ernst Kuipers, The Netherlands Peter Malfertheiner, Germany Karen Robinson, Nottingham, UK Francis Mégraud, France Corresponding Fellows Colm A. O'Morain, Ireland Emeritus Members Niyaz Ahmed, India Mirjana Rajilic-Stojanovic, Serbia Anthony Axon, United Kingdom Dmitry Bordin, Russia Ari P. Ristimäki, Finland Michel A.L. Deltenre, Belgium Luis G. Vaz Coelho, Brazil Theodore Rokkas, Greece Bram Flahou, Belgium Jae Gyu Kim, Korea Annemieke Smet, Belgium Giovanni Gasbarrini, Italy Varocha Mahachai, Thailand Herbert Tilg, Austria Alexander M. Hirschl, Austria Yaron Niv, Israel Pierre Michetti, Switzerland Chun-Ying Wu, Taiwan José M. Pajares Garcia, Spain Yoshio Yamaoka, Japan Ashley B. Price, United Kingdom Weicheng You, China Erik A.J Rauws, The Netherlands

Table of contents

Electronic Poster Presentations 3 Electronic Poster Round 1: Diagnosis of Helicobacter infection 3 Electronic Poster Round 2: Treatment of Helicobacter infection 6 Electronic Poster Round 3: Gastric cancer 49 Electronic Poster Round 4: Helicobacter infection – pathogenesis and host response 60 Electronic Poster Round 5: Epidemiology 69 Electronic Poster Round 6: Microbiology and genomics of Helicobacter 73 Electronic Poster Round 7: Helicobacter and extragastroduodenal disease 78 Electronic Poster Round 8: Paediatric conditions 83 Electronic Poster Round 9: Upper GI microbiota in health and disease 87 Electronic Poster Round 10: Gut microbiota and non-intestinal disease 88 Electronic Poster Round 11: Microbiota and intestinal disease 90 Electronic Poster Round 12: Microbiota and cancer 92 Electronic Poster Round 13: Gut microbiota manipulation 93 Electronic Poster Round 14: Microbiota detection and analyses 94 Author Index 96 Keyword Index 102

Conflict of interest declarations: In order to help readers form their own judgments of potential bias in published abstracts, authors are asked to declare any competing financial interests. Contributions of up to EUR 10.000.-(or equivalent value in kind) per year per entity are considered “Modest”. Contributions above EUR 10.000.-per year are considered “Significant”. Missing abstracts within the consecutive presentation numbers represent withdrawn papers. ABSTRACTS | 3 of 95

ABSTRACTS

ELECTRONIC POSTER the UK. “Test-and-Treat” strategy with UBT has comparable cost- PRESENTATIONS effectiveness outcomes to the strategy utilising SAT. D.M. Pritchard: F. Consultant/Advisory Board; Modest; Mayoly ELECTRONIC POSTER ROUND 1: Spindler Laboratories. J. Bornschein: F. Consultant/Advisory Board; DIAGNOSIS OF HELICOBACTER INFECTION Modest; Mayoly Spindler Laboratories. I.L.P. Beales: F. Consultant/ Advisory Board; Modest; Mayoly Spindler Laboratories. H. Salhi: EP1.01 | “Test-and-treat” strategy with urea breath test: A A. Employment (full or part-time); Modest; Mayoly Spindler cost-effective approach for the management of Helicobacter pylori- Laboratories. A. Beresniak: F. Consultant/Advisory Board; Modest; related dyspepsia and the prevention of peptic ulcer in the United Mayoly Spindler Laboratories. P. Malfertheiner: F. Consultant/ Kingdom-results of the Hp-Breath initiative Advisory Board; Modest; Mayoly Spindler Laboratories.

D. M. Pritchard1; J. Bornschein2; I. L. P. Beales3; H. Salhi4; A. Beresniak5; P. Malfertheiner6,7 EP1.02 | Comparative estimation of results of the new selective 1Institute of Translational Medicine, University of Liverpool, Liverpool, rapid urease test and detection of H. pylori in stool: A pilot study United Kingdom; 2Translational Gastroenterology Unit John Radcliffe Hospital Oxford University, Oxford, United Kingdom; 3Department of N. V. Baryshnikova1,2; Y. P. Uspenskiy1,3; A. N. Suvorov2; M. A. Gastroenterology, Norfolk and Norwich University Hospital, Norwich, Dmitrienko4 United Kingdom; 4Mayoly Spindler Laboratories, Chatou, France; 1Pavlov First St-Petersburg State Medical University, St-Petersburg, 5Data Mining International, Geneva, Switzerland; 6Department of Russian Federation; 2Institute of Experimental Medicine, St-Petersburg, Gastroenterology, Hepatology and Infectious Diseases, Otto-von- Russian Federation; 3Pediatric State St-Petersburg Medical University, Guericke University Hospital, Magdeburg, Germany; 7Department of St-Petersburg, Russian Federation; 4Association of Medicine and Medicine II, University Hospital, LMU, Munich, Germany Analytic, St-Petersburg, Russian Federation

Background: Clinical data comparing strategies used for the man- Background: According to Maastricht-5, detection of H. pylori in stool agement of H. pylori-associated diseases are limited. In the UK, is one of the main recommended method in clinical practice. Also Stool Antigen Test (SAT) seems to be the most frequently used non- we know many rapid urease tests for diagnosis of Helicobacter pylori invasive test for H. pylori detection. Cost-effectiveness studies might (Hp) infection. It is fast, simple and cost-effective methods but effi- help to identify optimal strategies. cacy of them is different with some percent of false-positive results. Aim: To assess cost-effectiveness of the “Test-and-Treat” strategy We begin to use the new selective rapid urease test for selective with Urea Breath Test (UBT) versus other strategies, in patients with analysis of urease activity of H. pylori. H. pylori-associated dyspepsia and peptic ulcer in the UK. The Aim: Comparative estimation of results of the new selective Methods: Cost-effectiveness models compared four strategies: “Test- rapid urease test and detection of H. pylori in stool. and-Treat” including either UBT or SAT, “Endoscopy and Treat” and Materials and Methods: We investigated gastric biopsies from an- “Symptomatic Treatment”. Advanced simulations were performed over a trum and fecal samples of eight patients to compare efficacy of the 4 week time horizon for the endpoint “Probability of dyspepsia symptoms new selective rapid urease test (“Association of medicine and analyt- relief” and over 10 years for the “Probability of peptic ulcer avoided”. Models ics, Saint-Petersburg, Russia) and detection of H. pylori in stool by were developed according to UK routine medical practice and costs. enzyme immunoassay. Patients during at least 4 weeks before diag- Results: For the “Probability of dyspepsia symptoms relief” end- nostics did not take any medications (PPIs, antibiotics, antacids and point, “Test-and-Treat” strategies with either UBT or SAT were the bismuth), which could change the results of both tests. Statistical most cost-effective (respectively £459 and £452/success) versus processing was performed using the SPSS8.0 software package. “Endoscopy and Treat” and “Symptomatic Treatment” (respec- Results: Concordance of results the new selective rapid urease test tively £1,115 and £897/success). For the “Probability of peptic ulcer and detection of H. pylori in stool was 100%: 4 patient were H. pylori avoided” endpoint, “Test-and-Treat” strategies with either UBT or SAT positive and 4 patient – H. pylori negative by results of both tests. were also the most cost-effective (respectively £182 and £167/peptic Conclusion: The new selective rapid urease test shows the high con- ulcer avoided/year) versus “Endoscopy and Treat” and “Symptomatic cordance with results of detection of H. pylori in stool and can be Treatment” (respectively £625 and £568/peptic ulcer avoided/year). recommended as express invasive test for diagnostic of H. pylori in- Conclusion: “Test-and-Treat” strategies with either UBT or SAT are fection. Next studies are needed for further investigation of this test. the most cost-effective medical approaches for the management of N.V. Baryshnikova: None. Y.P. Uspenskiy: None. A.N. Suvorov: None. H. pylori-associated dyspepsia and the prevention of peptic ulcer in M.A. Dmitrienko: None. 4 of 95 | ABSTRACTS

EP1.03 | Screening for Helicobacter pylori infection and factor for it. Some studies suggest accuracy of the diagnostic tests is Clarithromycin resistance using real-time polymerase chain decreased in PU bleeding. The international guidelines are vague on reaction the method of testing in the setting of acute peptic ulcer bleeding. However, detection of H. pylori would be essential as it reduces the M. Kovacheva-Slavova1; H. Valkov1; T. Angelov1; R. Tropcheva2; B. risks of untoward outcomes. Vladimirov1 Aims: Our aim was to update the most recent meta‐analysis which 1Department of Gastroenterology, University Hospital Tsaritsa included studies until 2006 and to assess the accuracy of one or a Ioanna-ISUL, Medical University-Sofia, Sofia, Bulgaria; 2Department combination of more diagnostic tests for H. pylori in patients with of Biotechnology, Faculty of Biology, Sofia University “St. Kliment bleeding peptic ulcer. Ohridski”, Sofia, Bulgaria Methods: A comprehensive literature search was carried out from inception to November 2019 to perform a network meta-analysis. Background: Helicobacter pylori (H. pylori) infection is spread world- We collected the raw data of diagnostic tests such as true positive, wide and affects at least half of the world's population. Infected peo- true negative, false positive and false negative values. All statisti- ple are at increased risk of several diseases development including cal calculations performed by R programming language using anova gastric adenocarcinoma. arm-based model by Nyaga et al., 2018. We ranked the methods, Aims: The aim of this study was to screen patients with dyspeptic index tests according to the diagnostic odds ratio and/or superiority symptoms for H. pylori infection and assess Clarithromycin resist- index. ance prevalence among the infected patients. Results: We analyzed 7 arbitrary gold standards in 7 network against Methods: Screening for H. pylori infection was performed in all pa- single and combination of diagnostic tests. None of the calculated tients using molecular test based on real-time polymerase chain re- superiority indices proved that any of the tests have better diagnos- action (RT-PCR) in feces after RNA-DNA extraction. Stool samples tic accuracy than the individual index tests. from all participants were collected 1-3 days after patients’ hospi- Conclusion: The results from are extensive network metaanalysis talization. The positive results were furthermore assessed for con- showed that none of the current diagnostic tests for H. plyori are firmation by breath test and stool antigen test. By point mutations better or worse in the diagnosis of the infection in the context of detection in 23S rRNA gene was possible to detect Clarithromycin peptic ulcer bleeding. resistance. Statistical analysis was performed via SPSS 22.0. N. Vörhendi: None. P. Hegyi: None. B. Erőss: None. Results: This study enrolled 50 patients (18 males) at mean age 46.46 ± 15.10 years. Using molecular test based on RT-PCR in feces we identified H. pylori infection in 24 patients (48.00%). EP1.05 | Helicobacter pylori screening in patients with acute Clarithromycin resistance was observed in 7 of them (29.17%). None myocardial infarction of those patients was eradicated before. There was no significant difference by age and gender between infected and non-infected R. Hofmann; J. Wärme; M. Sundqvist; K. Mars; L. Aladellie; M. Bäck patients. Gastrointestinal symptoms were more often reported in Karolinska Institutet, Stockholm, Sweden infected patients (P = 0.02). The molecular test showed 85.71% sensitivity and 100% specificity, with a diagnostic accuracy of 92.00%. Introduction: Potent antithrombotic therapy has significantly im- Conclusions: H. pylori screening by molecular test based on RT-PCR proved prognosis for patients with acute myocardial infarction in feces might be beneficial as the test's accuracy is high and include (MI), however, at a price of increased bleeding risk. Chronic gastric Clarithromycin resistance assessment, which could improve the out- infection with Helicobacter pylori (HP) commonly causes upper gas- come of eradication therapy. trointestinal bleeding and is proposed as a risk factor for MI. The M. Kovacheva-Slavova: None. H. Valkov: None. T. Angelov: None. R. prevalence of Hp in a current MI population and the feasibility of Hp Tropcheva: None. B. Vladimirov: None. screening as part of routine clinical care are unclear. Aims & Methods: In this multicenter, open-label, clinical trial, all patients admitted for acute MI during the study period were eligible for EP1.04 | Accuracy of the Helicobacter pylori diagnostic tests in enrollment. After written informed consent patients were tested for patients with peptic ulcer bleeding- The results of a network meta- Hp infection with a bedside urea breath test (UBT [Mayoly Spindler]) analysis incorporated into routine care during the hospitalization period. Results: 274 consecutive MI patients (median age 67 years, 24% N. Vörhendi; P. Hegyi; B. Erőss women) were enrolled. Overall, the HP prevalence was 20% (95% CI, Institute for Translational Medicine, Medical School, Pécs, Pécs, 15.5-25.3). The proportion of proton pump inhibitors (PPi) users was Hungary significantly higher in Hp negative compared to Hp positive patients (38% vs 16%; P = 0.003). After censoring of the 93 subjects with Introduction: Peptic ulcer (PU) being the most frequent source of PPi exposure preceding the UBT, the HP prevalence was 25%. After gastrointestinal bleeding and Helicobacter pylori is a main etiologic adjusting for age and sex, smoking was found to be significantly ABSTRACTS | 5 of 95 associated with testing positive compared with negative for HP (33% Y. Han: None. W. Dai: None. F. Meng: None. X. Gan: None. M. Liu: vs 20%, P = 0.03). None. X. Deng: None. Y. Li: None. G. Wang: None. Conclusion: Hp is highly prevalent in a contemporary MI population. Hp screening in the setting of acute MI was found to be feasible. A future randomized trial is needed to determine if routine Hp screen- EP1.07 | Implementation of the program of the Scientific ing and subsequent eradication therapy improves bleeding compli- Society of Gastroenterologists of Russia “Physicians without cations, cardiovascular outcomes, and ultimately, prognosis. helicobacteriosis” in Chita R. Hofmann: C. Other Research Support (supplies, equipment, receipt of drugs or other in-kind support); Modest; Mayoly Spindler E. Luzina1; L. Lazebnik2; N. Lareva1; N. Chartorizhskaya1; A. generously supported the diagnostics in this study, but had no role in Dutova1 the design of this study, data collection or interpretation of results. 1Chita State Medical Academy, Chita, Russian Federation; 2Moscow . J. Wärme: None. M. Sundqvist: None. K. Mars: None. L. Aladellie: State University of Medicine and Dentistry named after A. I. Evdokimov, None. M. Bäck: C. Other Research Support (supplies, equipment, re- Moscow, Russian Federation ceipt of drugs or other in-kind support); Modest; Mayoly Spindler generously supported the diagnostics in this study, but had no role in Objective: To identify the prevalence of Helicobacter pylori (HP) in the design of this study, data collection or interpretation of results.. doctors in Chita, morphological changes in gastric mucosa, carry out eradication treatment and assess its effectiveness, to determine HP resistance to clarithromycin. EP1.06 | Diagnosis of Helicobacter pylori infection in the elderly Materials and Methods: 70 doctors were examined. НР antigen in by immunochromatographic assay-based stool antigen test feces was determined by immunochromatographic method before and 6-8 weeks after the end of eradication treatment. In 27 biopsy Y. Han; W. Dai; F. Meng; X. Gan; M. Liu; X. Deng; Y. Li; G. Wang specimens of the gastric mucosa HP DNA and mutations A2142G, Chinese PLA General Hospital, Beijing, China A2143G, T2717C in the bacterial genome were determined. 29 biopsies of the stomach mucous membrane from 5 points for histological Background: The diagnostic role of Helicobacter pylori stool antigen examination and evaluation by OLGA system were taken. (HpSA) test in elderly subjects remains unclear. The objective of this Results: A positive result of AG HP in feces was recorded in 71.4% study was to assess the diagnostic accuracy of immunochromato- doctors. The efficiency of eradication treatment was 72.7% (table). graphic assay-based HpSA test in a male elderly cohort and to iden- During histological examination there was a high degree of inflam- tify factors that may affect the accuracy. mation in stomach mucosa, indicating high risk of erosive complica- Materials and Methods: Data of asymptomatic elderly male citizens tions in the majority of doctors (86.1%). Different stages of atrophy (≥65 years old) who conducted health check at Chinese PLA General were detected in 89.6%. Type III colonic metaplasia was detected in Hospital between July 2007 and November 2018, were collected. 6 (20.7%) people. One doctor demonstrated intraepithelial indefinite Diagnostic accuracy of HpSA test was determined using 13C-urea neoplasia. In 10 biopsies (37%) A2142G, A2143G mutations in the breath test as reference standard. Baseline comorbidities were ana- HP genome, ensuring its resistance to clarithromycin, were revealed. lyzed for factors which were associated with the accuracy of HpSA Mutations of T2717C were not determined. test. Conclusion: Doctors in Chita demonstrate a high level of HP infec- Results: 316 participants were enrolled, 193 in the pre-treatment tion, insufficient eradication treatment effectiveness, high level of group (77.2 ± 7.8 years old) and 123 in the post-treatment group genotypic HP resistance to clarithromycin, increased prevalence of (78.7 ± 8.3 years old). High accuracy (91.5%, 91.2% and 91.9%) and precancerous changes in gastric mucosa. specificity (97.6%,98.7% and 96.0%) were obtained in all, pre- and post-treatment groups respectively. However, the sensitivity was Treatment regimen Patients, n Efficiency, % only 68.7%, 65.1% and 75.0%, respectively. In the pre-treatment Esomeprazole, bismuth tripotassium dicitrate, probiotic group, constipation was associated with decreased sensitivity (76.7% Amoxicillin vs 38.5%, P = 0.039), while colorectal polyps with increased sensi- Clarithromycin 30 73 tivity (45.0% vs 82.6%, P = 0.010). Multivariate analysis indicated Josamycin 4 100 that constipation (OR = 0.115, 95% CI: 0.020-0.666) and colorectal Levofloxacin 3 100 polyps (OR = 9.095, 95% CI: 1.656-49.955) were independent factors Tetracycline for the sensitivity of HpSA in the pre-treatment group. Metronidazole 7 43 Conclusions: Immunochromatographic assay-based HpSA test achieved high accuracy, with high specificity but suboptimal sensi- E. Luzina: None. L. Lazebnik: None. N. Lareva: None. N. tivity in this elderly male cohort. Constipation was negatively while Chartorizhskaya: None. A. Dutova: None. colorectal polyps was positively associated with HpSA sensitivity in pre-treatment group. 6 of 95 | ABSTRACTS

EP1.08 | “Helicobacter pylori and mast cells in the mucous for 15 seconds, washed with PBS and the sections were enclosed in membrane of the stomach” an anti-fluorescent mounting medium. Stained micropreparations of the stomach were studied with a ZEISS Axio Imager.A2 microscope. N. Samodurova; D. Atiakshin Results: Localization of HP in the gastric mucosa led to an increase Voronezh State Medical University named after N. N. Burdenko, in the number of mast cells, their frequent colocalization with spiral Voronezh, Russian Federation bacteria, increased expression of tryptase and activation of its secretory pathways with the development of biological effects. Relevance: Mast cells are able to regulate the state of the gastric mu- Conclusion: Immunomorphological approaches provide new molec- cosa using mediators with high activity. Despite the obvious patho- ular aspects of the features of the interaction of mast cells and HP, genetic role of mast cells in the development of gastritis induced expanding the interpretation of the mechanisms of the formation of by H. pylori (HP), the features of their functional and morphological a pro-inflammatory background, the characteristics of immunogen- co-localization in the gastric mucosa are still poorly understood. esis and remodeling of the own plate of the gastric mucosa. Materials and Methods of Research: The biopsy samples of the N. Samodurova: None. D. Atiakshin: None. stomach of patients infected with H. pylori were studied, followed by analysis of the results of immunohistochemical staining. Results: The test material showed a high correlation between the ELECTRONIC POSTER ROUND 2: abundance of mast cells and HP in the stomach mucosa. We noted TREATMENT OF HELICOBACTER INFECTION frequent co-localization of tryptase+-mast cells with HP within paracrine influences the biological effects of specific proteases. EP2.01 | Quality assessment of meta-analyses: Probiotics and Situations of direct contact of mast cells with HP cluster loci are par- eradication of Helicobacter pylori infection ticularly important. Activation of mast cell secretory pathways into a specific tissue gastric environment of patients infected with HP was G. M. Buzás; J. Józan also observed. An issue is also the resistance of the mucosa to HP in Ferencváros Health Service Non-Profit Ltd, Budapest, Hungary the presence of mast cells. Conclusion: The study is a step forward in understanding the mech- Background: Meta-analyses are believed to represent the highest anisms of HP infection progression. HP in the gastric mucosa leads level of medical evidence (Grade A). to an increase in mast cell tryptase expression, increased inflamma- Aim: To assess the quality of meta-analyses published on the effect tion and the development of biological effects of specific proteases. of adding probiotics to eradication regimens for Helicobacter pylori N. Samodurova: None. D. Atiakshin: None. infection. Methods: The full text of meta-analyses regarding the effect of probiotics on the eradication rates of regimens given for Helicobacter EP1.09 | “Immunomorphological aspects of evaluating the pylori infection were retrieved from MEDLINE and Google Scholar interaction of mast cells and Helicobacter pylori in the stomach databases. The methodological and reporting quality were deter- muсous” mined using the Assessment of Multiple Systematic Reviews-2 (AMSTAR 2) questionnaire. The correlation between the AMSTAR N. Samodurova; D. Atiakshin score as a dependent variable and the number of authors, number Voronezh State Medical University named after N. N. Burdenko, of databases used, impact factor and citation rate as independent Voronezh, Russian Federation variables was calculated. The rate of using the PRISMA checklist, PROSPERO registration and evidence grading was also noted. Relevance: Morphological identification of Helicobacter pylori (HP) Results: The literature search produced 20 meta-analyses published in the gastric mucosa, including coccal forms of the spiral bacterium, between 2007 and 2019. The mean AMSTAR score was 15.7 ± 0.74 helps to verify the diagnosis and refine the prognosis of the disease. (95% CI: 14.1-17.3), corresponding to a moderate quality. There The use of multiple immunomarking technology opens up new pros- was no correlation between number of authors (r = 0.20, P = 0.39), pects for the informative value of histochemical analysis due to the impact factor (r = 0.18, P = 0.47), number of databases searched possibility of simultaneous identification of HP and mast cells. (r = 0.02, P = 0.91), number of studies included (r = 0.03, P = 0.89), Materials and Methods: Rabbit monoclonal antibodies (# ab172611, number of cases studied (r = 0.04, P = 0.86) and the AMSTAR score. dilution 1:500) were used as primary antibodies for immunohisto- The PRISMA checklist was used in 5 studies (25%), and no research chemical staining of HP, and mast cell tryptases were murine mono- protocol was registered in PROSPERO. The grading of evidence was clonal antibodies (# ab2378, dilution 1: 3000). Goat Anti-Mouse IgG explicitly stated only in 8 (40%) publications. H&L antibodies (# ab97035) conjugated with Alexa Fluor 488 and Conclusions: Meta-analyses published so far on the proposed topic Goat Anti-Rabbit IgG H&L antibodies (# ab150077) conjugated with are of rather moderate quality. Meta-analysis methodology must be Cy3 were used as secondary antibodies in multiple immunomark- improved to obtain more conclusive data on use of probiotics. ing. Next, the nuclei were stained with DAPI (5 μg/mL PBS; Sigma) G.M. Buzás: None. J. Józan: None. ABSTRACTS | 7 of 95

EP2.02 | Rifabutin triple therapy for first-line and rescue registry on H. pylori management (Hp-EuReg). H. pylori-infected treatment of Helicobacter pylori infection: A systematic review and patients were included from 2013 to March 2020. Data collected meta-analysis included demographics, clinical data, diagnostic tests, previous eradication attempts, current treatment, compliance, adverse events and Y. Niv; R. Gingold-Belfer; Z. Levi; D. Boltin treatment outcome. Rabin Medical Center, Petah Tikva, Israel Results: In total, 242 patients were registered including 121 (50%) who received first-line therapy, of whom 41% received clarithromy- Background: Due to the increasing resistance of H. pylori there is a cin based triple therapy and 58.9% received a four-drug regimen. The need for novel antibiotic treatment protocols. overall effectiveness of first-line therapy was 85% and 86% by modi- Aims: To perform a meta-analysis of clinical trials in order to deter- fied intention-to-treat and per protocol analyses, respectively. The mine the effectiveness and safety of rifabutin triple therapy for H. effectiveness of both sequential and concomitant therapies were pylori infection. 100% while clarithromycin-based triple therapy achieved an eradica- Methods: We selected prospective clinical trials with a treatment tion rate of 79%. Treatment eradication was higher among patients arm consisting of proton pump inhibitor, amoxicillin and rifabutin, who received high dose PPI compared to those treated with low dose and a recorded outcome measure. PPI (100% vs 81.5% respectively, P < 0.01). No difference in treat- Results: Thirty-three studies including 44 data sets were included. ment effectiveness was found between 7, 10 and 14-day treatment. The pooled eradication success for rifabutin triple therapy was Conclusion: The effectiveness of clarithromycin-based triple ther- 73.2% (95% CI 0.710-0.753) and the pooled OR for rifabutin tri- apy is suboptimal. First-line treatment of H. pylori infection should ple therapy vs control was 1.40 (95% CI 1.103-1.775, I2 = 73.55, consist of four drugs, including high doses PPI, in accordance with P = 0.006). Treatment was more likely to be successful when given international guidelines. first line vs rescue (82.4% vs 71.3%, P = 0.0001), in Asian vs non- D. Boltin: None. Z. Beniashvili: None. A. Lahat: None. J. Hirsch: Asian populations (81.0% vs 72.4% P = 0.001) and when drug dose or None. O.P. Nyssen: None. F. Mégraud: None. C. O'Morain: None. J.P. duration were augmented (80.6% vs 66.0% P = 0.0001). The overall Gisbert: None. Y. Niv: None. event rate for adverse effects was 25.3% (95% CI 0.23-0.28) and the pooled OR for adverse effects in the treatment vs control group was 0.79 (95% CI 0.57-1.09, I2 = 61.58, P = 0.15). EP2.04 | Eradication rate of Helicobacter pylori infection in Conclusion: Rifabutin is a relatively safe and effective option for Chinese duodenal ulcer patients treated with Vonoprazan 20 mg first-line and rescue treatment for H. pylori infection in adults. versus Lansoprazole 30 mg with bismuth containing quadruple Y. Niv: None. R. Gingold-Belfer: None. Z. Levi: None. D. Boltin: None. therapy

J. Wang1; X. Hou2; F. Meng3; W. Sha4; L. Gu5; K. Kudou6; L. Dong7; EP2.03 | European registry on Helicobacter pylori management L. Xie7; S. Zhang3 (Hp-EuReg): First-line therapy in Israel 1China-Japan Union Hospital, Jilin University, Changchun, China; 2Huazhong University of Science and Technology, Wuhan, China; D. Boltin1; Z. Beniashvili1; A. Lahat2; J. Hirsch3; O. P. Nyssen4; F. 3Beijing Friendship Hospital, Capital Medical University, Beijing, Mégraud5; C. O'Morain6; J. P. Gisbert4; Y. Niv1 China; 4Guangdong General Hospital (Guangdong Academy of Medical 1Rabin Medical Center, Petah Tikva, Israel; 2Chaim Sheba Medical Sciences), Guangdong Geriatrics Institute, Guangdong, China; 5Takeda Center, Ramat Gan, Israel; 3Meir Medical Center, Kefar Sava, Israel; Development Center Asia, Shanghai, China; 6Takeda Pharmaceutical 4Hospital Universitario de La Princesa, Instituto de Investigación Company, Osaka, Japan; 7Takeda Pharmaceutical Company, Beijing, Sanitaria Princesa (IIS-IP), Universidad Autónoma de Madrid, and China Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd), Madrid, Spain; 5Laboratoire de Bactériologie, Background: Vonoprazan shows superior healing of erosive oe- Hôpital Pellegrin, Bordeaux, France; 6Department of Clinical Medicine, sophagitis than lansoprazole. However, the clinical efficacy of vono- Trinity College Dublin, Dublin, Ireland prazan in eradicating Helicobacter pylori (Hp) infection in Chinese patients with duodenal ulcers (DU) is not established. Background: The antibiotic resistance profile of H. pylori is con- Methods: This phase 3, multicentre, randomised, double-blind, double- stantly changing. Up-to-date and reliable data for the effectiveness dummy study aimed to demonstrate non-inferiority of vonoprazan of first-line H. pylori treatments protocols for are necessary in order (20 mg) to lansoprazole (30 mg) in treating subjects with DU (strati- to provide evidence-based best-practice guidelines. fied by Hp status). Eradication of Hp was the secondary end point. Objectives: We aimed to determine the effectiveness, compliance Hp-positive patients received drugs twice daily for the first 2 weeks and safety of first-line treatment for H. pylori in Israel. in addition to bismuth-containing quadruple therapy. Hp eradication Methods: An observational, prospective, multicenter study was car- status was assessed using 13C-Urea Breath Test. Hp eradication rates ried out in tertiary referral centers in Israel, as part of the European (%) and 2-sided 95% confidence intervals were calculated along with 8 of 95 | ABSTRACTS eradication rate difference between the groups. Non-inferiority margin (Table 1). Incidence of treatment-emergent adverse events was com- was 10%. parable between the groups. Results: Totally, 433 Hp-positive Chinese patients with DU were Conclusion: Vonoprazan was non-inferior to lansoprazole when randomised to vonoprazan (N = 215) and lansoprazole (N = 218), of used in quadruple combination therapy for Hp eradication, with simi- which 394 were available for evaluation at 4 weeks post-treatment. lar safety profiles; however, vonoprazan-based quadruple therapy is Baseline characteristics were comparable between the 2 groups. clinically meaningful with a Hp eradication rate of more than 90% in Hp eradication rate was 91.5% and 87.6% in vonoprazan and lan- Chinese patients with DU. soprazole groups, respectively, with a treatment difference of 4.0%

TABLE 1. Percentage of Hp-positive patients with successful Hp eradication after 4 or 6 weeks of treatment

Vonoprazan+bismuth-containing Lansoprazole+bismuth-containing quadruple therapy* (N = 215) quadruple therapy*(N = 218)

Number of positive patients 201 193 Hp negative at 4 weeks post-treatment, (F-2 visit) n (%) 184 (91.5) 169 (87.6) Hp positive at 4 weeks post-treatment, (F-2 visit) n (%) 17 (8.5) 24 (12.4) 95% CI 86.804, 94.996 82.064, 91.867 Difference in eradication rate vs lansoprazole (%) 4.0 95% CI −2.062, 10.071 CI, confidence interval; Hp, Helicobacter pylori. F2: follow-up 4 weeks post-treatment*amoxicillin 1 g, clarithromycin 500 mg and bismuth potassium citrate/bismuth tripotassium dicitrate 600 mg

J. Wang: None. X. Hou: None. F. Meng: None. W. Sha: None. L. Gu: Methods: The European Registry on H. pylori Management (Hp- A. Employment (full or part-time); Modest; Takeda Development EuReg) collecting the data of H. pylori diagnostics, prescribed treat- Center Asia, Pte. Ltd. K. Kudou: A. Employment (full or part-time); ment and outcomes. Data from 2013 to 2019 were analysed. The Modest; Takeda Pharmaceutical Company Limited, Japan. L. eradication success was calculated using the modified intention-to- Dong: A. Employment (full or part-time); Modest; Takeda (China) treat (mITT) analysis. International Trading Co. Ltd. L. Xie: E. Ownership Interest (stock, Results: In total 1,408 patients from Lithuania were included in the stock options, patent or other intellectual property); Modest; Takeda Hp-EuReg. Overall, triple-therapy (proton pump inhibitor (PPI) + 2 (China) International Trading Co. Ltd. S. Zhang: None. antibiotics) was administered in 93.5% of the cases. For the first- line treatment, triple therapy with PPI, clarithromycin and amoxicillin (PPI+C+A) was prescribed in 93.6% of the cases. The most frequent EP2.05 | Helicobacter pylori eradication first- and second-line second-line treatment was combination of PPI, amoxicillin and levo- regimens prescriptions and effectiveness in Lithuania: Analysis floxacin (PPI+A+L) – in 57.1% of the cases. The frequencies of other from the European Registry on H. pylori Management (Hp-EuReg) combinations is presented in Table 1. The confirmation of H. pylori eradication was assessed only in 298 (21.2%) cases. The effective- L. Jonaitis1; L. Kupcinskas1; P. Jonaitis1; J. Kupcinskas1; I. Puig2; O. P. ness of first-line PPI+C+A regimen was 86.3% and of second-line Nyssen3; F. Megraud4; C. O'Morain5; J. P. Gisbert3; On behalf of the PPI+A+L regimen was 86.2%. The overall effectiveness of H. pylori Hp-EuReg Investigators treatments was 86.9%. 1Lithuanian University of Health Sciences, Kaunas, Lithuania; 2Althaia Conclusions: The number of cases with confirmatory tests post Xarxa Assistencial Universitària de Manresa and Universitat de Vic- treatment is extremely low. The effectiveness of most common Universitat Central de Catalunya, Manresa, Spain; 3Gastroenterology eradication regimens remains suboptimal. Unit, Hospital Universitario de La Princesa, Instituto de Investigación Sanitaria Princesa (IIS-IP), Universidad Autónoma de Madrid, Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBEREHD), Madrid, Spain; 4Laboratoire de Bactériologie, Hôpital Pellegrin, Bordeaux, France; 5Department of Clinical Medicine, Trinity College Dublin, Dublin, Ireland

Background: It is important to administer effective H. pylori eradication and perform testing for the eradication success. Aim: To evaluate the H. pylori treatment effectiveness in Lithuania with regards to Maastricht V guidelines. ABSTRACTS | 9 of 95

TABLE 1

No. of patients tested No. of patients % of all cases post-treatment mITT

H. pylori eradication regimen (first-line treatment) PPI+C+A 1,137 93.6% 234 86.3% PPI+C+A+B 27 2.2% 2 100% PPI+C+M 23 1.9% 7 100% PPI+A+M+B 7 0.6% 1 100% PPI+A+L+B 7 0.6% – – PPI+A+L 6 0.5% – – PPI+A+M 4 0.28% 2 100% PPI+A+C+T Sequential 1 0.08% 1 100% PPI+C+M+B 1 0.08% – – PPI+C+L 1 0.08% – – PPI+C+A+M 1 0.08% 1 100% H. pylori eradication regimen (second-line treatment) PPI+A+L 84 57.1% 29 86.2% PPI+C+A 18 12.2% 8 62.5% PPI+A+L+B 16 10.9% – – PPI+A+M 9 6.1% 3 100% PPI+A+M+B 7 4.8% – – PPI+C+M 4 2.7% 2 100% PPI+C+A+B 4 2.7% 1 100% PPI+A+C+T sequential 3 2% – – PPI+C+M+B 1 0.7% – – PPI+C+L+B 1 0.7% – – PPI, proton pump inhibitor; C, clarithromycin; A, amoxicillin; L, levofloxacin; M, metronidazole; T, tinidazole; B, bismuth; mITT, modified Intention-To-Treat.

L. Jonaitis: None. L. Kupcinskas: None. P. Jonaitis: None. J. Kupcinskas: None. I. Puig: None. O.P. Nyssen: None. F. Megraud: None. C. O'Morain: None. J.P. Gisbert: None. 10 of 95 | ABSTRACTS

EP2.06 | Helicobacter pylori eradication treatment in Lithuania Aim: To evaluate the trends of H. pylori eradication regimens and during 2013-2019: Trend analysis of the European Registry on duration in Lithuania. H. pylori management (Hp-EuReg) Methods: We analysed the data from the European Registry on H. pylori Management (Hp-EuReg) collected from 2013 to 2019. H. py- L. Jonaitis1; J. Kupcinskas1; G. Kiudelis1; P. Jonaitis1; R. Venciene2; lori eradication regimens were defined as triple or quadruple regi- L. Kupcinskas3; O. P. Nyssen4; I. Puig5; C. O'Morain6; F. Megraud7; J. mens and by length (7, 10 or 14 days). P. Gisbert4; On behalf of the Hp-EuReg Investigators Results: 1.408 patients were included. Between 2013 and 2019, 1Lithuanian University of Health Sciences, Kaunas, Lithuania; 2Alytus triple therapies were mostly prescribed. Most of the quadruple County S. Kudirkos Hospital, Alytus, Lithuania; 3Institute of Digestive therapies were introduced from 2018. (The bismuth introduced in research of Lithuanian University of Health sciences, Kaunas, Lithuania; the Lithuanian market only in 2018). The most common duration of 4Gastroenterology Unit, Hospital Universitario de La Princesa, Instituto treatment between the years 2013-2017 was 7 days however, since de Investigación Sanitaria Princesa (IIS-IP), Universidad Autónoma de 2018 the most common duration was 10-14 days. This could be in- Madrid, Centro de Investigación Biomédica en Red de Enfermedades fluenced by the Maastricht V guidelines in 2016 (7 days therapies Hepáticas y Digestivas (CIBEREHD), Madrid, Spain; 5Althaia Xarxa not recommended). The most commonly prescribed eradication reg- Assistencial Universitària de Manresa and Universitat de Vic- imen in Lithuania (PPI, clarithromycin and amoxicillin) for 7 days was Universitat Central de Catalunya, Manresa, Spain; 6Department of the preferred choice between 2013 and 2017; however, since 2015 Clinical Medicine, Trinity College Dublin, Dublin, Ireland; 7Laboratoire the number of 10-14 days duration treatments increased and was de Bactériologie, Hôpital Pellegrin, Bordeaux, France most frequent in 2018. The detailed data are in Table 1. Conclusions: Although triple therapy remains the most common Background: In recent years eradication of Helicobacter pylor is shift- treatment regimen in Lithuania, quadruple therapies have increased ing from triple to quadruple therapy and a treatment duration from since 2018. During the 2013-2019, a clear shift from 7 to 10 or 7 to 10-14 days. 14 days duration was observed.

TABLE 1

Year of visit and treatment duration by days

2013 2014 2015 2016 2017 2018 2019

Treatment regimen 7 10 14 7 10 14 7 10 14 7 10 14 7 10 14 7 10 14 7 10 14

Triple C+M 1 1 – 2 1 – 4 – – 3 3 – 2 1 – 1 2 2 3 – – Triple C+A 63 5 – 136 2 – 136 2 – 74 25 – 123 84 15 14 159 137 27 105 26 Triple A+L – 7 – 1 12 – 3 8 – 2 14 – 1 23 1 – 5 6 – 19 2 Triple A+M 2 – – 1 – – 1 – – 1 2 3 1 2 – Triple C+L 1 – – Seq A+C+T – 4 – – 1 – Quadruple C+A+M 1 – – Quadruple C+M+B – 1 – – 1 – Quadruple C+A+B – 2 18 – 7 6 Quadruple A+M+B – 4 2 – 7 3 Quadruple A+L+B – 1 12 – 4 18 Quadruple C+L+B – 1 – Triple Total 64 13 – 141 15 – 144 10 – 79 42 – 128 108 16 16 168 148 31 126 28 Quadruple Total 1 – – – 8 32 – 20 27

L. Jonaitis: None. J. Kupcinskas: None. G. Kiudelis: None. P. Jonaitis: None. R. Venciene: None. L. Kupcinskas: None. O.P. Nyssen: None. I. Puig: None. C. O'Morain: None. F. Megraud: None. J.P. Gisbert: None. ABSTRACTS | 11 of 95

EP2.08 | Current trend in the Helicobacter pylori eradication M. Joo: None. H. Song: None. K. Kim: None. C. Bang: None. H. Kim: rates of first-line sequential and concomitant therapies in Korea: A None. nationwide multicenter retrospective study over the 10 years

B. Kim1; B. Lee2; J. Kim3; J. Kim4; J. Chung5; S. Jeon6; J. Kim1; J. EP2.09 | Comparing efficacy of Helicobacter pylori eradication Lee7; J. Kim8; N. Kim9; J. Lee10; S. Seo11; S. Park12; S. Kim13; M. regimens: Bismuth containing quintet therapy vs moxifloxacin Joo14; H. Song15; K. Kim16; C. Bang17; H. Kim18 based sequential therapy as first-line eradication regimen 1The Catholic University of Korea, Incheon, Republic of Korea; 2Pusan National University, Busan, Republic of Korea; 3Yonsei University, Y. Kim1; D. Lee1,2; C. Shin1; H. Yoon1; Y. Park1; N. Kim1,2 Seoul, Republic of Korea; 4The Catholic University of Korea, Seoul, 1Department of Internal Medicine, Seoul National University Bundang Republic of Korea; 5Gachon University, Incheon, Republic of Korea; Hospital, Bundang, Republic of Korea; 2Department of Internal 6Kyungpook National University, Daegu, Republic of Korea; 7University Medicine Research Institute, Seoul National University College of of Ulsan, Seoul, Republic of Korea; 8Inje University, Busan, Republic Medicine, Seoul, Republic of Korea of Korea; 9Seoul National University, Bundang, Republic of Korea; 10Keimyung University, Daegu, Republic of Korea; 11Chonbuk National Background: We conducted this study to compare the efficacy of University, Jeonju, Republic of Korea; 12Chonnam National University, 7-day bismuth containing quintet therapy compared with 14-day Gwangju, Republic of Korea; 13Kosin University, Busan, Republic of moxifloxacin-based sequential therapy as a first-line eradication Korea; 14Korea University, Seoul, Republic of Korea; 15Jeju National treatment for Helicobacter pylori infection. University, Jeju, Republic of Korea; 16Chungbuk National University, Methods: This was a single-center, randomized trial. 179 patients Cheongju, Republic of Korea; 17Hallym University, Chuncheon, who diagnosed H. pylori infection by endoscopic biopsy between Republic of Korea; 18Gyeongsang National University, Jinju, Republic October 2015 and October 2019 randomly allocated to receive of Korea bismuth containing quintet (BCQT, n = 90) therapy for 7 days or moxifloxacin-based sequential (MBST, n = 89) therapy. To assess Background/Aims: Eradication rate of standard triple therapy for eradication of H. pylori Infection, we performed urea breath test 4 to H. pylori has declined to unacceptable level, and alternative regimens 6 weeks after the completion of each treatment. such as concomitant and sequential therapy have been introduced. Results: The eradication rates by intention-to-treat (ITT) analysis We aimed to assess the current trend of eradication rates of con- were 85.4% (76/89; 95% confidence interval [CI]: 76.0-91.7%) and comitant and sequential therapies as for the first-line H. pylori eradi- 93.3% (84/90; 95% CI: 85.5-97.3%) in the MBST and BCQT groups, cation in Korea. respectively (P = 0.069). The eradication rates by per-protocol (PP) Methods: A nationwide multicenter retrospective study was con- analysis were 88.5% (76/87; 95% CI: 78.1-93.2%) and 96.6% (84/87; ducted including 18 second or tertiary medical centers from January 95% CI: 89.5-99.1%) in the MBST and BCQT groups, respectively 2008 to December 2017. We included 3,940 adults who had test to (P = 0.025). The adverse event rate were 17.2% (15/87) and 10.3% confirm H. pylori eradication within 1 year after first-line concomitant (9/87) in the MBST and BCQT group, respectively (P < 0.05). or sequential therapy. Results: First-line concomitant and sequential Conclusions: The 7-day bismuth containing quintet therapy showed therapy was prescribed for 2,609 and 1,331 patients, respectively. better efficacy and lower adverse event rate compared to the The overall eradication rate of concomitant therapy was significantly 14-day moxifloxacin-based sequential therapy for eradication of higher than sequential therapy (91.6% vs 85.7%, P < 0.001). In time Helicobacter pylori infection. trend analysis, concomitant regimen also showed higher eradication rate from 2015 to 2017 with an increasing trend. Among 289 pa- TABLE 1. Helicobacter pylori eradication rates tients with first-line eradication failure, second-line bismuth-based BCQT MBST P-value quadruple therapy and quinolone-based triple therapy was given for ITT analysis 202 (69.9%) and 71 (24.6%) patients, respectively. Bismuth-based Eradication rate 93.3% (84/90) 85.4% (76/89) 0.069 quadruple therapy showed significant higher eradication rate than quinolone-based triple therapy. 95% CI 85.5-97.3% 76.0-91.7% Conclusion: Concomitant therapy was superior to sequential ther- PP analysis apy as the first-line H. pylori eradication, showing consistent higher Eradication rate 96.6% (84/87) 88.5% (76/87) 0.025 eradication rate with an increasing trend over the last 9 years. In 95% CI 89.5-99.1% 78.1-93.2% patients with eradication failure after concomitant or sequen- BCQT, 7-day bismuth containing quintet therapy; CI, confidence tial therapy, bismuth-based quadruple therapy is preferable than interval; ITT, intention-to-treat; MBST, 14-day moxifloxacin-based sequential therapy; PP, per-protocol. quinolone-based triple therapy in Korea. B. Kim: None. B. Lee: None. J. Kim: None. J. Kim: None. J. Chung: None. S. Jeon: None. J. Kim: None. J. Lee: None. J. Kim: None. N. Y. Kim: None. D. Lee: None. C. Shin: None. H. Yoon: None. Y. Park: Kim: None. J. Lee: None. S. Seo: None. S. Park: None. S. Kim: None. None. N. Kim: None. 12 of 95 | ABSTRACTS

25 EP2.10 | First-line H. pylori eradication therapy in Europe: Hospital, Timisora, Romania; Department of Gastroenterology, Results from 24,882 cases of the European Registry on H. pylori Hepatology & Nutrition, CHU Charleroi, Charleroi, Belgium; 26 Management (Hp-EuReg) Department of Gastroenterology, University Hospital of Split, School of Medicine, University of Split, Split, Croatia; 27Gastroenterology O. P. Nyssen1; D. Bordin2,3,4; B. Tepes5; A. Pérez-Aisa6; D. Vaira7; Unit, Medical Centre for Postgraduate Education, Warsaw, Poland; 28 M. Caldas1; L. Bujanda8; M. Castro-Fernandez9; F. Frode Lerang10; Gastroenterology Unit, Hospital de Basel, Basel, Switzerland; 29 M. Leja11; L. Rodrigo12; T. Rokkas13; L. Kupcinskas14; J. Pérez- Department of Gastroenterology, Hepatology and Infectious Lasala15; L. Jonaitis14; O. Shvets16; A. Gasbarrini17; H. Simsek18; A. Diseases, Otto-von-Guericke University Hospital, Magdeburg, 30 T. R Axon19; G. M. Buzás20; J. Machado21; Y. Niv22; L. Boyanova23; Germany; Department of Medicine, Zealand University Hospital, 31 A. Goldis24; V. Lamy25; A. Tonkic26; K. Przytulski27; C. Beglinger28; Copenhagen University, Copenague, Denmark; Gastroenterology M. Venerito29; P. Bytzer30; L. G. Capelle31; T. Milosavljevic32; V. and Hepatology, Erasmus MC University, Rotterdam, Netherlands; 32 Milivojevic32; L. Veijola33; J. Molina-Infante34; L. Vologzhanina35; Medical Department, Clinical Center of Serbia Clinic for G. Fadeenko36; I. Ariño37; G. Fiorini7; A. Garre1; J. Garrido38; C. F. Gastroenterology and Hepatology, University of Belgrade, Belgrade, 33 Pérez39; F. Heluwaert40; I. Puig41; F. Mégraud42; C. O'Morain43; J. P. Serbia; Internal Medicine, Herttoniemi Hospital, Helsinki, Finland; 34 Gisbert1; On behalf of the Hp-EuReg Investigators Gastroenterology, Hospital San Pedro de Alcantara, Caceres and 1Gastroenterology Unit, Hospital Universitario de La Princesa, Centro de Investigación Biomédica en Red de Enfermedades Hepáticas 35 Instituto de Investigación Sanitaria Princesa (IIS-IP), Universidad y Digestivas (CIBERehd), Madrid, Spain; Gastroenterology Unit 36 Autónoma de Madrid, and Centro de Investigación Biomédica en Gastrocentre, Perm, Russian Federation; Digestive Ukrainian 37 Red de Enfermedades Hepáticas y Digestivas (CIBERehd), Madrid, Academy of Medical Sciences, Kyiv, Ukraine; Gastroenterology Spain; 2Gastroenterolgy Unit, A. S. Loginov Moscow Clinical Scientific Unit, Hospital Clínico Universitario Lozano Blesa, Zaragoza, Spain; 38 Center, Moscow, Russian Federation; 3Department of Outpatient Departamento de Psicología Aplicada, Universidad Autónoma de 39 Therapy and Family Medicine, Tver State Medical University, Tver, Madrid, Madrid, Spain; Servicio de Medicina Preventiva, Hospital Russian Federation; 4Department of Propaedeutic of Internal Clínico San Carlos, Facultad de Enfermería, Universidad Complutense Diseases and Gastroenterology, Moscow, Russian Federation; de Madrid, Instituto de Investigación Sanitaria del Hospital Clínico San 40 5Gastroenterology Unit, AM DC Rogaska, Rogaska Slatina, Slovenia; Carlos (IdISSC), Madrid, Spain; Centre Hospitalier Annecy Genvois, 41 6Servicio de Gastroenterología, Agencia Sanitaria Costa del Sol, Red Pringy, France; Althaia Xarxa Assistencial Universitària de Manresa de Investigación en Servicios de Salud en Enfermedades Crónicas and Universitat de Vic-Universitat Central de Catalunya (UVicUCC), 42 (REDISSEC), Marbella, Spain; 7Department of Surgical and Medical Manresa, Spain; Laboratoire de Bactériologie, Hôpital Pellegrin, 43 Sciences, University of Bologna, Bologna, Italy; 8Department of Bordeaux, France; Department of Clinical Medicine, Trinity College Gastroenterology, Hospital Donostia/Instituto Biodonostia, Centro Dublin, Dublin, Ireland de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd), Universidad del País Vasco (UPV/EHU), Background: The best approach for Helicobacter pylori management San Sebastian, Spain; 9Digestive Unit, Hospital de Valme, Sevilla, remains unclear. An audit process is essential to ensure clinical prac- Spain; 10Medical Department, Central Hospital Ostfold, Fredrikstad, tice is aligned with best standards of care. Norway; 11Institute of Clinical and Preventive Medicine & Faculty Design: International multicentre prospective non-interventional of Medicine, University of Latvia, Riga, Latvia; 12Gastroenterology registry starting in 2013 aimed to evaluate the decisions and out- Unit, Hospital Universitario Central de Asturias, Oviedo, Spain; comes in H. pylori management by European gastroenterologists. 13Gastroenterology Unit, Henry Dunant Hospital, Athens, Greece; Patients were registered in an e-CRF by AEG-REDCap up to April 14Department of Gastroenterology, Lithuanian University of Health 2020. Variables included: demographics, previous eradication at- Sciences, Kaunas, Lithuania; 15Digestive Service, HM Sanchinarro, tempts, prescribed treatment, adverse events, and outcomes. Madrid. SPAIN, Madrid, Spain; 16Internal Diseases Department No. Modified intention-to-treat (mITT) and per-protocol (PP) analyses 1, National Medical University named after O.O. Bogomolets, Kyiv, were performed and data were subject to quality review to ensure Ukraine; 17Gastroenterology Area, Fondazione Policlinico Universitario information reliability. A. Gemelli, Rome, Italy; 18Internal Medicine/Gastroenterology Results: In total 36,319 patients from 29 European countries were department, Hacettepe University Faculty of Medicine, Ankara, Turkey; evaluated and 24,882 (70%) first-line empirical H. pylori treatments 19Gastroenterology Unit, University of Leeds, Leeds, United Kingdom; were included for analysis. Triple therapy with amoxicillin and 20Gastroenterology Unit, Ferencváros Policlinic, Budapest, Hungary; clarithromycin was most commonly prescribed (40%), followed by 21Instituto de Investigação e Inovação em Saúde, Universidade concomitant treatment (19%) and bismuth quadruple (Pylera®) (10%) do Porto, and Ipatimup – Institute of Molecular Pathology and achieving 83%, 91% and 95% mITT eradication rate, respectively. Immunology of the University of Porto, Porto, Portugal; 22Department Over 90% effectiveness was obtained only with 10 and 14-day bis- of Gastroenterology, Rabin Medical Center, Tel Aviv University, Petach muth quadruple or 14-day concomitant treatment (Table). Longer Tikva, Tel Aviv, Israel; 23Department of Medical Microbiology, Medical treatment duration, higher acid inhibition and compliance were as- University of Sofia, Sofia, Bulgaria; 24Gastroenterology Unit, Timisoara sociated with higher eradication rates. ABSTRACTS | 13 of 95

Conclusions: Management of H. pylori infection by European gastroenterologists is heterogeneous. Only quadruple therapies lasting at least 10 days are able to achieve over 90% eradication rates.

TABLE 1. Effectiveness (by modified intention-to-treat and per-protocol analyses) of first-line empirical treatments in Europe

First-line treatment Length (days) mITT, N (%) 95% CI PP, N (%) 95% CI

Triple-C+A 7 1,903 (83) 81-84 1,886 (83) 81-85 10 3,057 (83) 82-85 3,015 (84) 82-85 14 2,264 (89) 88-90 2,238 (89) 88-91 Triple-A+M 7 118 (81) 74-89 117 (81) 74-89 10 163 (85) 79-90 161 (85) 79-91 Triple-C+M 7 724 (84) 82-87 721 (85) 82-87 10 114 (65) 56-74 112 (66) 57-75 14 80 (70) 59-81 80 (70) 59-81 Triple-A+L 7 178 (79) 72-85 176 (78) 72-85 10 142 (85) 79-91 136 (86) 80-92 Sequential-C+A+M/T 10 596 (83) 80-86 556 (85) 82-88 Quadruple-C+A+M/T 10 2,378 (88) 87-90 2,316 (89) 88-90 14 2,228 (93) 92-94 2,180 (93) 92-94 Quadruple-C+A+B 10 394 (86) 82-89 390 (86) 83-90 14 1,194 (91) 89-93 1,178 (91) 90-93 Quadruple-M+Tc+B 10 130 (94) 89-98 130 (94) 89-98 Pylera® (M+Tc+B) 10 2,267 (95) 94-96 2,223 (95.5) 95-96 A, amoxicillin; B, bismuth salts; C, clarithromycin; L, levofloxacin; M, metronidazole; mITT, modified intention-to-treat; PP, per-protocol; T, tinidazole; Tc, tetracycline.

O. P. Nyssen: None. D. Bordin: None. B. Tepes: None. A. Pérez-Aisa: None. D. Vaira: None. M. Caldas: None. L. Bujanda: None. M. Castro- Fernandez: None. F. Frode Lerang: None. M. Leja: None. L. Rodrigo: None. T. Rokkas: None. L. Kupcinskas: None. J. Pérez-Lasala: None. L. Jonaitis: None. O. Shvets: None. A. Gasbarrini: None. H. Simsek: None. A. T. R Axon: None. G. M. Buzás: None. J. Machado: None. Y. Niv: None. L. Boyanova: None. A. Goldis: None. V. Lamy: None. A. Tonkic: None. K. Przytulski: None. C. Beglinger: None. M. Venerito: None. P. Bytzer: None. L. G. Capelle: None. T. Milosavljevic: None. V. Milivojevic: None. L. Veijola: None. J. Molina-Infante: None. L. Vologzhanina: None. G. Fadeenko: None. I. Ariño: None. G. Fiorini: None. A. Garre: None. J. Garrido: None. C. F. Pérez: None. F. Heluwaert: None. I. Puig: None. F. Mégraud: None. C. O'Morain: None. J.P. Gisbert: None. 14 of 95 | ABSTRACTS

EP2.11 | Room for improvement in the treatment of Helicobacter 1) To use the standard triple therapy where it is ineffective (46%). 2) pylori infection: Lessons from the European Registry on H. pylori To prescribe eradication therapy for only 7-10 days (69%) (Table 1). Management (Hp-EuReg) 3) To use a low dose of proton pump inhibitors (48%) (Table 2). 4) In patients allergic to penicillin, to prescribe always a triple therapy O. P. Nyssen1; D. Vaira2; B. Tepes3; L. Kupcinskas4; D. Bordin5; Á. with clarithromycin and metronidazole (38%). 5) To repeat certain Pérez-Aisa6; A. Gasbarrini7; M. Castro-Fernández8; L. Bujanda9; antibiotics after eradication failure (>15%). 6) To ignore the im- A. Garre1; A. Lucendo10; L. Vologzhanina11; N. Brglez Jurecic12; L. portance of compliance with treatment (2%). 7) Not to check the Rodrigo-Sáez13; J. Huguet14; I. Voynovan5; J. Jorge Perez Lasala15; eradication success (6%). Time-trend analyses showed progressive P. Mata Romero16; M. Vujasinovic17; R. Abdulkhakov18; J. Barrio19; greater compliance with current clinical guidelines. L. Fernandez-Salazar20; L. Jonaitis4; M. Espada1; F. Mégraud21; C. Conclusion: The management of H. pylori infection by European O'Morain22; J. P. Gisbert1; On behalf of the Hp-EuReg Investigators gastroenterologists is heterogeneous, frequently suboptimal and 1Gastroenterology Unit, Hospital Universitario de La Princesa, discrepant with current recommendations. Clinical practice is con- Instituto de Investigación Sanitaria Princesa (IIS-IP), Universidad stantly adapting to updated recommendations, although this shift is Autónoma de Madrid, and Centro de Investigación Biomédica en Red delayed and slow. de Enfermedades Hepáticas y Digestivas (CIBERehd), Madrid, Spain; 2Department of Surgical and Medical Sciences, University of Bologna, Bologna, Italy; 3Gastroenterology Unit, AM DC Rogaska, Rogaska Slatina, Slovenia; 4Department of Gastroenterology, Lithuanian University of Health Sciences, Kaunas, Lithuania; 5Department of pancreatobiliary and upper GI diseases, Moscow Clinical Scientific Center, and A.I. Yevdokimov Moscow State University of Medicine and Dentistry, Moscow, Russian Federation; 6Servicio de Gastroenterología, Agencia Sanitaria Costa del Sol, Red de Investigación en Servicios de Salud en Enfermedades Crónicas (REDISSEC), Marbella, Spain; 7Gastronterology Area, Fondazione Policlinico Universitario A. Gemelli, Rome, Italy; 8Digestive Unit, Hospital de Valme, Seville, Spain; 9Department of Gastroenterology, Hospital Donostia/ Instituto Biodonostia, Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd), Universidad del País Vasco (UPV/EHU), Donosti, Spain; 10Hospital de Tomelloso, Ciudad Real, Spain; 11Gastrocentre Perm, Perm, Russian Federation; 12Diagnostic Bled Centre, Bled, Slovenia; 13Gastroenterology Unit, Hospital Universitario Central de Asturias, Oviedo, Spain; 14Consorcio Hospital General Universitario, Valencia, Spain; 15Digestive Service, HM Sanchinarro, Madrid, Spain; 16Hospital San Pedro de Alcántara, Caceres, Spain; 17Slovenj Gradec General Hospital, Slovenj Gradec, Slovenia; 18Kazan State Medical University, Kazan, Russian Federation; 19Hospital Río Hortega, Valladolid, Spain; 20Hospital Clínico Universitario, Valladolid, Spain; 21Laboratoire de Bactériologie, Hôpital Pellegrin, Bordeaux Cedex, France; 22Trinity College Dublin – Faculty of Health Sciences, Trinity College Dublin, Dublin/IE, Faculty of Health Sciences, Dublin, Ireland

Background: Managing Helicobacter pylori infection requires constant decision-making, and each decision is open to possible errors. Aim: To evaluate common mistakes in the eradication of H. pylori, based on the European Registry on Helicobacter pylori management (Hp-EuReg). Methods: International multicentre prospective non-interventional registry evaluating the decisions and outcomes of H. pylori management by European gastroenterologists in routine clinical practice. Results: Countries recruiting over 1,000 patients were included (26,340 patients). The most common mistakes (percentages) were: ABSTRACTS | 15 of 95

TABLE 1. Use and effectiveness of 7, 10 and 14-day triple regimens in Europe

7 or 10 days 14 days

Mistake (%)1 mITT (%) 14-days use, N (%) mITT, N (%) 95% CI

Spain 71 71 1,429 (29) 1,297 (86) 83-87 Russia 63 77 984 (37) 790 (90) 88-92 Slovenia 62 85 1,070 (38) 722 (91) 89-93 Italy 93 84 28 (7) 21 (67) 43-85 Lithuania 84 75 182 (16) 1 (100) 1.3-99 Total 69 81 3,693 (31) 2,831 (88) 87-89 CI, confidence interval; mITT, modified intention-to-treat; N, total number of patients; PP, per-protocol. 1% of mistake accounted for 7 or 10 day- treatment durations.

TABLE 2. Acid inhibition potency of proton pump inhibitor use in triple regimens in Europe

Low, N % mistake1 95% CI Standard, N (%) 95% CI High, N 95% CI

Spain 1,368 41 39-42 1,223 (36) 35-38 782 (23) 22-25 Russia 1,173 56 54-58 754 (36) 34-38 169 (8) 6.8-9.2 Slovenia 1,385 52 50-54 50 (2) 1.3-2.4 1,241 (46) 44-48 Italy 106 85 78-91 14 (11) 5.3-17 5 (4) 1.3-9.1 Lithuania 480 46 43-49 326 (31) 28-34 234 (23) 20-25 Total 4,512 48 47-49 2,367 (25) 24-26 2,431 (26) 25-27 CI: confidence interval; Low dose: 4.5 to 27 mg omeprazole equivalents; Standard dose: 32 to 40 mg omeprazole equivalents; High dose: 54 to 128 mg omeprazole equivalents. 1% mistake accounted for all PPIs dose less than 32 mg omeprazole equivalent (as the PPI given twice daily).

O.P. Nyssen: None. D. Vaira: None. B. Tepes: None. L. Kupcinskas: Autónoma de Madrid, and Centro de Investigación Biomédica en Red None. D. Bordin: None. Á. Pérez-Aisa: None. A. Gasbarrini: None. de Enfermedades Hepáticas y Digestivas (CIBERehd), Madrid, Spain; M. Castro-Fernández: None. L. Bujanda: None. A. Garre: None. A. 2Gastroenterolgy Unit, A. S. Loginov Moscow Clinical Scientific Center, Lucendo: None. L. Vologzhanina: None. N. Brglez Jurecic: None. L. Moscow, ; 3Department of Outpatient Therapy and Family Medicine, Rodrigo-Sáez: None. J. Huguet: None. I. Voynovan: None. J. Jorge Tver State Medical University, Tver ; 4Department of Propaedeutic of Perez Lasala: None. P. Mata Romero: None. M. Vujasinovic: None. Internal Diseases and Gastroenterology, Moscow, Russian Federation; R. Abdulkhakov: None. J. Barrio: None. L. Fernandez-Salazar: None. 5Gastroenterology Unit, AM DC Rogask, Rogaska Slatina, Slovenia; L. Jonaitis: None. M. Espada: None. F. Mégraud: None. C. O'Morain: 6Servicio de Gastroenterología, Agencia Sanitaria Costa del Sol, Red None. J.P. Gisbert: None. de Investigación en Servicios de Salud en Enfermedades Crónicas (REDISSEC), Marbella, Spain; 7Department of Surgical and Medical Sciences, University of Bologna, Bologna, Italy; 8Department of EP2.12 | European Registry on H. pylori Management (Hp- Gastroenterology, Hospital Donostia/Instituto Biodonostia, Centro EuReg): Empirical first-line treatment use and effectiveness trends de Investigación Biomédica en Red de Enfermedades Hepáticas y in Europe in the period 2013-2020 Digestivas (CIBERehd), Universidad del País Vasco (UPV/EHU), San Sebastian, Spain; 9Digestive Unit, Hospital de Valme, Seville, Spain; O. P. Nyssen1; D. Bordin2,3,4; B. Tepes5; A. Pérez-Aisa6; D. Vaira7; M. 10Medical Department, Central Hospital Ostfold, Fredrikstad, Norway; Caldas1; L. Bujanda8; M. Castro-Fernandez9; F. Lerang10; M. Leja11; 11Institute of Clinical and Preventive Medicine & Faculty of Medicine, L. Rodrigo12; T. Rokkas13; L. Kupcinskas14; J. Pérez-Lasala15; L. University of Latvia, Riga, Latvia; 12Gastroenterology Unit, Hospital Jonaitis14; O. Shvets16; A. Gasbarrini17; H. Simsek18; A. R. T. Axon19; Universitario Central de Asturias, Oviedo, Spain; 13Gastroenterology G. M. Buzás20; J. Machado21; Y. Niv22; L. Boyanova23; A. Goldis24; V. Unit, Henry Dunant Hospital, Athens, Greece; 14Department of Lamy25; A. Tonkic26; K. Przytulski27; C. Beglinger28; M. Venerito29; Gastroenterology, Lithuanian University of Health Sciences, Kaunas, P. Bytzer 30; L. G. Capelle31; T. Milosavljevic32; L. Veijola33; J. Lithuania; 15Digestive Service, HM Sanchinarro, Madrid, Spain; Molina-Infante34; L. Vologzhanina35; G. Fadeenko36; I. Ariño37; G. 16Internal Diseases Department No. 1, National Medical University Fiorini7; A. Garre1; J. Garrido38; C. F. Pérez39; F. Heluwaert40; I. named after O.O. Bogomolets, Kyiv, Ukraine; 17Gastroenterology Area, Puig41; F. Mégraud42; C. O'Morain43; J. P. Gisbert1; On behalf of the Fondazione Policlinico Universitario A. Gemelli, Rome, Italy; 18Internal Hp-EuReg Investigators Medicine/Gastroenterology department, Hacettepe University Faculty 1Gastroenterology Unit, Hospital Universitario de La Princesa, of Medicine, Ankara, Turkey; 19Gastroenterology Unit, University of Instituto de Investigación Sanitaria Princesa (IIS-IP), Universidad Leeds, Leeds, United Kingdom; 20Gastroenterology Unit, Ferencváros 16 of 95 | ABSTRACTS

21 Policlinic, Budapest, Hungary; Instituto de Investigação e Inovação 2019/20, while Pylera® increased from 0-1% in 2014/2015 to 18% em Saúde, Universidade do Porto, and Ipatimup – Institute of in 2018/20. An increase in the average duration of treatments from Molecular Pathology and Immunology of the University of Porto, Porto, 10.9 days in 2013 to 12.0 in 2020, and of the daily dose of PPI was 22 Portugal; Department of Gastroenterology, Rabin Medical Center, identified. No trend was identified regarding the effectiveness of 23 Tel Aviv University, Petach Tikva, Tel Aviv, Israel; Department of each specific treatment (data now shown); however, an overall 5% Medical Microbiology, Medical University of Sofia, Sophia, Bulgaria; improvement in first-line mITT effectiveness was observed (Table 1). 24 Gastroenterology Unit, Timisoara Hospital, Timisora, Romania; Conclusions: European gastroenterological practice is constantly 25 Department of Gastroenterology, Hepatology & Nutrition, CHU adapting to the newest published evidence and recommendations 26 Charleroi, Charleroi, Belgium; Department of Gastroenterology, (reducing the use of triple therapies and increasing the duration of University Hospital of Split, School of Medicine, University of Split, Split, treatment and the dose of PPIs), with a subsequent improvement in 27 Croatia; Gastroenterology Unit, Medical Centre for Postgraduate overall effectiveness. Education, Warsaw, Poland; 28Gastroenterology Unit, Hospital de Basel, Basel, Switzerland; 29Department of Gastroenterology, Hepatology and Infectious Diseases, Otto-von-Guericke University Hospital, Magdeburg, Germany; 30Department of Medicine, Zealand University Hospital, Copenhagen University, Copenague, Denmark; 31Gastroenterology and Hepatology, Erasmus MC University, Rotterdam, Netherlands; 32Medical Department, Clinical Center of Serbia Clinic for Gastroenterology and Hepatology, University of Belgrade, Belgrade, Serbia; 33Internal Medicine, Herttoniemi Hospital, Helsinki, Finland; 34Gastroenterology, Hospital San Pedro de Alcantara, Caceres and Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd), Madrid, Spain; 35Gastroenterology Unit Gastrocentre, Perm, Russian Federation; 36Digestive Ukrainian Academy of Medical Sciences, Kyiv, Ukraine; 37Gastroenterology Unit, Hospital Clínico Universitario Lozano Blesa, Zaragoza, Spain; 38Departamento de Psicología Aplicada, Universidad Autónoma de Madrid, Madrid, Spain; 39Servicio de Medicina Preventiva, Hospital Clínico San Carlos, Facultad de Enfermería, Universidad Complutense de Madrid, Instituto de Investigación Sanitaria del Hospital Clínico San Carlos (IdISSC), Madrid, Spain; 40Centre Hospitalier Annecy Genvois, Pringy, France; 41Althaia Xarxa Assistencial Universitària de Manresa and Universitat de Vic-Universitat Central de Catalunya (UVicUCC), Manresa, Spain; 42Laboratoire de Bactériologie, Hôpital Pellegrin, Bordeaux, France; 43Department of Clinical Medicine, Trinity College Dublin, Dublin, Ireland

Background: The impact of consensus, prescription choices and efficacy trends on clinical practice over time has not been studied in depth. Methods: International multicenter prospective non-interventional registry aimed to evaluate the decisions and outcomes of H. pylori management by European gastroenterologists. All infected adult patients were registered at AEG-REDCap e-CRF up to April 2020. Modified intention-to-treat (mITT) and time trend analyses were performed. Results: So far 24,882 first-line empirical prescriptions from 29 European countries have been included. Overall, the most common prescribed treatments in 2013-20 were triple therapies; however, a shift in antibiotic regimens was identified. Triple therapies decreased from >50% of prescription in 2013/15 to less than 20% in 2018/20; concomitant therapy decreased from 21% in 2013/14 to 13% in ABSTRACTS | 17 of 95

TABLE 1. Prescriptions and effectiveness trends of first-line empirical treatments in Europe in 2013-2020

Year 2013 2014 2015 2016 2017 2018 2019 2020

Quadruple-C+A+B 0.5% 0.9% 5.2% 17.2% 10.2% 15.3% 5.2% 5.7% Pylera® 0.0% 0.0% 0.5% 12.0% 24.5% 22.3% 17.6% 17.8% Quadruple-M+Tc+B 2.3% 1.9% 0.4% 0.2% 0.3% 0.4% 1.6% 0.0% Quadruple-C+A+M/T 20.0% 21.4% 26.9% 22.3% 21.2% 10.6% 11.8% 14.4% Sequential-C+A+M/T 8.1% 3.4% 1.8% 0.9% 0.3% 0.5% 0.2% 0.3% Triple-A+L 2.1% 2.2% 3.2% 1.9% 0.3% 0.3% 0.4% 0.3% Triple-A+M 4.1% 3.0% 1.7% 0.9% 0.9% 0.6% 2.3% 0.6% Triple-C+M 3.9% 6.4% 9.0% 6.6% 1.4% 1.0% 1.0% 4.0% Triple-C+A 53.6% 54.3% 42.7% 28.2% 30.5% 34.0% 40.6% 34.3% Length 7 days 31.3% 28.1% 24.7% 16.7% 7.8% 1.8% 2.3% 10.1% 10 days 48.3% 52.7% 55.9% 46.4% 46.9% 43.9% 30.8% 31.7% 14 days 20.5% 19.2% 19.4% 36.8% 45.3% 54.2% 66.8% 58.3% PPI acid inhibition* Low 62.0% 56.7% 47.1% 36.2% 39.2% 28.5% 24.0% 33.4% Standard 18.7% 25.5% 26.5% 24.5% 23.7% 28.8% 34.6% 24.4% High 19.3% 17.8% 26.4% 39.4% 37.1% 42.8% 41.4% 42.2% Eradication rate (mITT) 85.3% 85.1% 85.9% 87.4% 88.2% 90.9% 92.2% 91.3% PPI, proton pomp inhibitor; mITT, modified intention-to-treat ; A, amoxicillin; C, clarithromycin; M, metronidazole; T, tinidazole; L, levofloxacin; B, bismuth salts; Tc, tetracycline. *Low dose PPI – 4.5 to 27 mg omeprazole equivalents, b.i.d., Standard dose PPI – 32 to 40 mg omeprazole equivalents, b.i.d, High dose PPI – 54 to 128 mg omeprazole equivalents, b.i.d.

O.P. Nyssen: None. D. Bordin: None. B. Tepes: None. A. Pérez- Aisa: None. D. Vaira: None. M. Caldas: None. L. Bujanda: None. M. Castro-Fernandez: None. F. Lerang: None. M. Leja: None. L. Rodrigo: None. T. Rokkas: None. L. Kupcinskas: None. J. Pérez-Lasala: None. L. Jonaitis: None. O. Shvets: None. A. Gasbarrini: None. H. Simsek: None. A. R. T. Axon: None. G. M. Buzás: None. J. Machado: None. Y. Niv: None. L. Boyanova: None. A. Goldis: None. V. Lamy: None. A. Tonkic: None. K. Przytulski: None. C. Beglinger: None. M. Venerito: None. P. Bytzer: None. L.G. Capelle: None. T. Milosavljevic: None. L. Veijola: None. J. Molina-Infante: None. L. Vologzhanina: None. G. Fadeenko: None. I. Ariño: None. G. Fiorini: None. A. Garre: None. J. Garrido: None. C.F. Pérez: None. F. Heluwaert: None. I. Puig: None. F. Mégraud: None. C. O'Morain: None. J.P. Gisbert: None. 18 of 95 | ABSTRACTS

EP2.13 | European Registry on H. pylori Management (Hp- shown in table 1. After failure of first-line clarithromycin-containing EuReg): Analysis of empirical second-line treatments in Europe treatment, optimal eradication (>90%) was obtained with moxifloxacin-containing triple therapy, Pylera® or quadruple ther- O. P. Nyssen1; A. Pérez-Aísa2; B. Tepes3; D. Vaira4; D. S. Bordin5; O. apy with levofloxacin and bismuth. In patients receiving triple regi- Shvets6; L. Kupcinskas7; R. Marcos Pinto8; M. Leja9; N. Fernanadez- mens containing levofloxacin or the standard bismuth quadruple Moreno2; I. Santaella2; G. Fiorini4; L. Vologzhanina5; G. Fadeenko10; regimen, cure rates were optimized with 14-day regimens using high L. Jonaitis7; A. Lucendo11; L. Bujanda12; A. S. Sarsenbaeva13; doses of proton pump inhibitors (PPIs). However, Pylera® or quadru- M. Areia14; M. Caldas1; A. Garre1; I. Puig15; F. Megraud16; C. ple therapy with levofloxacin and bismuth achieved reliable eradica- O'Morain17; J. P. Gisbert1; On behalf of the Hp-EuReg Investigators tion rates regardless of the PPI dose, duration of therapy, or previous 1Gastroenterology Unit, Hospital Universitario de La Princesa, first-line treatment. Instituto de Investigación Sanitaria Princesa (IIS-IP), Universidad Conclusion: Empirical second-line triple therapies generally pro- Autónoma de Madrid, Centro de Investigación Biomédica en Red de vided low eradication rates except when prescribing 14 days of levo- Enfermedades Hepáticas y Digestivas (CIBEREHD), Madrid, Spain; floxacin or moxifloxacin. However, high effectiveness was obtained 2Servicio de Gastroenterología, Agencia Sanitaria Costa del Sol, Red with second-line bismuth-containing quadruple therapies. de Investigación en Servicios de Salud en Enfermedades Crónicas (REDISSEC), Marbella, Spain; 3Gastroenterology Unit, AM DC Rogaska, Rogaska Slatina, Slovenia; 4Department of Surgical and Medical Sciences, University of Bologna, Bologna, Italy; 5Department of pancreatobiliary and upper GI diseases, Moscow Clinical Scientific Center, and A.I. Yevdokimov Moscow State University of Medicine and Dentistry, Moscow, Russian Federation; 6Internal Diseases Department No.1, National Medical University named after O.O. Bogomolets, Kyiv, Ukraine; 7Department of Gastroenterology, Lithuanian University of Health Sciences, Kaunas, Lithuania; 8Centro Hospitalar do Porto, Institute of Biomedical Sciences Abel Salazar, University of Porto and CINTESIS, University of Porto, Porto, Portugal; 9Faculty of Medicine, University of Latvia, Riga, Latvia; 10National Academy of Medical Sciences, Kyiv, Ukraine; 11Hospital de Tomelloso, Ciudad Real, Spain; 12Department of Gastroenterology. Hospital Donostia/ Instituto Biodonostia. Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd), Universidad del País Vasco (UPV/EHU), Donosti, Spain; 13Gastroenterological center, Chelyabinsk, Russian Federation; 14Portuguese Oncology Institute Coimbra, Coimbra, Portugal; 15Althaia Xarxa Assistencial Universitària de Manresa and Universitat de Vic-Universitat Central de Catalunya (UVicUCC), Manresa, Spain; 16Laboratoire de Bactériologie, Hôpital Pellegrin, Bordeaux, France; 17Department of Clinical Medicine, Trinity College Dublin, Dublin, Spain

Background: After a failed eradication attempt, approximately 10- 20% of patients will fail to obtain H. pylori eradication. Aims: To evaluate the effectiveness of second-line empirical treatments. Methods: A systematic prospective registry of the clinical practice of European gastroenterologists on H. pylori management was established. All infected adult patients were systematically registered at AEG-REDCap e-CRF until April 2020. Modified intention-to-treat (mITT) and per-protocol (PP) analyses were performed. Results: Overall, 4,862 patients from 29 European countries were given an empirical second-line therapy. Overall effectiveness was 83.7% (by mITT) and 84% (by PP). Over 97% of patients were compliant. AEs were reported in 28% of the cases. Most frequent second- line prescriptions and effectiveness per antibiotic combination is ABSTRACTS | 19 of 95

TABLE 1. Frequency of second-line empirical treatment prescriptions and effectiveness by modified intention-to-treat and per-protocol analyses

Treatment N % Use mITT, N (%) 95% CI PP, N (%) 95% CI

Triple-A+L 1,522 33.2 1,341 (81) 79-83 1,320 (81) 79-83 Pylera® (single capsule) 692 15.1 622 (90) 87-92 607 (90) 88-93 Quadruple-A+L+B 529 11.5 478 (89) 86-92 462 (89) 86-92 Triple-C+A 477 10.4 231 (81) 76-86 226 (81) 76-86 Quadruple-M+Tc+B 204 4.4 183 (83) 77-89 177 (84) 78-90 Quadruple-C+A+M 179 3.9 169 (85) 79-90 167 (84) 79-90 Triple-A+Mx 143 3.1 135 (91) 86-96 135 (91) 86-96 Triple-A+M 93 2.0 76 (60.5) 49-72 76 (60.5) 49-72 Other 1,023 21.0 NA NA NA NA Total 4,862 100% 3,966 (84) 82-85 3,966 (84) 81-83 mITT, modified intention-to-treat; PP, per-protocol; 95% CI, 95% confidence interval; C, clarithromycin; M, metronidazole; T, tinidazole; A, amoxicillin; L, levofloxacin; B, bismuth salts; Tc, tetracycline; Mx, moxifloxacin; N, Total of patients receiving an empirical treatment; Other, Other second-line empirical treatments with less than 100 patients treated in each category.

O.P. Nyssen: None. A. Pérez-Aísa: None. B. Tepes: None. D. Vaira: overcome these drawbacks3. This work intended the development None. D. S. Bordin: None. O. Shvets: None. L. Kupcinskas,: None. of biocompatible chitosan microspheres decorated with MSI-78A R. Marcos Pinto: None. M. Leja: None. N. Fernanadez-Moreno: (AMP-ChMic) capable of crossing the gastric mucosa and kill Hp in None. I. Santaella: None. G. Fiorini: None. L. Vologzhanina: None. situ, after oral administration. G. Fadeenko: None. L. Jonaitis: None. A. Lucendo: None. L. Bujanda: Chitosan microspheres (ChMic), average diameter of 5 μm, were None. A. S. Sarsenbaeva: None. M. Areia: None. M. Caldas: None. A. produced by spray drying. A heterobifunctional spacer (NHS-PEG- Garre: None. I. Puig: None. F. Megraud: None. C. O'Morain: None. MAL) was bonded to the ChMic, allowed immobilizing the MSI-78A J.P. Gisbert: None. modified with a terminal cysteine on the C-terminal (MSI-78A-SH) in a controlled orientation. The resulting AMP-ChMic were able to retain their integrity in a EP2.14 | A deadly hug: Chitosan microspheres functionalized wide range of acidic pH, proving their pH-resistance and validating with MSI-78A antimicrobial peptide kill Helicobacter pylori this approach for gastric settings. The microparticles were tested in vitro against Hp J99 strain (highly pathogenic human strain), at D. R. Fonseca1,2,3; A. Moura1,2; C. L. Seabra1,2,4; V. Leiro1,2; B. N. different timepoints and in a microspheres’ range of concentra- Estevinho5; C. Teixeira6; P. Gomes6; P. Parreira1,2; M. L. Martins1,2,7 tions (105-107mics/mL). Antimicrobial effect was seen after 2 hours 1INEB, Instituto de Engenharia Biomédica, Universidade do Porto, in higher concentrations and it was maintained up to 6 hours. The Porto, Portugal; 2i3S, Instituto de Investigação e Inovação em fast-bactericidal effect indicates that MSI-78A can retain its activity Saúde, Universidade do Porto, Porto, Portugal; 3Departamento de when immobilized onto ChMic. AMP-ChMic demonstrated high po- Engenharia Metalúrgica e de Materiais, Faculdade de Engenharia, tential for Hp infection management, being an innovative strategy to Universidade do Porto, Porto, Portugal; 4Current address: LAQV/ non-antibiotic therapeutics. REQUIMTE, Departamento de Ciências Químicas, Faculdade de 1. Rawla et al. Prz. Gastroenterol., 2019 Farmácia, Universidade do Porto, Portugal; 5LEPABE, Departamento 2. Abadie et al. Expert Rev. Anti. Infect. Ther., 2018 de Engenharia Química, Faculdade de Engenharia da Universidade Do 3. Parreira et al. Sci. Rep., 2019 Porto, Porto, Portugal; 6LAQV-REQUIMTE, Departamento de Química Acknowledgements: PTDC/CTM-BIO/4043/2014 & SFRH/ e Bioquímica, Faculdade de Ciências, Universidade do Porto, Porto, BD/146890/2019 Portugal; 7ICBAS, Instituto de Ciências Biomédicas Abel Salazar, D.R. Fonseca: None. A. Moura: None. C.L. Seabra: None. V. Leiro: Universidade do Porto, Porto, Portugal None. B.N. Estevinho: None. P. Gomes: None. P. Parreira: None. M.L. Martins: None. C. Teixeira: None. With the end of antibiotic era, newer therapeutic options, as antimicrobial peptides (AMPs), are a demand. Helicobacter pylori (Hp) was classified as 1 of the 16 antibiotic-resistant bacteria1. MSI-78A is one of the fewer AMPs that demonstrated bactericidal effects against Hp2. However, in vivo AMPs undergo protease degradation and proteins aggregation, reducing their effectiveness. AMPs im- mobilization onto a biomaterial surface is an advocated strategy to 20 of 95 | ABSTRACTS

EP2.15 | Bismuth quadruple three-in-one single capsule: 3 or treatment. The PPI dose did not influence the eradication rate. Both 4 times daily? Sub-analysis of the Spanish data of the European treatment schedules showed equivalent compliance, tolerance, and Registry on H. pylori Management (Hp-EuReg) effectiveness (table 1). One patient suffered a serious adverse event (C. difficile infection), in the group 3c/6h. M. Caldas1; O. P. Nyssen1; B. Gomez Rodriguez2; J. Barrio3; M. Conclusions: The prescription of quadruple therapy with single cap- Castro-Fernández4; M. Mego5; Á. Pérez-Aisa6; N. Fernández sule bismuth (Pylera®) given as four capsules three times a day seems Moreno6; B. Gómez7; L. Tito7; E. Iyo8; J. Huguet9; A. Lucendo10; to have the same compliance, tolerance and effectiveness as the T. Di Maira11; F. Martinez Cerezo12; Ó. Nuñez13; M. Barenys14; M. scheme included in the data sheet (three capsules four times a day). Perona15; A. Campillo16; P. Mata Romero17; J. Santos-Fernández18; A. Cerezo-Ruiz19; S. Lario20; M. Ramirez20; I. Puig21; F. Mégraud22; C. O'Morain23; J. P. Gisbert1,*; X. Calvet20,*; On behalf of the Hp- EuReg Investigators 1Hospital Universitario de La Princesa, Instituto de Investigación Sanitaria Princesa (IIS-IP), Universidad Autónoma de Madrid, Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBEREHD), Madrid, Spain; 2Virgen de la Macarena, Seville, Spain; 3Hospital Río Hortega, Valladolid, Spain; 4Digestive Unit, Hospital de Valme, Seville, Spain; 5Hospital Universitario General de Cataluña, Quirón Salud, Barcelona, Spain; 6Servicio de Gastroenterología, Agencia Sanitaria Costa del Sol, Red de Investigación en Servicios de Salud en Enfermedades Crónicas (REDISSEC), Marbella, Malaga, Spain; 7Hospital de Mataró, Barcelona, Spain; 8Hospital Comarcal de Inca, Mallorca, Spain; 9Consorcio Hospital General Universitario de Valencia, Valencia, Spain; 10Hospital de Tomelloso, Ciudad Real, Spain; 11Hospital La Fe, Valencia, Valencia, Spain; 12Hospital Sant Joan, Reus, Spain; 13Hospital Universitario Sanitas La Moraleja, Madrid, Spain; 14Hospital de Viladecans, Barcelona, Spain; 15Hospital Quirón, Marbella, Spain; 16Hospital Reina Sofía, Tudela, Spain; 17San Pedro de Alcántara, Caceres, Spain; 18Hospital Clínico Universitario, Valladolid, Spain; 19Hospital Sierra de Segura, Jaen, Spain; 20Hospital de Sabadell, CIBERehd, Spain; 21Althaia Xarxa Assistencial Universitària de Manresa and Universitat de Vic-Universitat Central de Catalunya (UVicUCC), Manresa, Spain; 22Laboratoire de Bactériologie, Hôpital Pellegrin, Bordeaux, France; 23Department of Clinical Medicine, Trinity College Dublin, Dublin, Ireland *Both senior authors contributed equally to the study

Background: Bismuth quadruple with the quadruple single capsule Pylera® (PPI, bismuth, tetracycline and metronidazole) includes the intake of 3 capsules four times a day (3c/6h), according to the technical sheet. This scheme may not be suitable for Spanish eating habits; therefore, some physicians prescribe the treatment in the form of 4 capsules three times a day (4c/8h). Aim: To assess the effectiveness and safety of Pylera® administered three times a day (4c/8h). Methods: Systematic prospective registry of the clinical practice of European gastroenterologists on the management of H. pylori infection (Hp-EuReg). All infected adult patients treated with Pylera® were systematically collected at AEG-REDCap e-CRF until June 2019. Modified intention-to-treat (mITT) and per-protocol (PP) analyses were performed. Results: Of the 2,326 patients, 1,140 (74%) were treated with 3c/6h and 403 (17%) with the 4c/8h. Most of the cases (72%) were naïve to ABSTRACTS | 21 of 95

TABLE 1. Effectiveness (by modified intention-to-treat and per-protocol analyses), compliance and safety of treatment with Pylera® in first-, second-, and third-line

Modified intention-to-treat Per-protocol

Pylera® Compliance AEs Total 1st line 2nd line 3rd line Total 1st line 2nd line 3rd line

4c/8h 97% 22% 91% 95% 92% 86% 93% 96% 94% 92% 3c/6h 98% 24% 86% 93% 83% 84% 90% 95% 87% 86% AEs: adverse events. 4c/8h: four capsules three times a day (every 8 hours); 3c/6h: three capsules four times a day (every 6 hours).

O.P. Nyssen: None. B. Gomez Rodriguez: None. J. Barrio: None. M. 19Department of Surgical and Medical Sciences, University of Bologna, Castro-Fernández: None. M. Mego: None. Á. Pérez-Aisa: None. N. Bologna, Italy; 20Hospital San Jorge, Huesca, Spain; 21Hospital Fernández Moreno: None. B. Gómez: None. L. Tito: None. E. Iyo: Universitario, Burgos, Spain; 22Hospital Comarcal de Inca, Mallorca, None. J. Huguet: None. A. Lucendo: None. T. Di Maira: None. F. Spain; 23HM Sanchinarro, Madrid, Spain; 24Hospital San Pedro de Martinez Cerezo: None. Ó. Nuñez: None. M. Barenys: None. M. Alcantara, Caceres and Centro de Investigación Biomédica en Red Perona: None. A. Campillo: None. P. Mata Romero: None. J. Santos- de Enfermedades Hepáticas y Digestivas (CIBERehd), Caceres, Spain; Fernández: None. A. Cerezo-Ruiz: None. S. Lario: None. M. Ramirez: 25Hospital Rio Hortega, Valladolid, Spain; 26Gastroenterology Unit, None. I. Puig: None. F. Mégraud: None. C. O'Morain: None. J.P. AM DC Rogaska, Rogaska Slatina, Slovenia; 27Hospital Universitario Gisbert**: None. X. Calvet**: None. de Fuenlabrada, Madrid, Spain; 28Hospital Ramon y Cajal, Madrid, Spain; 29Hospital General Universitario, Castellon, Spain; 30Hospital Donostia, Instituto Biodonostia. Centro de Investigación Biomédica en EP2.16 | European Registry on H. pylori Management (Hp- Red de Enfermedades Hepáticas y Digestivas (CIBERehd), Universidad EuReg): Experience with single capsule bismuth quadruple therapy del País Vasco (UPV/EHU), Donosti, Spain; 31Hospital de Tomelloso, in 3,439 patients Ciudad Real, Spain; 32Centre Hospitalier Annecy Genvois, Pringy, France; 33A. S. Loginov Moscow Clinical Scientific Center, Moscow, O. P. Nyssen1; A. Perez-Aisa2; M. Castro-Fernandez3; R. Pellicano4; ; 34Department of Outpatient Therapy and Family Medicine, Tver J. M. Huguet5; L. Rodrigo6; J. Ortuño7; B. J. Gomez-Rodriguez8; State Medical University, Moscow, Russian Federation; 35Department R. Marcos Pinto9; M. Areia10; M. Perona11; O. Nuñez12; M. of Gastroenterology and Internal Medicine, University Hospital Brno, Romano13; A. G Gravina13; L. Pozzati14; M. Fernandez-Bermejo15; Faculty of Medicine, Masaryk University, Brno, Czech Republic, Athens, M. Venerito16; P. Malfertheiner16; L. Fernandez-Salazar17; A. Greece; 36Department of Surgery, University Hospital Brno, Faculty of Gasbarrini18; D. Vaira19; M. Dominguez-Cajal20; M. Jimenez- Medicine, Masaryk University, Brno, Czech Republic, Athens, Greece; Moreno21; E. Iyo22; J. Perez-Lasala23; J. Molina-Infante24; J. 37Henry Dunant Hospital, Athens, Greece; 38Lithuanian University Barrio25; B. Tepes26; F. Bermejo27; D. Burgos28; P. Almela Notari29; of Health Sciences, Kaunas, Lithuania; 39Althaia Xarxa Assistencial L. Bujanda30; A. Lucendo31; F. Heluwaert32; D. Bordin33,34; L. Universitària de Manresa and Universitat de Vic-Universitat Central de Kunovský35,36; T. Rokkas37; L. Kupcinskas38; M. Caldas1; I. Puig39; Catalunya (UVicUCC), Manresa, Spain; 40Laboratoire de Bactériologie, F. Megraud40; C. O'Morain41; J. P. Gisbert1; On behalf of the Hp- Hôpital Pellegrin, Bordeaux Cedex, France; 41Trinity College Dublin – EuReg Investigators Faculty of Health Sciences, Trinity College Dublin, Dublin/IE, Faculty of 1Hospital Universitario de La Princesa, IIS-IP, CIBEREHD, and UAM, Health Sciences, Dublin, Ireland. Madrid, Spain; 2Servicio de Gastroenterología, Agencia Sanitaria Costa del Sol, Red de Investigación en Servicios de Salud en Enfermedades Background: Bismuth-quadruple therapy (PPI, bismuth, tetracycline Crónicas (REDISSEC), Marbella, Spain; 3Hospital de Valme, Sevilla, and metronidazole) has resurfaced in Europe thanks to a three-in- Spain; 4Molinette Hospital, Turin, Italy; 5Consorcio Hospital General one single-capsule formulation (Pylera®). Universitario, Valencia, Spain; 6Hospital Universitario Central de Aim: To evaluate the effectiveness and safety of Pylera®. Asturias, Oviedo, Spain; 7Hospital Universitari i Politècnic La Fe, Methods: International prospective registry of the clinical practice of Valencia, Spain; 8Hospital Quiron Sagrado Corazon, Sevilla, Spain; European gastroenterologists on the management of H. pylori infec- 9Centro Hospitalar do Porto, Institute of Biomedical Sciences Abel tion (Hp-EuReg). All infected adult patients treated with Pylera® ac- Salazar, University of Porto and CINTESIS, University of Porto, Porto, cording to data sheet (3 capsules/6h) were systematically collected Spain; 10Oncology Institute Coimbra, Coimbra, Spain; 11Hospital at AEG-REDCap e-CRF until December 2019. Modified intention-to- Quiron, Marbella, Spain; 12Hospital Universitario Sanitas La Moraleja, treat (mITT) analyses were performed. Madrid, Spain; 13Università degli Studi della Campania “Luigi Results: Overall, 2,100 patients were prescribed single-capsule Vanvitelli”, Napoli, Italy; 14Hospital, Merida, Spain; 15Clinica San bismuth-quadruple therapy (10 days, 3 capsules q.i.d.). The major- Francisco, Caceres, Spain; 16Otto-von-Guericke University Hospital, ity of these patients were naïve (63%) and 16% had peptic ulcer. Magdeburg, Germany; 17Hospital Clínico Universitario, Valladolid, Pylera® achieved a high eradication rate based on the mITT (91.9%). Spain; 18Fondazione Policlinico Universitario A. Gemelli, Rome, Italy; Effectiveness was higher when using Pylera® as a first-line treatment 22 of 95 | ABSTRACTS

(94.6%) but it had also high effectiveness as a rescue therapy, both a severe AE, leading to discontinuation of treatment in 1.7% of pain second-line (89.3%) or subsequent lines of therapy (3rd-6th line: tients. Conclusions 91.9%) (Table 1). Compliance was the factor most closely associated The 10-day treatment with single-capsule bismuth-quadruple ther- with the effectiveness of treatment. Adverse events (AEs) were gen- apy (Pylera®) achieves H. pylori eradication in approximately 90% of erally mild-to-moderate and transient, only 3% of patients reporting patients by mITT in real-world clinical practice, both as a first-line and rescue treatment, with a favourable safety profile.

TABLE 1. Pylera® effectiveness (by modified intention-to-treat) in first-, and consecutive rescue treatment lines

Use, N (%) mITT, N (%) 95% CI PP, N (%) 95% CI

Overall 2,100 (6*) 1,777 (92) 91-93 1,761 (93) 92-94 Naïve 1.335 (63) 1,166 (95) 93-96 1,158 (95.5) 94-97 2nd line 465 (22) 375 (89) 86-92 370 (90) 87-93 3rd line 212 (10) 174 (89) 84-93 177 (88) 83-93 * Of the total of treatments included in the Hp-EuReg up to December 2019 (i.e. N = 34,460); mITT: modified intention-to-treat; PP: per-protocol, N: total number of patients analysed.

O.P. Nyssen: None. A. Perez-Aisa: None. M. Castro-Fernandez: None. R. Pellicano: None. J.M. Huguet: None. L. Rodrigo: None. J. Ortuño: None. B.J. Gomez-Rodriguez: None. R. Marcos Pinto: None. M. Areia: None. M. Perona: None. O. Nuñez: None. M. Romano: None. A. G Gravina: None. L. Pozzati: None. M. Fernandez-Bermejo: None. M. Venerito: None. P. Malfertheiner: None. L. Fernandez- Salazar: None. A. Gasbarrini: None. D. Vaira: None. M. Dominguez- Cajal: None. M. Jimenez-Moreno: None. E. Iyo: None. J. Perez-Lasala: None. J. Molina-Infante: None. J. Barrio: None. B. Tepes: None. F. Bermejo: None. D. Burgos: None. P. Almela Notari: None. L. Bujanda: None. A. Lucendo: None. F. Heluwaert: None. D. Bordin: None. T. Rokkas: None. L. Kunovský: None. L. Kupcinskas: None. M. Caldas: None. I. Puig: None. F. Megraud: None. C. O'Morain: None. J.P. Gisbert: None. ABSTRACTS | 23 of 95

EP2.17 | Safety of the treatment of H. pylori infection: 0.08% were serious, with an average duration of 7 days. The treat- Experience from the European Registry on H. pylori Management ment compliance rate was 97%. Only 1.3% of the patients discontin- (Hp-EuReg) on 22,000 patients ued treatment due to AEs. Conclusions: H. pylori eradication treatment frequently induces AEs, O. P. Nyssen1; L. Kupcinskas2; B. Tepes3; O. Shvets4; D. Bordin5; M. although they are usually mild and of limited duration. Its appearance Leja6; J. Carlos Machado7; T. Rokkas8; G. M Buzas9; I. Simsekn10; T. does not interfere significantly with the compliance of treatment. Axon11; F. Lerang12; L. Jonaitis2; R. Muñoz1; E. Resina1; M. Espada1; I. Puig13; F. Megraud14; C. O'Morain15; J. P. Gisbert1; On behalf of TABLE 1. Safety in naïve and non-naïve patients the Hp-EuReg Investigators Adverse events Yes % 95% CI 1Gastroenterology Unit, Hospital Universitario de La Princesa, Instituto Triple-C+A 1,037 15 14-16 de Investigación Sanitaria Princesa (IIS-IP), Universidad Autónoma de Quadruple-C+A+M 926 25 23-26 Madrid, Centro de Investigación Biomédica en Red de Enfermedades Pylera® 642 28 26-30 Hepáticas y Digestivas (CIBEREHD), Madrid, Spain; 2Department of Gastroenterology, Lithuanian University of Health Sciences, Quadruple -C+A+B 627 34 34-37 Kaunas, Lithuania; 3Gastroenterology Unit, AM DC Rogaska, Rogaska Triple-A+L 339 21 19-23 Slatina, Slovenia; 4Internal Diseases Department No.1, National Triple-C+M 184 20 18-23 Medical University named after O.O. Bogomolets, Kyiv, Ukraine; Quadruple -A+L+B 180 32 28-36 5 Department of pancreatobiliary and upper GI diseases, Moscow Triple-A+M 79 22 17-26 6 Clinical Scientific Center, Moscow, Russian Federation; Institute of Sequential-C+A+M 50 19 14-24 Clinical and Preventive Medicine & Faculty of Medicine, University Quadruple -M+Tc+B 84 37 30-43 of Latvia, Riga, Latvia; 7Instituto de Investigação e Inovação em Quadruple -A+B+ 67 32 26-39 Saúde, Universidade do Porto, and Ipatimup – Institute of Molecular Quadruple -M+D+B 62 33 26-40 Pathology and Immunology of the University of Porto, Porto, Sequential -C+A+T 5 6.8 2.2-15 Portugal; 8Gastroenterology Unit, Henry Dunant Hospital, Athens, Quadruple -C+A+T 16 17 9.1-26 Greece; 9Gastroenterology Unit, Ferencváros Policlinic, Budapest, Total 4,298 22 22-23 Hungary; 10Dokuz Eylul University School of Medicine, Izmir, Turkey; 11Gastroenterology Unit, University of Leeds, Leeds, United Kingdom; A, amoxicillin; B, bismuth; C, clarithromycin; CI, confidence interval; D, doxycycline; L, levofloxacin; M, metronidazole; T, tinidazole; Tc, 12Medical Department, Central Hospital Ostfold, Fredrikstad, Norway; tetracycline. 13Althaia Xarxa Assistencial Universitària de Manresa and Universitat de Vic-Universitat Central de Catalunya (UVicUCC), Manresa, Spain; O.P. Nyssen: None. L. Kupcinskas: None. B. Tepes: None. O. Shvets: 14Laboratoire de Bactériologie, Hôpital Pellegrin, Bordeaux Cedex, None. D. Bordin: None. M. Leja: None. J. Carlos Machado: None. T. France; 15Trinity College Dublin – Faculty of Health Sciences, Trinity Rokkas: None. G. M Buzas: None. I. Simsekn: None. T. Axon: None. College Dublin; Dublin/IE, Faculty of Health Sciences, Dublin, Ireland F. Lerang: None. L. Jonaitis: None. R. Muñoz: None. E. Resina: None. M. Espada: None. I. Puig: None. F. Megraud: None. C. O'Morain: Introduction: The safety of Helicobacter pylori eradication treat- None. J.P. Gisbert: None. ments and to what extent adverse events (AEs) may influence therapeutic compliance is unknown. Objective: To assess the frequency, type, intensity and duration of AEs, and their impact on compliance. Methods: Systematic prospective non-interventional registry of the clinical practice of European gastroenterologists on the management of H. pylori infection. All prescribed treatments and their corresponding safety profile were recorded in an e-CRF in AEG-REDCap until June 2019. AEs were classified depending on the intensity of symptoms as mild/moderate/severe, and as serious AEs (death, hospitalisation, disability, congenial anomaly and/or requires intervention to prevent permanent damage). Results: The different treatments prescribed to a total of 22,492 naïve and non-naïve patients caused at least one AE in 22% of the cases (Table 1), the classic bismuth-based quadruple therapy being the worst tolerated (37% of AEs). Taste disturbance (7%), diarrhoea (7%), nausea (6%) and abdominal pain (3%) were the most frequent AEs. The majority of AEs were mild (57%), 6% were severe, and only 24 of 95 | ABSTRACTS

EP2.18 | Bismuth quadruple regimen with tetracycline or European gastroenterologists. After previous failure with clarithro- doxycycline versus Pylera® as third-line rescue therapy for mycin- and levofloxacin-containing therapies, patients receiving a H. pylori infection: A prospective multicenter analysis of the third-line regimen with 10/14-day of PPI, bismuth, metronidazole European Registry on Helicobacter pylori Management (Hp-EuReg) and either tetracycline (T) or doxycycline (D), or 10-day Pylera® (P) were registered at AEG-REDCap. O. P. Nyssen1; A. Perez-Aisa2; L. Rodrigo-Sáez3; M. Castro- Results: Overall, 454 patients were treated: 85 with T, 94 with D, Fernández4; P. Mata Romero5; J. Ortuño6; J. Barrio7; J. Huguet8; I. and 275 with P. Overall modified intention-to-treat and per-protocol Modollel9; N. Alcaide10; A. Lucendo11; X. Calvet12; M. Perona13; B. eradication rates were 81% (D: 65%, T: 76%, P: 88%) and 82% (D: Gomez14; B. Gomez Rodriguez15; P. Varela16; M. Jimenez-Moreno17; 66%, T: 77%, P: 88%), respectively (Table 1). Higher eradication rates M. Dominguez-Cajal18; L. Pozzati19; D. Burgos20; L. Bujanda21; J. were associated with compliance (OR = 2.96; 95% CI = 1.01-8.84) Hinojosa2; J. Molina-Infante5; T. Di Maira6; L. Ferrer8; L. Fernández- and no prior metronidazole use (OR = 1.96; 95% CI = 1.15-3.33); P Salazar10; A. Figuerola12; L. Tito14; C. de la Coba16; J. Gomez- was superior to D (OR = 4.46; 95% CI = 2.51-8.27), and T marginally Camarero17; N. Fernandez2; M. Caldas1; A. Garre1; E. Resina1; M. superior to D (OR = 1.67; 95% CI = 0.85-3.29). Espada1; I. Puig22; F. Megraud23; C. O'Morain24; J. P. Gisbert1; On Conclusion: Third-line (after failure with clarithromycin and levo- behalf of the Hp-EuReg Investigators floxacin) H. pylori eradication with bismuth quadruple treatment of- 1Gastroenterology Unit, Hospital Universitario de La Princesa, fers acceptable effectiveness and safety. Highest effectiveness was Instituto de Investigación Sanitaria Princesa (IIS-IP), Universidad found in compliant patients and in those taking 10-day Pylera® or Autónoma de Madrid, and Centro de Investigación Biomédica en 14-day tetracycline. Doxycycline appears less effective and there- Red de Enfermedades Hepáticas y Digestivas (CIBERehd), Madrid, fore should not be recommended. Spain; 2Servicio de Gastroenterología, Agencia Sanitaria Costa del Sol, Red de Investigación en Servicios de Salud en Enfermedades Crónicas (REDISSEC), Marbella, Spain; 3Hospital Universitario Central de Asturias, Oviedo, Spain; 4Hospital de Valme and CIBEREHD, Sevilla, Spain; 5Hospital San Pedro de Alcántara and CIBEREHD, Caceres, Spain; 6Hospital Universitari i Politècnic La Fe, Valencia, Spain, 7Hospital Rio Hortega, Valladolid, Spain; 8Consorcio Hospital General Universitario, Valencia, Spain; 9Consorci Sanitari Terrassa, Terrasa, Spain; 10Hospital Clínico Universitario, Valladolid, Spain; 11Hospital de Tomelloso, Ciudad Real, Spain; 12Hospital de Sabadell and CIBEREHD, Barcelona, Spain; 13Hospital Quiron, Marbella, Spain; 14Hospital de Mataró, Barcelona, Spain; 15Hospital Virgen de la Macarena, Sevilla, Spain; 16Hospital de Cabueñes, Gijon, Spain; 17Hospital Universitario, Burgos, Spain; 18Hospital San Jorge, Huesca, Spain; 19Hospital de Mérida, Merida, Spain; 20Hospital Ramon y Cajal, Madrid, Spain; 21Hospital Donostia/Instituto Biodonostia. Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd). Universidad del País Vasco (UPV/EHU), San Sebastián, Spain; 22Althaia Xarxa Assistencial Universitària de Manresa and Universitat de Vic-Universitat Central de Catalunya (UVicUCC), Manresa, Spain; 23Université de Bordeaux, Centre National de Référence des Campylobacters et Hélicobacters, Bordeaux, France; 24Gastroenterology Unit, Trinity College, Dublin, Ireland

Background: Different bismuth-quadruple therapies containing proton pump inhibitors, bismuth, metronidazole, and a tetracycline have been recommended as third-line Helicobacter pylori eradication treatment after failure with clarithromycin and levofloxacin. Aim: To evaluate the effectiveness and safety of third-line treatments with bismuth, metronidazole and either tetracycline or doxycycline. Methods: Sub-study of the European Registry on H. pylori Management (Hp-EuReg), an international multicenter prospective non-interventional registry of the routine clinical practice of ABSTRACTS | 25 of 95

TABLE 1. Effectiveness (by modified intention-to-treat and per-protocol) and compliance according to the treatment regimen and length

Effectiveness, N (%) Compliance mITT, N mITT 95% CI PP, N PP 95% CI

Group T All 82 (97%) 64 76% 66-86 63 77% 67-86 10 days* 29 (97%) 19 66% 47-85 19 66% 47-85 14 days 45 (96%) 45 82% 71-93 44 83% 72-94 Group D All 85 (93%) 58 65% 55-76 56 66% 55-77 10 days* 37 (90%) 25 63% 46-79 23 63% 45-79 14 days 53 (96%) 32 70% 55-84 32 71% 57-85 Group P 10 days* 249 (96%) 222 88% 83-92 216 88% 84-92 Group T – tetracycline containing bismuth quadruple therapy, Group D – doxycycline containing bismuth quadruple therapy, Group P – single capsule bismuth quadruple therapy (Pylera®), 95% CI – 95% confidence interval. ITT: intention-to-treat, mITT: modified intention-to-treat; PP: per-protocol. The Chi2 test showed statistically significant differences of treatment length in the mITT set between treatment groups (T, D and P) as reported in the table: *P < 0.001.

O.P. Nyssen: None. A. Perez-Aisa: None. L. Rodrigo-Sáez: None. M. Objectives: 1) To group patients from the European Registry on Castro-Fernández: None. P. Mata Romero: None. J. Ortuño: None. J. Helicobacter. pylori management (Hp-EuReg) according to their de- Barrio: None. J. Huguet: None. I. Modollel: None. N. Alcaide: None. A. mographic and clinical characteristics and to the treatment types Lucendo: None. X. Calvet: None. M. Perona: None. B. Gomez: None. through multivariate categorical analysis and subsequent cluster de- B. Gomez Rodriguez: None. P. Varela: None. M. Jimenez-Moreno: composition. 2) To evaluate treatments’ effectiveness. None. M. Dominguez-Cajal: None. L. Pozzati: None. D. Burgos: Methods: Categorical variables used: sex, ethnicity, diagnosis, symp- None. L. Bujanda: None. J. Hinojosa: None. J. Molina-Infante: None. toms, therapeutic indication, treatment and its duration, proton- T. Di Maira: None. L. Ferrer: None. L. Fernández-Salazar: None. pump inhibitor (PPI) dose, compliance, adverse events, and region of A. Figuerola: None. L. Tito: None. C. de la Coba: None. J. Gomez- the prescribing center. Camarero: None. N. Fernandez: None. M. Caldas: None. A. Garre: Results: Overall, 8,322 patients were analysed from 2013 to 2018. None. E. Resina: None. M. Espada: None. I. Puig: None. F. Megraud: Table 1 shows the increase of effectiveness, ranging from 78.4% in None. C. OMorain: None. J.P. Gisbert: None. 2013 to 92.2% in 2018. The lowest effectiveness, for clusters with over 100 patients, was obtained in cluster 1 (2015), with an eradication rate of 82.8%. This cluster comprised: triple therapy with EP2.19 | European Registry on H. pylori Management (Hp- PPI-clarithromycin-amoxicillin and concomitant therapy with PPI- EuReg): Clinical phenotypes through machine learning of first-line clarithromycin-amoxicillin- metronidazole/tinidazole, lasting both treated patients in Spain during the period 2013-2018 10 days in most of cases. High PPI dose, 10-day Pylera® treatment obtained over 95% effectiveness in cluster 3 (2018), uniformly dis- O. P. Nyssen1; A. Sanz-Garcia2; G. Ortega2; J. P. Gisbert1; On behalf tributed among Malaga, Valencia, Ciudad Real, Sevilla, Madrid, and of the Hp-EuReg Investigators Valladolid. High PPI dose, 14-day concomitant therapy achieved 1Hospital Universitario de La Princesa, IIS-IP, UAM, CIBEREHD, Madrid, 90.7% effectiveness in cluster 1 (2018), among Malaga, Ciudad Real Spain; 2Unidad de análisis de datos, Hospital Universitario de la and Madrid. Princesa, Madrid, Spain Conclusion: The cluster analysis allows both identifying homogeneous groups of patients as well as assessing the effectiveness of the Background: Patients’ segmentation in homogeneous groups could different first-line treatments evaluated. help to improve the effectiveness of current Helicobacter pylori eradication therapy.

TABLE 1. Trends in the overall effectiveness (by modified intention-to-treat, per cluster) between 2013 and 2018 in Spain

Effectiveness % (number of patients) per cluster

year Number of clusters 1 2 3 4 5

2013 3 89.6 (280) 83.2 (619) 80.0 (80) 2014 3 88.2 (1685) 69.6 (46) 83.3 (6) 2015 5 91.6 (83) 89.4 (839) 82.9 (615) 70.8 (24) 88.2 (17) 2016 3 94.7 (359) 86.1 (853) 92.6 (296) 2017 3 94.3 (630) 90.6 (636) 91.6 (153) 2018 3 91.8 (122) 90.7 (161) 96.5 (338) Simple underlining highlights the lowest effectiveness for groups of more than 100 patients and double underlining the highest effectiveness. 26 of 95 | ABSTRACTS

O.P. Nyssen: None. A. Sanz-Garcia: None. G. Ortega: None. J.P. EP2.21 | Real-world comparative effects of three-in-one single Gisbert: None. capsule bismuth quadruple therapy vs non-bismuth quadruple concomitant therapy: Interim analysis of the European Registry on H. pylori Management (Hp-EuReg) EP2.20 | Empirical versus susceptibility-guided treatment of Helicobacter pylori infection: A meta-analysis I. Puig1; M. Serra2; O. P. Nyssen3; G. Fiorini4; D. Vaira4; I. Saracino4; Á. Perez-Aisa5; N. Fernandez-Moreno5; I. Santaella5; M. Castro- M. Espada; O. P. Nyssen; J. P. Gisbert Fernandez6; L. Bujanda7; A. Lucendo8; M. Areia9; A. Gasbarrini10; Gastroenterology Unit, Hospital Universitario de La Princesa, Instituto M. Romano11; A. Gravina11; R. Marcos-Pinto12; F. Mégraud13; C. de Investigación Sanitaria Princesa (IIS-IP), Universidad Autónoma O'Morain14; J. P. Gisbert3; On behalf of the Hp-EuReg Investigators de Madrid, and Centro de Investigación Biomédica en Red de 1Digestive Diseases Department, Althaia Xarxa Assistencial Enfermedades Hepáticas y Digestivas (CIBERehd), Madrid, Spain Universitària de Manresa and Uni-versitat de Vic-Universitat Central de Catalunya (UVicUCC), Manresa, Spain; 2Center for Research in Health Background: Treating patients according to antibiotic resistances and Economics (CRES), Pompeu Fabra University (UPF), Barcelona, has frequently been recommended. However, the information on its Spain; 3Gastroenterology Unit, Hospital Universitario de La Princesa, real effectiveness is scarce. Instituto de Investigación Sanitaria Princesa (IIS-IP), Universidad Aim: To perform a meta-analysis comparing empirical versus Autónoma de Madrid, and Centro de Investigación Biomédica en susceptibility-guided treatment of H. pylori. Red de Enfermedades Hepáticas y Digestivas (CIBERehd), Madrid, Methods: Selection of studies: comparing empirical versus Spain; 4Department of Surgical and Medical Sciences, University susceptibility-guided treatment. Search strategy: electronic&manual. of Bologna, Bologna, Italy; 5Servicio de Gastroenterología, Agencia Data synthesis: by intention-to-treat (random effects model). Sanitaria Costa del Sol, Red de Investigación en Servicios de Salud Results: Overall, 38 studies were included (6,525 patients in the em- en Enfermedades Crónicas (REDISSEC), Marbella, Spain; 6Hospital pirical and 5,124 in the susceptibility-guided group). H. pylori eradi- de Valme, Sevilla, Spain; 7Department of Gastroenterology, Centro cation was achieved in 87% versus 77% respectively (RR: 1.13; 95% de Investigación Biomédica en Red de Enfermeda-des Hepáticas CI: 1.09-1.17; I2: 77%). Similar results were found when only RCTs y Digestivas (CIBERehd), Hospital Donostia/Instituto Biodonostia, were evaluated (22 studies; RR: 1.16; 95% CI: 1.10-1.22; I2: 72%). Universidad del País Vasco (UPV/EHU), Donosti, Spain; 8Department of Similar results were also observed when susceptibility testing was Gastroenterology, Hospital General de Tomelloso, Ciudad Real, Spain; assessed by culture (RR: 1.13; 95% CI: 1.07-1.19) or PCR (RR: 1.14; 9Portuguese Oncology Institute, Coimbra, Portugal; 10Gastroenterology 95% CI: 1.05-1.23). When assessing first-line treatments (naïve pa- Area, Fondazione Policlinico Universitario A. Gemelli, Rome, Italy; tients) only (28 studies), better efficacy results were obtained with 11Università degli Studi della Campania “Luigi Vanvitelli”, Napoli, Italy; the susceptibility-guided strategy (RR: 1.16; 95% CI: 1.11-1.21; I2: 12Department of Gastroenterology, Porto Centre Hospital, Porto, 79%). However, when prescribing empirical first-line quadruple regi- Portugal; 13Laboratoire de Bactériologie, Hôpital Pellegrin, Bordeaux, mens only (both with and without bismuth, excluding the suboptimal France; 14Department of Clinical Medicine, Trinity College, Dublin, triple therapies), no differences in efficacy were found versus the Ireland susceptibility-guided group (RR: 1.02; 95% CI: 0.95-1.09); this lack of difference was confirmed in RCTs not based on CYP2C19 gene Background: RCTs have strict selection criteria that render results polymorphism (RR: 1.07; 95% CI: 0.98-1.17). For rescue-therapies not fully transferable to the clinical practice. (13 studies, most as 2nd-line), similar results were demonstrated Objective: To assess the comparative effects of first- with both strategies, both including all studies (RR: 1.09; 95% CI: line bismuth-single- capsule (PPI-bismuth- tetracycline- 0.97-1.22; I2: 82%) and also when only RCTs were considered (RR: metronidazole) vs non-bismuth quadruple concomitant therapy 1.15; 95% CI: 0.97-1.36). (PPI-amoxicillin- clarithromycin- nitroimidazole). Conclusions: The benefit of susceptibility-guided treatment over Methods: The European Registry on H. pylori management (Hp- empirical treatment of H. pylori infection could not be demonstrated, EuReg) data from Spain, Italy and Portugal was used to emulate a either in first-line (if the most updated quadruple regimens are pre- target trial with prospective observational data, comparing the scribed) or in rescue therapies. relative effectiveness (modified intention-to-treat, mITT; and per- M. Espada: None. O.P. Nyssen: None. J.P. Gisbert: None. protocol, PP) and safety (adverse events, AEs) of first-line bismuth- single-capsule [10 days, 3 PPI dosages] and concomitant therapy [10/14 days; 3 PPI dosages], rendering 9 prescription strategies. Regression analysis controlling for confounders was used to estimate the relative effects of each strategy. Results: Overall, 2,340 individuals were included. Compared to 10- day concomitant therapy at low PPI doses (n = 484), all bismuth- single-capsule combinations presented an eradication incremental ABSTRACTS | 27 of 95 benefit by mITT ranging from 7.3% (95% CI: 1.1-13%; P = 0.024) with were found with respect to AEs or severe AEs in any of the assessed low dose PPI to 12.1% (95% CI: 5.1-19%; P < 0.001) with standard strategies. PPI dose. High PPI dosages in the concomitant therapy resulted in an Conclusions: Single-capsule bismuth quadruple therapy and non- eradication incremental benefit by mITT ranging from 7.7% (95% CI: bismuth quadruple concomitant therapy appear to have similar risk- 2.5-12.8; P = 0.003) to 8.8% (95% CI: 1.1-16.5; P = 0.025) when ad- benefit ratios when prescribed with high PPI doses. ministered for 14 and 10 days, respectively (Table 1). No differences

TABLE 1. Adjusted estimates* for eradication with respect to non-bismuth quadruple concomitant therapy during 10 days and low dose PPI

mITT absolute risk PP absolute risk Strategies difference (95% CI) P value difference (95% CI) P value

Bismuth-single-capsule, 10 days, low dose PPI 7.4 (1.8-13.1) 0.010 8.9 (3.4-13.5) 0.002 Bismuth-single-capsule, 10 days, standard dose PPI 12.1 (5.1-19.0) <0.001 12.6 (5.8-9.4) <0.001 Bismuth-single-capsule, 10 days, high dose PPI 7.3 (0.9-13.6) 0.025 8.3 (2.0-14.5) 0.009 Non-bismuth quadruple concomitant therapy, 10 days, standard dose PPI 8.2 (2.1-14.2) 0.008 8.0 (2.2-13.9) 0.007 Non-bismuth quadruple concomitant therapy, 10 days, high dose PPI 8.8 (1.1-16.5) 0.025 10.0 (2.5-17.6) 0.009 Non-bismuth quadruple concomitant therapy, 14 days, low dose PPI 4.5 (-1.8- 10.8) 0.166 4.6 (-1.6- 10.8) 0.145 Non-bismuth quadruple concomitant therapy, 14 days, standard dose PPI 7.5 (-0.6- 15.5) 0.069 6.8 (-1.0- 14.6) 0.088

Non-bismuth quadruple concomitant therapy, 14 days, high dose PPI 7.7 (2.5-12.8) 0.003 7.5 (2.4-12.5) 0.004 Low dose PPI: ranging from 4.5 to 27 mg omeprazole equivalents, b.i.d. Standard dose PPI: ranging from 32 to 40 mg omeprazole equivalents, b.i.d. High dose PPI: ranging from 54 to 128 mg omeprazole equivalents, b.i.d. Bismuth-single-capsule (PPI-bismuth-tetracycline-metronidazole). Non- bismuth quadruple concomitant therapy (PPI-amoxicillin-clarithromycin-nitroimidazole). *Estimates controlling for: age, sex, ethnicity, indication, concomitant allergy drug, hospital fixed effects and year fixed effects

I. Puig: None. M. Serra: None. O.P. Nyssen: None. G. Fiorini: None. D. Clinical Scientific Center, Moscow, Russian Federation; 4Department Vaira: None. I. Saracino: None. Á. Perez-Aisa: None. N. Fernandez- of Outpatient Therapy and Family Medicine, Tver State Medical Moreno: None. I. Santaella: None. M. Castro-Fernandez: None. L. University, Tver, Russian Federation; 5Department of Propaedeutic of Bujanda: None. A. Lucendo: None. M. Areia: None. A. Gasbarrini: Internal Diseases and Gastroenterology, A.I. Yevdok, Moscow, Russian None. M. Romano: None. A. Gravina: None. R. Marcos-Pinto: None. Federation; 6Gastroenterology Unit, AM DC Rogaska, Rogaska Slatina, F. Mégraud: None. C. O'Morain: None. J.P. Gisbert: None. Slovenia; 7Servicio de Gastroenterología, Agencia Sanitaria Costa del Sol, Red de Investigación en Servicios de Salud en Enfermedades Crónicas (REDISSEC), Marbella, Spain; 8Department of Surgical and EP2.22 | Antibiotic resistance trends of Helicobacter pylori Medical Sciences, University of Bologna, Bologna, Italy; 9Digestive naïve patients in the period 2013-2019: Analysis of the European Unit, Hospital de Valme, Sevilla, Spain; 10Medical Department, Registry on H. pylori Management (Hp-Eu-Reg) Central Hospital Ostfold, Fredrikstad, Norway; 11Institute of Clinical and Preventive Medicine & Faculty of Medicine, University of Latvia, L. Bujanda1; O. P. Nyssen2; D. S. Bordin3,4,5; A. Cosme1; B. Tepes6; Riga, Latvia; 12Gastroenterology Unit, Hospital Universitario Central A. Perez-Aisa7; D. Vaira8; M. Caldas2; M. Castro-Fernandez9; F. de Asturias, Oviedo, Spain; 13Gastroenterology Unit, Henry Dunant Lerang10; M. Leja11; L. Rodrigo12; T. Rokkas13; L. Kupcinskas14; Hospital, Athens, Greece; 14Department of Gastroenterology, Lithuanian J. Perez-Lasala15; L. Jonaitis14; O. Shvets16; A. Gasbarrini17; University of Health Sciences, Kaunas, Lithuania; 15Digestive Service, H. Simsek18; A. Axon19; G. Buzas20; J. Machado21; Y. Niv22; L. HM Sanchinarro, Madrid, Spain; 16Internal Diseases Department Boyanova23; A. Goldis24; V. Lamy25; A. Tonkic26; W. Marlicz27; No.1, National Medical University named after O.O. Bogomolets, Kyiv, C. Beglinger28; M. Venerito29; P. Bytzer30; L. Capelle31; T. Ukraine; 17Gastronterology Area, Fondazione Policlinico Universitario Milosavljevic32; L. Veijola33; J. Molina-Infante34; L. Vologhzanina35; A. Gemelli, Rome, Italy; 18Internal Medicine/Gastroenterology G. Fadeenko36; I. Ariño37; G. Fiorini8; E. Resina2; R. Muñoz2; I. department, Hacettepe University Faculty of Medicine, Ankara, Puig38; F. Megraud39; C. O'Morain40; J. P. Gisbert2; On behalf of the Turkey; 19Gastroenterology Unit, University of Leeds, Leeds, United Hp-EuReg Investigators Kingdom; 20Gastroenterology Unit, Ferencváros Policlinic, Budapest, 1Department of Gastroenterology. Hospital Donostia/Instituto Hungary; 21Instituto de Investigação e Inovação em Saúde, Universidade Biodonostia, Centro de Investigación Biomédica en Red de Enfermedades do Porto, and Ipatimup – Institute of Molecular Pathology and Hepáticas y Digestivas (CIBERehd), Universidad del País Vasco (UPV/ Immunology of the University of Porto, Porto, Portugal; 22Department EHU), Donosti, Spain; 2Hospital Universitario de La Princesa, IIS-IP, UAM, of Gastroenterology, Rabin Medical Center, Tel Aviv University, Tel Aviv, CIBEREHD, Madrid, Spain; 3Gastroenterolgy Unit, A. S. Loginov Moscow Israel; 23Department of Medical Microbiology, Medical University of 28 of 95 | ABSTRACTS

24 Sofia, Sofia, Bulgaria; Gastroenterology Unit, Timisoara Hospital, Objective: To conduct a time-trend analysis of the antibiotic re- 25 Timisoara, Romania; Department of Gastroenterology, Hepatology sistance to H. pylori infection in the European Registry on H. pylori 26 & Nutrition, CHU Charleroi, Charleroi, Belgium; University Hospital (Hp-EuReg). 27 Centre, Split, Croatia; Gastroenterology Unit, Pomeranian Medical Patients and Methods: International multicenter prospective non- 28 University, Szczecin, Poland; Gastroenterology Unit, Hospital interventional European Registry on H. pylori Management (Hp- 29 de Basel, Basel, Switzerland; Department of Gastroenterology, EuReg) aiming to evaluate the decisions and outcomes of H. pylori Hepatology and Infectious Diseases, Otto-von-Guericke University infection by European gastroenterologists. All infected adult pa- 30 Hospital, Magdeburg, Germany; Department of Medicine, Zealand tients diagnosed with culture and with a result of the antibiotic re- University Hospital, Copenhagen Universit, Copenhagen, Denmark; sistance test were registered at AEG-REDCap e-CRF from 2013 to 31 Gastroenterology and Hepatology, Erasmus MC University, Rotterdam, 2019. 32 Netherlands; Medical Department, Clinical Center of Serbia Clinic Results: A total of 32,447 patients were included, and culture was for Gastroenterology and hepatology, University of Belgrade, Belgrade, performed in 3,474 (11%), where 2,483 näive patients were included 33 Serbia; Internal Medicine, Herttoniemi Hospital, Helsinki, Finland; for analysis. Resistance to at least one antibiotic was described in 34 Gastroenterology Unit, Hospital San Pedro de Alcántara, Caceres, 57% of the patients. Resistance to metronidazole (27%) was most 35 Spain; Gastroenterology Unit Gastrocentre, Perm, Russian Federation; frequent, whereas resistance to tetracycline and amoxicillin was 36 Digestive Ukrainian Academy of Medical Sciences, Kyiv, Ukraine; below 1%. Clarithromycin resistance remained above 15% through- 37 Gastroenterology Unit, Hospital Clínico Universitario Lozano Blesa, out the studied years (Table 1). A significant decrease in the met- 38 Zaragoza, Spain; Althaia Xarxa Assistencial Universitària de Manresa ronidazole resistance rate was observed between 2013 (38%) and and Universitat de Vic-Universitat Central de Catalunya (UVicUCC), 2018 (21%). 39 Manresa, Spain; Laboratoire de Bactériologie, Hôpital Pellegrin, Conclusion: In naïve patients, resistance to clarithromycin re- 40 Bordeaux, Cedex, France; Trinity College Dublin – Faculty of Health mained above 15% in the period 2013-2019. A progressive de- Sciences, Trinity College Dublin, Dublin/IE, Faculty of Health Sciences, crease in metronidazole resistance was observed. No increasing or Dublin, Ireland decreasing trend was observed in the bacterial resistance to other antibiotics. Background: Bacterial antibiotic resistance changes over time based on multiple factors. It is essential to study these trends to apply preventive strategies to help reducing such resistances.

TABLE 1. Antibiotic resistance trends (2013-2019) of Helicobacter pylori naïve patients in Europe

Variation N (%) 2013 2014 2015 2016 2017 2018 2019 range

Nº Cultures 435 522 469 286 355 282 310 282-522 No resistance 210 (48) 259 (50) 197 (42) 93 (33) 162 (46) 106 (38) 104 (33.5) 33-50 Clarithromycin 86 (20) 120 (23) 117 (25) 59 (21) 68 (19) 65 (23) 57 (18) 18-25 (C) Metronidazole 165 (38) 156 (30) 140 (30) 72 (25) 64 (18) 60 (21) 66 (21) 18-38 (M) Levofloxacin (L) 58 (13) 100 (19) 103 (22) 46 (16) 59 (17) 55 (20) 41 (13) 13-22 Amoxicillin 6 (1) 0 (0) 0 (0) 0 (0) 10 (3) 1 (0.4) 0 (0) <1 Tetracycline 3 (0.7) 1 (0.2) 0 (0) 1 (0.3) 5 (1.4) 0 (0) 1 (0.3) <1.4 Dual (C+M) 56 (13) 65 (13) 62 (13) 33 (12) 30 (9) 28 (10) 29 (9) 9-13 Triple (C+M+L) 22 (5) 31 (6) 32 (7) 16 (6) 12 (3) 12 (4) 8 (3) 3-7 C, clarithromycin; L, levofloxacin; M, metronidazole.

L. Bujanda: None. O. P. Nyssen: None. D. S. Bordin: None. A. Cosme: Venerito: None. P. Bytzer: None. L. Capelle: None. T. Milosavljevic: None. B. Tepes: None. A. Perez-Aisa: None. D. Vaira: None. M. None. L. Veijola: None. J. Molina-Infante: None. L. Vologhzanina: Caldas: None. M. Castro-Fernandez: None. F. Lerang: None. M. Leja: None. G. Fadeenko: None. I. Ariño: None. G. Fiorini: None. E. None. L. Rodrigo: None. T. Rokkas: None. L. Kupcinskas: None. J. Resina: None. R. Muñoz: None. I. Puig: None. C. O'Morain: None. F. Perez-Lasala: None. L. Jonaitis: None. O. Shvets: None. A. Gasbarrini: Megraud: None. J.P. Gisbert: None. None. H. Simsek: None. A. Axon: None. G. Buzas: None. J. Machado: None. Y. Niv: None. L. Boyanova: None. A. Goldis: None. V. Lamy: None. A. Tonkic: None. W. Marlicz: None. C. Beglinger: None. M. ABSTRACTS | 29 of 95

EP2.23 | Tailored therapy based on clarithromycin resistance is Enfermedades Hepáticas y Digestivas (CIBERehd), Universidad del 2 effective for the first-line therapy of Helicobacter pylori País Vasco (UPV/EHU), Donosti, Spain; Hospital Universitario de La Princesa, IIS-IP, UAM, CIBEREHD, Madrid, Spain; 3Gastroenterolgy S. Moon; H. Kang; C. Lim; J. OH Unit, A. S. Loginov Moscow clinical scientific center, Moscow, Russian 4 The Catholic University of Korea, Seoul, Republic of Korea Federation; Department of Outpatient Therapy and Family Medicine, Tver State Medical University, Tver, Russian Federation; 5Department Background: Standard triple therapy (STT, PPI-clarithromycin- of propaedeutic of internal diseases and gastroenterology, A.I. Yevdoki, 6 amoxicillin) for Helicobacter pylori (H. pylori) eradication regi- Moscow, Russian Federation; Gastroenterology Unit, AM DC 7 men shows a lower treatment success rate recently. Dual Priming Rogaska, , Rogaska Slatina, Slovenia; Servicio de Gastroenterología, Oligonucleotide – based multiplex polymerase chain reaction (DPO- Agencia Sanitaria Costa del Sol, Red de Investigación en Servicios PCR) can be used to detect A2142G and/or A2143G point mutations de Salud en Enfermedades Crónicas (REDISSEC), Marbella, Spain; 8 of H. Pylori causing clarithromycin resistance (CAM-R). We com- Department of Surgical and Medical Sciences, University of Bologna, 9 pared the eradication rate of H. pylori between empirical STT and Bologna, Italy; Digestive Unit, Hospital de Valme, Sevilla, Spain; 10 tailored therapy by DPO-PCR. Medical Department, Central Hospital Ostfold, Fredrikstad, Norway; 11 Methods: A total of 575 H. pylori-infected patients were retrospec- Institute of Clinical and Preventive Medicine & Faculty of Medicine, 12 tively evaluated in Eunpyeong St. Mary's Hospital, Korea. Empirical University of Latvia, Riga, Latvia; Gastroenterology Unit, Hospital 13 therapy by traditional method (Warthin-Starry silver stain) group Universitario Central de Asturias, Oviedo, Spain; Gastroenterology 14 was treated with STT. DPO-PCR was performed in the tailored Unit, Henry Dunant Hospital, Athens, Greece; Department of therapy group. The CAM-R positive patients (who had A2142G and/ Gastroenterology, Lithuanian University of Health Sciences, Kaunas, 15 or A2143G point mutations) were treated with bismuth-containing Lithuania; Digestive Service, HM Sanchinarro, Madrid, Spain; 16 quadruple therapy (PPI-bismuth- metronidazole- tetracycline) for Internal Diseases Department No.1, National Medical University 17 7-14 days, while the CAM-R negative patients were treated with STT named after O.O. Bogomolets, Kyiv, Ukraine; Gastronterology Area, 18 for 7-14 days. Eradication success was defined as a negative 13C- Fondazione Policlinico Universitario A. Gemelli, Rome, Italy; Internal urea breath test at least 4 weeks after the treatment ended. Medicine/Gastroenterology department, Hacettepe University Faculty 19 Results: We included 536 patients, 39 patients were lost to follow-up: of Medicine, Ankara, Turkey; Gastroenterology Unit, University of 20 284 patients were treated by empirical STT as first-line and 242 patients Leeds, Leeds, United Kingdom; Gastroenterology Unit, Ferencváros 21 belonged to the tailored therapy group. The tailored therapy group was Policlinic, Budapest, Hungary; Instituto de Investigação e Inovação superior to the empirical therapy group in terms of first-line therapy em Saúde, Universidade do Porto, and Ipatimup – Institute of Molecular both in the intention-to-treat analysis (70.4% vs 83.7%, P = 0.0002) and Pathology and Immunology of the University of Porto, Porto, Portugal; 22 in the per-protocol analysis (76.9% vs 89.4%, P = 0.0003). Clarithromycin Department of Gastroenterology, Rabin Medical Center, Tel Aviv 23 resistance ratio by DPO-PCR was 33.1% (80/242). University, Tel Aviv, Israel; Department of Medical Microbiology, 24 Conclusion: The tailored therapy by DPO-PCR is more effective Medical University of Sofia, Sofia, Bulgaria; Gastroenterology 25 than the empirical therapy for the first-line therapy of H. pylori in a Unit, Timisoara Hospital, Timisoara, Romania; Department country with a high clarithromycin resistance. of Gastroenterology, Hepatology & Nutrition, CHU Charleroi, 26 S. Moon: None. H. Kang: None. C. Lim: None. J. Oh: None. Charleroi, Belgium; University Hospital Centre, Split, Croatia; 27Gastroenterology Unit, Pomeranian Medical University, Szczecin, Poland; 28Gastroenterology Unit, Hospital de Basel, Basel, Switzerland; 29 EP2.24 | Helicobacter pylori antibiotic resistance: Data from the Department of Gastroenterology, Hepatology and Infectious European Registry on H. pylori Management (Hp-EuReg) Diseases, Otto-von-Guericke University Hospital, Magdeburg, Germany; 30Department of Medicine, Zealand University Hospital, 31 L. Bujanda1; O. P. Nyssen2; A. Cosme1; D. Bordin3,4,5; B. Tepes6; Copenhagen University, Copenhagen, Denmark; Gastroenterology A. Perez-Aisa7; D. Vaira8; M. Caldas2; M. Castro-Fernandez9; F. and Hepatology, Erasmus MC University, Rotterdam, Netherlands; 32 Lerang10; M. Leja11; L. Rodrigo12; T. Rokkas13; L. Kupcinskas14; Medical Department, Clinical Center of Serbia Clinic for J. Perez-Lasala15; L. Jonaitis14; O. Shvets16; A. Gasbarrini17; H. Gastroenterology and Hepatology, University of Belgrade, Belgrade, 33 Simsek18; A. T. R Axon19; G. Buzas20; J. Machado21; Y. Niv22; L. Serbia; Internal Medicine, Herttoniemi Hospital, Helsinki, Finland; 34 Boyanova23; A. Goldis24; V. Lamy25; A. Tonkic26; W. Marlicz27; Gastroenterology Unit, Hospital San Pedro de Alcántara, Caceres, 35 C. Beglinger28; M. Venerito29; P. Bytzer30; L. Capelle31; T. Spain; Gastroenterology Unit Gastrocentre, Perm, Russian 36 Milosavljevic32; L. Veijola33; J. Molina-Infante34; L. Vologhzanina35; Federation; Digestive Ukrainian Academy of Medical Sciences, Kyiv, 37 G. Fadeenko36; I. Ariño37; G. Fiorini8; E. Resina2; R. Muñoz2; I. Ukraine; Gastroenterology Unit, Hospital ClÍnico Universitario Lozano 38 Puig38; F. Megraud39; C. O'Morain40; J. P. Gisbert2; On behalf of the Blesa, Zaragoza, Spain; Althaia Xarxa Assistencial Universitària Hp-EuReg Investigators de Manresa and Universitat de Vic-Universitat Central de Catalunya 39 1Department of Gastroenterology. Hospital Donostia/Instituto (UVicUCC), Manresa, Spain; Laboratoire de Bactériologie, Hôpital 40 Biodonostia, Centro de Investigación Biomédica en Red de Pellegrin, Bordeaux Cedex, France; Trinity College Dublin – Faculty 30 of 95 | ABSTRACTS of Health Sciences, Trinity College Dublin, Dublin/IE, Faculty of Health registered at AEG-REDCap e-CRF from 2013 to 2019. Per-protocol Sciences, Dublin, Ireland (PP) analysis was performed. The antibiotic bacterial resistances were described by treatment line. Background: Antibiotic resistance is the major factor affecting our Results: A total of 32,447 patients were included, and culture was ability to cure Helicobacter pylori infection. Understanding the dif- performed in 3,474 (11%). In naïve patients, 21% reported single ferent H. pylori antibiotic resistances could be the key to improve clarithromycin resistance, and 11% dual (clarithromycin and metro- treatment effectiveness. nidazole) resistance. Antibiotic resistance increased markedly from Objective: To evaluate the H. pylori antibiotic resistance both prior the first treatment, reaching over 37% dual resistance in second-line and after one or several eradication treatments, in order to provide treatment (Table 1). the most appropriate recommendations for the eradication of H. Conclusion: In Europe, culture testing to determine antibiotic resist- pylori. ance against H. pylori is scarce. H. pylori single clarithromycin resist- Methods: International multicenter prospective non-interventional ance remains high (>15%) in all treatment lines, and greater than 20% European Registry on H. pylori Management (Hp-EuReg) aiming in naïve patients. Dual or triple resistances are frequent and increase to evaluate the decisions and outcomes of H. pylori infection by remarkably after the first treatment failure. Resistance to amoxicillin European gastroenterologists. Infected adult patients diagnosed or tetracycline is exceptional. with culture and with a result of the antibiotic resistance test

TABLE 1. Helicobacter pylori antibiotic resistances (by treatment line) in Europe

Treatment line Naïve (%) Second (%) Third (%) Fourth (%) Fifth (%) Sixth (%) P-value

Number of patients 2,485 521 311 97 31 11 No resistance 1,054 (42) 74 (14) 26 (8) 7 (7) 4 (13) 1 (9) <0.001 Clarithromycin (C) 531 (21) 298 (57) 217 (70) 72 (74) 23 (74) 5 (45) <0.001 Metronidazole (M) 674 (27) 251 (48) 192 (62) 59 (61) 19 (61) 7 (64) <0.001 Levofloxacin (L) 438 (18) 134 (26) 130 (42) 44 (45) 12 (39) 3 (27) <0.001 Amoxicillin 17 (1) 4 (1) 5 (2) 0 (0) 0 (0) 0 (0) <0.001 Tetracycline 11 (0.4) 3 (1) 2 (0.6) 1 (1) 0 (0) 0 (0) >0.05 Dual (C+M) 279 (11) 195 (37) 165 (53) 52 (54) 17 (55) 5 (46) <0.001 Triple (C+M+L) 128 (5) 91 (18) 99 (32) 34 (35) 9 (29) 3 (27) <0.001 C, clarithromycin; L, levofloxacin; M, metronidazole.

L. Bujanda: None. O.P. Nyssen: None. A. Cosme: None. D. Bordin: EP2.25 | Impact of Helicobacter pylori clarithromycin resistance None. B. Tepes: None. A. Perez-Aisa: None. D. Vaira: None. M. on the treatment effectiveness: Data of the European Registry on Caldas: None. M. Castro-Fernandez: None. F. Lerang: None. M. H. pylori Management (Hp-EuReg) Leja: None. L. Rodrigo: None. T. Rokkas: None. L. Kupcinskas: None. J. Perez-Lasala: None. L. Jonaitis: None. O. Shvets: None. A. L. Bujanda1; O. P. Nyssen2; A. Cosme1; D. Bordin3,4,5; B. Tepes6; Gasbarrini: None. H. Simsek: None. A. T. R Axon: None. G. Buzas: A. Perez-Aisa7; D. Vaira8; M. Caldas2; M. Castro-Fernandez9; F. None. J. Machado: None. Y. Niv: None. L. Boyanova: None. A. Lerang10; M. Leja11; L. Rodrigo12; T. Rokkas13; L. Kupcinskas14; Goldis: None. V. Lamy: None. A. Tonkic: None. W. Marlicz: None. J. Perez-Lasala15; L. Jonaitis14; O. Shvets16; A. Gasbarrini17; H. C. Beglinger: None. M. Venerito: None. P. Bytzer: None. L. Capelle: Simsek18; A. T. R Axon19; G. Buzas20; J. Machado21; Y. Niv22; L. None. T. Milosavljevic: None. L. Veijola: None. J. Molina-Infante: Boyanova23; A. Goldis24; V. Lamy25; A. Tonkic26; W. Marlicz27; None. L. Vologhzanina: None. G. Fadeenko: None. I. Ariño: None. C. Beglinger28; M. Venerito29; P. Bytzer30; L. Capelle31; T. G. Fiorini: None. E. Resina: None. R. Muñoz: None. I. Puig: None. F. Milosavljevic32; L. Veijola33; J. Molina-Infante34; L. Vologhzanina35; Megraud: None. C. O'Morain: None. J.P. Gisbert: None. G. Fadeenko36; I. Ariño37; G. Fiorini8; E. Resina2; R. Muñoz2; I. Puig38; F. Megraud39; C. O'Morain40; J. P. Gisbert2; On behalf of the Hp-EuReg Investigators 1Department of Gastroenterology. Hospital Donostia/Instituto Biodonostia, Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd). Universidad del País Vasco (UPV/EHU), Donosti, Spain; 2Hospital Universitario de La Princesa, IIS-IP, UAM, CIBEREHD, Madrid, Spain; 3Gastroenterolgy Unit, A. S. Loginov Moscow Clinical Scientific Center, Moscow, Russian ABSTRACTS | 31 of 95

4 Federation; Department of Outpatient Therapy and Family Medicine, Background: Antibiotic resistance is the major factor affecting our 5 Tver State Medical University, Tver, Russian Federation; Department ability to cure Helicobacter pylori infection. Quadruple therapy is cur- of Propaedeutic of Internal Diseases and Gastroenterology, Moscow, rently recommended; however, triple therapy with two antibiotics 6 Russian Federation; Gastroenterology Unit, AM DC Rogaska, Slatina, may be sufficient in those patients without clarithromycin resistance. 7 Slovenia; Servicio de Gastroenterología, Agencia Sanitaria Costa Objective: To evaluate the effectiveness of the treatments accord- del Sol, Red de Investigación en Servicios de Salud en Enfermedades ing to the clarithromycin H. pylori resistance in Europe. 8 Crónicas (REDISSEC), Marbella, Spain; Department of Surgical and Methods: International multicenter prospective non-interventional 9 Medical Sciences, University of Bologna, Bologna, Italy; Digestive European Registry on H. pylori Management (Hp-EuReg) aiming to 10 Unit, Hospital de Valme, Sevilla, Spain; Medical Department, evaluate the decisions and outcomes of H. pylori infection. Infected 11 Central Hospital Ostfold, Fredrikstad, Norway; Institute of Clinical adult patients diagnosed with culture registered at AEG-REDCap e- and Preventive Medicine & Faculty of Medicine, University of Latvia, CRF from 2013 to 2019. Per-protocol (PP) analysis was performed 12 Riga, Latvia; Gastroenterology Unit, Hospital Universitario Central based on the presence or absence of clarithromycin bacterial 13 de Asturias, Oviedo, Spain; Gastroenterology Unit, Henry Dunant resistance. 14 Hospital, Athens, Greece; Department of Gastroenterology, Results: Overall, 5,036 patients were included: 1,747 (35%) were re- Lithuanian University of Health Sciences, Kaunas, Lithuania; sistant and 3,289 (65%) sensitive to clarithromycin. The overall erad- 15 16 Digestive Service, HM Sanchinarro, Madrid, Spain; Internal ication rate was higher in clarithromycin-susceptible patients (91% Diseases Department No.1, National Medical University named after vs 84%; P < 0.001). Triple therapy with a PPI, clarithromycin and 17 O.O. Bogomolets, Kyiv, Ukraine; Gastronterology Area, Fondazione amoxicillin achieved over 90% eradication rates in clarithromycin- 18 Policlinico Universitario A. Gemelli, Rome, Italy; Internal Medicine/ susceptible patients. However, in those with clarithromycin- Gastroenterology department, Hacettepe University Faculty of resistance, optimal effectiveness was only achieved when treated 19 Medicine, Ankara, Turkey; Gastroenterology Unit, University of with quadruple therapy with a PPI, clarithromycin, amoxicillin and 20 Leeds, Leeds, United Kingdom; Gastroenterology Unit, Ferencváros bismuth (Table 1). 21 Policlinic, Budapest, Hungary; Instituto de Investigação e Inovação Conclusions: Classic triple therapy with a PPI, clarithromycin and em Saúde, Universidade do Porto, and Ipatimup – Institute of Molecular amoxicillin achieves optimal results (>90%) in patients susceptible Pathology and Immunology of the University of Porto, Porto, Portugal; to clarithromycin. However, when clarithromycin resistance is un- 22 Department of Gastroenterology, Rabin Medical Center, Tel Aviv known, quadruple therapy with a PPI, clarithromycin, amoxicillin and 23 University, Tel Aviv, Israel; Department of Medical Microbiology, bismuth may be a better treatment option. Medical University of Sofia, Sofia, Bulgaria; 24Gastroenterology Unit, Timisoara Hospital, Timisoara, Romania; 25Department of Gastroenterology, Hepatology & Nutrition, CHU Charleroi, Charleroi, Belgium; 26University Hospital Centre, Split, Croatia; 27Gastroenterology Unit, Pomeranian Medical University, Szczecin, Poland; 28Gastroenterology Unit, Hospital de Basel, Basel, Switzerland; 29Department of Gastroenterology, Hepatology and Infectious Diseases, Otto-von-Guericke University Hospital, Magdeburg, Germany; 30Department of Medicine, Zealand University Hospital, Copenhagen University, Copenaguen, Denmark; 31Gastroenterology and Hepatology, Erasmus MC University, Rotterdam, Netherlands; 32Medical Department, Clinical Center of Serbia Clinic for Gastroenterology and hepatology, University of Belgrade, Belgrade, Serbia; 33Internal Medicine, Herttoniemi Hospital, Helsinki, Finland; 34Gastroenterology Unit, Hospital San Pedro de Alcántara, Caceres, Spain; 35Gastroenterology Unit Gastrocentre, Perm, Russian Federation; 36Digestive Ukrainian Academy of Medical Sciences, Kyiv, Ukraine; 37Gastroenterology Unit, Hospital ClÍnico Universitario Lozano Blesa, Zaragoza, Spain; 38Althaia Xarxa Assistencial Universitària de Manresa and Universitat de Vic-Universitat Central de Catalunya (UVicUCC), Manresa, Spain; 39Laboratoire de Bactériologie, Hôpital Pellegrin, Bordeaux Cedex, France; 40Trinity College Dublin – Faculty of Health Sciences, Trinity College Dublin, Dublin/IE, Faculty of Health Sciences, Dublin, Ireland 32 of 95 | ABSTRACTS

TABLE 1. Effect of the clarithromycin Helicobacter pylori on the effectiveness in Europe

Clarithromycin resistant Clarithromycin susceptible

Treatment schemes E N % E N %

Overall 754 897 84 1.512 1.658 91 Triple-C+A 11 14 79 392 431 91 Triple-A+L 165 191 86 47 55 85 Triple-A+M 46 55 84 147 166 89 Triple-A+R 91 102 89 9 11 82 Triple-C+M NA NA NA 17 19 89 Quadruple-C+A+M/T 43 54 80 88 100 88 Quadruple-C+A+B 10 11 91 36 40 90 Sequential-C+A+T 242 286 85 627 664 94 Sequential-C+A+M 17 23 74% 41 53 77% Hybrid-C+A+M 27 34 79% 36 38 95% Single capsule 66 80 83% 53 54 98% A, amoxicillin; B, bismuth; C, clarithromycin; E, number of eradicated patients; M, metronidazole; N, total number of patients analysed; T, tinidazole; Single capsule: three-in-one single capsule containing bismuth, tetracycline and metronidazole (marketed as Pylera®).

L. Bujanda: None. O.P. Nyssen: None. A. Cosme: None. D. Bordin: Aim: Assessment of trends in eradication effectiveness in Russia None. B. Tepes: None. A. Perez-Aisa: None. D. Vaira: None. M. using the 13C urea breath test (13C-UBT). Caldas: None. M. Castro-Fernandez: None. F. Lerang: None. M. Material and Methods: The results of 13C-UBT in patients after HP Leja: None. L. Rodrigo: None. T. Rokkas: None. L. Kupcinskas: eradication. The treatment was considered as effective, if control None. J. Perez-Lasala: None. L. Jonaitis: None. O. Shvets: None. A. test results came negative (DOB < 4‰). We analyzed the data on Gasbarrini: None. H. Simsek: None. A. T. R Axon: None. G. Buzas: 1217 patients (age 14-83 years, M – 467, F – 750) and 279 patients None. J. Machado: None. Y. Niv: None. L. Boyanova: None. A. (age 14-83 years, M – 112, F – 167) collected in 2017 and in 2019, re- Goldis: None. V. Lamy: None. A. Tonkic: None. W. Marlicz: None. spectively. Pearson's chi-square test was used for statistical analysis. C. Beglinger: None. M. Venerito: None. P. Bytzer: None. L. Capelle: Results: The average eradication rate increased insignificantly from 2 None. T. Milosavljevic: None. L. Veijola: None. J. Molina-Infante: 74.3% in 2017 to 78.9% in 2019 (χ = 2,081; р > 0.05). In 2017, 2 None. L. Vologhzanina: None. G. Fadeenko: None. I. Ariño: None. the rate reached 76.4% in women and 70.9% in men (χ = 4.594; G. Fiorini: None. E. Resina: None. R. Muñoz: None. I. Puig: None. F. P > 0.05) with no difference in the rate between age groups 2 Megraud: None. C. O'Morain: None. J.P. Gisbert: None. (χ = 0.563; P > 0.05). In 2019 it reached 79.6% in women and 77.7% 2 in men (χ = 0.155; P > 0.05) with no difference between age groups 2 (χ = 1.799; P > 0.05). EP2.26 | Trends in the effectiveness of eradication therapy in Conclusion: The HP eradication effectiveness rate in Russia is low. Russia Thorough studies data on treatment schemes and patients’ compliance is necessary for the eradication schemes selection. D. S. Bordin1,2,3; R. G. Plavnik4; E. Tivanova5; I. I. Skibo6; Y. V. D.S. Bordin: None. R.G. Plavnik: None. E. Tivanova: None. I.I. Skibo: Embutnieks1; I. V. Maev2 None. Y.V. Embutnieks: None. I.V. Maev: None. 1A.S. Loginov Moscow Clinical Scientific Center, Moscow, Russian Federation; 2A.I. Yevdokimov Moscow State University of Medicine and Dentistry, Moscow, Russian Federation; 3Tver State Medical University, Tver, Russian Federation; 4Peoples’ Friendship University of Russia, Moscow, Russian Federation; 5Central Research Institute of Epidemiology, Moscow, Russian Federation; 6Laboratory HELIX, Moscow, Russian Federation

The eradication therapy schemes with the effectiveness of at least 90% are recommended for H. pylori (HP) eradication. Local monitoring of eradication effectiveness is be done to find out the current effectiveness rate in each separate region. 13C-UBT is the most recommended modality for the effectiveness control. ABSTRACTS | 33 of 95

EP2.27 | The comparison of side effects and effectiveness of EP2.28 | The effects of Eupatilin of NSAID-gastropathy standard triple therapy with clarithromycin and alternative high- associated with H. pylori dose amoxicillin/bismuth therapy in eradication of H. pylori I. Skrypnyk; V. Parkhomenko; O. Gopko A. Lielause1,2; O. Sjomina1,2; A. Rūdule1; J. Priedola1; D. Pūpola1,3; Ukrainian Medical Stomatological Academy, Poltava, Ukraine R. Vangravs1; A. Kiršners1; S. Paršutins1; I. Poļaka1; E. Cine2; G. Šķenders1; D. Ražuka-Ebela2; M. Leja1,2,4 A topical issue is the study of the effects of Eupatilin on the mucous 1The Institute of Clinical and preventive medicine of the University of barrier of the gastroduodenal zone (GDZ) and oxidative stress in Latvia, Riga, Latvia; 2Faculty of Medicine, University of Latvia, Riga, patients with H. pylori-related nonsteroidal anti-inflammatory drugs Latvia; 3Latvian Biomedical Research and Study Centre, Riga, Latvia; (NSAIDs)-gastropathy. The study involved 43 patients, the mean age 4Digestive Disease Centre GASTRO, Riga, Latvia of the patients was 63.8 ± 9.1 years. The patients were divided into 2 groups: I (n = 23) – treated with antihelicobacter therapy (AHBT) Background: Antibiotics are standard treatment for Helicobacter according to Maastricht-V (2016) recommendations; group II (n = 20) pylori infection. A standard triple therapy tends to cause wide spec- – AHBT and Eupatilin 60 mg 3 times a day for 28 days. The presence trum of side effects, which may lead to therapy discontinuations, of H. pylori was diagnosed by determining the H. pylori antigen in fae- decrease of eradication rate and increase the risk of developing ces (stool-test). The state of mucous-forming function of GDZ mu- resistance. cous membrane was assessed by the content of N-acetylneuraminic Aim: Compare the effectiveness and the spectrum of side effects acid (NANA) and fucoproteins in serum, the activity of free-radical of standard triple H. pylori eradication therapy and alternative high oxidation – by the concentration of TBA-reactive products and cat- dose amoxicillin/bismuth therapy. alase activity in the blood serum. Positive effect of Eupatilin after Methods: Participants were healthy individuals aged 40-64. 1.5 months of complex treatment was noticed by lower 1.2-fold Eradication subgroup underwent UBT and serology; 483 posi- (P < 0.05) serum NANA concentration compared with patients of tive patients were randomly divided into eradication subgroups – group I, a significantly higher in 1.4 times raise of fucoproteins levels standard triple therapy (Amoxicillin 1 g ×2, Clarythromycin 0.5 g ×2 after 14 days of treatment and in 1.5 times (P < 0.02) after 45 days. and Esomeprazole 0.04 g ×2 – 14 days) 248 and alternative therapy The antioxidant effect of Eupatilin was confirmed by 1.5-fold lower (Amoxicillin 1 g ×3, Esomeprazole 0.04 g ×2 and Bismuth subcitrate (P < 0.02) concentrations of TBA-reactive products in serum and 0.24 g ×2 – 14 days) 235. After 21-28 days side effects and compli- 1.2-fold higher (P < 0.05) of serum catalase activity in patients of ance were registered. group II compared to group I. Complex therapy with the inclusion Results: During standard treatment of H. pylori with clarithromy- of Eupatilin, in comparison with traditional AHBT, significantly im- cin (TER1) 56.9% (n = 141) and in alternative therapy with Bismuth proves the clinical course of H. pylori-associated NSAID-gastropathy Subcitrate (TER2) 40.0% (n = 94) patients experience side effects due to the cytoprotective and antioxidant effects. (P < 0.01). The most frequent adverse reactions in the TER1 group I. Skrypnyk: None. V. Parkhomenko: None. O. Gopko: None. were bitter taste (P < 0.01), diarrhoea (P < 0.01), fatigue (P = 0.02) and vomiting (P = 0.04), and in the TER2 group – discoloration of the stool (P < 0.01). The higher efficacy of eradication was demonstrated in the TER1 group – 88.1% (n = 140) and relatively the eradication efficacy of TER2 reached 77.9% (n = 116) (P = 0.01). Conclusions: Clarithromycin-containing therapy more often causes side effects: a bitter taste, diarrhea, fatigue and vomiting. Alternative therapy include discoloration of the stool. Standard triple therapy achieves a higher eradication rate than alternative bismuth therapy. A. Lielause: None. O. Sjomina: None. A. Rūdule: None. J. Priedola: None. D. Pūpola: None. R. Vangravs: None. A. Kiršners: None. S. Paršutins: None. I. Poļaka: None. E. Cine: None. G. Šķenders: None. D. Ražuka-Ebela: None. M. Leja: None. 34 of 95 | ABSTRACTS

EP2.29 | Excellent performance of 2-weeks tailored triple Results: Of 756 completed cases, 419 met inclusion criteria (52% therapy in H. pylori infected children: Interim results of the new female, median age: 13 years). Strains susceptible to CLA and MET EuroPedHp Registry were detected in 60% (n = 252), double-resistance in 2% (n = 10). Primary resistance to CLA and MET was high (24%, 18%, respec- T. Le Thi1; K. Werkstetter1; J. Cabral2; K. Kotilea3; P. Bontems3; J. tively). PAC was given to 59%, PAM to 41% of cases; 96% were Barrio4; M. Cilleruelo Pascual5; M. Homan6; M. Kori7; P. Urruzuno8; treated for 14 days. Antibiotics were dosed according to guidelines N. Kalach9; Z. Misak10; R. Lima11; M. Tavares11,12; E. Miele13; V. in >80%, while PPI dose was too low in 52%. The ER in relation to Urbonas14; A. Chiaro15,16; A. Papadopoulou17; J. Sykora18; A. country of living, antibiotic susceptibility, treatment regimen and Krahl19; K. Matusiewics20; M. Korkut Ugras21; F. Rea22; E. Roma17; compliance is shown in Table 1. In fully susceptible subgroup, PAC T. Casswall23; M. Klemenak24; A. Cseh25; J. de Laffolie26; M. tended to have higher risk for treatment failure than PAM (92% vs 27 28 29 1 Rogalidou ; A. Lopes ; H. Banoub ; S. Koletzko ; On behalf of the 95%, ORadj = 1.6, 95% CI: 0.5-5.0, P = 0.4). H. pylori Working Group of ESPGHAN 1Dr. von Hauner Children's Hospital, LMU University Hospital of TABLE 1. Risk factors for eradication failure in 419 treatment Munich, Munich, Germany; 2Dona Estefânia Hospital, University naïve patients with TTT Hospital Centre of Central Lisbon, Lisbon, Portugal; 3Université Libre Eradication Eradication ORadj (95% de Bruxelles, Hôpital Universitaire des Enfants Reine Fabiola, Brussels, Factors success failed CI) P-value 4 Belgium; Hospital Universitario de Fuenlabrada Madrid, Madrid, Number of 376 (90%) 43 (10%) Spain; 5University Hospital Puerta de Hierro Majadahonda, Madrid, patients, n Spain; 6University Children's Hospital of Ljubljana, Ljubljana, Slovenia; (ER%) 7Kaplan Medical Center, Rehovot, Israel; 8Hospital 12 de Octobre, Country of living Madrid, Spain; 9Saint Antoine Pediatric Clinic, Saint Vincent de Paul North 100 (93%) 7 (7%) 1 (ref) Hospital, Catholic University, Lille, France; 10Children's Hospital Zagreb, and West Europe University of Zagreb, Zagreb, Croatia; 11Centro Materno Infantil do South 173 (91%) 18 (9%) 1.4 (0.6-3.6) 0.4 Norte, Porto Hospital Center, Porto, Portugal; 12Hospital Sao Joao, Europe Porto, Portugal; 13University of Naples “Federico II”, Naples, Italy; East Europe 84 (85%) 15 (15%) 2.5 0.05 14Clinic of Children's Diseases of Vilnius University, Vilnius, Lithuania; (1.0-6.5) 15Giannina Gaslini Children's Hospital and Research Institute, Genoa, Israel & 19 (86%) 3 (14%) 2.2 (0.5-9.5) 0.3 16 Italy; Department of Pediatrics, “Maggiore” Hospital, Crema, Italy; Turkey 17 University of Athens, Athens Children's Hospital “Agia Sofia”, Athens, Susceptibility groups Greece; 18Prof Charles University of Prague, Pilsen, Czech Republic; MET-S/ 233 (93%) 19 (7%) 1 (ref) 19 Darmstädter Kinderkliniken Prinzessin Margaret, Darmstadt, CLA-S 20 Germany; Department of Pediatrics, Gastroenterology and Nutrition, MET-S/ 80 (87%) 12 (13%) 1.8 (0.8-3.9) 0.1 21 Wroclaw Medical University, Wroclaw, Poland; Yeditepe University CLA-R 22 Medical Faculty, Istanbul, Turkey; Digestive Endoscopy and Surgery MET-R/ 53 (82%) 12 (18%) 2.8 (1.3-6.2) 0.01 Unit, Bambino Gesù Children's Hospital, Rome, Italy; 23Karolinska CLA-S University Hospital, Stockholm, Sweden; 24University Medical Centre MET-R/ 10 (100%) 0 (0%) na na Maribor, Maribor, Slovenia; 25Department of Pediatrics, Semmelweis CLA-R University, Budapest, Hungary; 26University Children's Hospital of Treatment regimen Giessen, Giessen, Germany; 27University Hospital of Ioannina, Pediatrics PPI + AMO 159 (92%) 14 (8%) 1 (ref) Department & Ped. Gastroenterology, Ioannina, Greece; 28Hospital + MET (PAM) Santa Maria, Medical Faculty, University of Lisbon, Lisbon, Portugal; 29Queen Mary's Hospital for Children, Carshalton, United Kingdom PPI + AMO 217 (88%) 29 (12%) 1.5 (0.8-3.0) 0.2 + CLA (PAC) Drug dosing according to guidelines Aims: To evaluate eradication rate (ER) of antibiotic susceptibility Yes 165 (91%) 17 (9%) 1 (ref) tailored triple therapy (TTT) according to the updated ESPGHAN and NASPGHAN Guidelines (JPGN 2017;64: 991-1003). No 202 (89%) 25 (11%) 1.3 (0.7-2.4) 0.5 Methods: Since 2017, 30 centers from 17 European countries re- Compliance to therapy ported prospectively demographic, clinical and follow up data of H. Excellent 346 (93%) 27 (7%) 1 (ref) pylori infected pediatric patients. For this analysis, we included all 90-100% treatment naïve children with biopsy proven infection and antibiotic Lower than 15 (63%) 9 (37%) 7.7 <0.0001 90% (3.0-19.2) susceptibility results for clarithromycin (CLA) and metronidazole OR obtained from multivariate logistic analysis adjusted for gender (MET), who received TTT with PPI + Amoxicillin + CLA (PAC) or MET adj and age. Significant results are given in bold characters. (PAM). ER was accessed 4 to 8 weeks after completed treatment. ABSTRACTS | 35 of 95

Conclusions: TTT for 2 weeks reached 90% ER. Increasing drug dose Methods: The study was performed on two reference strains, H. py- and compliance may further improve treatment success. lori Tx30a and J99. The activity of myricetin alone and in combination T. Le Thi: None. K. Werkstetter: None. J. Cabral: None. K. Kotilea: with antibiotics with the highest (clarithromycin and metronidazole) None. P. Bontems : D. Speakers Bureau/Honoraria (speakers bu- and the lowest resistance prevalence (amoxicillin – a control antibi- reau, symposia, and expert witness); Modest; Abbvie, Ferring and otic) was performed using the microtiter and checkerboard method. Nutricia. F. Consultant/Advisory Board; Modest; Biocodex. J. Barrio: Bacterial morphology and viability were determined by microscopy None. M. Cilleruelo Pascual: None. M. Homan: None. M. Kori: None. and flow cytometry. P. Urruzuno : None. N. Kalach : None. Z. Misak : B. Research Grant Results: It was noticed that incubation of H. pylori with 1/16 to 1/2 (principal investigator, collaborator or consultant and pending grants minimal inhibitory concentrations of myricetin (0.128-1.024 mM) as well as grants already received); Modest; GlaxoSmithKline, Abbvie, significantly reduced the transition of this bacterium into a coccoid Pharmas, and Wurth. R. Lima: None. M. Tavares: None. E. Miele: B. form and increased the average ratio of green/red fluorescence of Research Grant (principal investigator, collaborator or consultant and cells. A synergistic interaction of myricetin was demonstrated with pending grants as well as grants already received); Modest; Nestle all antibiotics tested, allowing for a 4-16-fold reduction in their Italy and Nutricia Italy. D. Speakers Bureau/Honoraria (speakers bu- concentrations. reau, symposia, and expert witness); Modest; Ferring. F. Consultant/ Summary: The obtained results suggest that myricetin most prob- Advisory Board; Modest; Abbvie. V. Urbonas: None. A. Chiaro: None. ably sensitizes H. pylori to the antibiotics used by keeping this bacte- A. Papadopoulou: B. Research Grant (principal investigator, collabo- rium in a spiral, metabolically active form. rator or consultant and pending grants as well as grants already re- P. Krzyżek: None. E. Paluch: None. G. Gościniak: None. ceived); Modest; BioGaia and Abbvie. D. Speakers Bureau/Honoraria (speakers bureau, symposia, and expert witness); Modest; Nestle, Nutricia, Vian, Friesland, Abbvie, Aventis. F. Consultant/Advisory EP2.31 | Counteracting Helicobacter pylori using drug-free Board; Modest; Adare Pharmaceuticals and Adacyte Therapeutics. nanostructured lipid carriers (NLC) J. Sykora: None. A. Krahl: None. K. Matusiewics: None. M. Korkut Ugras: None. F. Rea: None. E. Roma: D. Speakers Bureau/Honoraria R. Chitas1,2,3; C. L. Seabra4; C. Nunes4; P. Parreira1,2; (speakers bureau, symposia, and expert witness); Modest; Abbvie. M. C. L. Martins1,2,3 T. Casswall: None. M. Klemenak: None. A. Cseh: B. Research Grant 1i3S – Instituto de Investigação e Inovação em Saúde, Universidade (principal investigator, collaborator or consultant and pending grants do Porto, Porto, Portugal; 2INEB – Instituto de Engenharia Biomédica, as well as grants already received); Modest; Abbvie, Biogaia, Ferring Universidade do Porto, Porto, Portugal; 3ICBAS – Instituto de Ciências and Danone. J. de Laffolie: None. M. Rogalidou: None. A. Lopes: Biomédicas Abel Salazar, Universidade do Porto, Porto, Portugal; None. H. Banoub: None. S. Koletzko: B. Research Grant (principal 4LAQV-REQUIMTE, Departamento de Ciências Químicas, Faculdade de investigator, collaborator or consultant and pending grants as well as Farmácia, Universidade do Porto, Porto, Portugal grants already received); Modest; Mead Johnson, Nestec Nutrition, BioGaia. D. Speakers Bureau/Honoraria (speakers bureau, sympo- Background: Current treatments for Helicobacter pylori (Hp) infec- sia, and expert witness); Modest; Nestle, Danone, Biocodex, Shire, tion are failing, due to the increase of antibiotic resistance1. Drug- Abbvie, R-Biopharm, Vifor, Pharmacosmos, Celgene, Thermo Fisher, free nanostructured lipid carriers (NLC) have been studied for Hp Janssen. eradication, showing both in vitro/vivo effect against Hp2,3. This work aims to optimize NLC efficiency by fine-tuning physicochemi- cal characteristics, in order to achieve Hp eradication. EP2.30 | Myricetin as a natural compound sensitizing H. pylori to Methods: In the preparation of NLC two surfactants were tested, antibiotics Tween60 ® and Tween80 ®. NLC were prepared by hot homogeniza- tion followed by ultrasonication2. Additionally, half of each formu- P. Krzyżek; E. Paluch; G. Gościniak lation was dialyzed, to wash eventual surfactant debris. They were Department of Microbiology, Wrocław Medical University, Wrocław, characterized in terms of size, charge and concentration. Dialyzed Poland and non-dialyzed NLC were tested in vitro against Hp J99 strain. Results: NLC with Tween60® had sizes around 250 nm and a surface Introduction: The high prevalence of H. pylori antibiotic resistance is charge of −27 mV. The same characteristics were only obtained in a major challenge for modern medicine. The level of primary resist- NLC with Tween80® after optimization of the ultrasonication pa- ance to clarithromycin and metronidazole in many countries around rameters. All NLC stocks had a final concentration in the range of the world has exceeded the threshold of 15%, preventing their use 1014 particles/mL. After 24 hours of incubation, both NLC formula- in empirical therapies. Therefore, the aim of this study was to deter- tions had similar outcomes, achieving a decrease of 3 logs from 107 mine the activity of myricetin, a flavonoid compound, as a substance to 103 CFU/mL (bactericidal effect). Non-dialyzed and dialyzed NLC sensitizing H. pylori to antibiotics. showed also the same bactericidal activity, what indicates that NLC have an effect per se. 36 of 95 | ABSTRACTS

20 Conclusions: Both formulations (Tween60® and Tween80®) were Russian Federation; Gastroenterology Unit of Hospital San Pedro effective against Hp, and the dialysis step didn't affect the NLC bac- de Alcántara, Cáceres and Centro de Investigación Biomédica en Red tericidal activity. These results support the therapeutic potential of de Enfermedades Hepáticas y Digestivas (CIBERehd), Caceres, Spain; 21 these nanoparticles. Universal clinic Private medical center, Moscow, Russian Federation; 22 References: 1. Testerman & Morris, World J Gastroenterol.2014. Gastroenterology Department of General Hospital Pireaus, Pireaus, 23 2. Seabra et al. Int J Pharm.2017. Greece; Gastroenterology Unit of Hospital San Jorge, Huesca, 24 3. Seabra et al. Eur J Pharm Biopharm.2018. Spain; Gastroenterology Unit of Hospital de Sierrallana Torrelavega, 25 Acknowledgments: PTDC/CTM-BIO/4043/201 and Cantabria, Spain; Molinette Hospital, Città della Salute e della 26 BiotechHealthDoctoralProgram Scienza di Torino, Turin, Italy; Digestive Diseases Department of R. Chitas: None. C.L. Seabra: None. C. Nunes: None. P. Parreira: Althaia Xarxa Assistencial Universitària de Manresa, Universitat de None. M.C.L. Martins: None. Vic-Universitat Central de Catalunya (UVicUCC), Manresa, Spain; 27Laboratoire de Bactériologie, Hôpital Pellegrin, Bordeaux, France; 28Department of Clinical Medicine, Trinity College Dublin, Dublin, EP2.32 | Effectiveness of first-line H. pylori eradication therapy Ireland according to the daily statin-use: Analysis of the European Registry on H. pylori Management (Hp-EuReg) Introduction: The use of statins with antibiotics and proton pump inhibitors has been suggested as a strategy to increase the effective- M. Caldas1; Á. Pérez-Aisa2; B. Tepes3; M. Castro-Fernández4; L. ness of Helicobacter pylori treatments, mainly based on their anti- Bujanda5; G. Fadeenko6; A. J. Lucendo7; D. Vaira8; L. Jonaitis9; inflammatory characteristics. However, evidence published so far N. Brglez Jurecic10; J. Pérez-Lasala11; L. Fernández-Salazar12; L. still remains scarce. Rodrigo13; J. Huguet14; M. Leja15; M. Areia16; J. Barrio17; J. Ortuño18; Aim: To analyse the impact of the daily use of statins in the effective- S. Alekseenko19; J. Molina-Infante20; P. Bogomolov21; V. Ntouli22; ness of H. pylori first-line therapies. M. Domínguez-Cajal23; R. Ruiz-Zorrilla24; R. Pellicano25; M. Espada1; Methods: Multicentre prospective non-interventional registry of the I. Puig26; O. P. Nyssen1; F. Megraud27; C. O´Morain28; J. P. Gisbert1; clinical practice of European gastroenterologists of the European On behalf of the Hp-EuReg Investigators Registry on H. pylori Management (Hp-EuReg). Patients were col- 1Gastroenterology Unit of Hospital Universitario de La Princesa, lected at AEG-REDCap e-CRF from 2013 to December 2019. Records Instituto de Investigación Sanitaria Princesa (IIS-IP), Universidad of naïve patients containing information about the statins’ use were Autónoma de Madrid, Centro de Investigación Biomédica en Red included for current analysis. Modified intention-to-treat (mITT) de Enfermedades Hepáticas y Digestivas (CIBEREHD), Madrid, analysis was performed to evaluate the treatment effectiveness. Spain; 2Gastroenterology Unit of Hospital Costa del Sol and Red Results: Overall, 7,687 patients received an empirical first-line de Investigación en Servicios de Salud en Enfermedades Crónicas therapy: 60.5% were women and median age was 56 years. From (REDISSEC), Marbella, Spain; 3Gastroenterology Unit of 3AM DC those, 1,895 (25%) were daily statins-users: 45% used simvastatin, Rogaska, Rogaska Slatina, Slovenia; 4Gastroenterology Unit of Hospital 35% atorvastatin, 11% rosuvastatin and 9% other statins. Univariate de Valme, Sevilla, Spain; 5Gastroenterology Unit of Hospital Donostia/ analysis showed no differences in the treatment effectiveness of the Instituto Biodonostia, Centro de Investigación Biomédica en Red de statin-users group versus no statin-users (Table). Enfermedades Hepáticas y Digestivas (CIBERehd), Universidad del Conclusions: The daily use of statins does not seem to increase the País Vasco (UPV/EHU), San Sebastián, Spain; 6Digestive Ukrainian effectiveness of H. pylori eradication treatment. Academy of Medical Sciences, Kyiv, Ukraine; 7Gastroenterology Unit of Hospital General de Tomelloso, Tomelloso, Spain; 8Gastroenterology TABLE 1. Impact of the statins’ use on the effectiveness of 9 most frequently used first-line empirical treatments in Europe. Unit of S. Orsola Malpighi Hospital, Bologna, Italy; Department of Gastroenterology of Lithuanian University of Health Sciences, Daily use Differences Kaunas, Lithuania; 10Krajnc Diagnosticni Center Bled, Bled, of statins mITT, N (%) (P-value) 11 Slovenia; Gastroenterology Unit of HM Sanchinarro, Madrid, Overall No 4,835 (88) 0.44 12 Spain; Gastroenterology Unit of Hospital Clínico Universitario de Yes 1,729 (88.5) Valladolid, Valladolid, Spain; 13Gastroenterology Unit of Hospital PPI+C+A No 1,790 (86) 0.05 Universitario Central de Asturias, Oviedo, Spain; 14Gastroenterology Yes 544 (82) Unit of Consorcio Hospital General Universitario de Valencia, PPI+C+M No 380 (82) 0.52 Valencia, Spain; 15Institute of Clinical and Preventive Medicine & Yes 95 (79) Faculty of Medicine, University of Latvia, Riga, Latvia; 16Portuguese PPI+Bi+Tc+M No 616 (94.5) 0.69 Oncology Institute Coimbra, Coimbra, Portugal; 17Gastroenterology Unit of Hospital Universitario Río Hortega, Valladolid, Spain; Yes 287 (95) 18Gastroenterology Unit of Hospital Universitari i Politècnic La Fe, Valencia, Spain; 19Far Eastern State Medical University, Khabarovsk, ABSTRACTS | 37 of 95

EP2.33 | Effectiveness of first-line H. pylori eradication Daily use Differences of statins mITT, N (%) (P-value) treatments in Spain: Results from the European Registry on H. pylori management (Hp-EuReg) PPI+C+A+M No 53 (81) 0.32 (Sequential) Yes 27 (93) M. Caldas1; Á. Pérez-Aisa2; M. Castro-Fernández3; L. Bujanda4; A. PPI+C+A +M No 1,189 (88) 0.08 J. Lucendo5; J. Huguet6; J. Molina-Infante7; L. Fernández-Salazar8; (Concomitant) Yes 527 (91) J. Ortuño9; M. Domínguez-Cajal10; P. Almela11; J. Botargués12; J. PPI+Bi+C+A No 612 (88) 0.12 Gómez13; C. De la Coba14; L. Pozzati15; M. Barenys16; M. Fernández- Yes 186 (92.5) Bermejo17; J. Alcedo18; M. Mego19; J. Domínguez-Jiménez20; N. mITT: modified intention-to-treat. N: number of patients included. Fernández2; M. Pabón-Carrasco3; H. Alonso-Galán4; I. Ariño21; A. %: proportion of patients showing effectiveness. PPI: proton pump Garre1; I. Puig22; O. P. Nyssen1; F. Megraud23; C. O´Morain24; J. P. inhibitor. C: clarithromycin. A: amoxicillin. M: metronidazole. Bi: 1 bismuth. Tc: tetracycline. Sequential: sequential administration of the Gisbert ; On behalf of the Hp-EuReg Investigators 1 treatment components. Concomitant: concomitant administration of Gastroenterology Unit of Hospital Universitario de La Princesa, the treatment components. Instituto de Investigación Sanitaria Princesa (IIS-IP), Universidad Autónoma de Madrid and Centro de Investigación Biomédica en M. Caldas: None. Á. Pérez-Aisa: None. B. Tepes: None. M. Castro- Red de Enfermedades Hepáticas y Digestivas (CIBERehd), Madrid, Fernández: None. L. Bujanda: None. G. Fadeenko: None. A. J. Spain; 2Gastroenterology Unit of Hospital Costa del Sol and Red Lucendo: None. D. Vaira: None. L. Jonaitis: None. N. Brglez Jurecic: de Investigación en Servicios de Salud en Enfermedades Crónicas None. J. Pérez-Lasala: None. L. Fernández-Salazar: None. L. Rodrigo: (REDISSEC), Marbella, Spain; 3Gastroenterology Unit of Hospital de None. J. Huguet: None. M. Leja: None. M. Areia: None. J. Barrio: Valme, Sevilla, Spain; 4Gastroenterology Unit of Hospital Donostia/ None. J. Ortuño: None. S. Alekseenko: None. J. Molina-Infante: Instituto Biodonostia, Centro de Investigación Biomédica en Red de None. P. Bogomolov: None. V. Ntouli: None. M. Domínguez-Cajal: Enfermedades Hepáticas y Digestivas (CIBERehd), Universidad del País None. R. Ruiz-Zorrilla: None. R. Pellicano: None. M. Espada: None. Vasco (UPV/EHU), San Sebastián, Spain; 5Gastroenterology Unit of I. Puig: None. O. P. Nyssen: None. F. Megraud: None. C. O´Morain: Hospital General de Tomelloso, Tomelloso, Spain; 6Gastroenterology None. J. P. Gisbert: None. Unit of Consorcio Hospital General Universitario de Valencia, Valencia, Spain; 7Gastroenterology Unit of Hospital San Pedro de Alcántara and Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd), Cáceres, Spain; 8Gastroenterology Unit of Hospital Clínico Universitario de Valladolid, Valladolid, Spain; 9Gastroenterology Unit of Hospital Universitari i Politècnic La Fe, Valencia, Spain; 10Gastroenterology Unit of Hospital San Jorge, Huesca, Spain; 11Gastroenterology Unit of Hospital Universitari General de Castelló, Castellón, Spain; 12Gastroenterology Unit of Hospital Universitari de Bellvitge, Barcelona, Spain; 13Gastroenterology Unit of Complejo Asistencial Universitario de Burgos, Burgos, Spain; 14Gastroenterology Unit of Hospital de Cabueñes, Asturias, Spain; 15Gastroenterology Unit of Hospital de Mérida, Badajoz, Spain; 16Gastroenterology Unit of Hospital de Viladecans, Barcelona, Spain; 17Gastroenterology Unit of Clínica San Francisco, Cáceres, Spain; 18Gastroenterology Unit of Hospital de Barbastro, Huesca, Spain; 19Gastroenterology Unit of Hospital Universitario General de Catalunya, Barcelona, Spain; 20Gastroenterology Unit of Hospital Alto del Guadalquivir, Jaén, Spain; 21Gastroenterology Unit of Hospital Clínico Universitario Lozano Blesa and CIBERehd, Zaragoza, Spain; 22Digestive Diseases Department of Althaia Xarxa Assistencial Universitària de Manresa, Universitat de Vic-Universitat Central de Catalunya (UVicUCC), Manresa, Spain; 23Laboratoire de Bactériologie, Hôpital Pellegrin, Bordeaux, France; 24Department of Clinical Medicine, Trinity College Dublin, Dublin, Ireland

Introduction: Updated data in Spain is needed to design the best strategy to treat Helicobacter pylori infection. 38 of 95 | ABSTRACTS

Aim: To analyse the effectiveness of H. pylori first-line eradication those, 10,267 patients received an empirical prescription. Over 90% therapies in Spain. mITT eradication rate was obtained with first-line 14-day quadru- Methods: Systematic multicentre prospective registry of the clini- ple therapies or 10-day bismuth three-in-one single-capsule (Table). cal practice of gastroenterologists on the management of H. pylori Adverse events occurred in 25% of the cases, 0.2% being serious ad- infection (Hp-EuReg). All infected adult patients were registered at verse events (Table). Multivariate analysis reported that 10-14 days AEG-REDCap e-CRF from February 2013 to June 2019. Data were therapies (OR = 4), good compliance (>90% drug intake; OR = 4) and subject to quality control. Effectiveness (by modified intention-to- high PPI doses (OR = 2) were associated with higher mITT eradica- treat) and multivariate analysis were performed. Independent fac- tion rates. tors evaluated: age, gender, presence of ulcer, proton pump inhibitor Conclusions: In Spain, optimal effectiveness (>90%) in first-line treat- (PPI) dose, therapy duration and compliance. ment was obtained with the non-bismuth concomitant therapy, the Results: Overall, 10,633 naïve patients from 53 Spanish hospitals bismuth quadruple therapy with amoxicillin and clarithromycin (both were included: median age was 51 years and 61% were women. From for 14 days), and the 10-day bismuth quadruple (single capsule).

TABLE 1. Effectiveness and safety of the most-frequently prescribed first-line therapies in Spain

Effectiveness

mITT PP Adverse events

N (%) C.I. 95% N (%) C.I. 95% N (%) C.I. 95%

Overall 1st line 9,726 (88) 88-89 9,497 (89) 88-89 9,937 (25) 25-26 therapies 7 days 159 (60) 52-68 158 (61) 53-68 159 (3.1) 1-7 10 days 6.011 (88) 87-89 5,858 (89) 88-90 6,167 (22) 21-23 14 days 3,522 (90) 89-91 3,449 (90) 89-91 3,574 (33) 31-34 PPI + C + A + M 3,880 (90) 89-91 3,781 (90) 89-91 3,963 (28) 26-29 (Concomitant) 10 days 2,232 (88) 87-90 2,175 (89) 88-90 2,296 (26) 24-28 14 days 1,629 (92) 91-93 1,588 (92) 91-94 1,648 (30) 28-32 PPI + C + A 2,544 (83) 82-85 2,498 (84) 82-85 2,617 (15) 13-16 7 days 146 (59) 51-67 145 (59) 51-67 146 (2.7) 1-7 10 days 1,686 (84) 82-86 1,657 (84.5) 83-86 1,737 (10) 9-12 14 days 699 (86) 84-89 683 (87) 84-89 719 (28) 25-31 PPI + Single capsule 1,540 (95) 94-96 1,514 (96) 95-97 1,566 (25) 23-27 10 days 1,533 (95) 94-96 1,507 (96) 95-97 1,558 (25) 23-27 PPI + Bi + C + A 1,015 (91) 89-93 1,002 (91) 89-93 1,019 (40) 37-44 14 days 1,004 (91) 89-93 992 (91) 89-93 1,008 (41) 38-44 PPI + C + A + M 222 (81.5) 76-86 192 (84) 79-89 230 (49) 42-55 (Sequential) 10 days 221 (81) 76-86 191 (84) 78-89 229 (49) 42-56 mITT: modified intention-to-treat. PP: per protocol. N: number of patients included. %: proportion of patients showing the event (effectiveness or the adverse event). C.I.: confidence interval. PPI: proton pump inhibitor. C: clarithromycin. A: amoxicillin. M: metronidazole. Single capsule: three-in-one single capsule containing bismuth, tetracycline and metronidazole. Bi: bismuth. Concomitant: concomitant administration of the drugs. Sequential: sequential administration of the drugs.

M. Caldas: None. Á. Pérez-Aisa: None. M. Castro-Fernández: None. L. Bujanda: None. A. J. Lucendo: None. J. Huguet: None. J. Molina- Infante: None. L. Fernández-Salazar: None. J. Ortuño: None. M. Domínguez-Cajal: None. P. Almela: None. J. Botargués: None. J. Gómez: None. C. De la Coba: None. L. Pozzati: None. M. Barenys: None. M. Fernández-Bermejo: None. J. Alcedo: None. M. Mego: None. J. Domínguez-Jiménez: None. N. Fernández: None. M. Pabón- Carrasco: None. H. Alonso-Galán: None. I. Ariño: None. A. Garre: None. I. Puig: None. O. P. Nyssen: None. F. Megraud: None. C. O´Morain: None. J. P. Gisbert: None. ABSTRACTS | 39 of 95

EP2.34 | Effectiveness of second-line H. pylori eradication Introduction: Optimal second-line regimens in Helicobacter pylori in- treatments in Spain: Results from the European Registry on H. fection are required based on local previous results. pylori management (Hp-EuReg) Aim: To analyse the effectiveness of second-line therapies in Spain. Methods: Systematic multicentre prospective registry of clinical M. Caldas1; Á. Pérez-Aisa2; M. Castro-Fernández3; L. Bujanda4; practice of gastroenterologists on the management of Helicobacter L. Rodrigo5; J. Pérez-Lasala6; J. Barrio7; Á. Lanas8; M. Perona9; B. pylori infection (Hp-EuReg). All infected adult patients were regis- Gómez-Rodriguez10; I. Mololell11; Ó. Núñez12; R. Ruiz-Zorrilla13; A. tered at AEG-REDCap e-CRF from February 2013 to June 2019. Huerta14; E. Iyo15; R. Antón16; A. Campillo17; R. Pajares-Villaroya18; Data were subject to quality control. Effectiveness (by modi- F. Bermejo19; L. Titó20; T. Angueira21; J. Huguet22; P. González- fied intention-to-treat) and multivariate analysis were performed. Cordero23; N. Alcaide24; A. Garre1; I. Puig25; O. P. Nyssen1; F. Independent factors evaluated: age, gender, presence of ulcer, pro- Megraud26; C. O´Morain27; J. P. Gisbert1; On behalf of the Hp- ton pump inhibitor (PPI) dose, therapy duration, use of clarithromy- EuReg Investigators cin in the previous line, and compliance. 1Gastroenterology Unit of Hospital Universitario de La Princesa, Results: Overall, 2,481 patients received a second-line therapy: me- Instituto de Investigación Sanitaria Princesa (IIS-IP), Universidad dian age was 50 years and 66% were women. From those, 2,448 Autónoma de Madrid, and Centro de Investigación Biomédica en patients received an empirical prescription. Nearly 90% mITT eradi- Red de Enfermedades Hepáticas y Digestivas (CIBERehd), Madrid, cation rate was obtained with either moxifloxacin-or levofloxacin Spain; 2Gastroenterology Unit of Hospital Costa del Sol and Red containing triple therapy, or with quadruple therapy with levofloxa- de Investigación en Servicios de Salud en Enfermedades Crónicas cin and bismuth (all given for 14 days) or with 10-day bismuth three- (REDISSEC), Marbella, Spain; 3Gastroenterology Unit of Hospital de in-one single capsule (Table). Only 1 patient (0.2%) showed a serious Valme, Sevilla, Spain; 4Gastroenterology Unit of Hospital Donostia/ adverse event. Multivariate analysis showed that compliance (>90% Instituto Biodonostia, Centro de Investigación Biomédica en Red de drug intake; OR = 3), high PPI dose (OR = 2) and 14-day therapy Enfermedades Hepáticas y Digestivas (CIBERehd), Universidad del (OR = 1.5) were associated with higher mITT eradication rates. País Vasco (UPV/EHU), San Sebastián, Spain; 5Gastroenterology Conclusions: In Spain, optimal effectiveness (approximately 90%) in Unit of Hospital Universitario Central de Asturias, Oviedo, Spain; second-line treatment was obtained with triple quinolone or quad- 6Gastroenterology Unit of HM Sanchinarro, Madrid, Spain; ruple bismuth-quinolone regimens (both for 14 days) or with the 10- 7Gastroenterology Unit of Hospital Universitario Río Hortega, Valladolid, day bismuth quadruple (single capsule). Spain; 8Gastroenterology Unit of Hospital Clínico Universitario Lozano Blesa and CIBERehd, Zaragoza, Spain; 9Gastroenterology Unit of Hospital Quirón Marbella, Málaga, Spain; 10Gastroenterology Unit of Hospital Universitario Virgen Macarena, Sevilla, Spain; 11Gastroenterology Unit of Consorci Sanitari de Terrassa, Barcelona, Spain; 12Gastroenterology Unit of Hospital Universitario Sanitas La Moraleja, Madrid, Spain; 13Gastroenterology Unit of Hospital de Sierrallana Torrelavega, Cantabria, Spain; 14Gastroenterology Unit of Hospital de Galdakao-Usansolo, Vizcaya, Spain; 15Gastroenterology Unit of Hospital Comarcal de Inca, Mallorca, Spain; 16Gastroenterology Unit of Hospital Clínic Universitari de Vàlencia, Valencia, Spain; 17Gastroenterology Unit of Hospital Reina Sofía, Tudela, Navarra, Spain; 18Gastroenterology Unit of Hospital Infanta Sofía, Madrid, Spain; 19Gastroenterology Unit of Hospital Universitario de Fuenlabrada, idiPAZ, Madrid, Spain; 20Gastroenterology Unit of Hospital de Mataró, Barcelona, Spain; 21Gastroenterology Unit of Hospital General de Tomelloso, Tomelloso, Spain; 22Gastroenterology Unit of Consorcio Hospital General Universitario de Valencia, Valencia, Spain; 23Gastroenterology Unit of Hospital San Pedro de Alcántara and Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd), Cáceres, Spain; 24Gastroenterology Unit of Hospital Clínico Universitario de Valladolid, Valladolid, Spain; 25Digestive Diseases Department of Althaia Xarxa Assistencial Universitària de Manresa, Universitat de Vic-Universitat Central de Catalunya (UVicUCC), Manresa, Spain; 26Laboratoire de Bactériologie, Hôpital Pellegrin, Bordeaux, France; 27Department of Clinical Medicine, Trinity College Dublin, Dublin, Ireland. 40 of 95 | ABSTRACTS

TABLE 1. Effectiveness and safety of the most frequently prescribed second-line therapies in Spain.

Effectiveness

mITT PP Adverse events

N (%) C.I. 95% N (%) C.I. 95% N (%) C.I. 95%

Overall 2nd line 2,295 (84) 82-85 2,247 (84) 82-86 2,348 (28) 27-30 therapies 10 days 1,265 (79) 77-81 1,241 (80) 77-82 1,303 (18) 16-20 14 days 1,007 (89) 87-91 986 (90) 88-92 1,020 (42) 39-45 PPI + L +A 893 (78.5) 76-81 881 (79) 76-82 919 (26) 23-29 10 days 647 (74) 70-77 636 (74) 70-77 668 (11) 9-14 14 days 241 (92) 88-95 240 (92.5) 88-96 246 (65) 59-71 PPI + Bi + L +A 451 (89) 86-92 435 (90) 87-93 454 (33) 28-37 14 days 444 (90) 86-92 428 (90) 87-93 448 (33) 28-37 PPI + Single capsule 409 (88) 85-91 398 (89) 85-92 422 (31) 27-36 10 days 399 (88.5) 85-91 390 (89) 86-92 411 (30) 26-35 PPI + Mx+ A 129 (91) 84-95 129 (91) 84-95 134 (19) 13-27 10 days 20 (100) – 20 (100) – 21 (5) 0-24 14 days 109 (89) 82-94 109 (89) 82-94 112 (21) 14-30 PPI + C + A + M 110 (82) 73-89 109 (82) 73-88 112 (24) 17-33 (Concomitant) 10 days 47 (81) 67-91 46 (80) 66-91 48 (15) 6-28 14 days 62 (84) 72-92 62 (84) 72-92 63 (32) 21-45 mITT: modified intention-to-treat. PP: per-protocol. N: number of patients included. %: proportion of patients showing the event (effectiveness or the adverse event). C.I.: confidence interval. PPI: proton pump inhibitor. L: levofloxacin. A: amoxicillin. Bi: bismuth. Single capsule: three-in-one single capsule containing bismuth, tetracycline and metronidazole. Mx: moxifloxacin. C: clarithromycin. M: metronidazole. Concomitant: concomitant administration of the drugs.

M. Caldas: None. Á. Pérez-Aisa: None. M. Castro-Fernández: None. Methods: A multicenter prospective investigation was performed in L. Bujanda: None. L. Rodrigo: None. J. Pérez-Lasala: None. J. Barrio: West Flanders, Belgium for collecting gastric biopsies for histopa- None. Á. Lanas: None. M. Perona: None. B. Gómez-Rodriguez: None. thology, Rapid Urease Test (RUT) and if the RUT is positive, a culture I. Mololell: None. Ó. Núñez: None. R. Ruiz-Zorrilla: None. A. Huerta: was started. The principal investigation question was the prevalence None. E. Iyo: None. R. Antón: None. A. Campillo: None. R. Pajares- and the primary resistance rate of HP in first line testing. Other in- Villaroya: None. F. Bermejo: None. L. Titó: None. T. Angueira: None. vestigation topics are the performance of histopathology, RUT and J. Huguet: None. P. González-Cordero: None. N. Alcaide: None. A. culture. Garre: None. I. Puig: None. O. P. Nyssen: None. F. Megraud: None. C. Results: From October 2017 to February 2019, 512 patients par- O´Morain: None. J. P. Gisbert: None. ticipated. 438 were eligible for analysis in first line testing, of whom 89.7% are native Belgians. 89.8% (n = 88/98) of the cultures showed successful growth of HP but an antibiogram was achieved in only EP2.35 | Population study on the prevalence and antimicrobial 52.3% (n = 46/88), including 37 in first line testing. The prevalence resistance of Helicobacter pylori in West Flanders – Belgium of HP in first line testing is 17.8% for native Belgians and 75.6% for immigrants. The primary resistance rate is 13.5% for clarithromycin, A. Vanden Bulcke1; B. Waked2; L. Haems2; G. Lambrecht3; A. 29.7% for metronidazole and 29.7% for levofloxacin. Hervent3; S. Vervaeke4; F. Baert4 Conclusions: The primary clarithromycin resistance rate of HP in the 1UZ Leuven, Leuven, Belgium; 2UZ Gent, Gent, Belgium; 3AZ Damiaan, province West Flanders in Belgium is below 15% which implicates a Oostende, Belgium; 4AZ Delta, Roeselare, Belgium clarithromycin based triple therapy is still an option for empiric eradication. Conclusions of this study must be interpreted with caution Background: Data on Helicobacter pylori (HP) primary resistance due to the low number of successful antibiograms. Further surveil- in Belgium are largely based on the population of Brussels and lance in West Flanders is recommended as the resistance rate can Wallonia. Notably Brussels has a substantial proportion of patients differ from the population of Brussels. with an immigration background, which is not representative for other parts of Belgium. ABSTRACTS | 41 of 95

25 A. Vanden Bulcke: None. B. Waked: None. L. Haems: None. G. Valladolid, Spain; Laboratoire de Bactériologie, Hôpital Pellegrin, 26 Lambrecht: None. A. Hervent: None. S. Vervaeke: None. F. Baert: Bordeaux Cedex, France; Department of Clinical Medicine, Trinity None. College Dublin, Dublin, Ireland

Introduction: H. pylori treatment's effectiveness decreases as treat- EP2.36 | European registry on H. pylorimanagement (Hp- ment eradication attempts fail. EuReg): Analysis of 1,782 empirical rescue therapies on third and Aims: To evaluate the use and effectiveness of empirical rescue subsequent lines therapies on third and subsequent lines in Europe. Methods: Sub-study of the European Registry on H. pylori D. Burgos-Santamaría1; O. P. Nyssen2; D. Vaira3; Y. Niv4; B. Tepes5; Management, an international multicenter prospective non- G. Fiorini3; A. Perez-Aisa6; L. Rodrigo-Sáez7; M. Castro-Fernández8; interventional registry aimed to evaluate H. pylori management in R. Pellicano9; I. Modolell10; P. Mata Romero11; J. Delchier12; J. Europe. All cases with ≥3 eradication attempts were extracted until Ortuño13; M. Areia14; J. Barrio15; P. Phull16; L. Bujanda17; N. Brglez June 2019. Only the empirically prescribed therapies were analyzed. Jurecic18; J. Pérez-Lasala19; A. Lucendo20; J. Gomez-Camarero21; Data were subject to quality review. L. Jonaitis22; X. Calvet23; J. Santos-Fernández24; F. Mégraud25; C. Results: In total, 1,782 rescue treatments were included: 1,264, 359, O´Morain26; J. P. Gisbert2; Hp-EuReg Investigators 125 and 34 third-, fourth-, fifth- and sixth-line treatments, respec- 1Servicio de Gastroenterología y Hepatología, Hospital Universitario tively. Mean age was 51, 69% of patients were women and 5% were Ramón y Cajal, Instituto Ramón y Cajal De Investigación Sanitaria allergic to penicillin. Sixty-three different therapies were used, being (IRYCIS), Universidad de Alcalá, Madrid, Spain; 2Servicio de Pylera® the most commonly prescribed. The most frequent regimens Gastroenterología, Hospital Universitario de La Princesa, Instituto de are shown in the table. Overall effectiveness was 73% by modified Investigación Sanitaria Princesa (IIS-IP), Universidad Autónoma de intention-to-treat (mITT) and 74% by per-protocol (PP) analyses. Madrid, Centro de Investigación Biomedica en Red de Enfermedades Three regimens achieved an optimal eradication rate (≥90% by Hepáticas y Digestivas (CIBEREHD), Madrid, Spain; 3Department of mITT): Pylera®, quadruple PPI-bismuth- tetracycline- metronidazole Surgical and Medical Sciences, University of Bologna, Bologna, Italy; and triple PPI-amoxicillin-levofloxacin, the two latter only when high 4Rabin Medical Centre, Tel Aviv University, Petach Tikva, Israel; 5AM PPI doses and 14 days’ duration were used. The use of doxycycline DC Rogaska, Rogaska Slatina, Slovenia; 6Servicio de Gastroenterología, instead of tetracycline was associated with lower eradication rates Agencia Sanitaria Costa del Sol, Red de Investigación en Servicios in classical bismuth quadruple therapies (P < 0.05). de Salud en Enfermedades Crónicas (REDISSEC), Marbella, Spain; Conclusions: Empirical rescue treatments in third and subsequent 7Servicio de Gastroenterología, Hospital Universitario Central de lines obtain suboptimal eradication rates in Europe. Only Pylera® Asturias, Oviedo, Spain; 8Servicio de Gastroenterología, Hospital and the optimised versions of triple PPI-amoxicillin-levofloxacin and de Valme, Sevilla, Sevilla, Spain; 9Molinette Hospital, Turin, Italy; quadruple PPI-bismuth- tetracycline- metronidazole- achieve accept- 10Servicio de Gastroenterología, Consorci Sanitari Terrassa, Barcelona, able outcomes. Spain; 11Servicio de Gastroenterología, San Pedro de Alcántara, Cáceres, Spain; 12Henri Mondor Hospital, Créteil, France; 13Servicio de Gastroenterología, Hospital Universitari i Politècnic La Fe Valencia, Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBEREHD), Valencia, Spain; 14Portuguese Oncology Institute Coimbra, Coimbra, Portugal; 15Servicio de Gastroenterología, Hospital Rio Hortega, Valladolid, Spain; 16Aberdeen Royal Infirmary, Aberdeen, United Kingdom; 17Servicio de Gastroenterología, Hospital Donostia/Instituto Biodonostia, Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBEREHD), Universidad del País Vasco (UPV/EHU), Donosti, Spain; 18Diagnostic Center Bled, Bled, Slovenia; 19Servicio de Gastroenterología, Hospital HM Sanchinarro, Madrid, Spain; 20Servicio de Gastroenterología, Hospital General de Tomelloso, Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBEREHD), Ciudad Real, Spain; 21Servicio de Gastroenterología, Hospital Universitario de Burgos, Burgos, Spain; 22Lithuanian University of Health Sciences, Kaunas, Lithuania; 23Servicio de Gastroenterología, Hospital de Sabadell, Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBEREHD), Barcelona, Spain; 24Servicio de Gastroenterología, Hospital Clínico Universitario de Valladolid, 42 of 95 | ABSTRACTS

Overall eradication rates of the most prescribed empirical therapies on third and subsequent lines.

Modified intention-to-treat Per-protocol

Effectiveness (95% Rescue therapy Use, N (%) n Effectiveness (95% CI) n CI)

Pylera® 416 (23%) 363 84 (80-87) 350 85 (81-88) Triple PPI-A- L 277 (15%) 213 78 (72-83) 206 78 (72-84) Triple PPI-A- R 231 (13%) 205 66 (59-72) 198 67 (60-74) Quadruple PPI-B- Tc- M 171 (9.6%) 162 73 (65-80) 157 73 (66-80) Quadruple PPI-B- D- M 115 (6.5%) 109 63 (54-72) 105 64 (54-73) Quadruple PPI-A- L- B 95 (5.3%) 81 78 (67-86) 79 80 (69-88) Quadruple PPI-C- A- M 62 (3.5%) 57 58 (44-71) 54 59 (45-72) Triple PPI-A- M 54 (3.0%) 47 68 (5381) 45 69 (53-82) Triple PPI-C-A 43 (2.4%) 33 67 (48-82) 30 67 (47-83) Quadruple PPI-C- A- B 28 (1.6%) 24 75 (53-90) 21 86 (64-97) Triple PPI-A- Mx 27 (1.5%) 26 69 (48-86) 26 69 (48-86) Quadruple PPI-A- R- B 24 (1.3%) 22 59 (36-79) 21 57 (34-78) A, amoxicillin; B, bismuth; C, clarithromycin; D, doxycycline; L, levofloxacin; M, metronidazole; Mx, moxifloxacin; Tc, tetracycline; R, rifabutin; 95% CI, 95% confidence interval.

D. Burgos-Santamaría: None. O. P. Nyssen: None. D. Vaira: None. Y. feces using bacteriological, biochemical (AMA RUT Reader, Russia) Niv: None. B. Tepes: None. G. Fiorini: None. A. Perez-Aisa: None. immunochromatographic method, ELISA (ArcDIA, Finland) and PCR. L. Rodrigo-Sáez: None. M. Castro-Fernández: None. R. Pellicano: Autoprobiotics were prepared using indigenous non-pathogenic None. I. Modolell: None. P. Mata Romero: None. J. Delchier: None. Enterococcus faecium isolated from feces or stomach samples and J. Ortuño: None. M. Areia: None. J. Barrio: None. P. Phull: None. L. tested for pathogenicity genes. Autoprobiotics were administered Bujanda: None. N. Brglez Jurecic: None. J. Pérez-Lasala: None. A. per os twice daily at 50 mL (8.0 lg CFU/mL) for 20 days. Monitoring Lucendo: None. J. Gomez-Camarero: None. L. Jonaitis: None. X. of treatment effectiveness was carried out using an immunochro- Calvet: None. J. Santos-Fernández: None. F. Mégraud: None. C. matographic test and ELISA . The composition of microbiota of the O´Morain: None. J. P. Gisbert: None. stomach and feces was analyzed before and after the treatment by qPCR (Colonoflor OOO «ALFA LAB» and metagenome analysis 16 S rRNA). Results: Gastrointestinal dysfunctions (belching, heart- EP2.37 | Autoprobiotics in treatment of Helicobacter pylori burn, flatulence, nausea, epigastric pain, poor appetite) disappeared gastritis after therapy. No Helicobacter pylori antigens were detected using immunochromatographic method and ELISA. Results of control E. Ermolenko1,2; A. S. Molostova1; N. S. Gladyshev2,3; A. V. study were negative. Signs of intestinal dysbiosis such as a de- Svarval3; Y. S. Dubosarskiy1; A. N. Tsapieva1; K. Ermolenko4; M. A. crease in Firmicutes (Lactobacillus, Enterococcus), an increase in Dmitrienko5; A. N. Suvorov1 gamma-Proteobacteria (opportunistic representatives of the family 1Institute of Experimental Medicine, Saint-Petersburg, Russian Enterobacteriaceae) were eliminated. Conclusion: Autoprobiotic en- Federation; 2Saint-Petersburg State University, Saint-Petersburg, terococci can be considered as candidates for an alternative method Russian Federation; 3Saint-Petersburg Pasteur Institute, Saint- or important addition to eradication of H.p. infection. The study was Petersburg, Russian Federation; 4Pediatric Research and Clinical supported by Russian Scientific Foundation grant 16-15-10085. Center for Infectious Diseases, Saint-Petersburg, Russian Federation; E. Ermolenko: None. A.S. Molostova: None. N.S. Gladyshev: None. 5Association of Medicine and Analytics, Saint-Petersburg, Russian A.V. Svarval: None. Y.S. Dubosarskiy: None. A.N. Tsapieva: None. K. Federation Ermolenko: None. M.A. Dmitrienko: None. A.N. Suvorov: None.

Probiotics are recommended in accordance with Maastricht V in treatment of Helicobacter pylori gastritis. Probiotic therapy isn't аlways effective. Autoprobiotics – beneficial and indigenous bacteria are more promising. This study aimed to investigate the effectiveness of eradication therapy of Helicobacter pylori gastritis (HPG) using autoprobiotic enterococci. Methods: The study was conducted on patients with HPG (8 men, 8 women, aged 27-63). HPG was confirmed by studying biopsy samples of the stomach and ABSTRACTS | 43 of 95

EP2.38 | Antibiotics susceptibility testing increases Helicobacter pylori activity and a favorable safety profile for eradication of H. py- pylori eradication rates in dyspeptic patients from Egypt: A lori infection. randomized controlled trial Aim: Compare 14-day nifuratel-based triple therapy as first-line H. pylori treatment with 14-day clarithromycin-based triple therapy. A. Elrakeeb1; S. Eltayyeb2; A. Elgazzar3; M. Alboraie1 Materials/Methods: In total, 70 H. pylori-infected subjects partici- 1Department of Internal Medicine, Al-Azhar University, Darrasah, pated in the randomized clinical trial. 35 patients of the first group Egypt; 2Department of Clinical Pathology, Al-Azhar University, received a 14-day nifuratel-based triple therapy: esomeprazole Darrasah, Egypt; 3Department of Internal Medicine, Almatareya (20 mg BID), nifuratel (400 mg BID), and amoxicillin (1000 mg BID). Teaching Hospital, Darrasah, Egypt 35 patients of the second group – 14-day clarithromycin-based triple therapy: esomeprazole (20 mg BID), clarithromycin (500 mg BID), Background: Eradication rates for Helicobacter pylori has declined and amoxicillin (1000 mg BID). H. pylori stool antigen was taken to be over the past years. To overcome treatment failure, antibiotics sus- checked for eradication. ceptibility‐guided therapy was suggested as an effective option for Results: Intention-to-treat (ITT) eradication rates of 14-day nifuratel- eradication of H. pylori infection. based triple and 14-day clarithromycin-based triple therapy were Aims: To test the effectiveness of culture‐based antibiotics suscep- 82.9% and 74.3% (P = 0.561), respectively, and the per-protocol (PP) tibility‐guided therapy versus clarithromycin or levofloxacin triple rates were 90.6% and 89.7% (P = 1.000), respectively. The adverse therapy as first‐line therapy for H. pylori infection. events were reported in 17.1% of the first group and 34.3% of pa- Methods: Dyspeptic patients performing esophagogastroduoden- tients in the second group. There were no statistically significant oscopy were prospectively enrolled. Patients with positive H. pylori differences of eradication rates and adverse events in both groups results by rapid urease test were randomized to receive antibiotics (P > 0.05). susceptibility-guided therapy or empirical clarithromycin or levo- Conclusions: 14-day triple nifuratel-based therapy has demon- floxacin based triple therapy for 14 days. strated the excellent eradication rates that exceed 90%. Nifuratel Results: In total, 82 patients were enrolled (52 in culture and triple therapy may be considered as an alternative to clarithromycin sensitivity-based therapy group and 30 in empirical therapy group) triple therapy for patients with previous history of macrolide expo- and 50 (60.1%) patients completed the study according to the pro- sure or macrolide intolerance. tocols. Cultures were possible in 28 patients of the culture and N. Dekhnich: None. A. Triapyshko: None. R. Kozlov: None. I. Trushin: sensitivity-based therapy group (53.8%). The overall resistance rates None. A. Kuzmenkov: None. to clarithromycin, amoxicillin, metronidazole, levofloxacin, tetracycline, nitrofurantoin and rifampicin were 32.1%, 32.1%, 78.6%, 7.1%, 17.9%, 17.9% and 21.4% respectively. Empirical triple and an- EP2.40 | Toxic effects of bismuth on Helicobacter pylori tibiotics susceptibility-guided eradication rates were, respectively, associated with the intra-gastric acidity: A transmission electron 53.3% and 85.7% by intention-to-treat (P = 0.035) and 64% and 96% microscopy study (P = 0.005) by per-protocol analysis. Adverse events were reported in 16.6% of patients in empirical triple therapy and 21.4% of in anti- Y. Lee; T. Chiang; C. Shun biotics susceptibility-guided therapy (P < 0.527 NS). National Taiwan University Hospital, Taipei, Taiwan Conclusions: Culture‐based eradication therapy demonstrated superior eradication rates than empirical therapy as a first-line therapy Objective: Whether the toxic effect of bismuth on Helicobacter py- for H. pylori in a region with high rates of antimicrobial resistance. lori is pH dependent or not is unclear. A. Elrakeeb: None. S. Eltayyeb: None. A. Elgazzar: None. M. Alboraie: Design: Patients with positive results of 13C-urea breath test (UBT) None. were randomized into 3 groups: (1) no treatment; (2) colloidal bismuth subcitrate (CBS, 120 mg/tab); and (3) proton pump inhibitor (esomeprazole, 40 mg/tab) plus CBS. For the CBS group, patients EP2.39 | Nifuratel in the eradication of Helicobacter pylori were separated to: CBS 1 dose 1 hour before endoscopy, CBS 1 dose infection in adults: Results of a randomized comparative clinical 4 hours before endoscopy, and CBS 4 times a day 24 hours before trial endoscopy. For the esomeprazole plus CBS group, patients were separated to: esomeprazole four times a day for 3 days, followed by N. Dekhnich; A. Triapyshko; R. Kozlov; I. Trushin; A. Kuzmenkov CBS 1 dose 1 hour before endoscopy, esomeprazole four times a day Smolensk State Medical University, Smolensk, Russian Federation for 3 days, followed by CBS 1 dose 4 hours before endoscopy; and esomeprazole four times a day for the first 3 days, followed by CBS Background: Eradication rates for clarithromycin triple therapy dra- four times a day 24 hours before endoscopy. Biopsy samples was matically decrease whatever the reason is, in cases when patients examined by transmission electron microscopy (TEM). have previous medical history of macrolide exposure. In this regard, Results: A total of 21 subjects with positive 13C-UBT were enrolled there is a search for alternative antibacterial agents with high anti-H. Active budding processes of replication were observed by TEM in 44 of 95 | ABSTRACTS participants without prior treatment. By contrast, morphological EP2.42 | Modified bismuth quadruple therapy with low dose damages of H. pylori, including swelling, intra-bacterial vacuolization, metronidazole as first-line therapy for Helicobacter pylori infection and structural degradation with wall eruption, were noted starting from 1 hour after CBS. The phenomena were similarly noted when G. Pih; K. Choi; H. Na; J. Ahn; J. Lee; K. Jung; D. Kim; H. Song; G. the CBS was administered in different timing, dosage, and whether Lee; H. Jung the PPI was used or not. Asan Medical Center, Seoul, Republic of Korea Conclusions: An immediate toxic effect of CBS is noted for H. pylori infection, which is independent from the intra-gastric acidity. Background: Bismuth-containing quadruple therapy is as an effec- Y. Lee: None. T. Chiang: None. C. Shun: None. tive alternative first-line therapy for Helicobacter pylori infection. We evaluated an efficacy and safety of modified bismuth quadruple regimen twice a daily with low dose metronidazole (BQT-2) as a first- EP2.41 | A real-life study assessing the efficacy of single line therapy for H. pylori eradication. capsule Bismuth quadruple therapy supplemented with probiotics Materials and Methods: A prospective pilot study was conducted for H pylori eradication in patients naïve to treatment in a high with patients diagnosed H. pylori-infection and naïve to eradication. clarithromycin resistance area 14 days of modified BQT-2 therapy consisted of rabeprazole 20 mg, amoxicillin 1 g, metronidazole 500 mg, and tripotassium dicitrato K. Priadko1,2; A. G. Gravina1; L. Granata1; R. Cerbone1; P. Ciamarra1; bismuthate 600 mg (elemental bismuth 240 mg) twice a daily, given A. Montanaro1; A. Facchiano1; A. Miranda1; M. Romano1 30 minutes before morning and evening meals. H. pylori eradication 1Università degli Studi della Campania “L. Vanvitelli”, Naples, Italy; was assessed by ¹³C-urea breath test conducted at least 4 weeks 2Dnipro State Medical Academy, Dnipro, Ukraine after completion of therapy. Results: Of total 66 patients, the H. pylori eradication rate of modi- Background: International guidelines suggest the use of bismuth fied BQT-2 regimen was 77.3%, and compliance rate was 100%. quadruple therapy (BQT) as first-line regimen for H. pylori eradica- Metronidazole and Clarithromycin resistance rates were 30.0% and tion in areas of high clarithromycin (C) resistance. In Italy, an area 22.0%, respectively. Eradication rate showed no significant differ- with high C resistance rate, BQT is only possible through the 3-in-1 ence between metronidazole susceptible and resistant strains (sus- capsule formulation. Whether probiotics counteract antibiotic- ceptible 74.3%, 26/35, and resistant 73.3%, 11/15) (P = 1.000). Most induced microbiome disturbance, thus decreasing treatment-related of the adverse events were mild and 20 patients (30.3%) presented adverse events (TRAEs) and increasing compliance to therapy, is still nausea, epigastric soreness, loose stool, asthenia, skin rash, dizzi- debated. ness, taste perversion, headache, or dyspepsia. Objective: To assess the efficacy of single capsule BQT sup- Conclusions: Twice a day modified BQT-2 therapy with low dose plemented with probiotics in H. pylori-infected subjects naive to metronidazole may be suboptimal as an alternative first-line therapy treatment. against H. pylori, despite of its high compliance. Method: Real-life study performed on 250 H pylori-infected dys- G. Pih: None. K. Choi: None. H. Na: None. J. Ahn: None. J. Lee: None. peptic patients naïve to treatment. H pylori diagnosis was through K. Jung: None. D. Kim: None. H. Song: None. G. Lee: None. H. Jung: 13C Urea Breath Test (UBT), HpSA or histology. Single capsule BQT None. (i.e. PyleraⓇ), approved by the Italian National Health System for 10 days, was as follows: Esomeprazole 40 mg bid + PyleraⓇ qid + Lactobacillus paracasei formulation (Enterolactis plus Ⓡ) bid. Efficacy of treatment was assessed at least 45 days after the end of treatment by UBT. Side effects were evaluated via a questionnaire at the end of therapy. Results: 1) ITT and PP eradication rates were 227/250 (90.8%; 95% CI 86.3%-93.7%) and 226/237 (95.3%; 95% CI 91%-99%), respectively; 2) Compliance to treatment was greater than 90%; 3) The prevalence of TRAEs was 26.9% with a therapy discontinuation rate due to severe TRAEs of 13/250 (5.2%). Conclusion: Single capsule BQT together with probiotic supplementation of Lactobacillus paracasei is a well-tolerated and highly effective first-line regimen to eradicate H. pylori infection in an area of high C resistance. K. Priadko: None. A.G. Gravina: None. L. Granata: None. R. Cerbone: None. P. Ciamarra: None. A. Montanaro: None. A. Facchiano: None. A. Miranda: None. M. Romano: None. ABSTRACTS | 45 of 95

EP2.43 | Helicobacter pylori resistance to antibiotics in Europe EP2.44 | Antibiotic resistance breakers to counteract the in 2018 and its relationship to antibiotic consumption in the multidrug-resistance in Helicobacter pylori community S. Di Lodovico1; M. Di Giulio1; S. D'Ercole1; P. Di Fermo1; R. Bruyndonckx1,2; F. Mégraud3; S. Coenen1; L. Wittkop4; A. F. Ciccaglione1; A. Nostro2; G. Magi3; L. Cellini1 T. D. Huang5; M. Hoebeke5; L. Bénéjat3; P. Lehours3; H. 1”G. d'Annunzio” – University of Chieti-Pescara, Chieti, Italy; Goossens1; Y. Glupczynski1,5; H. pylori Resistance European 2Department of Chemical, Biological, Pharmaceutical and Multicentric Study Group; European Surveillance of Antimicrobial Environmental Sciences, University of Messina, Messina, Italy; ConsumptionNetwork (ESAC-Net) 3Department of Biomedical Sciences and Public Health, Polytechnic 1Vaccine & Infectious Disease Institute (VAXINFECTIO), Laboratory University of Marche, Ancona, Italy of Microbiology, University of Antwerp, Antwerp, Belgium; 2Data Science Institute (DSI), Hasselt University, Hasselt, Belgium; 3INSERM Multidrug-resistance in Helicobacter pylori strongly stimulates the U1053 UMR BaRITOn, Université de Bordeaux, & Centre National identification of new strategies improving eradication rate. Novel de Référence des Campylobacters et Helicobacters, Laboratoire de approaches for tackling the global antimicrobial-resistance phenom- Bactériologie, Hôpital Pellegrin, Bordeaux, France; 4ISPED, Université enon involve natural compounds so-called Antibiotic Resistance de Bordeaux, Bordeaux, France; 5Université Catholique de Louvain, Breakers-ARBs expressing antibacterial/anti-virulence activities re- CHU UCL Namur, Laboratoire de Bactériologie and Centre National storing the efficacy of conventional drugs. This study analysed two de Référence de la résistance de Helicobacter pylori aux antibiotiques, ARBs, Pistacia vera L. oleoresin-ORS and Bovine Lactoferrin-BLF, Mont-Godinne, Belgium for their antimicrobial, anti-virulence action and synergistic effect when combined with Levofloxacin-LVX against resistant H. pylori Background & Aim: A survey on H. pylori resistance performed in strains. ORS and BLF antimicrobial/anti-virulence effect was in Europe in 2018 reported resistance rates of 21% for clarithromy- vitro analyzed by MIC/MBC determination, biomass quantification cin, 16% for levofloxacin and 39% for metronidazole with signifi- and twitching motility. The synergism with LVX was evaluated by cantly higher rates in Southern/Central vs Northern countries.1 We checkerboard assay. In vivo studies were performed using Galleria aimed to study the link between H. pylori resistance and antibiotic mellonella that is a recognized experimental model for H. pylori infec- consumption. tion, for ORS. A prospective therapeutic trial on two patient groups Methods: Data on antibiotics for systemic use in the community (pe- (treated with esomeprazole, amoxicillin, LVX plus BLF in one group), riod 2008-2017) were expressed in Defined Daily Doses per 1,000 for BLF. Treatment outcome was determined by 13C Urea Breath inhabitants per day (DID). The model fit and degree of ecological as- test. In vitro ORS was able to synergize with LVX, restoring its ef- sociation between antibiotic consumption and resistance data were fectiveness in LVX resistant strains. ORS, LVX and their synergistic assessed using generalised linear mixed models based on yearly and combinations displayed significant biofilm reduction. BLF combined cumulative consumption. The model with the best fit was selected with LVX displayed synergistic effect for all H. pylori strains with MIC by means of the Akaike information criterion. reduction until 16 and 32-fold. BLF at ¼ MIC reduced, significantly, Results: Model fit improved with cumulated years of usage, but the the microbial motility. In vivo, ORS and LVX, showed protective ef- best fit was obtained using 2013 consumption data. Large variations fect against H. pylori infection on G. mellonella (62%-63% survival, in consumption were observed for macrolides, from 1.22 DID in the respectively). In vivo, BLF added to triple therapy, achieved a thera- Netherlands to 6.94 DID in Greece; and for quinolones from 0.54 peutic gain of 20%. ORS and BLF can be considered promising po- DID in Norway to 3.55 DID in Italy. Significant associations were tentiators for restoring the LVX susceptibility in resistant H. pylori found between clarithromycin resistance in H. pylori and the use of strains. BLF added to a triple therapy potentiates the therapeutic macrolides (OR = 1.17 (95% CI: 1.08-1.28); P = 0.0003) and between effect. levofloxacin resistance and consumption of quinolones (OR = 1.57 S. Di Lodovico: None. M. Di Giulio: None. S. D'Ercole: None. P. Di (95% CI: 1.31-1.89); P = 0.0002). Fermo: None. A.F. Ciccaglione: None. A. Nostro: None. G. Magi: Conclusion: The antibiotic consumption in the community in Europe None. L. Cellini: None. varies widely and correlates positively with H. pylori resistance levels. Historical knowledge of macrolide and quinolone consumption in previous years provides a simple and useful tool to predict the susceptibility of H. pylori to clarithromycin and to levofloxacin and to optimise treatment strategies. R. Bruyndonckx: None. F. Mégraud: None. S. Coenen: None. L. Wittkop: None. T.D. Huang: None. M. Hoebeke: None. L. Bénéjat: None. P. Lehours: None. H. Goossens: None. Y. Glupczynski: None. 46 of 95 | ABSTRACTS

EP2.45 | The effectiveness of various antiHelicobacter therapy antibacterial and anti-virulence effects of resveratrol and new syn- regimens in Ukraine thetized phenol-derivatives, alone and combined with Levofloxacin used in H. pylori therapy, in areas where Clarithromycin resistance Y. V. Nikiforova; G. D. Fadieienko is major to 15%, against resistant clinical isolates, in in vitro and in Government Institution “L.T.Malaya Therapy National Institute of the vivo studies. The antibacterial activity was determined by MIC/MBC National Academy of Medical Sci, Kharkiv, Ukraine evaluation and the synergism with Levofloxacin through the checkerboard tests. The anti-virulence action was assessed by the mo- The goal is to evaluate the effectiveness of various anti-Helicobacter tility inhibition, biofilm biomass reduction and anti-quorum sensing therapy (AHBT) regimens in Ukraine in order to select the most op- effect. In vivo Galleria mellonella-model was used to confirm in vitro timal treatment tactics. data. The results showed an increased antibacterial action of the Object of Study and Methods: 610 patients were examined, with new derivatives with lower MIC (6.25-100 μg/mL) and MBC (12.5- an average age of (50.36 ± 15.13) years. Female (330, 54.1%), Male 400 μg/mL) values in respect to the resveratrol (MIC = 400 μg/mL, (280, 45.9%). The most common nosology was chronic atrophic MBC = 800 μg/mL) and a more interesting anti-virulence action of gastritis associated with Helicobacter pylori (НР) (479, 78.5%). Non the detected new derivatives in respect to the lead compound, to- Investigated Dyspepsia (0, 0.0%), Functional Dyspepsia (2, 0.3%), gether with a synergistic effect in combination with Levofloxacin Duodenal Ulcer (117, 19.2%), Gastric Ulcer (14, 2.3%). Most patients against H. pylori strains. Resveratrol and new derivatives showed (449, 73.6%) did not receive primary therapy. Patients received dif- protective effect against H. pylori infection on G. mellonella. Overall, ferent anti-Helicobacter therapy regimens: Dual (2, 0.3%), Triple the results underline the anti-H. pylori effect of resveratrol-phenol (325, 53.3%), Quadruple (273, 44.8%), Sequential (0, 0.0%), Hybrid derivatives, representing interesting candidates for innovative ther- (0, 0.0%), Pylera (single capsule bismuth) (0, 0.0%), Other (10, 1.6%). apeutic schemes to tackle the H. pylori antibiotic resistance. Results and Discussion: The most effective eradication scheme is M. Di Giulio: None. P. Di Fermo: None. S. Di Lodovico: None. E. Di Quadruple with the addition of Bismuth salts of tripotassium dici- Campli: None. S. D'Ercole: None. B. De Filippis: None. L. Cellini: trate (BTD) lasting 14 days (92.0%), as well as schemes with the in- None. clusion of probiotics (the most effective addition of Saccharomyces Boulardii) during AHBT with prolonged administration up to 4 weeks after the end of therapy (eradication efficiency is 90.6%). The effec- EP2.47 | Evaluation of antimicrobial activity against Helicobacter tiveness of Quadruple depending on the proton pump inhibitor (PPI) pylori and phytochemical analysis of extracts from Passiflora and used was as follows: Pantoprazole (92.0%), Esomeprazole (90.0%), Ilex species Rabeprazole (89.9%), Omeprazole (78.6%). Conclusions: Ways to increase the effectiveness of AHTB in Ukraine J. S. Castañeda; D. Cualla; J. J. Reyes; A. F. Saenz; J. D. Franco; C. R. are the addition of BTD to therapy and the duration of therapy is Acosta; G. M. Costa; A. A. Trespalacios 14 days, the use of high doses of PPI – Pantoprazole, the addition of Pontifical Javeriana University, Bogota, Colombia probiotics to treatment regimens. Y.V. Nikiforova: None. G.D. Fadieienko: None. Helicobacter pylori is associated with gastroduodenal diseases and gastric cancer. Moreover, bacterial resistance to antimicrobial therapy is a major challenge in the treatment of this infection and find EP2.46 | Potential role of new resveratrol derivatives for the new therapy alternatives and new molecules are important to im- management of drug resistant Helicobacter pylori infection prove H. pylori eradication. One of these alternatives is the natural products from plant species. This study aimed to evaluate the M. Di Giulio1; P. Di Fermo1; S. Di Lodovico1; E. Di Campli1; S. antimicrobial activity of hydroethanolic and aqueous leaf extracts D'Ercole2; B. De Filippis1; L. Cellini1 from some Passiflora and Ilex species against H. pylori. Antimicrobial 1Department of Pharmacy, University G. d'Annunzio Chieti-Pescara, activity was evaluated with agar dilution technique, following the Chieti, Italy; 2Department of Medical, Oral and Biotechnological CLSI recommendations. Reference strains of H. pylori NCTC11637 Sciences, University G. d'Annunzio Chieti-Pescara, Chieti, Italy and NCTC11638 were employed, with DMSO as negative control and amoxicillin as positive control. Phytochemical analysis of the The emerging spread of multidrug-resistance Helicobacter pylori extracts was performed by HPTLC and UPLC-DAD. Our results strains underlines the stringent need of novel treatments to im- showed a minimum inhibitory concentration (MIC) of 1000 ?g/mL prove the eradication. Nowadays, there is a great attention in al- for P. tripartita f. mollissima and P. tarminiana hydroethanolic ex- ternative strategies based on combined synergistic effect between tracts and for both hydroethanolic and aqueous extracts from I. gu- antibiotics and non-antibiotic compounds resulting in a potentiated ayusa. The phytochemical analysis of these active extracts showed effect. Resveratrol arouses great interest for its multifaceted bio- distinct chromatographic profiles for each species, although no logical and antimicrobial activities, although the in vivo application qualitative difference was observed between hydroethanolic and is limited for its poor bioavailability. In this study, we evaluated the aqueous extracts. C-glycosylflavonoids were observed as the main ABSTRACTS | 47 of 95 compounds for Passiflora species. For I. guayusa, caffeine was the EP2.49 | Antioxidant and anti-inflammatory properties of a mayor compound, along with several phenolic acids, among them grape seed extracts against Helicobacter pylori infection chlorogenic and caffeic acid. These results suggest an interesting activity for these species. Purification processes for active compounds T. Alarcón1; J. M. Silvan2; L. Domingo-Serrano2; M. N. Siles2; M. are ongoing. Prodanov2; A. J. Martínez-Rodríguez2 Funding: J.S.C, J.J.R, A.F.S, C.R.A, G.M.C, A.A.T are recipients of 1Hospital Univ. La Princesa, Madrid, Spain; 2Institute of Food Science grants from Colciencias (120380763025/2018). J.S.C, D.C.T, J.D.F, Research (CIAL, CSIC-UAM), Madrid, Spain G.M.C, A.A.T are recipients of grants from Research Vice-rectory Pontificia Universidad Javeriana (ID 7739). Background: Helicobacter pylori (Hp) could be implicated in the J.S. Castañeda: None. D. Cualla: None. J.J. Reyes: None. A.F. Saenz: pathogenesis of gastritis, peptic ulcer disease, gastric carcinoma, and None. J.D. Franco: None. G.M. Costa: None. C.R. Acosta: None. A.A. gastric lymphoma. There is increasing evidence that Hp infection Trespalacios: None. induce oxidative stress in host cells and an inflammatory process that conditions an immunological response both local and systemic. These events may represent an important mechanism leading to epi- EP2.48 | Empiric versus clarithromycin-resistance-guided thelial injury in Hp infection. therapy for Helicobacter pylori based on polymerase chain reaction Objective: The present study was aimed to evaluate the effect of results in patients with gastric neoplasms or gastric MALT a grape seed extract (GSE) and its fractions (F1 and F2) on the Hp- lymphoma: A randomized controlled trial induced oxidative stress and inflammatory response in epithelial gastric AGS human cells. J. Kim; S. Cho; S. Chung; A. Lee; J. Choi; H. Chung; S. Kim Methods: AGS cells were pre-treated with GSE and fractions (2 mg/ Seoul National Hospital, Seoul, Republic of Korea mL) for 2 hours before infection with seven Hp strains. Intracellular reactive oxygen species (ROS) levels were detected using a redox- We investigated to compare the effect of empirical therapy versus sensitive fluorescent probe and pro-inflammatory IL-8 cytokine pro- clarithromycin resistance-guided tailored therapy (tailored ther- duction was measured by ELISA assay. apy) for eradication of Helicobacter pylori. In this prospective, sin- Results: Infection of AGS cells with all Hp strains resulted in a sig- gle center, open-label randomized controlled trial, we enrolled 72 nificantly (P < 0.05) increase in intracellular ROS generation and IL-8 patients with H. pylori infection from January 2019 through June cytokine production respect to the uninfected controls. However, 2019 in Korea. The patients were randomly assigned to both groups when AGS cells were pre-treated with GSE and fractions, it was received empirical (n = 36) or tailored therapy (n = 36). Empirical achieved an inhibition percentage of intracellular ROS production in therapy was defined as triple therapy with esomeprazole, amoxi- a range from 29.1% to 86.7%. Similarly, the cells pre-treatments with cillin, and clarithromycin for 10 days irrespective of clarithromy- GSE and fractions also reached a significant reduction of IL-8 secre- cin resistance. Tailored therapy was triple or quadruple therapy tion ranging from 37.2% to 89.6%. with esomeprazole, metronidazole, tetracycline, and bismuth for Conclusions: These results suggest that GSE and fractions in the 10 days based on genotype markers of resistance determined by present study may prevent and/or modulate the oxidative stress and gastric biopsy. Resistance-associated mutations in 23S rRNA were inflammatory response induced by Hp infection. confirmed by multiplex polymerase chain reaction. Eradication sta- Acknowledgments: Ministry of Science, Innovation and Universities, tus was assessed by 13C-urea breath test and the primary outcome Government of Spain, project AGL2017-89566-R. was eradication rate. H. pylori was eradicated in 27 (75.0%) patients T. Alarcón: None. J.M. Silvan: None. L. Domingo-Serrano: None. M.N. given empirical therapy and 32 (88.9%) patients treated with tailored Siles: None. M. Prodanov: None. A.J. Martínez-Rodríguez: None. therapy (P = 0.136) in intention-to-treat analysis. In per-protocol analysis, eradication rate was 97.0% and 81.8% in tailored versus empirical group (P = 0.046). While clarithromycin-resistant H. pylori EP2.50 | Effects of temperature on the growth and was eradicated in 3/9 (33.3%) with empirical therapy, it was treated metronidazole resistance in Helicobacter pylori in 11/12 (91.7%) with tailored therapy (P = 0.009). There was no difference in compliance between two groups. Rate of adverse events M. Gong; Y. Han; X. Wang; H. Tao; F. Meng; G. Wang of tailored group was higher than that of empirical group (P = 0.036) Chinese PLA General Hospital, Beijing, China since quadruple therapy had more side effects than triple therapy (P = 0.001). Tailored therapy based on PCR is a good alternative to Aims: To investigate the effect of temperature on the growth of H. increase eradication rate in a region of high prevalence of clarithro- pylori, as well as the sensitivity of H. pylori to metronidazole and its mycin resistance. underlying transcriptome profiles. J. Kim: None. S. Cho: None. S. Chung: None. A. Lee: None. J. Choi: Methods: H. pylori NCTC 11637 was cultured at 37°C and 41°C to eval- None. H. Chung: None. S. Kim: None. uate the effects of elevated temperature on bacteria growth. The in vitro minimum inhibitory concentration (MIC) of metronidazole was 48 of 95 | ABSTRACTS tested via the Epsilometer test (E-test). RNA-seq was performed for Patients with AAG had lower (P < 0.01) concentration at the 30th, the transcriptome analyses. Gene Ontology and Kyoto Encyclopedia 60th and 120th minute than patients with normal GM. of Genes and Genomes pathway enrichment analyses were used to Conclusion: AFG and AAG are characterized by decreased amoxicil- investigate the biological functions and signal pathways. lin transport to gastric lumen. Results: Growth of H. pylori was significantly inhibited after A. Sablina: None. O. Sablin: None. S. Aleksanin: None. G. Rodionov: incubation at 41°C. At inoculation concentration of 0.002 None. I. Shantyr’: None. I. Ushal: None. McFarland, the bacterial colony count of the control group (37°C) was 4288.00 ± 184.16 cfu/mL. The count decreased to 2254.67 ± 574.75 cfu/mL after 3 days of 41°C treatment (P = 0.0043, EP2.52 | The chimeric protein CTB-multiHp: Immunological compared with control group). After the bacteria were cultured at features and the ability to inhibit Helicobacter pylori activities 41°C, the MIC value dropped from 256 to 8 µg/mL which is the breakpoint of metronidazole resistance. Transcriptome analyses re- B. Meza1; F. Ascencio1; J. Torres2 vealed 583 differentially expressed genes which were enriched in 1Centro de Investigaciones Biológicas del Noroeste, La Paz, Mexico; substance metabolism, structural constituent of ribosome, oxidore- 2Centro Médico Nacional Siglo XXI, Ciudad de México, Mexico ductase activity and oxyradical scavenging. Conclusions: Culturing in vitro in 41°C can inhibit H. pylori prolif- Helicobacter pylori is a bacterium that infects half of the population eration by the possible effects on substance metabolism and ribo- worldwide, is causes gastroduodenal diseases, and it is classified as some's structural constituent. Meanwhile, the decreased resistance a type I carcinogen by the World Health Organization. The most of H. pylori to metronidazole was probably related to the changes of suitable strategy against H. pylori infection is vaccine development. oxidoreductase activity and oxyradical scavenging. CTB-multHp is a chimeric protein that is composed of multiple B and M. Gong: None. Y. Han: None. X. Wang: None. H. Tao: None. F. T cell epitopes of the seven main antigens involved in the different Meng: None. G. Wang: None. stages of H. pylori pathogenesis. CTB-multiHp was designed by bioinformatics as a vaccine against H. pylori, however, its immune response still needs to be experimentally evaluated. In this study were EP2.51 | Amoxicillin secretion by gastric mucosa in patients with assessed immunological features and the ability of CTB-multiHp atrophic and nonatrophic gastritis undergoing H. pylori eradication antibodies to inhibit in vitro H. pylori activities. The experimental re- therapy sults indicated that CTB-multiHp raise specific antibodies that could recognize Urease B, CagA, NapA, VacA, HpaA, HspA and GGT of A. Sablina; O. Sablin; S. Aleksanin; G. Rodionov; I. Shantyr’; I. Ushal H. pylori. Also, these antibodies showed effective inhibition of ure- Nikiforov Russian Center of Emergency and Radiation Medicine, ase activity, inhibition of haemagglutination, and neutralization of EMERCOM of Russia, Saint-Petersburg, Russian Federation vacuolating cytotoxin activity of H. pylori. Furthermore, THP-1 cells reacted to the presence of CTB-multiHp vaccine by inducing the Background: Lower efficacy of H. pylori eradication in patients with production of proinflammatory cytokines. in vitro analyses suggest gastric mucosa (GM) atrophy can be conditioned by lower intensity that CTB-multiHp could induce a humoral and cellular immune re- of antibiotics delivery to gastric lumen because of decreased num- sponse, suggesting it is a promising H. pylori vaccine candidate to be ber of parietal cells taking part in amoxicillin active transport. investigated. Methods: 27 patients with normal GM, 12 with atrophic fundal gas- B. Meza: None. F. Ascencio: None. J. Torres: None. tritis (AFG) and 26 with atrophic antral gastritis (AAG) were included in study. Endoscopy, histological examination, rapid urease test and GastroPanel® (“Biohit”, Finland) were done in all the patients. On the first day of eradication therapy gastric secretion samples were taken via nasogastric probe 30, 60, 120, 180 and 240 minutes after oral administration of two 500 mg amoxicillin capsules. Amoxicillin concentration in samples was evaluated via liquid chromatography- mass spectrometry. Results: Mean values of amoxicillin concentration in gastric secretion samples were lower (P < 0.01, hereinafter – Mann-Whitney U test) in AAG group (1.8 µg/mL) than in patients with normal GM (30.4 µg/mL) and AFG (17.3 µg/mL). Antibiotic concentration at the 30th and 60th minute was lower (P = 0.02) in patients with AFG than in patients with normal GM. Concentration at the 120th (P < 0.01) and 180th (P = 0.02) minute in AFG group was higher than in AAG group, and at the 240th (P < 0.01) minute than in both other groups. ABSTRACTS | 49 of 95

ELECTRONIC POSTER ROUND 3: GASTRIC EP3.02 | Identification of volatile organic compounds emitted by CANCER gastric juice

P. Mochalski1,2; L. Mezmale3,4; I. Polaka3,5; I. Kikuste3,4,6; A. Vanags6; I. Tolmanis6; V. Veliks3; M. Leja3,4,6 EP3.01 | Application of gold nanoparticles and metal oxide 1Breath Research Institute of the University of Innsbruck, Dornbirn, sensors for non-invasive detection of gastric cancer Austria; 2Institute of Chemistry, Jan Kochanowski University, Kielce, Poland; 3University of Latvia, Institute of Clinical and Preventive L. Mezmale1,2; I. Polaka1,3; I. Kikuste1,4,2; I. Tolmanis4; K. Zarkova1,2; Medicine, Riga, Latvia; 4University of Latvia, Faculty of Medicine, Riga, A. Lescinska1,5; M. Padilla6; J. Mitrovics6; M. Leja1,2,4 Latvia; 5Riga Technical University, Riga, Latvia; 6Digestive Diseases 1University of Latvia, Institute of Clinical and Preventive Medicine, Riga, Centre GASTRO, Riga, Latvia Latvia; 2University of Latvia, Faculty of Medicine, Riga, Latvia, 3Riga Technical University, Riga, Latvia; 4Digestive Diseases Centre GASTRO, Introduction: Volatile organic compounds (VOCs) released by the Riga, Latvia; 5Riga Stradins University, Riga, Latvia; 6JLM Innovation, human organism mirror normal physiological processes as well as Tuebingen, Germany pathological disorders. However, the main unresolved issue is the poor understanding of the sources and metabolic fate of VOCs in Introduction: Many other cancers with a high burden of the disease, the human organism. This problem can be addressed via comparing including gastric cancer (GC) would benefit of a reliable non-invasive volatile patterns obtained from different sources (fluids, tissues). screening tool but are still lacking one. The analysis of volatile or- Aim: To identify volatiles being emitted by gastric juice (GJ) as an ganic compound from breath samples using sensors is a potentially alternative source of information on potential gastric cancer (GC) new way to perform GC screening method. markers. Aim: To evaluate the ability of gold nanoparticles (GNP) and metal Methods: A cohort of 10 healthy volunteers were enrolled. For oxide sensors (MOX) to detect GC patients. VOCs analysis GJ were collected during gastroscopy. After collec- Methods: Healthy individuals and GC patients were recruited for tion, all samples were frozen. Gas chromatography with mass spec- study using a POC modular breath analyser prototype, which in- trometric detection coupled with head-space needle trap extraction cluded three modules with a different type of sensors: 8 GNP,14 as the pre-concentration technique was used to identify and quan- MOX digital, 8 MOX analog sensors. The ability of the sensors to tify VOCs emitted by GJ. differentiate gastric cancer patients from healthy individuals was Results: A total number of 62 compounds have been identified in compared using ANOVA test for mean values of sensor readings. the headspace of the GJ samples. Only 33 species exhibited oc- The level of statistical significance was set at P < 0.05. currence above 20%. Amongst, them there were several hospital Results: Data from altogether 61 study subjects (41%-females and environment-related species (propofol, 1-propanol and 2-propanol). 51%-males; mean age 51) were included in the analysis, of these The predominant chemical classes were aldehydes and alcohols with 36 were cancer patients. GNP sensors show the best ability to dif- 14 and 9 species, respectively. Apart from these, there were 6 ke- ferentiate GC patients from healthy subjects: out of eight sensors, tones, 7 esters, 6 organic acids, 6 hydrocarbons, 3 aromatics and 3 seven GNP sensors (GNP2, GNP3, GNP4, GNP5, GNP6, GNP7, heterocyclics. Only one compound (acetone) was found in all sam- GNP8) can detect GC patients (P < 0.001). Digital MOX sensors also ples and further 3 (2-methyl-propanal, 2-butanone, cyclohexanone) are capable of detecting GC patients: out of 15 sensors, six sensors in all samples but one. (ZMOD44101A, ZMOD44102A, ZMOD44103A, ZMOD44101B, Conclusions: Analysis of VOCs emitted by GJ samples provides ZMOD44102B, ZMOD44103B) showed positive result (P < 0.05). an opportunity to identify compounds associated with a GC state. Meanwhile, analogue MOX sensors show that out of eight sensors, These components in turn could be targeted in breath of GC patients only one sensor (TGS8100) can detect disease (P = 0.020). and thereby assist the non-invasive diagnosis of GC based on simply Conclusion: GNP and MOX sensors have shown potential to detect in use, portable breath analysers. VOC profiles in GC patients, however, standardization of the device P. Mochalski: None. L. Mezmale: None. I. Polaka: None. I. Kikuste: readings is required. None. A. Vanags: None. I. Tolmanis: None. V. Veliks: None. M. Leja: L. Mezmale: None. I. Polaka: None. I. Kikuste: None. I. Tolmanis: None. None. K. Zarkova: None. A. Lescinska: None. M. Padilla: None. J. Mitrovics: None. M. Leja: None. 50 of 95 | ABSTRACTS

EP3.03 | Helicobacter pylori CagA hijacks cortactin to control ortholog, drives effector molecule delivery into host cells. However, host cell migration via Vav2-mediated small GTPase Rac1 CagY exhibits an additional large N-terminal domain comprising two activation large repeat sections with an extraordinary structural variability produced by in frame deletion or duplication events. Interestingly, the N. Tegtmeyer; A. Harrer; S. Backert rearrangements in CagY are immune-driven by the host, sufficient Friedrich-Alexander University Erlangen-Nuremberg, Erlangen, to trigger gain or loss of T4SS function. However, the exact function Germany of the repeats, and whether they are employed in direct host cell interactions is yet unknown. Here, we identified the CagY repeats Host cell migration and invasion are important processes in gastric as a novel flagellin-independent TLR5 agonist. We detected five cancerogenesis that involve the concerted regulation of cytoskeletal TLR5 interaction sites, promoting binding of CagY-positive H. pylori rearrangements by signal transduction proteins such as the actin- to TLR5-expressing cells, TLR5 stimulation and intracellular signal binding protein cortactin. Various microbial pathogens subvert transduction. TLR5 expression is also symptomatic for severe gastric cortactin to promote their own uptake, proliferation and spread dur- diseases in patients. Consequently, CagY constitutes a remarkable ing infection. Here, we demonstrate that the gastric pathogen and VirB10 member detected by TLR5, driving crucial innate immune re- type-I carcinogen H. pylori targets cortactin by inducing its tyrosine sponses by this eminent human pathogen. phosphorylation at Y-466 to trigger cell migration and elongation. N. Tegtmeyer: None. H. Sticht: None. J. Lind: None. M. Neddermann: The phosphorylation status of cortactin commands its subcellular None. S.K. Pachathundikandi: None. A.J. Gutiérrez-Escobar: None. localization and subsequently induces the recruitment of signaling S. Backert: None. partners. During infection, cortactin was discovered to undergo tyrosine dephosphorylation at residues Y-421 and Y-486 triggered by inactivation of Src kinase through the T4SS effector protein CagA. EP3.05 | Overexpression of toll-like receptor 5 in H. pylori- However, H. pylori infection activates another tyrosine kinase, Abl, infected patients with or without neoplasia which phosphorylates cortactin at Y-466. Phosphorylated cortactin then interacts with the guanine exchange factor Vav2 to stimulate S. Backert1; C. Falkeis-Veits2; N. Tegtmeyer1; M. Vieth2 its GEF activity. This specific interaction required the SH2 domain 1Friedrich-Alexander University Erlangen-Nuremberg, Erlangen, of Vav2 and phosphorylation of cortactin at Y-466. The cortactin/ Germany; 2Klinikum Bayreuth, Bayreuth, Germany Vav2 complex then stimulates the small Rho GTPase member Rac1 to trigger actin rearrangements and cell motility. Using H. pylori as a Toll-like receptors (TLRs) represent a crucial family of pathogen rec- model system, this study unravels a previously unrecognized Rac1 ognition receptors, which sense evolutionarily conserved structures activation pathway. We propose that H. pylori targets cortactin to in microbes. A prototypic member is TLR5, which recognizes the locally open the gastric epithelium in order to get access to certain conserved D1-domain in flagellins produced by Salmonella, Vibrio nutrients and thereby disturbs cellular barrier functions that could and other pathogens. In contrast, the flagellins of Campylobacter, play a role in gastric disease development. Bartonella and H. pylori are not recognized by TLR5. These data led to S. Backert: None. N. Tegtmeyer: None. A. Harrer: None. the hypothesis that TLR5 evasion is essential for these bacteria such as H. pylori to survive at mucosal surfaces in mammals. However, we examined immunohistochemically the expression of TLR5 in pa- EP3.04 | The repeat regions of Helicobacter pylori VirB10- tients with severe gastric diseases. Remarkably, while antrum biop- ortholog CagY can bind and activate toll-like receptor 5 sies from healthy non-infected individuals showed very little or no TLR5 staining, TLR5 signals appeared upon infection and gradually N. Tegtmeyer; H. Sticht; J. Lind; M. Neddermann; S. K. increased with the grade of H. pylori colonization and severity of in- Pachathundikandi; A. J. Gutiérrez-Escobar; S. Backert flammation in the gastric mucosa as classified by the updated Sydney Friedrich-Alexander University Erlangen-Nuremberg, Erlangen, System. Staining for TLR5 was strongly upregulated in patients with Germany H. pylori-associated lymphocytic gastritis, with low grade B-cell lymphoma of the MALT-type, autoimmune gastritis and, accord- Helicobacter pylori is an important human pathogen associated with ing to Laurén, the intestinal type of gastric adenocarcinoma, while gastric ulceration and neoplasia. It is commonly believed that the the signals were significantly reduced in H. pylori-negative patients bacterium avoids immune recognition by Toll-like receptors (TLRs) with diffuse type of gastric carcinoma. TLR5-staining was mainly de- because of low intrinsic activity of its flagellin and LPS, important to tected in epithelial cells, granulocytes and plasma cells within the establish a chronic infection. In particular, TLR5 specifically detects lamina propria, while goblet cells (intestinal metaplasia) were devoid flagellins in various bacterial pathogens, while H. pylori evolved mu- of TLR5. Immunoreactive scoring according to Remmele and Stenger tations in flagellin to evade detection through TLR5. Cancerogenic confirmed that TLR5 expression is significantly induced by infection H. pylori strains encode a type IV secretion system (T4SS). The T4SS and coincides with the grade of inflammation and gastric malignant core component and pilus-associated protein CagY, a large VirB10 ABSTRACTS | 51 of 95 progression in patients. The importance of TLR5 overexpression endoscopic biopsies were reported by OLGA and OLGIM systems during H. pylori pathogenesis is discussed. according to updated Sydney system. Blood samples were collected S. Backert: None. C. Falkeis-Veits: None. N. Tegtmeyer: None. M. for biomarkers serological analysis of PGI, PGII, G17 and anti-H. py- Vieth: None. lori antibodies (GastroPanel®, Helsinki, Finland). The cut off values used to define high risk patients were those recommended by the manufacturer: PGI ≤30 µm/L and PGI/PGII ≤3. EP3.06 | H. pylori chronic gastritis: OLGA and OLGIM evaluation Results: Forty-one patients, 28 women, mean age 67.3 years were and serum biomarkers for risk assessment of gastric cancer recruited. See Table. The concordance rate found between the clas- development in Brazilian patients sifications was 85.4%. Considering a high risk patient as classified in at least one of the histological staging systems, the final distribution M. Coelho; H. G. Ribeiro; J. S. Alves; C. G. Gomes; A. P. Ramos; F. P. of our sample considers 24 low-risk and 17 high-risk patients for the Marinho; K. S. Lima; R. I. Passos; A. J. A. Barbosa; L. G. Coelho development of gastric cancer. PGI showed a sensitivity, specificity UFMG, Belo Horizonte, Brazil and accuracy of 0.47, 0.67, and 0.58, respectively, while PGI/PGII showed sensitivity, specificity and accuracy of 0.06, 0.83, and 0.51, Aim: Prospective study to evaluate the concordance rate between respectively. the OLGA and OLGIM systems, as well as to study serum biomarkers Conclusion: OLGA and OLGIM systems presented a good concord- performance in patients with precancerous lesions secondary to H. ance rate. Simultaneous use of both systems increased the identifi- pylori chronic gastritis. cation of high-risk patients. Biomarker analysis was not effective in Patients and Methods: Patients with histologically proven H. py- differentiating low to high risk patients. lori chronic gastritis with precancerous lesions were recruited and

Distribution of 41 pts as low- and high-risk to cancer development according OLGA and OLGIM systems

OLGA 0 OLGA I OLGA II OLGA III OLGA IV

Patients (n) 1 7 17 9 7 OLGA: Low Risk OLGA: High Risk OLGA: High Risk 25 16 Patients (n) OLGIM 0 OLGIM I OLGIM II OLGIM III OLGIM IV 14 5 10 10 2 OLGIM: Low Risk OLGIM: High Risk 29 12

M. Coelho: None. H.G. Ribeiro: None. J.S. Alves: None. C.G. Gomes: individuals. As a method for studying the activity of neutrophilic None. A.P. Ramos: None. F.P. Marinho: None. K.S. Lima: None. R.I. granulocytes, we used a chemiluminescent analysis of spontaneous Passos: None. A.J.A. Barbosa: None. L.G. Coelho: None. and induced production of ROS NG in patients with gastric cancer. Statistical data processing was performed using Statistica software packages for Windows 8.0 and Microsoft Excel, 2007. Processing EP3.07 | Evaluation of the nonspecific immunity in patients with the obtained data included the calculation of nonparametric data. gastric cancer with Helicobacter pylori infection The statistical significance of the differences was determined using the Mann-Whitney test P < 0.05. O. Smirnova; A. Sinyakov Results: In patients with gastric cancer with spontaneous and in- Scientific Research Institute of Medical Problems of the North, duced chemiluminescence of neutrophilic granulocytes, there was an Krasnoyarsk, Russian Federation increase in the time to reach the maximum with spontaneous and induced chemiluminescence compared to the control group. In addition, Background: The mechanisms of the pathogenesis of gastric cancer in patients with gastric cancer with spontaneous and induced chemi- are still poorly understood. The study of precancerous changes in luminescence of neutrophilic granulocytes, there was a decrease in the stomach is one of the most urgent tasks in the clinic of internal the area under the glow curve compared to the control group. diseases. The aim of the study was to evaluate the chemiluminescent Conclusions: Patients with gastric cancer with Helicobacter pylori in- activity of neutrophilic granulocytes in patients with gastric cancer fection have been found to have a depletion of metabolic reserves with H. pylori infection. and a decrease in antitumor effects, as well as a decrease in the re- Methods: Fifty patients with gastric cancer with Helicobacter pylori sponse rate of NG in this disease. infection were examined. The control group consisted of 50 healthy O. Smirnova: None. A. Sinyakov: None. 52 of 95 | ABSTRACTS

EP3.08 | The role of non-specific monocytic phagocytes in the disorders associated with malignant transformation, affects the lipid progression of gastric cancer associated with Helicobacter pylori peroxidation and antioxidant defense genes. infection Objective: To study the content of malondialdehyde and the activity of superoxide dismutase and catalase enzymes in gastric cancer as- O. Smirnova; V. Tsukanov; A. Sinyakov; O. Moskalenko; N. sociated with Helicobacter pylori- infection. Elmanova; E. Ovcharenko Methods: Forty patients with gastric cancer and 50 healthy volun- Scientific Research Institute of Medical Problems of the North, teers were examined. In the blood serum, the content of malondial- Krasnoyarsk, Russian Federation dehyde, the activity of superoxide dismutase and catalase enzymes were determined by spectrophotometric methods. Statistical data Background: The role of the immune system in the occurrence and processing was carried out using Statistica. The statistical signifi- progression of gastric cancer associated with Helicobacter pylori- in- cance of the differences was determined using the Mann–Whitney fection is undeniable, while the participation of non-specific phago- rank test. cytes – monocytes and macrophages in the elimination of foreign Results: In patients with gastric cancer, showed 50-fold increase in antigens is unconditional. the content of malondialdehyde relative to the control group, indi- Objective: To study the chemiluminescent activity of monocytes in cating significant oxidative stress in patients. However, there was a gastric cancer associated with Helicobacter pylori- infection. decrease in the activity of superoxide dismutase and an increase in Methods: Forty patients with gastric cancer and 50 healthy volun- catalase activity in patients with gastric cancer relative to the con- teers were examined. Monocyte activity was studied by chemilumi- trol group. nescent methods. Statistical data processing was carried out using Conclusion: Patients with gastric cancer associated with Helicobacter Statistica. The statistical significance of the differences was deter- pylori- infection exhibit severe oxidative stress. An imbalance is de- mined using the Mann–Whitney rank test. tected in the bifunctional system of superoxide dismutase – cata- Results: In patients with gastric cancer, a decrease in the maximum lase, the activity of the main enzyme of the antioxidant defense intensity of luminescence of monocytes in spontaneous and induced superoxide dismutase is reduced, while the high activity of catalase states relative to the control group was detected. The time to reach indicates massive cell decay in gastric cancer, and it can be assumed the maximum luminescence of monocytes increased in the induced that in conditions of high catalase activity, cells lining blood vessels state, and the area under the curve of chemiluminescence of mono- are subject to significant oxidative stress. cytes increased in spontaneous and induced states relative to the O. Smirnova: None. A. Sinyakov: None. control group. Conclusion: In patients with gastric cancer associated with Helicobacter pylori- infection, a decrease in monocyte activity is EP3.10 | Peculiarities of glutathione antioxidant protection detected due to the duration of the disease and the toxic effects functioning in gastric cancer associated with Helicobacter pylori of the tumor products. The inefficiency of phagocytosis of monoinfection cytes leads to the spread of the tumor. The project “Development and implementation of a program for screening and early diagnosis O. Smirnova; A. Sinyakov of gastric cancer by indicators of the immune, prooxidant and anti- Scientific Research Institute of Medical Problems of the North, oxidant systems to reduce mortality and disability” was funded by Krasnoyarsk, Russian Federation Krasnoyarsk Regional Fund of Science. O. Smirnova: None. V. Tsukanov: None. A. Sinyakov: None. O. Background: Up to 800,000 new cases of gastric cancer are diag- Moskalenko: None. N. Elmanova: None. E. Ovcharenko: None. nosed each year in the world. Gastric adenocarcinoma remains in second place among oncological diseases leading to death, the risk of developing gastric cancer in infected patients is 2-4 times higher EP3.09 | Features of lipid peroxidation and antioxidant than in the rest. The pathogenesis of cancer involves lipoperoxida- protection in gastric cancer associated with Helicobacter pylori tion and antioxidant defense. infection Objective: To study the state of the processes of lipid peroxidation and the glutathione link of antioxidant defense in gastric cancer as- O. Smirnova; A. Sinyakov sociated with Helicobacter pylori- infection. Scientific Research Institute of Medical Problems of the North, Methods: Forty patients with gastric cancer and 50 healthy volun- Krasnoyarsk, Russian Federation teers were examined. The content of malondialdehyde, reduced glutathione, the activity of glutathione-S-transferase and glutathione Background: Gastric cancer in Russia ranks 2nd in the structure peroxidase were determined in the blood serum by spectrophoto- of mortality from malignant diseases. Helicobacter pylori infection metric methods. Statistical data processing was carried out using induces a mutation of genes that trigger cell apoptosis in genetic Statistica. The statistical significance of the differences was determined using the Mann–Whitney rank test. ABSTRACTS | 53 of 95

Results: In patients with gastric cancer there was an increase in the EP3.12 | Gastric cancer risk factors due to life style concentration of malondialdehyde in plasma compared with the control group. The concentration of glutathione-S transferase and O. V. Shtygasheva1; E. S. Ageeva2 glutathione peroxidase in plasma in patients with cancer increased 1Katanov Khakass State University, Abakan, Russian Federation; compared with the control group. The level of restored glutathione 2Medical Academy named after S.I. Georgievsky of Vernadsky CFU, in patients with gastric cancer was significantly higher than in all Simferopol, Russian Federation other studied groups. Conclusion: In patients with gastric cancer, lipid peroxidation pro- Aim: To study frequency and expression of vital risk factors in pa- cesses are enhanced, proven by an increase in serum malondialde- tients with gastric cancer (GC). Material and Method. hyde. The high activity of the enzymes of glutathione link and the A survey of patients of the Republic of Khakassia with a 1st diagnosis high content of glutathione prove an increase in the activity of the of GC (2018-2019) was conducted. We evaluated the smoking index antioxidant system aimed at combating oxidative stress. (IS, packs/year), alcohol, nutrition. O. Smirnova: None. A. Sinyakov: None. Results: The smoking has been established in 45% of GC patients. Among man 36% were “heavy smokers,” 23% were “unconditional smokers.” A relationship was established between the male gender EP3.11 | Trends in gastric cancer in the Alaska Native and the number of cigarettes smoked (r = 0.51, P = 0.02). 100% of population, 1988-2017 Trends in gastric cancer in the Alaska respondents confirmed a history of alcohol consumption, significant Native population, 1988-2017 alcohol more 50 g/day – 27% of men and 17% of women. Smoking history and IS are interrelated with frequent alcohol consumption L. Nolen1; S. Seeman1; K. Miller2; D. Bruden1; S. Vindigni2; M. (r = 0.72 and r = 0.70, P = 0.05) in men. In women, a directly pro- Bruce1; S. Nash2 portional relationship was found between IS and alcohol (r = 0.83, 1Arctic Investigations Program, Division of Preparedness and Emerging P = 0.03), long time smoking (r = 0.86, P = 0.05), and number of ciga- Infections, National Center for, Anchorage, AK, United States; 2Alaska rettes (r = 0.84, P = 0.04). Excessive consumption of salt and red Native Tribal Health Consortium, Anchorage, AK, United States meat (more 30 g/day) and canned foods was confirmed in 85% of patients. The male was interrelated with the frequency of consumption Alaska Native (AN) people have higher gastric cancer (GCan) inci- of salted and fried (r = 0.58, P = 0.04) and smoked and fried foods dence and mortality rates compared to other U.S. populations. Using (r = 0.63, P = 0.04). Factor analysis to distinguish two groups. The 1st an AN-specific cancer registry, we evaluated the trends in GCan be- group of factors includes gender (r = 0.7, P = 0.04), smoking experi- tween 1988 and 2017. Data were obtained from the Alaska Native ence (r = −0.92, P = 0.05), the number of cigarettes smoked (r = −0.95, Tumor Registry, a population-based central cancer registry that cap- P = 0.04), IS (r = −091, P = 0.05), alcohol (r = −0.75, P = 0.03). The 2nd tures all cancer in American Indian/AN people living in Alaska. Rates is the frequent use of frying food (r = −0.83, P = 0.04). were calculated for 3-year time periods and age-adjusted using the Conclusion: The premorbid and primary disease prevention system 2016 Alaska census as the standard. The trend across time periods are elimination of cancer-related predictors of lifestyle. was analyzed using Poisson regression. A total of 429 cases of GCan E.S. Ageeva: None. O.V. Shtygasheva: None. occurred in the AI/AN population between 1988 and 2017. The age- adjusted rate ranged from a high of 26.9 per 100,000 persons in the 1991-1993 period to a low of 14.2 in 2015-2017 period, however no EP3.13 | Diffuse type gastric cancer is associated with high titer significant trend was found over the 30 year period. The mean age of of anti-Helicobacter pylori antibody people diagnosed with GCan was 59.6 years, with 11.4% <40 years old; 63.4% of cases were male. The majority of cancers were classi- J. Lim1; S. Cho2; S. Kim2; J. Kim2 fied as adenocarcinoma without additional subtyping (53.6%). The 1Seoul National University Hospital, Healthcare System Gangnam most commonly defined subtype was signet-ring cell (SRC) (18.2%). Center, Healthcare Research Institute, Seoul, Republic of Korea; Tumors were more often SRC in people <40 years (35.0%) compared 2Department of Internal Medicine and Liver Research Institute, Seoul to people ≥40 years (16.1%, P < 0.0001). These data show rates of National University College of Medicine, Seoul, Republic of Korea GCan in the AN population from 1988 to 2017. Individuals <40 years were more likely to have SRC tumors, a histology that is typically Introduction: The implication of serum anti-Helicobacter pylori an- much more aggressive. tibody titer on the pattern of carcinogenesis is rarely investigated. L. Nolen: None. S. Seeman: None. K. Miller: None. D. Bruden: None. This study is designed to evaluate the effect of anti-H. pylori IgG titer S. Vindigni: None. M. Bruce: None. S. Nash: None. on the development of each type of gastric cancer. Methods: We retrospectively reviewed prospectively collected cohort of health screening population who underwent regular upper gastrointestinal endoscopy and laboratory tests including serum anti-H. pylori IgG between October 2003 and December 2018. 54 of 95 | ABSTRACTS

Results: Among the total of 12,4794 individuals who had screening This correlated with decreased survival (P = 0.017, log-rank test). For endoscopy and test for serum anti-H. pylori IgG antibody, 63,235 in- the other mucins tested, this association could not be established. dividuals with positive result in anti-H. pylori IgG were enrolled. High Conclusion: Our results highlight a key role for MUC13 in gastric titer was defined as the IgG greater than the upper limit. Overall, cancer progression and survival. More research is required to under- 18,603 showed high titer of IgG. High titer group developed gastric stand its exact mechanism. cancer less commonly compared with low titer group (Log Rank P- B. Oosterlinck: None. T. Breugelmans: None. J. De Man: None. K. value <0.001). However, among those who developed gastric cancer, Geboes: None. J. Kupčinskas: None. A. Link: None. B. De Winter: high titer group had more patients with diffuse type cancer than low None. A. Smet: None. titer group (51.8% vs 38.7%, P = 0.032). Conclusions: Low titer of anti-H. pylori IgG is related with high rate of gastric carcinogenesis. However, those with high titer have a ten- EP3.15 | Cost-effectiveness of Helicobacter pylori screening and dency to develop diffuse type gastric cancer more commonly than eradication to prevent stomach cancer in Spain those with low titer. J. Lim: B. Research Grant (principal investigator, collaborator or J. López-Saavedra1; E. Martínez-Junquera1; L. Fontan2; M. López- consultant and pending grants as well as grants already received); Torreblanca1; I. Lorenzana-Sánchez1; T. Alarcón1,2 Significant; Seoul National University Hospital. S. Cho: None. S. Kim: 1Autonomous University of Madrid, Madrid, Spain; 2Hospital Univ. La None. J. Kim: None. Princesa, Madrid, Spain

Introduction: Helicobacter pylori is believed to cause up to 69% of EP3.14 | Aberrant MUC13 expression as prognostic marker for stomach cancers (SC). SC is the seventh most deadly in Spain, with gastric cancer its prevalence increasing in population over 50 years. Eradication of H. pylori has been proposed as a prevention strategy against SC. The B. Oosterlinck1; T. Breugelmans1; J. De Man1; K. Geboes2; J. aim of this study is to compare the costs of H. pylori screening and Kupčinskas3; A. Link4; B. De Winter1; A. Smet1 treatment with the costs derived from SC in the Spanish National 1University of Antwerp, Antwerp, Belgium; 2Ghent University Hospital, Health System (SNHS). Ghent, Belgium; 3Lithuanian University of Health Sciences, Kaunas, Methods: We designed a Markov model with cohort simulation to Lithuania; 4Otto-von-Guericke University, Magdeburg, Germany evaluate the cost-effectiveness of H. pylori screening and eradication. A probabilistic sensitivity analysis was performed by applying Background: One of the hallmarks of gastric adenocarcinoma is the Monte Carlo simulation with 1000 iterations using Microsoft aberrant mucin expression. Gastric- and intestinal-type mucins are Excel 365. The protocol consisted of a Stool Antigen Test (SAT), a widely expressed in gastric tumours, but their clinical importance confirmation C13-Urea Breath Test (UBT), and a quadruple 14 days is still controversial in relation to disease progression and outcome. eradication therapy with rabeprazole, clarithromycin, amoxicillin and Here, we investigated mucin expression in human gastric adenocar- metronidazole. The model compared this protocol (Scenario 1) with cinomas and their correlation with disease outcome. no screening or treatment for H. pylori (Scenario 2). Methods: Gastric biopsies of tumour and adjacent tissue of two in- Results: dependent cohorts of Belgian (n = 45) and Lithuanian (n = 43) pa- Scenario 1 Scenario 2 tients were analysed for mucin expression. Relative expression of Average cost 7,234.55€ 20,182.66€ gastric (MUC1, MUC5AC and MUC6) and intestinal mucins (MUC2, Average of QALYs gained 20.75 14.9 MUC4 and MUC13) was determined by RT-qPCR. The adenocarcinomas were classified by expression leading to gastric (predominantly MUC5AC and MUC6), intestinal (predominantly intestinal The average Incremental Cost-Effectiveness Ratio (ICER) amounted and MUC1), mixed (all types) and unclassified/null (neither gastric to −2,224.67 €/QALY (Quality-Adjusted Life Year) and a consequent nor intestinal) mucin phenotypes. The overexpression threshold was probability of cost-effectiveness of 100% at any cost-effectiveness defined as a 0.2*MNE increase (mean normal tissue expression) in threshold. the tumour compared to normal tissue. Correlation with 5-year sur- Conclusion: This analysis support the hypothesis that, through the vival (Kaplan-Meijer analysis) and other clinical traits (tumour stadia, screening and treatment for H. pylori above 50 years old, SC can be histology, age, gender, ···) was tested. prevented and health costs for the SNHS can be reduced. However, Results: Our analysis classified the cancers as gastric (14.5%), intes- the analysis has some limitations and more studies are needed. tinal (25.0%), mixed (17.1%) and unclassified (43.4%) mucin pheno- J. López-Saavedra: None. E. Martínez-Junquera: None. L. Fontan: types. MUC13 overexpression was observed in 55.3% of the cases. None. M. López-Torreblanca: None. I. Lorenzana-Sánchez.: None. T. Interestingly, 30% of the complete cohort -intestinal and mixed Alarcón: None. type- had a MUC13 expression exceeding a 1.75*MNE threshold. ABSTRACTS | 55 of 95

EP3.16 | In vitro profiling of volatile organic compounds released P. Mochalski: None. L. Mezmale: None. A. Leiherer: None. C. Heinzle: and consumed by CLS-145 and HGC-27 gastric cell lines None. A. Muendlein: None. D. Ślefarska: None. I. Kikuste: None. I. Tolmanis: None. G. Shani: None. M. Leja: None. H. Haick: None. P. Mochalski1,2; A. Leiherer3,4,5; C. Heinzle3,5; A. Muendlein3; D. Ślefarska1,6; L. Mezmale7; I. Kikuste7,8; I. Tolmanis8; G. Shani9; M. Leja7,8,10; H. Haick9 EP3.18 | Endoscopic biopsy sampling during gastroscopy – 1Breath Research Institute of the University of Innsbruck, Dornbirn, Discrepancies across Europe Austria; 2Institute of Chemistry, Jan Kochanowski University, Kielce, Poland; 3Vorarlberg Institute for Vascular Investigation and J. Bornschein1; T. Tran-Nguyen1; S. Ash2; G. Fernandez- Treatment, Feldkirch, Austria; 4Private University of the Principality of Esparrach3; F. Balaguer3; E. Bird-Lieberman1; H. Córdova3; Z. Liechtenstein, Triesen, Liechtenstein; 5Medical Central Laboratories, Dzerve4; M. Fassan5; M. Leja4; I. Lyutakov6; T. Middelburg7; Feldkirch, Austria; 6Institute of Chemistry, Jan Kochanowski University, L. Moreira3; R. Nakov6; S. A. V. Nieuwenburg7; A. O'Connor8; Kielce, Austria; 7University of Latvia, Institute of Clinical and S. Realdon9; H. DeSchepper10; A. Smet11; M. C. Spaander7; Preventive Medicine & Faculty of Medicine, Riga, Latvia; 8Digestive I. Tolmanis4; T. Urbonas12; J. Weigt13; G. Hold14; A. Link13; J. Diseases Centre GASTRO, Riga, Latvia; 9Department of Chemical Kupcinskas12; ENIGMA (European Network for the Investigation of Engineering and Russel Berrie Nanotechnology Institute, Technion Gastrointestinal Mucosal Alterations) – Israel Institute of Technology, Haifa, Israel; 10Riga East University 1Oxford University Hospitals, Oxford, United Kingdom; 2Nuffield Hospital, Riga, Latvia Department of Medicine, University of Oxford, Oxford, United Kingdom; 3Institut d'Investigacions Biomèdiques August Pi i Sunyer Introduction: Analysis of volatile organic compounds (VOCs) re- (IDIBAPS), University of Barcelona, Barcelona, Spain; 4Digestive leased by human body provides an emerging approach for cancer Diseases Centre GASTRO, University of Latvia, Riga, Latvia; 5Surgical screening. The metabolism of cancer cells differs from that of nor- Pathology Unit, University of Padua, Padua, Italy; 6Tsaritsa Yoanna mal ones and this difference can be detected in the VOCs profiles. University Hospital, Medical University of Sofia, Sofia, Bulgaria; In this context in vitro studies are of considerable importance for 7Erasmus MC University Medical Center Rotterdam, Rotterdam, the explorations of these changes in exhaled breath and other body Netherlands; 8Tallaght University Hospital, University of Dublin, Trinity emanations. College, Dublin, Ireland; 9Veneto Institute of Oncology IOV-IRCCS, Aim: The main aim of this study was to pinpoint the volatile metabo- Padua, Padua, Italy; 10University Hospital Antwerp, Egedem, Belgium; lomic signature of selected gastric cancer cell lines and detect pos- 11Laboratory of Experimental Medicine and Pediatrics, University sible differences between these fingerprints. of Antwerp, Antwerp, Belgium; 12Department of Gastroenterology Methods: Gas chromatography with mass spectrometric detection and Institute for Digestive Research, Lithuanian University of Health (GC-MS) and head-space needle trap extraction (HS-NTE) as the Sciences, Kaunas, Lithuania; 13Department of Gastroenterology, pre-concentration method were applied to profile VOCs produced Hepatology and Infectious Diseases, Otto-von-Guericke University, and metabolized by two Human Gastric Carcinoma cell lines (CLS- Magdeburg, Germany; 14Microbiome Research Centre, St George & 145, HGC-27) and Human Stomach Epithelial Cells (HSEC), the latter Sutherland Clinical School, University of New South Wales, Sydney, serving as a control. Australia Results: In total 12 sets of cultures (three cultures containing different lines and medium without cells) were prepared. Background: National and international guidelines give robust rec- Twelve species (2 methylpropanal, 2-methyl-2-propenal, ommendations on which biopsies should be taken in the presence of 2-methylbutanal, 3-methylbutanal, hexanal, heptanal, nonanal, endoscopic signs of gastric inflammation. This study aimed to give benzaldehyde, 2-ethyl- furan, 2-pentyl- furan and 2-methyl- furan an overview on current practice in tertiary referral centres across and dimethyl disulfide) were found to be consumed and ten (ethyl Europe. acetate, ethyl propanoate ethyl-α-methylbutyrate, 2-pentanone, Methods: Data was collected at ten tertiary referral centres across 2-heptanone, 2-nonanone, 2-methyl-1-butanol, 3-methyl-1-butanol, Europe. Demographic data, the indication for each procedure, and 2-ethyl- 1- hexanol and 2-methyl- 3- (methylthio) furan) were pro- endoscopic findings were recorded as well as what biopsies were duced by all lines under study. Interestingly, HGC-27 cells emit- taken. Findings were compared between centres and factors influ- ted a numer of unique VOCs (2-undecanone,2-tridecanone, encing the decision to take biopsies were explored. 2-pentadecanone,2-nonadecanone, cyclopentadecanone and Results: A total of 9425 gastroscopies were analysed. Biopsies were toluene). taken in 56.6% of procedures with significant variation between Conclusions: The results obtained within this study provide evi- centres (P < 0.001). Interestingly, fewer biopsies were taken in cen- dence that gastric cancer alters the VOCs profiles of cell lines under tres routinely applying the updated Sydney classification for gastri- study. The components of these fingerprints secreted from human tis assessment (46.0%) compared to centres where this was done organism via e.g. breath could assist in the non-invasive diagnosis of only upon direct request (75.3%, P < 0.001). Similar results were gastric cancer employing sensitive mobile platforms. documented for centres stratifying patients according to the OLGA 56 of 95 | ABSTRACTS system (51.8% vs 73.0%, P < 0.001). More biopsies were taken in to potential modulation of Base-Excision-Repair, Mismatch-Repair centres following the MAPS guidelines on stomach surveillance and a more intricate deregulation of Nucleotide-Excision- Repair (68.1% vs 37.1%, P < 0.001). Although the patients’ age had no influ- and Homologous-Recombination. CagA contributes to NTHL1, ence on the decision to take biopsies in the whole cohort (P = 0.537), MUTYH, FEN1, APE1, POLD1, LIG1 and RAD51 downregulation and in 8 centres biopsy sampling was significantly more likely in younger those observations were verified on the protein expression level, patients (P < 0.05). Anticoagulative therapy had no statistical influ- with the exception of APE1 that was on contrary observed to be ence. The percentage of procedures with biopsies correlated with upregulated. Our study accentuates the role of CagA, as a significant additional costs per procedure in case of biopsies at the respective contributor of the Hp infection-mediated DDR-modulation, disrupt- centres (r = 0.709, P = 0.022). ing the balance between DNA damage introduction and repair thus Conclusion: Adherence to guideline recommendations for biopsy favoring genomic instability and potentially contributing to gastric sampling at gastroscopy seems inconsistent across the participating carcinogenesis. centres. Our data suggest rather centre-specific policies. D.N. Sgouras: None. E. Kontizas: B. Research Grant (principal in- J. Bornschein: None. T. Tran-Nguyen: None. S. Ash: None. G. vestigator, collaborator or consultant and pending grants as well as Fernandez-Esparrach: None. F. Balaguer: None. E. Bird-Lieberman: grants already received); Modest; Work was partly supported by the None. H. Córdova: None. Z. Dzerve: None. M. Fassan: None. M. I. Kampouris Donation for Research Program Cancer & EMMPRIN Leja: None. I. Lyutakov: None. T. Middelburg: None. L. Moreira: of the Hellenic Pasteur Institute. S. Tastsoglou: None. T. Karamitros: None. R. Nakov: None. S.A.V. Nieuwenburg: None. A. O'Connor: None. Y. Karayiannis: None. P. Kollia: None. A. Hatzigeorgiou: None. None. S. Realdon: None. H. DeSchepper: None. A. Smet: None. A. Mentis: None. M.C. Spaander: None. I. Tolmanis: None. T. Urbonas: None. J. Weigt: None. G. Hold: None. A. Link: None. J. Kupcinskas: None. EP3.20 | The role of lactate in gastric carcinogenesis

EP3.19 | Impact of Helicobacter pylori infection and its virulence K. Vinasco-Pacheco; H. Mitchell; N. Kaakoush; N. factor CagA on DNA damage repair machinery Castano-Rodriguez The University of New South Wales, Sydney, Australia E. Kontizas1,2; S. Tastsoglou3; T. Karamitros1; Y. Karayiannis1,2; P. Kollia2; A. Hatzigeorgiou3; A. Mentis1; D. N. Sgouras1 Introduction: As lactate is involved in several hallmarks of cancer, 1Laboratory of Medical Microbiology, Hellenic Pasteur Institute, microbially derived lactate could be a pivotal contributing factor in Athens, Greece; 2Department of Genetics and Biotechnology, Faculty non-cardia gastric cancer (GC). Here, we investigated the impact of of Biology, School of Science, National and Kapodistrian University important genes involved in lactate metabolism in a high-risk ethnic of Athens, Athens, Greece; 3Laboratory of Bioinformatics, Hellenic Chinese population, in which we have previously shown lactic acid- Pasteur Institute, Athens, Greece producing bacteria (LAB) enrichment to be associated with GC, and a low-risk Caucasian population. Helicobacter pylori (Hp) infection promotes chronic inflammation and Methods: Functional germline polymorphisms in MCT1 (rs1049434), plethora of DNA damages including strand breaks, base alterations, MCT2 (rs1000708, rs3763980, rs7976956, rs995343) and MCT4 point mutations, microsatellite instability and epigenetic alterations. (rs9907757) were detected by MALDI-TOF mass spectrometry in The gastric epitheliaI cells, in order to prevent genomic instability, 302 ethnic Chinese (86 GC/216 controls) and 355 Caucasians (119 require an integrous DNA damage repair (DDR) machinery which, GC/236 controls). RNA was extracted from gastric biopsies from however, has been reported to be modulated by the infection. CagA ethnic Chinese and reverse transcribed to cDNA for qRT-PCR of is a major Hp virulence factor that deregulates host cell functions MCT1, MCT2, MCT4, and HCAR1. such as proliferation, apoptosis and chromosomal integrity. Its path- Results: In the Caucasian population, the MCT4 rs9907757 C allele ogenic activity is partly regulated by tyrosine phosphorylation on significantly increased the risk of GC by 2-fold (OR: 2.190, 95% CI: repeated EPIYA-motifs. Our aim was to identify putative effects of 1.14 to 4.22). In the Chinese population, the MCT4 rs9907757 C al- Hp infection and CagA on DDR-machinery, investigating the tran- lele might increase the risk of GC (OR: 1.67, 95% CI: 0.81 to 3.43). scriptome of AGS cells, infected with wild-type, ΔCagA and EPIYA- qRT-PCR analyses revealed that MCT1, MCT2, MCT4, and HCAR1 phosphorylation-defective strains. Upon RNA-Sequencing on were downregulated in GC patients were compared to controls. polyA-selected transcripts we performed Differential-Expression- Conclusions: MCT4 rs9907757 appears to be associated with GC Analysis, Pathway-Enrichment-Analysis and visualization on KEGG- in Caucasian and ethnic Chinese individuals. The expression levels Pathway-Maps per DDR-mechanism. Key DDR-components that of MCTs and HCAR1 were differentially expressed in GC patients were observed to be downregulated in a CagA-related manner were from a high-risk population. These same individuals were previously validated via Western-Blot utilizing AGS and the non-cancerous shown to present with LAB enrichment in their gastric mucosa. GES1 cell lines. Transcriptome analysis revealed that a notable num- Overall, these results indicate an important role for lactate in gastric ber of DDR-genes were downregulated during Hp infection resulting carcinogenesis, some of which could be microbially derived. ABSTRACTS | 57 of 95

K. Vinasco-Pacheco: None. N. Castano-Rodriguez: B. Research Grant and Medical Research Council (APP1111461), Gastroenterological (principal investigator, collaborator or consultant and pending grants Society of Australia, Cancer Institute NSW (2019/ECF1082). M.C. as well as grants already received); Significant; National Health Mommersteeg: None. B. Yu: None. S. van Nieuwenburg: None. M. and Medical Research Council (APP1111461), Gastroenterological Bruno: None. M. Bruno: None. G.L. Porras-Hurtado: None. H.A. Society of Australia, Cancer Institute NSW (2019/ECF1082). N. Salazar-Carmona: None. A.R. Cobo-Alvarado: None. J. Cardona- Kaakoush: B. Research Grant (principal investigator, collaborator or Deazza: None. M. Doukas: None. E.J. Kuipers: None. M. Spaander: consultant and pending grants as well as grants already received); None. M.P. Peppelenbosch: None. G.M. Fuhler: None. Significant; UNSW Scientia Program. H. Mitchell: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Significant; Ministry of Higher EP3.22 | Leukaemia Inhibitory Factor signalling for targeting Education, Malaysia (UM.C/625/HIR/MOHE/CHAN/13/1). cancer stem cells in gastric adenocarcinoma

L. Seeneevassen1; J. Giraud1; S. Molina-Castro2; C. Tiffon1; O. EP3.21 | ER stress and inflammation via autophagy influence Martin1; E. Sifré1; C. Staedel3; F. Megraud1,4; P. Lehours1,4; H. Helicobacter pylori-related gastric cancer Boeuf5; P. Dubus1,4; C. Varon1 1University of Bordeaux/INSERM/U1053 BaRITOn, Bordeaux, France; I. Simovic1; M. C. Mommersteeg2; B. Yu2; S. van Nieuwenburg2; M. 2University of Costa Rica/INISA-School of Medicine, Costa Rica, Costa Bruno2; M. Bruno2; G. L. Porras-Hurtado3; H. A. Salazar-Carmona3; Rica; 3University of Bordeaux/INSERM U1212 Régulations Naturelles A. R. Cobo-Alvarado3; J. Cardona-Deazza3; M. Doukas2; E. J. et Artificielles des ARNs, Bordeaux, France; 4CHU de Bordeaux, Kuipers2; M. Spaander2; M. P. Peppelenbosch2; G. M. Fuhler2; N. Bordeaux, France; 5University of Bordeaux/INSERM U1026, Bordeaux, Castano-Rodriguez1 France 1UNSW Sydney, Sydney, Australia; 2Erasmus University Medical Center, Rotterdam, Netherlands; 3Clinica Comfamiliar Risaralda, Pereira, Gastric cancer (GC) is a bad prognosis disease with high number Colombia of relapse cases and 5-year survival rate of less than 20%. Cancer stem cells (CSCs), making the heterogeneous architecture of gas- Background: Disrupted autophagy has been linked to increased tric tumours, present chemo-resistance mechanisms contributing susceptibility to infection and cancer. Polymorphisms in autophagy- to tumour maintenance and recurrence. Their targeting in cancer related genes, such as ATG16L1 rs2241880, have been shown to therapy thus seems of utmost importance. The Hippo pathway has deregulate the autophagic pathway, impairing pathogen clearance recently been implicated in gastric CSC properties and its regulation and increasing intestinal endoplasmic reticulum (ER) stress. Here, we by Leukaemia Inhibitory Factor Receptor (LIFR) and its ligand LIF investigate the role of this SNP in H. pylori-mediated gastric cancer has been described in breast cancer. Consequently, this study aimed (GC) and its molecular pathways, in Dutch, Australian and Colombian to determine the effect of LIF on CSC phenotype and properties in populations. GC cell lines and patient derived xenograft (PDX) cells, where it has Methods: ATG16L1 rs2241880 was genotyped in subjects present- not been investigated yet. LIF treatment decreased tumoursphere ing with gastric precancerous lesions, GC patients and controls. The forming capacity, an important tumorigenic property, of both GC cell functional relevance of ATG16L1 rs2241880 on H. pylori-mediated lines and PDX cells. In addition, LIF increased activation of LATS1/2 IL-8 induction and ER stress, was determined using CRISPR/Cas9 Hippo kinases thereby decreasing downstream YAP/TAZ nuclear ac- modified cell lines and organoids. Expression of important mark- cumulation, TEAD transcriptional activity and target gene expres- ers of ER stress (GRP78, CHOP1 and spliced XBP1 mRNA) were as- sion in our models. LIF anti-CSC effects were reversed by Hippo sessed in gastric tissues. kinase inhibition but not by STAT3 inhibition, highlighting the role Results: The ATG16L1 rs2241880 G-allele increased the risk of severe of the Hippo pathway in LIF-induced anti-tumourigenic properties. gastric precancerous lesions and cancer in the studied populations. Furthermore, KMplot database analysis show that low LIF and LIFR In vitro models demonstrated that H. pylori reduces ER stress via au- expression is associated to patients’ survival underlining the interest tophagy, which appears to be influenced by the ATG16L1 rs2241880 of LIF as potential therapy. In conclusion, this study displays LIF anti- genotype. Similarly, IL-8 production is dramatically increased in cells CSC properties in GC, linked to activation of Hippo kinases LATS1/2. homozygous for the ATG16L1 rs2241880 G-allele. This could in fine lead to the development of targeted strategies Conclusions: The ATG16L1 rs2241880 G-allele is associated with against CSCs and help decrease the number of relapse cases and gastric carcinogenesis in diverse ethnic groups with varying degrees bad prognosis in gastric cancer. of GC risk. Altered H. pylori-induced ER stress pathways and pro- L. Seeneevassen: None. J. Giraud: None. S. Molina-Castro: None. C. inflammatory mediators, are some of the mechanisms involved. Tiffon: None. O. Martin: None. E. Sifré: None. C. Staedel: None. F. I. Simovic: None. N. Castano-Rodriguez: B. Research Grant (prin- Megraud: None. P. Lehours: None. H. Boeuf: None. P. Dubus: None. cipal investigator, collaborator or consultant and pending grants C. Varon: None. as well as grants already received); Significant; National Health 58 of 95 | ABSTRACTS

EP3.23 | Cell-free DNA somatic alterations in plasma of gastric EP3.24 | Induction of precancerous phenotype of normal gastric cancer patients: Mutational spectra, association with tumor size epithelial cells after their long-term incubation with supernatant and survival from Helicobacter pylori-infected cancer-associated fibroblasts in vitro. Involvement of transforming growth factor beta and its G. Streleckiene1; M. Forster2; J. Kupcinskas3; J. Skieceviciene1 receptors 1Institute for Digestive Reasearch, Kaunas, Lithuania; 2Institute of Clinical Molecular Biology, Christian-Albrechts-Universität zu Kiel, Kiel, G. Krzysiek-Maczka1; M. Strzalka1; A. Targosz1; U. Szczyrk1; A. Germany; 3Department of Gastroenterology, Lithuanian University of Ptak-Belowska1; T. Wrobel2; J. Czyz1; T. Brzozowski1 Health Sciences, Kaunas, Lithuania 1Department of Physiology, Faculty of Medicine, Jagiellonian University Medical College, Cracow, Poland; 2Department of Cell Biology, Faculty Since the discovery of the circulating plasma cell-free DNA (cfDNA) of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, it was shown that cfDNA could harbour genetic aberrations from Cracow, Poland malignant tissue. However, there is a lack of studies conducted in gastric cancer (GC) analysing cfDNA mutational spectra. The aim of The Hp-induced inflammatory reaction may lead to a cascade of study was to compare GC tissue and cfDNA mutational profiles and pathogenic events resulting in development of chronic gastritis, analyse associations with different clinical features, levels of onco- gastroduodenal ulcers and cancer. This is illustrated by deregula- proteins. GC tissue and blood were collected from 29 patients who tion of gastric tissue cells self-renewal process by cancer-associated were recruited at the Department of Gastroenterology, Lithuanian fibroblasts (CAFs) playing the crucial role in process of epithelial- University of Health Sciences Hospital. Whole exome sequencing mesenchymal transition (EMT). We reported that EMT process ini- was performed for GC patients’ tissue and paired WBC samples, tiated by Hp-induced CAFs has changed the phenotype of gastric while targeted NGS consisting of 38 cancer-associated genes was epithelial RGM-1 cells. Here the long-termed (l.t.) incubation of performed for cfDNA only. After WES analysis, in total for 23 of RGM-1 cells with supernatant collected from Hp-induced CAFs with 29 patients (76.7 %) mutations associated with GC were detected. time duration up to 30 days, caused their dedifferentiation in Lgr+/ Matching tissue cfDNA alterations were detected for 14 of 23 (60.9 Oct4+/Sox-2+/c-Myc+/Klf4- pattern. The enhanced proliferation %) GC patients in genes: TP53, ERBB2, FAT1, MLH1, FAT4, SPEN, and phenotypical plasticity was observed in these cells compared KMT2C, MUC16, ACVR2A, ERBB4, PREX2, and SYNE1. Matching with long-termed Hp non-infected supernatant which presented sta- tumour and plasma alterations were detected significantly more ble epithelial myofibroblast transition EMyoT of epithelial cells (Lgr-/ often in samples of the patients with larger tumours (55.6 % and Oct4+/Sox-2- /c- Myc- /Klf4+ pattern). TGFβR1 may participate in 10.0%, T3-T4 and T1-T2 respectively, P = 0.018). Kaplan-Meier the induction of anti-apoptotic effect in l.t.EMT+RGM-1 cells, while survival analysis revealed that detectable alterations in cfDNA or inhibiting proliferation and promoting apoptosis of l.t.EMT-RGM-1 number of mutations could be related to overall survival (P > 0.05). fibro cells. The secretome of Hp-reprogrammed fibroblast prompts + Our results show, that tissue and cfDNA matching mutations were the enhanced proliferation of l.t.EMT RGM-1 under TGFβ stress, mostly detected for GC patients with larger tumours and may en- thus potentially facilitating Hp-induced gastric neoplasia. TGFβR1/2 able cfDNA analysis for monitoring of the GC patients’ disease state. activation can regulate an expansion of pro-invasive RGM-1 cells. Supported by the grant from Research Council of Lithuania No. Residual TGFβR1 activity along with TGFβR2 activation may nega- LMT-K-712-01-0130_MULTIOMICS. tively affect the proliferation of l.t.EMT-RGM-1 fibro cells thus, G. Streleckiene: None. M. Forster: None. J. Kupcinskas: None. J. regulating their “stromal” phenotype. We propose that Hp infection Skieceviciene: None. activating normal fibroblasts towards CAFs results in induction of normal epithelial cells changes towards precancerous phenotype mediated by TGFβ influence initially by TGFβ-dependent EMT induction and subsequently by limiting TGFβ signaling. Our study seems to underline the importance of proper balance of TGFβ signaling at different stages of tumor development. T. Brzozowski: None. G. Krzysiek-Maczka: None. M. Strzalka: None. A. Targosz: None. U. Szczyrk: None. A. Ptak-Belowska: None. T. Wrobel: None. J. Czyz: None. ABSTRACTS | 59 of 95

EP3.25 | Microbial abundance of H. pylori assessed by high- EP3.26 | Helicobacter pylori and Epstein-Barr virus co-infection throughput sequencing and prognosis of gastric cancer patients in Greek patients with gastric malignancies

K. Lehr1; R. Vilchez-Vargas1; R. Steponaitiene2; C. Thon1; D. D. Stamiri1; B. Martinez-Gonzalez1; C. Pontas2; E. Horefti1; S. Schanze1; M. Zenker1; P. Malfertheiner1; J. Kupcinskas2; A. Link1 Michopoulos3; G. Mantzaris2; S. Sougioultzis4; A. F. Mentis1; D. N. 1Otto-von-Guericke University Hospital Magdeburg, Magdeburg, Sgouras1 Germany; 2Lithuanian University of Health Sciences Kaunas, Kaunas, 1Laboratory of Medical Microbiology, Hellenic Pasteur Institute, Lithuania Athens, Greece; 2Gastroenterology Department, Evangelismos General Hospital, Athens, Greece; 3Gastroenterology Department, Alexandra Introduction: Microbiome is increasingly recognized as a crucial fac- Hospital, Athens, Greece; 4Department of Pathophysiology, National tor in gastric cancer development. Certain bacteria types may impact and Kapodistrian University of Athens, Athens, Greece prognosis of cancer patients, however, little is known on prognostic role of Helicobacter pylori (H. pylori) Infection in gastric mucosa of Background/Aim: Gastric cancer development has been associated gastric cancer patients using high throughput sequencing analysis. In with infection of Helicobacter pylori (H. pylori) and Epstein-Barr virus this work, we studied the prognostic role of microbial alteration and (EBV). Prevalence of H. pylori and EBV associated gastric cancer and in particular H. pylori infection in gastric cancer patients. H. pylori-EBV co-infection rates vary worldwide. We aimed to evalu- Materials and Methods: DNA from well-characterized paired gastric ate the frequency of EBV infection in patients diagnosed with gastric cancer and adjusted non-tumorous tissue were obtained from 64 cancer, with and without H. pylori infection. gastric cancer patients. Region V1-V2 of the 16S rRNA gene was am- Methods: Gastric biopsies (n = 56) from patients endoscopically plified by PCR and barcoded for high throughput sequencing using suspected for presence of gastric neoplasia were included. H. py- Illumina platform. Clinical and pathological characteristics as well as lori infection and clarithromycin resistance status was analyzed by survival data were available for follow up period of up to 7 years. RT-PCR targeting the 23S rRNA gene of H. pylori, while the encoded Results: After normalization, roughly 5000 reads per samples were small ribonucleic acid 1 (EBER 1) fragment region of the EBV genome obtained and taxonomically annotated. Overall, cancer and adjacent was used to evaluate presence of the virus. non-tumorous tissues showed microbial differences among, which Results: Histopathology characterized cases as peptic ulcer disease was primarily determined by H. pylori status. H. pylori status was not (n = 11) and gastric cancer (n = 45). Mean age was 72 ± 11.8 y.o., associated with a distinct tumour characteristics or tumour pathol- while males predominated 71.4% (40/56) overall. H. pylori pres- ogy. Mucosal H. pylori positivity had no association with differences ence was detected in 35.6% (16/45) gastric cancer cases and 35.7% in overall survival of patients with gastric cancer. (20/56) overall, whereas EBV was detected in 20% (9/45) of the pa- Conclusion: Although H. pylori plays a key role in gastric cancer de- tients with gastric cancer and 17.9% (10/56) overall. H. pylori-EBV velopment, H. pylori positivity of the tumour tissues is not associated co-infection was detected in 11.1% (5/45) gastric cancer and 9% with a distinct prognostic phenotype. Further research is process to (1/11) peptic ulcer cases. Among patients positive to H. pylori, 5 unravel the prognostic role of the other microbial communities in strains (25%) were clarithromycin-resistant with the most character- gastric tumour patients. istic mutation at position A2146G in the 23S rRNA gene. K. Lehr: None. R. Vilchez-Vargas: None. R. Steponaitiene: None. C. Conclusion: An overall 20% presence of EBV in gastric biopsies from Thon: None. D. Schanze: None. M. Zenker: None. P. Malfertheiner: gastric cancer cases was detected supporting its association with None. J. Kupcinskas: None. A. Link: B. Research Grant (princi- gastric carcinoma development. Further investigation are warranted pal investigator, collaborator or consultant and pending grants as to comprehend the role of H. pylori-EBV co-infection in gastric ma- well as grants already received); Significant; European Regional lignant disease development. Development Fund. D. Stamiri: None. B. Martinez-Gonzalez: None. C. Pontas: None. E. Horefti: None. S. Michopoulos: None. G. Mantzaris: None. S. Sougioultzis: None. A.F. Mentis: None. D.N. Sgouras: None.

EP3.27 | Increasing trend of gastroesophageal junction in the primary site of endoscopic resected gastric cancers

Y. Choe1; M. Choi1,2; S. Lee1 1Catholic University of Korea, Seoul, Republic of Korea; 2Catholic Photomedicine Research Institute, Seoul, Republic of Korea

Background & Aims: The frequency of cardiac cancers seems to increase in Eastern countries as well as Western. The aim of this study 60 of 95 | ABSTRACTS was to investigate the incidence rate, including cardia dysplasia as the reported AGS wild-type and isogenic knockout cells ΔITGB1 and well as cardia cancer, and to analyze the clinical and pathological ΔITGAvB4 with various worldwide T4SS-positive strains including characteristics. TN2-GF4, G27 and P12. The absence or presence of integrin-β 1 and

Methods: We reviewed medical records, endoscopic findings and integrin-α v in the respective cell clones was confirmed by Western pathological characteristics of patients who had undergone endo- blotting and FACS analyses. Subsequently, the blots were probed scopic resection at University Hospital from 2005 to 2019. To compare with α‐CagA and α‐PY‐99 antibodies to monitor CagA phosphoryla- the gastric atrophy, we confirmed the pepsinogen I/II ratio, Kimura- tion, indicating successful translocation. In addition, we found that Takemoto classification and Sydney classification. We have defined knockout of ITGB1 completely abolished the cell elongation pheno- gastroesophageal (GE) junction as the distal end of palisade vessels. type, while inactivation of ITGAvB4 even enhanced this phenotype The location of tumor epicenter within 1 cm from GE junction was significantly. These data suggest a yet unrecognized and important classified as group A, within 1~2 cm as group B, 2~5 cm as group C. role of ITGB1 and suppressive function by ITGAvB4. We discuss Results: Of the 4,029 patients we identified, 120 (3.0%) had car- these findings with regard to the function of phosphorylated CagA dia cancers (Group A, B and C), and 276 (6.9%) had cardia neoplasm and integrins to control cell adhesion in the focal adhesions of the including dysplasia. The mean age of people with cardiac cancer gastric epithelium, preventing excessive cell lifting from the extra- was 64 ± 11 years old. The proportion of cardiac cancer increased cellular matrix during infection. over time (2005-2009, 2.2%; 2010-2014, 2.5%; 2015-2019, 3.6%; S. Backert: None. N. Tegtmeyer: None. P<0.05). This increase was mainly associated with an increase of group A. Age, sex and smoking history did not differ among groups, but obesity was significantly higher in group A. Endoscopic atrophy EP4.02 | The actin-binding protein cortactin is required for was more common in group B and C. Closed-type of atrophy was efficient AGS cell elongation by H. pylori CagA, but not for 47% in the group A. Pepsinogen I/II ratio of group A was higher com- vacuolization and apoptosis by VacA pared to group B and C. The rate of Helicobacter pylori infection was also significantly lower in group A. N. Tegtmeyer; F. Fiedler; J. Knorr; S. Backert Conclusions: Recently, the incidence of cardia cancer and dysplasia Friedrich-Alexander University Erlangen-Nuremberg, Erlangen, has increased in Korea. The increase in cardia cancer and dysplasia Germany was associated with an increase in neoplasm 'within 1 cm' from GE junction. Cardia cancer and dysplasia were associated with obesity Cortactin is an actin-binding protein and actin-nucleation promoting and without atrophy (non-Helicobacter pylori related). factor regulating cytoskeletal rearrangements in eukaryotes. Thus, Y. Choe: None. M. Choi: None. S. Lee: None. cortactin represents an attractive target for pathogens to manipulate a given host cell to their own benefit. One of the pathogens following this strategy is the gastric pathogen H. pylori. During infection of gas- ELECTRONIC POSTER tric epithelial cells, H. pylori hijacks multiple cellular kinase signaling ROUND 4: HELICOBACTER INFECTION – pathways, leading to the disruption of key cell functions, in which the PATHOGENESIS AND HOST RESPONSE vacuolating cytotoxin VacA and translocated effector protein CagA play important roles. Specifically, by overruling the phosphoryla- EP4.01 | Important role of integrin receptors in controlling the tion status of cortactin, H. pylori alternates the activity of molecular AGS cell elongation/hummingbird phenotype by Helicobacter pylori interaction partners of this important protein, thereby manipulat- CagA ing the performance of actin-cytoskeletal rearrangements and cell movement. Based on siRNA knockdown and other studies, it was N. Tegtmeyer; S. Backert recently reported by various groups that VacA utilizes cortactin for Friedrich-Alexander University Erlangen-Nuremberg, Erlangen, its cellular uptake, intracellular travel and induction of apoptosis by Germany a mitochondria-dependent mechanism. To investigate this phenomenon we produced a complete knockout mutant of cortactin in two cell Various CagPAI type IV secretion system (T4SS) proteins, includ- lines, AGS and Caco-2, by CRISPR-Cas9 technology. These cells were ing CagA, CagI, CagL and CagY, have been previously reported to infected with H. pylori wild-type or isogenic vacA and cagA mutant bind with high affinity to various integrin host cell receptors. The strains. Unexpectedly, the functional inactivation of cortactin did not CRISPR/Cas9 gene knockout methodology has been recently ap- prevent the uptake and formation of VacA-dependent vacuoles, nor plied to generate AGS gastric epithelial cell clones that completely the induction of apoptosis by internalized VacA, while the induction lack the integrin-β 1 (ΔITGB1) and integrin-α v/integrin-β 4 (ΔITGAvB4) of the CagA-dependent AGS cell elongation phenotype was strongly members. While the proteins seem to be not essential for phospho- reduced through suppression of a unique mechanism of cortactin to rylation of CagA after translocation by the T4SS, they had a great activate focal adhesion kinase. Thus, we provide evidence that cort- impact in the induction of the AGS cell elongation/hummingbird actin is required for the function of internalized CagA, but not VacA. phenotype by H. pylori. We performed infection experiments using N. Tegtmeyer: None. F. Fiedler: None. S. Backert: None. J. Knorr: None. ABSTRACTS | 61 of 95

EP4.03 | Type IV secretion of Helicobacter pylori CagA and ADP- Methods: 50 patients with chronic atrophic gastritis without and heptose into oral epithelial cell lines 50 patients with Helicobacter pylori were studied. The control group consisted of 50 healthy individuals. Determination of the content of N. Tegtmeyer; T. D. Ghete; S. Backert cytokines (IL-2, IL-4, IL-8, L-10) in the blood serum was performed Friedrich-Alexander University Erlangen-Nuremberg, Erlangen, by enzyme-linked immunosorbent assay. Statistical data processing Germany was carried out using Statistica software packages for Windows 8.0. The statistical significance of the differences was determined using Helicobacter pylori typically colonizes the human stomach, but the the Mann-Whitney test P < 0.05. Results: In patients with chronic bacteria can occasionally be detected in the oral cavity. Clinical out- atrophic gastritis, there was an increase in IL-2 and IL-8 compared come during gastric colonization depends on presence of the cag to the control group. In patients with chronic atrophic gastritis with pathogenicity island (PAI). This cagPAI encodes a typical type-IV Helicobacter pylori, an increase in IL-2, IL-4, IL-8 and IL-10 was de- secretion system (T4SS) for translocation of the effector molecules tected in comparison with both groups. CagA and pro-inflammatory ADP-heptose. Upon injection into host Conclusions: In atrophic gastritis with Helicobacter pylori infection, cells, the CagA protein undergoes tyrosine-phosphorylation as dem- immuno-inflammatory changes in the Th-1 and Th-2 types are ac- onstrated by infection of cultured gastric AGS cells, resulting in cell tivated. Activation of pro-inflammatory and anti-inflammatory elongation. Here we investigated whether H. pylori can exert these cytokines helps to limit the inflammatory process in the gastric mu- responses during interaction with cells from the oral epithelium. To cosa. pathogen elimination does not occur, which contributes to an this purpose, three oral epithelial cell lines (HN, CAL-27 and BHY) increase in the infectious load on the patient and the progression of were infected with various H. pylori strains, and CagA delivery and atrophic changes in the gastric mucosa. IL-8 induction by ADP-heptose were monitored. Interestingly, all O. Smirnova: None. A. Sinyakov: None. three oral cell lines were resistant to elongation upon infection, despite proper bacterial binding. Moreover, T4SS-dependent CagA delivery was absent, though IL-8 secretion by ADP-heptose was in- EP4.05 | Immunoglobulins in chronic gastritis and chronic duced. Lack of CagA delivery was due to absence of CEACAM ex- atrophic gastritis with H. pylori infection pression in all oral cells, while these surface molecules have recently been recognized as H. pylori T4SS receptors. Genetic introduction O. Smirnova; A. Sinyakov of either CEACAM-1, CEACAM-5, or CEACAM-6 into oral cells was Scientific Research Institute of Medical Problems of the North, sufficient to trigger CagA delivery and phosphorylation to levels sim- Krasnoyarsk, Russian Federation ilar to those in infected gastric AGS cells. These results demonstrate that lack of CEACAM receptors on the surface of the oral epithelial Background: One of the main pathogenetic factors in the occur- cells was responsible for resistance to CagA-dependent pathogenic rence of chronic gastritis is Helicobacter pylori infection, and its se- activities, and confirms the important role for the T4SS-dependent verity depends on the virulence of H. pylori strains. The aim of the interaction of these receptors with H. pylori in the gastric epithelium. work was to study the characteristics of the response of the humoral S. Backert: None. N. Tegtmeyer: None. T.D. Ghete: None. immunity in patients with H. pylori- associated diseases. Methods: 50 patients with chronic gastritis in combination with H. pylori infection (CG), 50 patients with chronic atrophic gastritis in combination EP4.04 | The role of pro-inflammatory and anti-inflammatory with H. pylori infection (CAG), and 50 practically healthy volunteers were cytokines in the development of chronic atrophic gastritis with examined. The quantitative determination of IgA, IgM, IgG, IgE was car- Helicobacter pylori infection ried out by the enzyme immunoassay using reagent kits manufactured by Vector-Best. Statistical data processing was performed using Statistica O. Smirnova; A. Sinyakov 7.0. The significance of differences (P < 0.05) between the indices of in- Scientific Research Institute of Medical Problems of the North, dependent samples was evaluated by the Mann-Whitney criterion. Krasnoyarsk, Russian Federation Results: In patients with CG and CAG, in combination with H. pylori infection, unidirectional changes in the humoral immunity were ob-

Background: Helicobacter pylori infection is detected in nearly 80% served, an increase in IgG (p1-2 = 0.01; p1-3 = 0.002) and an increase in of people with chronic gastritis. The presence of a microorganism IgA (p1-2 = 0.03; p1-3 = 0.01) compared with the control group. triggers a local inflammatory process in the gastric mucosa. Cells of Conclusions: In chronic gastritis and chronic atrophic gastritis in the immune system involved in the immune response generate a cas- combination with H. pylori infection, immune disorders occur associ- cade of cytokines aimed at eliminating the microorganism. The aim ated with regulatory T-cell imbalance, and the development of the of this investigation was to study the content of pro-inflammatory immune response according to Th2 – a mechanism with activation of and anti-inflammatory cytokines in patients with chronic atrophic the humoral immunity. First of all, immunoglobulins of the IgG and gastritis associated with Helicobacter pylori infection. IgA class begin to be actively produced on bacterial antigens. O. Smirnova: None. A. Sinyakov: None. 62 of 95 | ABSTRACTS

EP4.06 | Features of the functioning of monocytes in chronic examined. Monocyte activity was studied by chemiluminescent gastritis associated with Helicobacter pylori- infection methods. The maximum luminescence intensity, the time to reach the maximum luminescence, and the area under the chemilumines- O. Smirnova; V. Tsukanov; A. Sinyakov; O. Moskalenko; N. cence curve in the spontaneous and zymosan-induced states were Elmanova; E. Ovcharenko determined. To enhance the glow used luminol. Statistical data pro- Scientific Research Institute of Medical Problems of the North, cessing was carried out using Statistica. The statistical significance Krasnoyarsk, Russian Federation of the differences was determined using the Mann–Whitney rank test. Results: In patients with chronic gastritis, there was an increase Background: Chronic gastritis and chronic atrophic gastritis have in all the studied parameters in the induced state. In patients with a common pathogenesis due to infection with Helicobacter pylori. chronic atrophic gastritis, the indicators of maximum intensity and Objective: to study the chemiluminescent activity of monocytes in area under the glow curve in spontaneous and induced states, and chronic gastritis associated with Helicobacter pylori- infection. the time to reach the maximum glow in the induced state increased. Methods: 40 patients with chronic gastritis, 25 patients with chronic Conclusion: In patients with chronic atrophic gastritis associ- atrophic gastritis, and 50 practically healthy volunteers were exam- ated with Helicobacter pylori- infection, an increase in the activity ined. Monocyte activity was studied by chemiluminescent meth- of monocytes in spontaneous and induced conditions is detected, ods. The maximum luminescence intensity, the time to reach the probably due to chronic inflammatory and histodestructive pro- maximum luminescence, and the area under the chemiluminescence cesses in the gastric mucosa, aimed at restoring the patient's homeo- curve in the spontaneous and zymosan-induced states were deter- stasis. The project “Development and implementation of a program mined. To enhance the glow used luminol. Statistical data processing for screening and early diagnosis of gastric cancer by indicators of was carried out using Statistica. The statistical significance of the the immune, prooxidant and antioxidant systems to reduce mortality differences was determined using the Mann–Whitney rank test. and disability” was funded by Krasnoyarsk Regional Fund of Science. Results: In patients with chronic gastritis, there was an increase O. Smirnova: None. V. Tsukanov: None. A. Sinyakov: None. O. in all the studied parameters in the induced state. In patients with Moskalenko: None. N. Elmanova: None. E. Ovcharenko: None. chronic atrophic gastritis, the indicators of maximum intensity and area under the glow curve in spontaneous and induced states, and the time to reach the maximum glow in the induced state increased. EP4.08 | Features of lipid peroxidation and antioxidant Conclusion: In patients with chronic atrophic gastritis associ- protection in chronic atrophic gastritis associated with ated with Helicobacter pylori- infection, an increase in the activity Helicobacter pylori infection of monocytes in spontaneous and induced conditions is detected, probably due to chronic inflammatory and histodestructive pro- O. Smirnova; A. Sinyakov cesses in the gastric mucosa, aimed at restoring the patient's homeo- Scientific Research Institute of Medical Problems of the North, stasis. The project “Development and implementation of a program Krasnoyarsk, Russian Federation for screening and early diagnosis of gastric cancer by indicators of the immune, prooxidant and antioxidant systems to reduce mortality Background: Objective: to evaluate the content of malondialdehyde and disability” was funded by Krasnoyarsk Regional Fund of Science. and the activity of antioxidant enzymes (superoxide dismutase and O. Smirnova: None. V. Tsukanov: None. A. Sinyakov: None. O. catalase) in chronic atrophic gastritis associated with Helicobacter Moskalenko: None. N. Elmanova: None. E. Ovcharenko: None. pylori- infection. Methods: 40 patients with chronic gastritis, 25 patients with chronic atrophic gastritis, and 50 practically healthy volunteers were exam- EP4.07 | Role of monocytes during chronic atrophic gastritis ined. The content of malondialdehyde, the activity of superoxide associated with Helicobacter pylori infection dismutase and catalase were determined in the blood serum by spectrophotometric methods. Statistical data processing was car- O. Smirnova; V. Tsukanov; A. Sinyakov; O. Moskalenko; N. ried out using Statistica. The statistical significance of the differ- Elmanova; E. Ovcharenko ences was determined using the Mann–Whitney rank test. Scientific Research Institute of Medical Problems of the North, Results: In patients with chronic gastritis and in patients with chronic Krasnoyarsk, Russian Federation atrophic gastritis in the blood serum, an increase in the content of malondialdehyde relative to the control group was revealed, which Background: Chronic gastritis and chronic atrophic gastritis have a indicates an increase in lipid peroxidation in these patients. The ac- common pathogenesis due to infection with Helicobacter pylori. tivity of antioxidant protection depended on the type of chronic Objective: To study the chemiluminescent activity of monocytes in gastritis, with superficial gastritis, the activity of the superoxide dis- chronic gastritis associated with Helicobacter pylori- infection. mutase enzyme increased relative to the control group, and in pa- Methods: 40 patients with chronic gastritis, 25 patients with tients with chronic atrophic gastritis, the activity of both enzymes: chronic atrophic gastritis, and 50 practically healthy volunteers were superoxide dismutase and catalase increased. ABSTRACTS | 63 of 95

Conclusion: In patients with chronic gastritis associated with EP4.10 | Indicators of proliferation and apoptosis of gastric Helicobacter pylori- infection, increased lipid peroxidation is off- epithelial cells in the indigenous inhabitants of the Republic of set by activation of superoxide dismutase. In patients with chronic Tyva with Helicobacter pylori-positive duodenal ulcer atrophic gastritis associated with Helicobacter pylori- infection, oxidative stress is opposed by activation of the bifunctional superoxide V. V. Tsukanov; O. V. Peretyat'ko; E. V. Kasparov; A. S. Pulikov; A. V. dismutase-catalase system, and high catalase activity proves the Vasyutin; J. L. Tonkikh; T. V. Polivanova; V. A. Vshivkov presence of histodestructive changes in the gastric mucosa, accom- FRC KSC SB RAS, Scientific Research Institute of Medical Problems of panied by cell breakdown and the influence of oxidative stress on the North, Krasnoyarsk, Russian Federation the endothelium. O. Smirnova: None. A. Sinyakov: None. Introduction: Studying cell renewal in the gastric mucosa will create new perspectives for understanding the pathogenesis of Helicobacter pylori-associated diseases (Blagih J. et al., 2020). EP4.09 | The role of the glutathione part of antioxidant Methods: An immunohistochemical study of gastric mucosa epi- protection in the development of atrophy in chronic gastritis thelial cells with identification of proliferation markers (Ki-67 and associated with Helicobacter pylori infection PCNA) and apoptosis (bcl-2 and p53) was performed in 32 Tuvinians (15 men and 17 women, average age 47.7 years) with Helicobacter O. Smirnova; A. Sinyakov pylori-positive duodenal peptic ulcer (group A) and in 24 Helicobacter Scientific Research Institute of Medical Problems of the North, pylori-positive Tuvinians (12 men and 12 women, average age Krasnoyarsk, Russian Federation 46.4 years) without peptic ulcer (group B) in the Republic of Tyva. Results: Indices apoptosis (bcl-2 and p53) had no significant differ- Background: The development of atrophy depends on the ge- ences when comparing patients with duodenal ulcer and the control netic predisposition and individual response to H. pylori infection. group. In antrum Ki-67 was found in 6.2% of cells in group A and in Objective: to evaluate the content of malondialdehyde and compo- 5.0% of epithelial cells in group B (P = 0.04). For the gastric body nents of the glutathione antioxidant defense component in chronic these indicators were, respectively, 5.9% and 4.1% (P = 0.01). The atrophic gastritis associated with Helicobacter pylori infection. proportion of cells with PCNA in the antrum was 8.3% in group A Methods: 40 patients with chronic gastritis, 25 patients with chronic and 6.0% in group B (P = 0.01). In the gastric body these indicators atrophic gastritis, and 50 practically healthy volunteers were exam- were, respectively, 8.5% and 7.0% (P = 0.02). As a result, regulatory ined. The content of malondialdehyde, reduced glutathione, the ratios (proliferation indicators/apoptosis indices) were significantly activity of glutathione-S-transferase and glutathione peroxidase higher in group A compared to group B. were determined in the blood serum by spectrophotometric meth- Conclusion: Among the indigenous inhabitants of the Republic of ods. Statistical data processing was carried out using Statistica. The Tyva, there is a shift in the proliferative-apoptotic relationship of statistical significance of the differences was determined using the gastric epithelial cells towards an increase in proliferation activity Mann–Whitney rank test. in patients with Helicobacter pylori-associated duodenal ulcer com- Results: The content of malondialdehyde increased 3 times in pa- pared with people without peptic ulcer disease with Helicobacter tients with chronic gastritis and 5 times in patients with chronic pylori infection. atrophic gastritis relative to control group. In patients with chronic V.V. Tsukanov: None. O.V. Peretyat'ko: None. A.S. Pulikov: None. gastritis, the activity of only the glutathione peroxidase enzyme in- A.V. Vasyutin: None. J.L. Tonkikh: None. T.V. Polivanova: None. V.A. creased, in patients with chronic atrophic gastritis, the activity of Vshivkov: None. E.V. Kasparov: None. both enzymes increased, while the content of reduced glutathione did not statistically significantly differ from the control group. Conclusion: In patients with chronic gastritis associated with EP4.11 | Immunophenotype of cell infiltrate of the gastric Helicobacter pylori infection, lipid peroxidation is enhanced, which mucosa lamina propria in indigenous inhabitants of Khakassia with is compensated by the activation of a component of the antioxidant Helicobacter pylori-positive duodenal ulcer glutathione system. In patients with chronic atrophic gastritis associated with Helicobacter pylori infection, pathogenetic changes are V. V. Tsukanov1; A. V. Vasyutin1; J. L. Tonkikh1; O. V. Shtygasheva2; caused not only by inflammation, but also by a histodestructive pro- N. N. Butorin2 cess in the gastric mucosa, which leads to a more pronounced oxida- 1FRC KSC SB RAS, Scientific Research Institute of Medical Problems tive stress and activation of two components of antioxidant defense, of the North, Krasnoyarsk, Russian Federation; 2Federal State-Funded aimed at reducing manifestations. Educational Institution of Higher Education “Katanov Khakass State O. Smirnova: None. A. Sinyakov: None. University”, Abakan, Russian Federation

Aim: To study the immunophenotype of the gastric mucosa lamina propria in indigenous inhabitants of Khakassia with duodenal ulcer. 64 of 95 | ABSTRACTS

Methods: We examined 22 indigenous inhabitants with Helicobacter and II respectively in comparison to control. In the group I level of pylori–positive duodenal ulcer (group A) and 23 indigenous people NO2 was 1.4 more, iNOS – 1.8 times more, eNOS – 1.2 times less in without peptic ulcer (group B) in Khakassia. The cell infiltrate immu- comparison to the group II (р < 0.05). nophenotype in the gastric mucosa lamina propria was determined Conclusion: HP-infection in patients with CAG and T2DM increases using immunohistochemistry. The percentage of CD4+ (T-helpers), NO2 production and induces the activity of iNOS. It also potentiates CD8+ (T-killers), CD20+ (B-lymphocytes) and HLA-DR+ (marker of endothelial dysfunction through eNOS activity reduction. late activation of immune cells) cells was determined in 10 randomly I. Skrypnyk: None. T. Radionova: None. G. Maslova: None. selected fields of view (≥1000 cells) in mononuclear cells of the gastric mucosa lamina propria (inflammatory infiltrate). Results: In the antrum, there were no significant differences in the EP4.14 | Active forms of oxygen in monocyte culture under high content of CD8+ and CD20+ cells when comparing group A and dissemination with Helicobacter pylori group B patients. The proportion of CD4+ cells in the antrum was 33.6% in group A and 24.1% in group B (P = 0.01). For HLA-DR+ I. Litvinova1; O. Kolencukova1,2; S. Tereshchenko1; N. Gorbacheva1; cells, these indices were 18.9% and 11.3%, respectively (P = 0.02). In V. Tsukanov1 the gastric body, an increase in the proportion of CD4+ cells (17.2% 1Scientific Research Institute for Medical Problems of the North FRC versus 8.0%, P = 0.01) CD8+cells (10.2% versus 3.4%; P = 0.008), KSC SD RAS, Krasnoyarsk, Russian Federation; 2Siberian Federal CD20 + cells (30.0% versus 13.4%, P < 0.001) and a decrease of University, Krasnoyarsk, Russian Federation the immunoregulatory index CD4+/CD8+ (1.7 versus 2.4, P = 0.04) was found in group A compared with group B. The proportion of Colonization of the stomach Helicobacter pylori leads to the release HLA-DR+ cells in the gastric body was 15.4% in group A and 8.7% in of reactive oxygen species by phagocytes and the development of group B (P = 0.07). inflammation of varying severity depends on the effectiveness of Conclusion: We found activation of the immune response in the gas- the phagocytosis process. Objective: to determine the intensity of tric mucosa lamina propria in group A in comparison with the indica- the formation of reactive oxygen species in a monocyte culture with tors of group B among Khakasses. a high titer on the gastric mucosa of bacteria and associated lesions V.V. Tsukanov: None. A.V. Vasyutin: None. J.L. Tonkikh: None. O.V. of the stomach and duodenum. Shtygasheva: None. N.N. Butorin: None. Objects and Methods: Forty-four children with high dissemination and associated ulcers of the gastroduodenal zone (group A) and 34 children – low dissemination but without peptic ulcers (group B) were EP4.13 | Helicobacter pylori infection affects nitric oxide system in examined. The concentration of bacteria was taken into account By patients with chronic antral gastritis and diabetes mellitus type 2 of microscopic tests for bioptats of stomach mucosa. Culture of blood monocytes isolated by separation on ficoll and adhesion on I. Skrypnyk; T. Radionova; G. Maslova plastics. The baseline level and the level after zymosan stimulation Ukrainian Medical Stomatological Academy, Poltava, Ukraine of the ROS in the culture of blood monocytes were determined by the chemiluminescent method. Strains H. pylori were detected in all Background: Gastric pathology in patients with type 2 diabetes mel- patients by breath test (UBT). litus (T2DM) may have pathogenetic peculiarities that are important Results: Secondary reactive oxygen species in monocyte culture for treatment optimization. Objective: to assess state of nitric oxide in group 1 were produced 3.5 times more intensively compared to (NO) system in patients with chronic antral gastritis (CAG) and con- group 2 at the baseline level and upon antigen induction. The acti- comitant T2DM depending on Helicobacter pylori (HP) status. vation of the superoxide radical associated with the primary forms Materials and Methods: Ninety-two patients with CAG and T2DM of oxygen in group 1 increases 5-fold at the basic level and when were examined, 71 (77.2%) patients had positive H. pylori antigen antigen-induced comparison with group 2. Conclusions: Marked the stool test, 21 (22.8%) were HP-negative. To form 2 equal groups, increase of the activity in producing active forms of oxygen culture we randomly selected 40 patients: group I (n = 20) – HP-positive of monocyte in children with high dissemination of H. pylori associ- CAG and T2DM; II (n = 20) – HP-negative CAG and T2DM. Also 20 ated gastric and duodenal ulcers. healthy individuals were enrolled for control. Nitrites (NO2), induc- I. Litvinova: None. O. Kolencukova: None. S. Tereshchenko: None. N. ible (iNOS) and endothelial nitric oxide synthase (eNOS) were meas- Gorbacheva: None. V. Tsukanov: None. ured in blood serum. Results: In comparison to healthy individuals, level of NO2 among the patients of the groups I and II increased 4.5 and 3.5 times more respectively (р < 0.05). Activity of iNOS increased 8.2 times more in patients of the group I, and 4.6 times more – in the group II compared to healthy subjects (р < 0.05). On the contrary, activity of eNOS decreased 2.7 and 2.3 times less in patients of the groups I ABSTRACTS | 65 of 95

EP4.15 | Helicobacter pylori alters expression of Notch pathway EP4.16 | Presence of matrix metalloproteinase-9-positive components in gastric epithelial cells and macrophages in a cell neutrophil extracellular traps (NETs) in gastric biopsies of H. pylori type-specific manner infected patients

R. FitzGerald1; H. Windle1; D. Kelleher2; C. O'Morain1; D. E. Michailou1; K. Kambas2; Y. Karayiannis1; B. Martinez-Gonzalez1; McNamara1; S. Smith1 K. Petraki3; S. Michopoulos4; D. N. Sgouras1 1Trinity College Dublin, Dublin, Ireland; 2University of British Columbia, 1Laboratory of Medical Microbiology, Hellenic Pasteur Institute, Athens, Vancouver, BC, Canada Greece; 2Laboratory of Molecular Genetics, Hellenic Pasteur Institute, Athens, Greece; 3Department of Pathology, Metropolitan Hospital, Introduction: Accumulating evidence supports an important role for Athens, Greece; 4Gastroenterology, Alexandra Hospital, Athens, Greece the highly conserved Notch signalling pathway in inflammation and immunity. Helicobacter pylori infection remains a very prominent infection even Aim: To monitor expression of Notch pathway components dur- in developed countries accounting for approximately 50% of the total ing H. pylori infection in gastric epithelial cells, tissue biopsies and population worldwide, while its colonization persistence has been cor- macrophages. related with predisposition for the development of gastric adenocar- Methods: RNA was isolated from H. pylori infected AGS gastric cinoma in late adulthood. One of the hallmarks of H. pylori infection is epithelial cells, THP-1 macrophages and antral biopsies from in- neutrophil infiltration in the lamina propria, although the interaction fected and uninfected patients. Gene expression was measured by between neutrophils and H. pylori or the contribution of neutrophilic RT-qPCR. immune response to the remodeling of gastric tissue is poorly under- Results: H. pylori infection led to significant increases in IL-8 and stood. Considering the capacity of neutrophils to release extracellular CXCL1 mRNA expression in AGS cells, THP-1 cells and the gastric chromatin structures with embedded neutrophilic proteins (NETs), epithelium. In AGS cells, infection resulted in a significant decrease in that can remain in the tissue and contribute to tissue remodeling, we expression of the Notch receptors Notch1, 2 and 3, ligands Jagged2 aimed to investigate the presence of NETs in gastric biopsies of H. py- and Delta-like 4 and the transcription factors HES1 and HEY1. lori positive patients. Immunofluorescence confocal microscopy was Similarly, in biopsies from H. pylori-infected gastritis patients (N = 25) performed in gastric biopsies from H. pylori positive patients (n = 10) compared to uninfected controls (N = 17) significantly lower median and respective age-matched uninfected controls (n = 10). NETs were expression of Notch4 (46%; P = 0.02), Jagged2 (39%; P = 0.01), HES1 identified as extracellular structures with colocalization of myeloper- (38%: P = 0.02) and HEY1 (45%; P = 0.03) was seen. In macrophages, oxidase (MPO) and citrullinated H3. Consequently, staining for MMP-9, H. pylori infection led to a significant decrease in HES1 expression but MMP-3, CD47 and SIRPα on NETs was also performed. H. pylori posi- significant increases in other Notch components; Jagged1, Notch1, tive biopsies demonstrated prominent presence of NETs compared to Delta-like4 and notably RBP-J which is the principle effector of the uninfected controls, where neutrophilic infiltration was almost absent. Notch pathway. Similar expression of Notch pathway components Moreover, NETs structures in H. pylori infected patients were found was seen in THP-1 cells treated with E. coli LPS. positive for MMP-9, while CD47 expression was found on some NETs Conclusion: H. pylori infection is associated with cell-type specific from infected biopsies, but not SIRPα. These findings definitively sup- changes in the expression of Notch pathway components in epi- port the formation of NETs during H. pylori infection and highlight their thelial cells and macrophages. Further experiments will be neces- contribution in tissue remodeling through proteases such as MMP-9, sary to discover the function of Notch signalling during H. pylori while remaining in the tissue due to “do not eat me” signals. pathogenesis. E. Michailou: None. K. Kambas: None. Y. Karayiannis: None. B. R. FitzGerald: None. H. Windle: None. D. Kelleher: None. C. Martinez-Gonzalez: None. K. Petraki: None. S. Michopoulos: None. O'Morain: None. D. McNamara: None. S. Smith: None. D.N. Sgouras: None.

EP4.17 | Virulence gene cagA of Helicobacter pylori and severe esogastroduodenal diseases: Is there a relationship?

A. S. Oliveira1; L. L. d. Silva1; A. G. Rodrigues1; M. P. Miguel1; A. J. V. Blanco2; D. M. M. Cardoso1; L. T. Rasmussem3; L. C. Carneiro1; M. S. Barbosa1 1University Federal of Goiás, Goiânia, Brazil; 2Institute Federal of Goiás, Goiânia, Brazil; 3Faculty of Medicine of Marilia, Goiânia, Brazil

Helicobacter pylori (H. pylori) colonizes about a half of the world's population. Virulence genes of H. pylori have been associated to increased 66 of 95 | ABSTRACTS risk of severe gastrointestinal diseases, such as gastric cancer. The remission (CR). Another 28 patients (50%) showed non-H. pylori in- cagA gene encodes a cytotoxin‐associated antigen (CagA) involved in fection, 10 patients received empirical H. pylori eradication therapy. the pathogenicity of the bacteria. This study aimed to investigate the Among them, 6 patients (60%) achieved CR. Another 11 patients and prevalence of cagA genes among H. pylori isolates from patients with 2 patients who failed CR after successful H. pylori eradication received different esogastroduodenal lesions and for phylogenetic analysis of RT. Among them, 12 (92%) achieved CR. Out of 51 patients who were the isolated bacteria according to gene sequence. A total of 117 gastric followed up by imaging and endoscopic study, 41 (80%) reached CR biopsies were collected from patients with different esogastroduodenal after treatment with various modalities. Among them, 25 patients by disease. Polymerase chain reaction (PCR) product of selected samples H. pylori eradication (61%) including empirical eradication (6, 15%), 12 of positive for cagA was undergone direct sequencing. A total of 77 by RT (29%), and 4 (10%) by surgery (2) or ESD (2). strains of H. pylori were analyzed. Most strains of H. pylori carried cagA Conclusion: H. pylori eradication is a 1st treatment for the MALToma. (62/77; 80.5%). The presence of cagA was associated with severity of Although RT is considered as a 1st treatment for H. pylori negative esogastroduodenal lesions (P < 0.001). Moreover, our study not detect patients, empirical H. pylori eradication could be applied before RT. any difference in phylogenetic distribution between severe and not se- W. Kim: None. J. Park: None. M. Joo: None. B. Lee: None. S. Kim: vere disease. This might be explained, at least in part, by phylogenetic None. H. Chun: None. S. Lee: None. C. Yang: None. analyzes were performed with the partial fragment of the cagA gene. The presence of the cagA gene may be a putative marker of the severity of H. pylori infection. This is the first study to investigate the phyloge- EP4.19 | Helicobacter pylori dupA virulence gene: Risk factor or netic population structure of the epidemic strains of H. pylori in Brazil. protector of gastropathies? Further study with a larger number of strains is necessary to confirm the proposed associations between the specific EPIYA type and their hosts’ L. L. d. Silva1; A. S. Oliveira1; A. R. Gama1; T. C. Silva2; A. J. V. clinical status and the identified sequence motifs as genetic markers. Blanco3; L. T. Rasmussem4; A. F. P. L. Ramos1; M. S. Barbosa1 A.S. Oliveira: None. L.L.D. Silva: None. A.G. Rodrigues: None. M.P. 1University Federal of Goiás, Goiânia, Brazil; 2Catholic University of Miguel: None. A.J.V. Blanco: None. D.M.M. Cardoso: None. L.C. Goiás, Goiânia, Brazil; 3Institute Federal of Goiás, Goiânia, Brazil; Carneiro: None. M.S. Barbosa: None. L.T. Rasmussem: None. 4Faculty of Medicine of Marília, Marília, Brazil

Helicobacter pylori infection is considered the main etiology of EP4.18 | Clinical treatment outcomes and prognosis of gastric chronic gastritis, peptic ulcer and gastric cancer. The duodenal ulcer MALToma: A single center experience promoter gene (dupA) located in the plasticity region of the H. pylori genome is homologous to the virB gene, which encodes a type IV W. Kim1; J. Park1; M. Joo1; B. Lee1; S. Kim1; H. Chun2; S. Lee3; C. secretion protein in Agrobacterium tumefaciens. Some studies have Yang4 shown associations between gastroduodenal diseases and positive 1Korea university Guro hospital, Seoul, Republic of Korea; 2Korea dupA strains, but there is no consensus in the literature. As a result, University Anam Hospital, Seoul, Republic of Korea; 3Korea university this study aimed to evaluate the presence of the dupA gene in infec- ansan hospital, Gyeonggi-do, Republic of Korea; 4Dongguk University tious strains in the Brazilian Midwest; relate to the clinical outcomes Gyeongju Hospital, Gyeongju, Republic of Korea presented by dyspeptic patients and evaluate the origin of circulating strains. Gastric biopsies from 117 dyspeptic patients were ana- Introduction: There is association between H. pylori infection and lyzed using histological and molecular techniques. The screening for gastric MALToma. Guidelines advise H. pylori eradication as 1st ther- H. pylori infection was performed using the hpx gene (16S rRNA) and apy for H. pylori positive MALToma, and also involved-site radiation the positive H. pylori samples were subjected to the detection of the therapy (ISRT) for H. pylori negative MALToma. We investigated the dupA gene. DupA positive samples were sequenced and used for treatment outcomes and prognosis of gastric MALToma. phylogenetic analysis. The results demonstrated a significant rela- Methods: We collected gastric MALToma patients who were histo- tionship (P < 0.0001) between the presence of the dupA gene in the pathologically confirmed from Jan. 2005 till Dec. 2019, and retro- infecting strain and the absence of duodenal ulcer. Furthermore, it spectively reviewed their medical records. was observed that in women the infection by H. pylori dupA positive, Results: A total of 56 patients were enrolled: mean age was 61 ± 14, 23 increased the chance of developing gastritis by two times. The dupA were male (41%). The common site was corpus (31, 56%). Endoscopic sequences obtained in this work were grouped in the same clade as gross appearance was variable, such as IIc (27, 49%), polypoid or mass sequences from Western countries. It is concluded that the presence (8, 15%), discoloration (6, 11%). According to modified Ann Arbor of dupA can be considered a protective factor for peptic ulcer, how- staging, most of patients were corresponding to IE (50, 89%). 28 (50%) ever it can induce the development of gastritis in women. patients showed H. pylori infection. Among them, 26 patients received M.S. Barbosa: None. L.L.D. Silva: None. A.S. Oliveira: None. A.R. eradication therapy. 23 patients (88%) achieved successful eradica- Gama: None. T.C. Silva: None. A.J.V. Blanco: None. L.T. Rasmussem: tion. As a result of therapy, 19 patients (83%) achieved complete None. A.F.P.L. Ramos: None. ABSTRACTS | 67 of 95

EP4.20 | Contribution of Helicobacter pylori to foam cell The transcription factor Nrf2 is the major driver of cellular antioxi- formation in experimental atherosclerosis dant response activated after a high oxidative stress. Nevertheless, few studies have investigated the role of Nrf2 in H. pylori-induced A. Krupa; A. Dziuba; M. Mikolajczyk-Chmiela GC. The aims of the project are: (i) to check the modulation of Nrf2 Faculty of Biology and Environmental Protection, University of Lodz, signaling pathway and (ii) to decipher the role of Nrf2 in EMT after H. Lodz, Poland pylori infection. Kinetic infection of GC cells with H. pylori induces an early activation of Nrf2 signaling pathway, shown by increase of nu- Introduction: The correlation between Helicobacter pylori (H. pylori) clear translocation of Nrf2, by activation of the antioxidant respon- infection and atherosclerosis remains controversial, therefore there sive element sequence and by increased expression of target genes is need to investigate some mechanisms taking place during athero- and proteins. However, 24 hours after infection, the Nrf2 signaling sclerosis development, especially in the accompaniment of persis- pathway is inhibited and level of glutathione, an important antioxi- tent bacterial infection. dant protein, is dramatically decreased. This inhibition leads to an Aim: The main objective of the work was to study the contribu- increase of cellular oxidative stress, characterized by an increase of tion of H. pylori surface antigens and LPS in the transformation of ROS accumulation. Inhibition of Nrf2 by CRISPR-Cas9 strategy leads macrophages into foam cells, which are crucial for atherosclerosis to an increase of cells harboring a mesenchymal phenotype and development. EMT-related gene expression, suggesting that Nrf2 pathway is im- Materials and Methods: The in vitro model employed in the study portant to maintain the epithelial integrity. Therefore, the inhibition included THP-1 cells, which change into macrophages upon PMA of Nrf2 pathway, highlighted after H. pylori infection, may participate treatment. Next, THP-1 macrophages were exposed to H. pylori LPS to EMT, an early event in cancer progression. These preliminary re- and glycine extract purified from H. pylori CCUG strain 17874 and sults may indicate that the modulation of Nrf2-antioxidant response containing composition of following antigens: CagA, VacA, Hsp, after H. pylori infection contributes to gastric cancer. UreB, UreA. LPS E. coli was used as a reference control for bacte- O. Martin: None. S. Bacon: None. L. Seeneevassen: None. P. Lecompte- rial components and 7KCh as a positive control. Transformation of Saint-Jean: None. E. Sifré: None. P. Lehours: None. C. Varon: None. macrophages into foam cells was visualized microscopically after 24 and 48 hours based on observation of lipid droplets stained red by Oil Red O method. EP4.22 | Modulation of Helicobacter pylori adhesion to gastric Results: Our results indicate that both H. pylori LPS and surface an- epithelial cells by BCGOnko vaccine mycobacteria tigens (glycine extract), induced transformation of macrophages into foam cells. Among all the stimulators used in the study, the great- W. Gonciarz; M. Chyb; M. Chmiela est foam-forming potential was shown by H. pylori glycine extract Labolatory of Gastroimmunology, Department of Immunology and in concentrations of 0.1 and 1 μg/mL. Our results indicated, that Infectious Biology, Institute of Microbiology, Biotechnology and only macrophages THP-1 transformed into foam cells. THP-1 mono- Immunology, Faculty of Biology and Environmental Protection, cytes treated with H. pylori components showed no evidence of lipid University of Lodz, Lodz, Poland droplets. Conclusions: Obtained results indicate that persistent infection Introduction: Due to increasing antibiotic resistance of H. pylori clini- with H. pylori may contribute to development and progression of cal isolates new preparations supporting anti-H. pylori therapy are proatherogenic changes. necessary. The BCG-onko mycobacteria having immunomodulatory A. Krupa: None. A. Dziuba: None. M. Mikolajczyk-Chmiela: None. properties are considered. Aim: To assess the effect of BCG-onkoon H. pylori driven mucin (MUC5AC) production by gastric epithelial cells and H. pyloriadhesion. EP4.21 | Modulation of Nrf2-mediated antioxidant response Materials and Methods: Himalayan Cavia porcellus were inoculated after infection with Helicobacter pylori may contribute to gastric (permission58/ŁB45/2016) per os with Brucella broth or with H. py- cancer lori CCUG17874 reference strain (1010 CFU/mL) 3× at 2 days intervals or with BCG-onko (1×108 CFU/mL) (Biomed, Lublin, Poland), O. Martin1; S. Bacon1; L. Seeneevassen1; P. Lecompte-Saint-Jean1; before or after treatment with H. pylori. The primary gastric epithelial E. Sifré1; P. Lehours1,2; C. Varon1 cells from Caviaeporcellus were treated with live H. pylori or soluble 1 2 University of Bordeaux, Bordeaux, France; CHU Bordeaux, Bordeaux, components of these bacteria: glycine-acid extract (GE) 10 μg/mL, France CagA 1 μg/mL, urease A subunit 5 μg/mL or LPS 25 ng/mL, for 24 h in the presence or absence of BCG-onco. MUC5AC was detected Chronic infection with Helicobacter pylori is the major risk factor of using anti-MUC5AC antibody (MyBiosource, USA) FITC conjugate gastric cancer (GC) through induction of chronic inflammation and whereas adhesion of H. pylori by staining with anti-H. pylori FITC and oxidative stress. Our team demonstrated that H. pylori infection BCG-onco with Live/Dead BacLight. leads to an epithelial to mesenchymal transition (EMT) favoring GC. 68 of 95 | ABSTRACTS

Results: Live H. pylori and their soluble components increased ELECTRONIC POSTER ROUND 5: MUC5AC production by gastric epithelial cells in vivo and in vitro. EPIDEMIOLOGY By comparison BCG-onko mycobacteria decreased MUC5AC production or deposition in the gastric mucosa, which was initially up- EP5.01 | Prevalence and genetic features of drug resistant regulated by H. pylori or soluble components of these bacteria. A Helicobacter pylori strains from Zhengzhou smaller amount of mucin in the gastric epithelium was correlated with diminished adhesion of H. pylori. C. Liu1,2; Y. Mi1,2; P. y. Zheng1,2 Conclusions: BCG-onco mycobacteria by interfering with the pro- 1The Fifth Affiliated Hospital of Zhengzhou University, Zhengzhou, duction/deposition of gastric mucin may limit the colonization of H. China; 2Marshall B.J.Medical Research Center of Zhengzhou University, pylori. Zhengzhou, China W. Gonciarz: None. M. Chyb: None. M. Chmiela: None. Objective: To analyze the resistance situation of Helicobacter pylori (Hp) in Zhengzhou area to commonly used antibacterial drugs and EP4.23 | Induction of autoantibodies in response to infection to investigate the mutation characteristics of drug-related resistant with CagA-positive Helicobacter pylori genes. Methods: Gastric mucosa biopsy specimens in the patients with W. Gonciarz1; A. Tomaszewska1; T. Rechcinski2; M. Chmiela1 Hp infection diagnosed in the fifth affiliated hospital of Zhengzhou 1Labolatory of Gastroimmunology, Department of Immunology university from January to November 2019 were collected and per- and Infectious Biology, Institute of Microbiology, Biotechnology formed the Hp culture and identification. Their drug resistance were and Immunology, Faculty of Biology and Environmental Protection, determined with agar diffusion test. Hp resistance gene, including University of Lodz, Lodz, Poland; 2Department of Cardiology, Bieganski 23S rRNA, gyrA and rdxA, was amplified by PCR and the sequences Regional Speciality Hospital, Medical University of Lodz, Lodz, Poland were analyzed. Results: The drug susceptibility test results found that the single re- Introduction: Molecular mimicry between pathogen and host com- sistance rates of 187 strains of clinically isolated Hp to amoxicillin, ponents may result in an induction of cross-reactive antibodies dur- clarithromycin, metronidazole, furazolidone, tetracycline and levo- ing infection. It has been suggested that H. pylori can contribute to floxacin were 39.57%, 39.04%, 4.28%, 9.63%, 1.07% and 87.70%, systemic diseases, like coronary heart disease-(CHD), due to molec- respectively. Only 7.49% of Hp strains were susceptible to these 6 ular mimicry. The BLAST algorithm analysis showed the sequence kinds of antibacterial drug. The double resistance rates to amoxicillin similarity between H. pylori CagA protein and human or Caviae por- plus clarithromycin, amoxicillin plus levofloxacin, clarithromycin plus cellus tumor necrosis factor receptor (TNFR). levofloxacin, metronidazole plus levofloxacin, and furazolidone plus Aim: To estimate whether CagA+ H. pylori induce the cross-reactive levofloxacin were 27.81%, 35.83%, 36.90%, 4.28% and 9.63%, re- antibodies towards TNFR common sequence. spectively. The multi-drug resistance rate was 28.88%, among which Material and Methods: Sera from: healthy donors – HD, uninfected the triple drug resistance rate of amoxicillin plus clarithromycin and or asymptomatically infected with H. pylori (48), patients with CHD levofloxacin was the highest at 24.60%. The drug resistance genes (54), Cavia porcellus uninfected (10) or experimentally infected with sequence analyses showed that the commonest mutation locus of H. pylori, 7 (10), 28 (20) or 60 (10) days from inoculation, were used 23S rRNA and rdxA gene were A2143G (81.95%) and C92A (21.05%), for this study. The ELISA assay with P1 peptide (with the CagA and the commonest mode of gyrA gene mutation was N87K (46.99%). TNFR protein shared sequence) was performed. In order to know Conclusion: The drug resistance rate of Hp is high in Zhengzhou whether anti-P1 antibodies were induced during H. pylori infection, area, especially for levofloxacin. The effective antibacterial drugs the sera before and after adsorption with heat inactivated H. pylori should be selected according to the drug susceptibility test results. were used for the ELISA. The biological activity of anti-P1 antibodies C. Liu: None. Y. Mi: None. P.Y. Zheng: None. was determined in the complement fixation assay. Results: Cross-reactive antibodies were only present in patients with CHD infected with CagA+ H. pylori and the levels of such antibodies significantly decreased after adsorption of sera with H. pylori. Anti-P1 antibodies were also produced in Cavia porcellus infected with H. pylori. Immune complexes, P1-anti-P1 Igs, activated complement. Conclusions: Antibodies induced in CHD patients during CagA+ H. pylori infection, potentially cross-reactive in vivo with TNFR, may participate in pathogenesis of CHD. W. Gonciarz: None. A. Tomaszewska: None. T. Rechcinski: None. M. Chmiela: None. ABSTRACTS | 69 of 95

EP5.02 | Prevalence of Helicobacter pylori infection in north- There is limited up-to-date information about the prevalence of HP eastern Romania- data from a tertiary care center in central and Eastern Europe. Aim: To assess the prevalence of HP and its trend over the last E. V. Popovici1,2; C. Muzica1,3; A. Trifan1,3 25 years among students of Lithuanian University of Health Sciences 1“Grigore T Popa “ University of Medicine and Pharmacy, Iasi, Romania; (LUHS). 2County Clinical Emergency Hospital, Bacau, Romania; 3Institute Methods: Students from the 1st to the 4th study year were randomly of Gastroenterology and Hepatology, “Sf. Spiridon” County Clinical selected in the Medical and Nursing Faculties in year 2020. They Emergency Hospital, Iasi, Romania were tested for the presence of antibodies against HP performing serological test from finger blood. Similar studies on the prevalence Background: Worldwide, Helicobacter pylori (H. pylori) infection af- of HP among LUHS students were performed in 1995 (“Helisal” test), fects about 80% of the population, with significant differences in 2012 and 2016 (“SureScreen Diagnostics Ltd” test was used). prevalence among geographical areas, socio-economic resources Results: Overall 148 students tested (120 (81.1%) female). The mean > access to medical services. age (MA) was 20.4 ± 1.7 years. HP test was positive in 21 (14.2%) Aim: In our study, we assessed the prevalence of H. pylori infection in students. HP detected in 19 (16.1%) female and in 2 (7.1%) male stu- a medical center from North-Eastern Romania. dents, P > 0.05. 120 (MA- 21.3 ± 1.0 years) students investigated Methods: H. pylori infection was analyzed in consecutive patients in 1995; 187 students (MA – 22.4 ± 0.7 years) in the year 2012 and who addressed the Emergency County Hospital (ECH) Bacău 262 students (MA – 20.4 ± 1.0 years) in 2016. In 1995, HP test was Analysis Laboratory during June 1st 2018–May 31st 2019. H. pylori positive in 62 students (51.7%), in 2012 – in 57 students (30.4%), and infection was diagnosed by fecal antigen assay for (antigen test). in 2016 – in 69 students (26.3%). The statistically significant differ- Demographic data (age, gender, environment of origin) > co- ence (P < 0.05) was found between all study years, except between morbidities were analysed. RESULTS. We analysed 2048 patients 2012 and 2016. presented to the ECH Bacau Analysis Laboratory, from which 819 Conclusions: Helicobacter pylori was established in 14.2% of stu- (40%) patients were detected as having H. pylori infection. No sig- dents of LUHS. Over the last 25 years, the prevalence of HP among nificant differences were identified between genders (men 40.29%, students of LUHS has decreased significantly. 305/757, > women 39.81%, 514/1291). Subjects from rural areas I.R. Jonaityte: None. L. Jonaitis: None. E. Ciupkeviciene: None. P. had a higher prevalence of H. pylori infection than those from urban Jonaitis: None. J. Kupcinskas: None. L. Kupcinskas: None. areas (rural 47.28%, 296/626, urban 36.77%, 523/1422). H. pylori infection was significantly associated with age, the highest prevalence being in subjects aged 31-40 years (54.28%, 89/164) > the lowest EP5.04 | Evaluation of dyspeptic symptoms in Helicobacter in patients aged 0-6 years (25.84%, 23/89). The highest prevalence pylori-positive and negative students of Lithuanian University of of infection was found in patients admitted in the Internal Medicine Health Sciences section (50.71%, 107/211), the Gastroenterology (41.21%, 237/575), Endocrinology 42.85%, 30/70; Nephrology 48.64%, 18/37). I. R. Jonaityte; G. Kavaliauskaite; L. Jonaitis; L. Kupcinskas; P. Conclusion: The prevalence of H. pylori in the population addressed Jonaitis; V. Petkevicius; E. Ciupkeviciene; J. Kupcinskas to Emergency County Hospital-Bacau is lower than that estimated Lithuanian University of Health Sciences, Kaunas, Lithuania by current literature at national level. Further epidemiological studies are needed to establish incidence > prevalence rates nation- Introduction: HP-positive people with chronic gastritis are thought ally, in order to increase awareness among specialists > primary to be more likely to complain of dyspeptic symptoms, however, this care physicians. statement is often not supported by the studies. E.V. Popovici: None. C. Muzica: None. A. Trifan: None. Aim: To determine the relation between HP infection and dyspeptic symptoms among students of Lithuanian University of Health Sciences (LUHS). EP5.03 | Changes in the prevalence of Helicobacter pylori over Methods: 148 students (mean age 20.4 ± 1.7) of LUHS (81% female) last 25 years among Lithuanian medical students participated in the study. HP was tested serologically from capillary blood (SureScreen Diagnostics). Anonymous questionnaire assessed I. R. Jonaityte1; L. Jonaitis1; E. Ciupkeviciene1; J. Kupcinskas1; P. dyspeptic symptoms: epigastric pain or discomfort, heartburn, re- Jonaitis1; L. Kupcinskas2 gurgitation, hunger-like-pain, nausea, borborygmus, epigastric full- 1Lithuanian University of Health Sciences, Kaunas, Lithuania; 2Institute ness, belching, abdominal distention, constipation, diarrhea, hard of Digestive research of Lithuanian University of Health sciences, faeces, liquid faeces, urgency to defecate, incomplete feeling of Kaunas, Lithuania defecation. The intensity of symptoms rated by 7-grade Likert scale. Results: HP test was positive in 21 (14.2%) students, negative – in Introduction: The prevalence of Helicobacter pylori (HP) is decreasing 125 (84.4%) students and 2 (1.4%) tests were non-informative and in the Western world while remaining high in developing countries. they were eliminated from analysis. The most prevalent symptoms 70 of 95 | ABSTRACTS were borborygmus (73%), hunger-like-pain (66%), and abdominal EP5.06 | The influence of parental education on the prevalence distention (62%). The prevalence of belching and diarrhea differs sig- of Helicobacter pylori in rural children nificantly between HP-positive and HP-negative students. Belching was present in 6 (29%) HP-positive and in 66 (53%) HP-negative stu- T. V. Polivanova; V. A. Vshivkov dents (P = 0.037). Diarrhea reported by 2 (9%) HP-positive and 42 Federal Research Center «Krasnoyarsk Science Center» of the Siberian (34%) HP-negative students (P = 0.025). There were no significant Branch of the Russian Academy of Sciences – Scientific Research differences in the prevalence of other dyspeptic symptoms between Institute for Medical Problems of the North, Krasnoyarsk, Russian the two groups. The intensity of dyspeptic symptoms does not differ Federation significantly between HP-positive and HP-negative students. Conclusions: The symptoms of belching and diarrhea were signifi- Aim of the Research: To study the influence of parental education on cantly more prevalent in HP-negative students. No significant as- the prevalence of H. pylori among rural children. sociation between HP infection and the intensity of dyspeptic Material and Methods: 1535 children aged 7-17 years were examined symptoms was observed. in rural areas of the Central Asian region (southern Siberia). By random I.R. Jonaityte: None. G. Kavaliauskaite: None. L. Jonaitis: None. sampling, 270 children with gastroenterological complaints underwent L. Kupcinskas: None. P. Jonaitis: None. V. Petkevicius: None. E. gastroscopy with a biopsy fence. H. pylori was diagnosed in biopsy sec- Ciupkeviciene: None. J. Kupcinskas: None. tions after Giemsa staining. Data on the education of parents of the examined children were collected. Parents’ education is divided into three clusters: higher, secondary vocational and secondary (including incom- EP5.05 | The prevalence of CagA Helicobacter pylori in children plete secondary). The results were processed using logistic regression of the Mongoloid population of Siberia analysis (odds ratio (OR) and 95% confidence interval (CI)). Results: Father's education did not affect the prevalence of H. py- V. A. Vshivkov; T. V. Polivanova lori in schoolchildren (higher education: 0.36 (0.09-1.37), P = 0.184; Federal Research Center «Krasnoyarsk Science Center» of the Siberian secondary education: 1.39 (0.53-3.64), P = 0.625). The presence of Branch of the Russian Academy of Sciences – Scientific Research higher education in the mother had a positive effect on the preva- Institute for Medical Problems of the North, Krasnoyarsk, Russian lence of H. pylori in schoolchildren (0.22 (0.05-0.92), P = 0.044). In Federation families where the mother had a secondary education, the prevalence of H. pylori among school-age children increased (4.35 (1.27- Aim: To study the prevalence of the CagA strain Helicobacter pylori in 14.93), P = 0.017). children of the Mongoloid population of Siberia (Russian Federation). Conclusion: Mother's education has a pronounced effect on the Material and Methods: A cross-sectional survey was conducted of prevalence of H. pylori among rural children, which is obviously the children of the Mongoloid population of Siberia (558 schoolchildren result of the connection of this factor with the sanitary-hygienic cul- of the Republic of Tuva and 622 schoolchildren of the Republic of ture in the family. Father's education does not affect the frequency Buryatia) aged 7-17 years. By random sampling, the prevalence of of H. pylori in children. the CagA strain of H. pylori was studied by determining the serum T.V. Polivanova: None. V.A. Vshivkov: None. IgG to the pathogen antigen (ELISA) in 212 children (112 Tuvans; 100 Buryats). Results: The presence of IgG in serum to the H. pylori CagA antigen EP5.07 | Trends in the prevalence of Helicobacter pylori in Russia was found in 54.5% of the examined Tuvans and in 42.0% of the Buryats (P = 0.069). Among Tuvinians aged 7-11 years old, CagA- D. S. Bordin1,2,3; R. G. Plavnik4; E. Tivanova5; I. I. Skibo6; Y. V. seropositive children accounted for 55.6%, and at the age of 12- Embutnieks1; I. V. Maev2 17 years, rates were 54.1% (P = 0.896). In the Buryats of the younger 1A.S. Loginov Moscow Clinical Scientific Center, Moscow, Russian age group, the presence of CagA H. pylori was determined in 29.6%, Federation; 2A.I. Yevdokimov Moscow State University of Medicine and in the older age group – 46.6% (P = 0.127). Differences in the and Dentistry, Moscow, Russian Federation; 3Tver State Medical prevalence of H. pylori CagA among boys (51.7% in Tuvans and University, Tver, Russian Federation; 4Peoples’ Friendship University 35.1% in Buryats) and girls (55.4% in Tuvans (P = 0.731) and 46.0% in of Russia, Moscow, Russian Federation; 5Central Research Institute Buryats (P = 0.286)) was not in the surveyed territories. of Epidemiology, Moscow, Russian Federation; 6Laboratory HELIX, Conclusion: The high frequency of the CagA strain of H. pylori was Moscow, Russian Federation found in children of the Mongoloid population of Siberia. Infection occurs mainly before the age of 12 years. A limited number of studies regarding H. pylori (HP) prevalence are V.A. Vshivkov: None. T.V. Polivanova: None. available in Russia. According to our study, conducted in 2017 using 13C-UBT, the average prevalence of HP in Russia is 42.5%, it significantly increases with age and does not significantly vary in federal districts (FD). Aim. Comparison of data of study about the prevalence ABSTRACTS | 71 of 95 of HP, obtained in 2017 and 2019 in Russia. Materials and meth- TABLE 1 ods. Results of 13C-UBT tests of individuals, who had not received 2008 2013 2018 eradication therapy. The samples with DOB ≥4‰ were considered as positive test result. Pearson's chi-square test was used for statisti- Gastric ulcers 26.44% 15.32% 15.87% cal analysis. Data of 2926 individuals (M – 1169, F – 1757, average Duodenal ulcers 31.4% 25% 23.24% age 42.1 year) were obtained in 2017 and of 8840 individuals (M – Gastric erosions 12.4% 10.48% 8.73% 3163, F – 5677, average age 42.8 year) – in 2019. Results. Average Duodenal erosions 8.26% 19.32% 24.6% HP prevalence was 42.5% in 2017, and 35.3% in 2019, without sig- Variceal bleeding 15.4% 6.48% 11.11% nificant gender differences (P > 0.05). In the Central FD positive Other 13.23% 25% 25.4% results were in 43.1% and 35.4% respectively, in Northwestern FD H. pylori 60.6% 64.93% 39.5% – 43.0% and 34.7%, in Volga FD – 40.6% and 33%, in Southern FD NSAIDs 63.63% 68.55% 65.87% – 48.4% and 36..5%, in North Caucasus – 50.9% and 44.2%, in Ural Anticoagulants 6.44% 12.1% 16.67% FD – 40.4% and 32.7%, in Siberian FD – 42.5% and 41.2%, and in Far Mortality 14.05% 9.68% 10.32% Eastern FD – 35% and 37.7%. A significant increase in the prevalence with age was noted. Conclusion: Our data showed, that the average prevalence of HP in Russia was decreasing from 42.5% in 2017 to Patients with AUGIB are older with more comorbidities, their 35.3% in 2019, without significant varies in federal districts. mortality remains unchanged. Main risk factors for AUGIB are D.S. Bordin: None. R.G. Plavnik: None. E. Tivanova: None. I.I. Skibo: NSAID's and antiplatelets use with clear trend of decreasing of None. Y.V. Embutnieks: None. I.V. Maev: None. peptic ulcer disease (mainly gastric ulcers) and Helicobacter pylori infection. V. Milivojevic: None. I. Rankovic: None. D. Popovic: None. T. EP5.08 | Time trends in acute upper gastrointestinal bleeding in Glisic: None. O. Matejic: None. D. Tomic: None. M. Krstic: None. T. Serbian adult population Milosavljevic: None.

V. Milivojevic1,2; I. Rankovic1; D. Popovic1,2; T. Glisic1,2; O. Matejic1; D. Tomic1,2; M. Krstic1,2; T. Milosavljevic1,2 EP5.09 | Relationship of Helicobacter pylori infection to lifestyle, 1Clinical center of Serbia, Clinic for Gastroenterology and Hepatology, sociodemographic and economic profile in dyspeptic patients Belgrade, Serbia; 2School of Medicine, Belgrade University, Belgrade, Serbia N. A. P. de Campos1; A. F. P. L. Ramos1; G. R. Sousa1; L. d. Silva1; F. A. d. Moraes1; G. A. S. Soares1; M. P. Curado2; M. S. Barbosa1; Acute upper gastrointestinal bleeding (AUGIB) is a common medical L. C. Carneiro1 emergency encountered worldwide. Despite medical, endoscopy and 1University Federal of Goiás, Goiânia, Brazil; 2ACCamargo Center, São technical advances, it remains associated with significant morbidity Paulo, Brazil and mortality. The aim of this study was to evaluate changes in clinico- epidemiologic characteristics of patients who presented with AUGIB Helicobacter pylori (H. pylori) is a gram-negative, coiled, microaero- during the last 10 years in Serbia. Data from 126 patients admitted with philic and mobile bacterium. This microorganism colonizes the gas- AUGIB in our center during the year 2018. were compared with ret- tric mucosa of approximately half of the world's population. H. pylori rospectively collected data from 124 patients admitted with AUGIB in infection can trigger an inflammatory response causing gastritis, ul- 2013. year and with 121 patients from 2008. year. Mean age of patients cers or progressing to more severe clinical outcomes such as gastric increased from 63.84 ± 14.1 years to 65.71 ± 14.27 and 68.92 ± 12.77, adenocarcinoma. Due to the relationship of infection with the devel- and the number of patient's comorbidity, too. The percentage of NSAID's opment of gastric neoplasms, the bacterium has been characterized and antiplatelets use remained stable, whereas the use of oral antico- by the World Health Organization (WHO) as a type 1 carcinogen. agulants drugs increased significantly during this period (P = 0.041). Given the above, the present study aimed to evaluate the associa- Table 1 revealed clinical data and risk factors during 2008., 2013. tion of H. pylori with possible risk factors for infection. We analyzed and 2018. Percentage of Helicobacter pylori positive in bleeding group 100 questionnaires containing sociodemographic, socioeconomic in 2008. was 60.6%, in 2013. 64.93% and 39% in 2018 (X2 = 15.33, , and lifestyle questions of patients submitted to upper digestive en- P = 0.00047, P < 0.05). During the period of these 10 years duodenal doscopy, followed by biopsy. H. pylori was diagnosed by histopatho- erosions increased significantly (X2 = 11.84, P = 0.0027, P < 0.05) while logical examination. Statistical analyzes using Fisher's exact test and gastric ulcer decreased significantly (X2 = 6.21, P = 0.044, P < 0.05). odds ratio were performed to assess the association of bacterial infection with possible risk factors. Half of the study population was infected with H. pylori, 60% (60/100) women. Among the infected patients, 75% were between 22 and 59 years old and most had the diagnosis of gastritis/pangastritis. There was statistical significance 72 of 95 | ABSTRACTS between former smokers and bacterial infection (P = 0.030) in ad- EP5.11 | Helicobacter pylori reinfection rates in Crimean dition to the use of well water (P = 0.005) and untreated water population: Follow-up study (P = 0.015). N.A.P. de Campos: None. A.F.P.L. Ramos: None. G.R. Sousa: None. V. Kryvy; I. Kliaritskaia; T. Tsapyak; I. I. Iskova L.D. Silva: None. F.A.D. Moraes: None. G.A.S. Soares: None. M.P. Medical Academy named after S.I. Georgievsky of Vernadsky CFU, Curado: None. M.S. Barbosa: None. L.C. Carneiro: None. Simferopol, Russian Federation

Aims: H. pylori recurrence remains a difficult clinical situation for EP5.10 | Retrospective analysis of the H. pylori eradication rates practitioners. The study aimed to assess H. pylori reinfection rate in Crimean population and identify of risk factors this in our region. Methods: Patients with confirmed successful eradication after first and second line therapy V. Kryvy; I. Klyaritskaya; T. Tsapyak; E. Semenikhina during 2013 to 2019 were included in the study. A total 164 subjects Medical Academy named after S.I. Georgievsky of Vernadsky CFU, enrolled in the study. Simferopol, Russian Federation Results: H. pylori recurrence was defined as positive status (13C- UBT), which occurred at 12, 24, 48 months after successful eradica- Background: Maastricht V Consensus recommends that, as a first- tion with a follow-up rate of 100.0%, 84.1%, 49.6% and a general line therapy clarithromycin or bismuth containing regimes. The dif- follow-up rate of 77.9%. Reinfection rate on visits 2, 3 and 4 was ferent prevalence levels and eradication rates of H. pylori in reports 1.6%, 0.9%, 0.3% respectively. H. pylori reinfection was indepen- from different regions requires permanent local monitoring of these dently associated with the education at lower levels (OR = 2.26, 95% indices. CI: 0.3-2.9, P < 0.05) and the residence located in the rural areas Aim: We compared the dynamics of eradication rates first-line (OR = 3.81, 95% CI: 1.4-6.9, P < 0.05). clarithromycin-based triple and quadruple-based bismuth therapy in Conclusions: Reinfection rate of H. pylori in our region is relatively the Crimean population from 2011 to 2019. low. Patients with specific properties of education level and resi- Methods: Were compared of outcome eradication therapy (our dence location appear to be at higher risk for reinfection. dates 2011-2013- first period, 543 patients) with period from 2017- V. Kryvy: None. I. Kliaritskaia: None. T. Tsapyak: None. I. I. Iskova: 2019 (second period, 689 patients). None. Results: There were no significant clinical differences in H. pylori prevalence over the compared periods (58.3% vs 49.1%, P > 0.05). The eradication rates of PPI-clarithromycin-based triple therapy: ELECTRONIC POSTER ROUND 6: 7 days – (ITT: 61.67% vs 63.2%, P > 0.05), 10 days – (ITT: 78.7% vs MICROBIOLOGY AND GENOMICS OF 86.3%, P < 0.05), 14 days (ITT: 79.4% vs 90.1%, P < 0.05). The bis- HELICOBACTER muth containing quadruple regimes became more commonly used (19.3% vs 38.9%, P < 0.05) in H. pylori-positive patients. H. pylori EP6.01 | Changes in the fluoroquinolone resistance of eradication rates were for 10 days (ITT: 81.2% vs 84.0%), for 14 days Helicobacter pylori over a 14-year period and discovery of a novel (ITT: 87.6% vs 86.9%, P > 0.05). mutation in DNA gyrase: A single center study in Korea Conclusions: A comparison of the dynamics of the results of triple and quadruple therapy in the Crimean population from 2014 to 2020 S. Rhie1; J. Park2; T. Shin3; J. Kim2; B. Kim2; J. G. Kim2,4 shows the preservation of the effectiveness of 10 day regimes. This 1Center for Health Promotion, Sungkyunkwan University School allows us to recommend their further use in our region. Over the of Medicine, Samsung Medical Center, Seoul, Republic of Korea; past observation period, there has been a tendency to a decrease in 2Chung-Ang University College of Medicine, Seoul, Republic of Korea; the prevalence of H. pylori infection in our region. 3Research Institute, Chung-Ang University, Seoul, Republic of Korea; V. Kryvy: None. I. Klyaritskaya: None. T. Tsapyak: None. E. 4Korean College of Helicobacter and Upper Gastrointestinal Research, Semenikhina: None. Seoul, Republic of Korea

Objective: Eradication failure of Helicobacter pylori is increasing due to antimicrobial resistance. The aim of this study was to investigate the changes in the prevalence and mechanism of fluoroquinolone resistance of H. pylori in Korea. Methods: H. pylori strains were isolated from 143 patients and 48 patients at a single tertiary hospital in 2005-2006 and 2017-2018, respectively. The minimum inhibitory concentrations (MICs) of fluoroquinolone were determined by the serial 2-fold agar dilution method. The breakpoint for fluoroquinolone resistance was >1.0 µg/ ABSTRACTS | 73 of 95 mL. Sequence analyses of gyrA/gyrB and natural transformation and G1513A, found in 8 and 7 sequenced Hp strains, respectively. studies were performed to investigate the mechanism of resistance. Mutation A2142G was found in only one strain, T2182C – in three. Results: The resistance rates for levofloxacin and moxifloxacin Conclusions: The high rate of H. pylori resistance to clarithromycin were equally 16.8% (24/143) in 2005-2006, which increased up to was revealed in St. Petersburg, Russia. Analysis of point mutations 43.8% (21/48) for both antibiotics in 2017-2018. The range of MIC in the 23S rRNA region revealed genetic heterogeneity of Clar Hp values for resistant strains increased overall, from 2 to 8 µg/mL in isolates. 2005-2006 to 4-16 µg/mL in 2017-2018. Among 24 resistant strains A. Svarval: None. D. Starkova: None. R. Ferman: None. from 2005-2006, mutation of gyrA was observed in 95.8% (23/24). Transformation experiments revealed that the mutation of gyrB, observed in 12.5% (3/24), was not associated with resistance. All of EP6.03 | The genomic polymorphism of clinical strains of 21 resistant strains from 2017-2018 showed gyrA mutation. Among H. pylori isolated in St. Petersburg, Russia these, a novel mutation of gyrA (Gly-85) which has never been reported before, was detected in one strain and was confirmed to be A. Svarval; D. Starkova; R. Ferman associated with fluoroquinolone resistance by natural transforma- Pasteur Institute, Saint Petersburg, Russian Federation tion experiments. Conclusion: The prevalence of fluoroquinolone resistance of H. The aim of our work was to study the genomic polymorphism of pylori has markedly increased over time in Korea. Fluoroquinolone clinical isolates of H. pylori obtained from various manifestations should be carefully used for H. pylori eradication in Korea, consider- of H. pylori infection in St. Petersburg. Materials and methods. We ing the high prevalence of fluoroquinolone resistance. studied 64 H. pylori strains isolated from patients with chronic gastri- S. Rhie: None. J. Park: None. T. Shin: None. J. Kim: None. B. Kim: tis (CG), duodenal ulcer (DU), gastric cancer (GC). The obtained DNA None. J.G. Kim: B. Research Grant (principal investigator, collabora- was used for PCR for the detection of cagA, oipA genes and typing tor or consultant and pending grants as well as grants already re- of the vacA gene. Amplification of gene regions was carried out in ceived); Significant; the Korean College of Helicobacter and Upper a Bio-Rad C1000 Thermal Cycler thermal cycler (USA). The results Gastrointestinal Research. were visualized using the GelDoc gel documentation system (Bio- Rad, USA). Results. 67% of cagA+ H. pylori strains were detected. The presence of the cagA gene was observed in 82.6% and 100% EP6.02 | Clarithromycin resistance of Helicobacter pylori strains of H. pylori isolates at DU and GC. 95% strains at UD had vacAs1 al- isolated in St. Petersburg, Russia lele. All H. pylori isolates vacAs1/m1 and vacAs2/m2 were carriers of the alleles i1 (vacAs1/m1/i1) and i2 (vacAs2/m2/i2), respectively. A A. Svarval; D. Starkova; R. Ferman functionally active OipA gene was found only in 64% of H. pylori iso- Pasteur Institute, Saint Petersburg, Russian Federation lates. Most oipA+ isolates (85%) were carrier of the cagA gene and the vacAs1 allele. The dominant combined genotype cagA +/oipA Introduction: Currently, the problem of the effectiveness of eradica- +/s1/m1/i1, which was found in 34% of clinical isolates of H. pylori, tion therapy of H. pylori infection remains relevant. One of the main was revealed. Thus, an analysis of the genomic polymorphism of the causes of failure during eradication is the resistance of H. pylori (Hp) H. pylori clinical isolates isolated from patients with helicobacteriosis to the antibiotics used. revealed a genetic heterogeneity of the pathogen population in St. Aim: Detection of point mutations in the 23S rRNA gene of Cla- Petersburg, Russia. resistant (Clar) clinical Hp strains isolated from patients with pathol- A. Svarval: None. D. Starkova: None. R. Ferman: None. ogy of the stomach or duodenum in St. Petersburg, Russia. Materials and methods. The resistance of 87 H. pylori strains to antibiotics was determined using the disk-diffusion method. Sequencing (by Sanger) EP6.04 | Helicobacter pylori resistance, treatment outcome and of an amplification product of 1402 bp the 23S rRNA gene of eight Hp point mutation analysis based on molecular testing in Serbian adult strains was performed using direct (AGTCGGGTCCTAAGCCGAG) population and reverse (TTCCTGCTTAGATGCTTTCAG) primers. Chromatogram processing, alignment of sequences to the reference sequence V. Milivojevic1,2; D. Kekic3; I. Rankovic1; L. Ranin3; M. Krstic1; T. GenBank acc. no. U27270 and identification of nucleotide substi- Milosavljevic1 tutions were performed using the Unipro UGENE 1.12 program. 1Clinical center of Serbia, Clinic for gastroenterology and hepatology, Results. During the work, 28 (32.18%) strains of clarithromycin- Belgrade, Serbia; 2School of Medicine, Belgrade University, Belgrade, resistant Hp were identified. Sequencing of the 23S rRNA Clar gene Serbia; 3Microbiology Institute, School of Medicine, Belgrade, Serbia region of the Hp isolates identified 3-6 different point mutations in each of them. Point mutations were detected in the following po- Increased resistance to antibiotics is the major cause of treatment sitions: G1513A, A1821G, G1826A, T1830C, A2142G, A2143G, failure of H. pylori infection. The aims of this study were to determine T2182C, T2244C. The most frequent mutations were T2244C the prevalence of H. pylori colonization, resistance rate of H. pylori to 74 of 95 | ABSTRACTS

2 clarithromycin and fluoroquinolones and corresponding point muta- strains (38.5% vs 61.4%, respectively; χ = 5.7, P = 0.02). Similarly, tions and to assess the treatment outcome of the molecular tests- fewer cagE-positive strains were clarithromycin resistant than cagE- 2 based eradication protocol. In the study enrolled 149 patients, who negative strains (44.8% vs 65%, respectively, χ = 5.2, P = 0.02). underwent upper gastroscopy from 2018-2020. Obtained bioptates Clarithromycin resistance was also lower among more virulent vacA 2 were sent for histopathological evaluation and molecular diagnosis S1 genotypes compared to S2 (49.5% vs 80%, respectively; χ = 6.3, (GenoType HelicoDR, Hain) for the detection of H. pylori and point P = 0.01). No significant associations between virulence factor geno- mutations confers clarithromycin and fluoroquinolone resistance. type and fluoroquinolone resistance were found. Treatment outcomes of H. pylori infection were assessed using urea Conclusion: Less virulent vacA genotypes and the absence of cagA breath test. H. pylori resistance to clarithromycin and fluoroqui- and cagE are associated with clarithromycin resistance. nolone was found in 51.9% and 45.5% strains, respectively. Primary C. Sinha: None. R. FitzGerald: None. A. Whelan: None. L. O'Reilly: resistance to clarithromycin and fluoroquinolone was found in 37% None. N. Curran: None. A. Douglas: None. D. Brennan: None. C. and 14.8%, respectively. Dual resistance to these antibiotics was O'Morain: None. D. McNamara: None. S. Smith: None. more common in patients over 60 years old, compared to younger (23.1% vs 11.3%). The A2143G point mutation was found in 85% of clarithromycin-resistant H. pylori, while mutation in gyrA87 was EP6.06 | Pathway of focal adhesion and its relevant circRNAs the most common of the fluoroquinolone-resistant strains (31.4%). and lncRNAs are involved with perianal Crohn's disease More than one mutation of the respective gene was found in 10% of clarithromycin- and 19.8% of fluoroquinolone-resistant H. pylori. The S. Dai1; J. Hu2; Y. Huang2 success rate of H. pylori eradication therapy was significantly higher 1Department of Gastroenterology, Guangdong Provincial People's in “naive” patients (91.3%) than in non-treatment-naive patients Hospital and Guangdong Academy of Medical Sciences, South China 71% (P < 0.05). High resistance rate of H. pylori to clarithromycin University of Technology, Guangzhou, China; 2The Second Clinical required revision of the standard eradication protocol used in Serbia. School, Southern Medical University, Guangzhou, China Molecular-based treatment lead to high eradication rates of H. pylori. V. Milivojevic: None. D. Kekic: None. I. Rankovic: None. L. Ranin: Background and Aim: Perianal Crohn's disease (P-CD) is a subtype of None. M. Krstic: None. T. Milosavljevic: None. CD suffering from perianal abscess or fistula, the molecular mechanisms of which are not elucidated. Our aim is to screen the signal pathways, circRNAs, and lncRNAs correlated with the pathogenesis EP6.05 | Clarithromycin resistance is more common among less of P-CD. virulent Helicobacter pylori strains – Data from an Irish centre Methods: Colonic mucosal samples were collected from four patients with P-CD, four with non-P-CD (NP-CD), all were newly diagnosed C. Sinha; R. FitzGerald; A. Whelan; L. O'Reilly; N. Curran; A. as CD without infliximab or azathioprine usage. The coding RNAs Douglas; D. Brennan; C. O'Morain; D. McNamara; S. Smith and ncRNAs were remained whereas rRNAs were removed. After Trinity College Dublin, Dublin, Ireland getting the total RNAs from mucosal samples, PCRs was performed. HISAT2, Stringtie, CPC, CNCI were applied when the “clean data” Introduction: Increasing antibiotic resistance is making H. pylori were filtered to analyze the correlation of “lncRNA-mRNA”. Anchors eradication progressively difficult. Virulence factors including the reads were compared through “Find_circ” to determine the targeted vacuolating cytotoxin A (VacA), cytotoxin-associated genes A and E circRNAs. Through miRNA sponges, the complicated ceRNA regula- (CagA and CagE) and the outer inflammatory protein A (OipA) play a tory networks of circRNAs, lncRNAs, and miRNAs formed. role in determining the severity of disease. Results: 527 genes, 186 lncRNAs and 114 circRNAs differentially Aims/Background: To evaluate correlations between clarithromycin expressed between P-CD and NP-CD (all P < 0.05), with 249 up- and fluoroquinolone resistance and virulence factor genotype. regulated and 278 down-regulated genes, 97 up-regulated and 89 Methods: DNA was isolated from stomach biopsies of RUT-positive down-regulated lncRNAs, 50 up-regulated and 64 down-regulated patients attending Tallaght University Hospital. The GenoType circRNAs in P-CD compared with NP-CD. Among the 47 mostly HelicoDR assay (Hain Lifesciences) was used to detect resistance- clustered genes, ERBB2 and ITGA1 were involved with focal adhe- mediating mutations. Genotyping for virulence factors was done by sion in P-CD. Three circRNAs, including hsa_circ_0043837, hsa_ PCR. SPSS software was used to perform statistical analysis. circ_0008164, and hsa_circ_0019225 showed a significant function Results: 127 patients were included (mean age 48.3 ± 15.7 years; in regulating the expression of the target genes and leading to dys- 59% male), regardless of H. pylori treatment history. Overall resistance function of focal adhesion, which were significantly associated with rates to clarithromycin and fluoroquinolones were 54.3% and 11.8%, the development of P-CD. respectively. 30.7%, 52.7% and 56.7% of strains were cagA-, cagE- and Conclusions: Focal adhesion is a notable pathway for P-CD, it could oipA-positive, respectively. VacA genotyping revealed that 60.6% were be associated with decreased fibroblast migration in the fistula tis- S1/M2, 23.6% S1/M1, 15% S2/M2 and 0.8% S2/M1. Clarithromycin sues of P-CD patients. resistance was significantly lower in cagA-positive than cagA-negative S. Dai: None. J. Hu: None. Y. Huang: None. ABSTRACTS | 75 of 95

7 EP6.07 | Comparison in vitro of activity of various macrolides China Hospital, Sichuan University, Chengdu, China; Key Laboratory against Helicobacter pylori of Geoscience Spatial Information Technology, Ministry of Land and Resources of the P.R.China, Chengdu University of Technology, 8 N. Dekhnich; N. Ivanchic; R. Kozlov Chengdu, China; School of Molecular Sciences, University of Western 9 Smolensk State Medical University, Smolensk, Russian Federation Australia, Perth, Australia; Ondek Pty Ltd, Sydney, Australia

Background: Clarithromycin is almost exclusively used worldwide The lipopolysaccharide O-antigen structure expressed by the for H. pylori eradication therapy among macrolides. However, some European Helicobacter pylori model strain G27 encompasses a trisac- authors suggest that other macrolides have potential for this in- charide, an intervening glucan-heptan and distal Lewis antigens that dication. The aim of our study was to compare in vitro activity of promote immune escape. However, several gaps still remain in the clarithromycin, erythromycin, azithromycin and josamycin against H. corresponding biosynthetic pathway. Here, systematic mutagenesis pylori isolates collected during 2010-2017 in Smolensk, Russia. of glycosyltransferase genes in G27 combined with lipopolysaccha- Materials/methods: Antimicrobial susceptibility testing was done by ride structural analysis, uncovered HP0102 as the trisaccharide fu- agar dilution method. Interpretation of susceptibility testing results cosyltransferase, HP1283 as the heptan transferase, and HP1578 as for clarithromycin was performed according EUCAST (v 8.0) break- the GlcNAc transferase that initiates the synthesis of Lewis antigens points. Resistance breakpoints for erythromycin, azithromycin, and onto the heptan motif. Comparative genomic analysis of G27 lipopol- josamycin were set at ≥1.0 mg/L, as for clarithromycin. ysaccharide biosynthetic genes in strains of different ethnic origin

Results: A total of 276 H. pylori isolates were tested. MIC50 and revealed that East-Asian strains lack the HP1283/HP1578 genes but

MIC90 values for clarithromycin, azithromycin, erythromycin, and contain an additional copy of HP1105 and JHP0562. Further correla- josamycin were: 0.015 mg/L and 0.125 mg/L, 0.125 mg/L and tion of different lipopolysaccharide structures with corresponding 0.25 mg/L, 0.125 mg/L and 0.5 mg/L, 0.25 mg/L and 1 mg/L. MIC gene contents led us to propose that the second copy of HP1105 ranges for clarithromycin, azithromycin, erythromycin, and josa- and the JHP0562 may function as the GlcNAc and Gal transferase, mycin were: 0.015-16 mg/L, 0.015-16 mg/L, 0.015-128 mg/L, and respectively, to initiate synthesis of the Lewis antigen onto the Glc- 0.015-256 mg/L, respectively. Resistance rates were as follows: Trio-Core in East-Asian strains lacking the HP1283/HP1578 genes. clarithromycin – 5.1%, azithromycin – 7.5%, erythromycin – 8%, In view of the high gastric cancer rate in East Asia, the absence of josamycin – 23.2%. Only for 1 of 14 clarithromycin-resistant strains the HP1283/HP1578 genes in East-Asian H. pylori strains warrants MIC of josamycin was less than 1 mg/L (0.5 mg/L), for other 13 future studies addressing the role of the lipopolysaccharide heptan clarithromycin-resistant isolates MICs of josamycin were signifi- in pathogenesis. cantly higher than MICs of clarithromycin (1-16 mg/L vs 2-256 mg/L). H. Li: None. M. Marceau: None. T. Yang: None. T. Liao: None. X. Tang: Conclusions: Clarithromycin demonstrated the highest in vitro activ- None. R. Hu: None. Y. Xie: None. H. Tang: None. A. Tay: None. Y. Shi: ity against H. pylori among tested macrolides. None. Y. Shen: None. T. Yang: None. X. Pi: None. B. Lamichhane: N. Dekhnich: None. N. Ivanchic: None. R. Kozlov: None. None. Y. Luo: None. A.W. Debowski: None. H. Nilsson: None. S.M. Haslam: None. B. Mulloy: None. A. Dell: None. K.A. Stubbs: None. B.J. Marshall: None. M. Benghezal: None. EP6.08 | East-Asian Helicobacter pylori strains synthesize heptan-deficient lipopolysaccharide EP6.09 | The role of two PDZ domains in HtrA from Helicobacter H. Li1,2; M. Marceau3; T. Yang4; T. Liao2; X. Tang1; R. Hu5; Y. Xie5; H. pylori in the protein quality control system Tang1; A. Tay2; Y. Shi1; Y. Shen1; T. Yang1; X. Pi6; B. Lamichhane2; Y. Luo7; A. W. Debowski2,8; H. Nilsson2; S. M. Haslam4; B. Mulloy4; A. U. Zarzecka1,2; S. Backert2; J. Skorko-Glonek1 Dell4; K. A. Stubbs8; B. J. Marshall2,9; M. Benghezal1,2 1Department of General and Medical Biochemistry, Faculty of Biology, 1West China Marshall Research Center for Infectious Diseases, Center University of Gdansk, Gdansk, Poland; 2Division of Microbiology, of Infectious Diseases, Division of Infectious Diseases, State Key Department of Biology, Friedrich-Alexander-University Erlangen- Laboratory of Biotherapy, West China Hospital, Sichuan University, Nürnberg, Erlangen, Germany Chengdu, China; 2Helicobacter pylori Research Laboratory, School of Biomedical Sciences, Marshall Centre for Infectious Disease Research Helicobacter pylori is a Gram-negative bacterium that colonizes the and Training, University of Western Australia, Perth, Australia; 3Univ. mucus layer covering the gastric epithelium of humans. The HtrA

Lille, CNRS, Inserm, CHU Lille, Institut Pasteur de Lille, U1019 – UMR protein from H. pylori (HtrAHp) is an important secreted virulence 8204 – CIIL – Center for Infection and Immunity of Lille, Lille, France; factor involved in the colonization process by proteolysis of compo- 4Department of Life Sciences, Imperial College London, London, nents of the adherens and tight junctions between epithelial cells. United Kingdom; 5Department of Gastroenterology, West China As a protease and chaperone, HtrA is involved in the protein qual- Hospital, Sichuan University, Chengdu, China; 6Precision Medicine ity control system in the periplasm, which is particularly important

Key Laboratory of Sichuan Province & Precision Medicine Center, West under stress conditions. The HtrAHp protein comprises a protease 76 of 95 | ABSTRACTS domain at the N-terminus and two PDZ domains (PDZ1 and PDZ2) Pontificia Universidad Javeriana. F.F.V. is recipient of project grant at the C- terminus. In HtrA homologs from other bacteria, the PDZ PTDC/BTM-SAL/28978/2017 from the Fundação para a Ciência e a domains play important regulatory roles, including modulation Tecnologia (FCT) that partially supports this work. of the proteolytic activity and transformations of the oligomeric A.B. Muñoz: None. A.A. Trespalacios: None. F.F. Vale: None. forms. To expand knowledge about HtrAHp, we examined by mutagenesis the importance of the PDZ1 and PDZ2 domains to maintain the proteolytic activity of the enzyme and ability of HtrAHp to EP6.11 | Frequency of Helicobacter pylori cagA, dupA and form the high-order oligomers. In the experiments, we produced a vacA genotypes and their association with severity of gastric series of HtrAHp variants lacking either one or both PDZ domains. pathologies in clinical patients in midwestern Brazil We found, that the PDZ2 domain is important to form high-order oligomers. The variants lacking the PDZ1 or both domains formed L. L. d. Silva1; J. C. Pontes1; A. S. Oliveira1; A. F. P. L. Ramos1; D. trimers only. The PDZ1 domain was crucial for efficient proteolytic M. M. Cardoso1; A. R. Gama1; A. T. C. Silva2; A. J. V. Blanco3; L. T. activity. Furthermore, using the H. pylori mutant strains expressing Rasmussem4; L. C. Carneiro1; M. S. Barbosa1 HtrA without one or both PDZ domains, the importance of these 1University Federal of Goiás, Goiânia, Brazil; 2Pontifical Catholic domains for the H. pylori survival under stress conditions was dem- University, Goiânia, Brazil; 3Institute Federal of Goiás, Goiânia, Brazil; onstrated. The work was supported by Grant no. UMO-2016/21/B/ 4University of Medicine, Marilia, Brazil NZ2/01775 from the Polish National Science Center. U. Zarzecka: None. S. Backert: None. J. Skorko-Glonek: None. Helicobacter pylori (H. pylori) is a Gram negative bacterium associated with the development of severe gastric pathologies such as atrophy, metaplasia and gastric adenocarcinoma. As a result, the microorgan- EP6.10 | New Helicobacter pylori prophage phylogenetic ism is considered a type 1 carcinogen by the International Agency population from Colombian strains for Research on Cancer (IARC). The virulence factors present in the infecting strain determine the clinical outcome of the infection and A. B. Muñoz1; A. A. Trespalacios1; F. F. Vale2 can be used as specific markers for the severity of gastric diseases. 1Infectius Diseases Gruop. Sciences Faculty. Pontificia Universidad The aim of this study was to evaluate the prevalence and association Javeriana, Bogotá, Colombia; 2Host-Pathogen Interactions Unit, of cagA, vacA and dupA virulence genotypes with gastric pathologies. Research Institute for Medicines (iMed-ULisboa), Faculdade de Antral and gastric body biopsies of 117 dyspeptic patients were ana- Farmácia, Universidade de Lisboa., Lisboa, Portugal lyzed by histological and molecular techniques. Screening for H. pylori infection was performed using the hpx gene (16S rRNA). Positive Prophages are present in about 20% of Helicobacter pylori strains, samples were submitted to detection of virulence genes vacA, cagA, forming four populations. Here, we did a phylogenetic characteri- dupA. The prevalence of infection was 64.1%, with a high frequency zation of the prophages from Colombian H. pylori strains, using the of positive cagA (80.0%), dupA (70.7%) and vacA (56.0%) strains. The prophage sequence typing (PST). Totally 213 Colombian H. pylori cagA gene was detected in all strains present in patients with se- strains were screened for holin and integrase genes. Additionally 16 vere pathologies, whereas the isolated vacA gene was not detected genomes from Colombian strains presenting prophage sequences in this group. In addition, interestingly, patients with severe diseases were retrieved from public databases. Results from STRUCTURE had fewer virulence genes in the infecting strain. The association of were analyzed with the Structure Harvester tool for easier detec- cagA and dupA genotypes was determined in greater number among tion of the number of populations that best fit the data. A phylo- patients with severe pathologies. The circulating H. pylori strains in genetic tree was constructed using neighbor-joining method and the Brazilian Midwest present high heterogeneity of cagA, vacA and Kimura two-parameter model. We found a lower frequency of holin dupA virulence frequency. The presence and combination of various and integrase genes than previously observed. Only 24 isolates virulence factors may influence the clinical outcome. (11.3%) were positive for integrase and 6 (2.8%) were positive for L.L.D. Silva: None. J.C. Pontes: None. A.S. Oliveira: None. A.F.P.L. both genes. The PST analysis showed evidence of five populations, Ramos: None. D.M.M. Cardoso: None. A.R. Gama: None. A.T.C. Silva: including a new fifth population exclusively composed of Colombian None. A.J.V. Blanco: None. L.T. Rasmussem: None. L.C. Carneiro: strains. The phylogenetic tree clusters were consistent with this new None. M.S. Barbosa: None. population. To the best of our knowledge this is the first report of H. pylori prophages from the Americas (Colombia), surprisingly revealing a new population. Isolation, admixture and miscegenation that began with the arrival of the Europeans and African slaves to America could explain this phenomenon. Funding: A.M is recipient of scholarship from CEIBA Foundation; A.M and A.T are recipients of a project grant (120380763025/2018) from Colciencias and (PPTA_7676) from Research Vice-rectory ABSTRACTS | 77 of 95

EP6.12 | Comparative genomic analysis of novel Helicobacter 2017;. Current genomic studies in some H. pylori populations have pylori strains isolated from domestic cats with gastritis reveals shown distinctive patterns of diversity associated with pathogenesis unique genetic profile that may contribute to colonization and (Shaffer et al. 2011; Berthenet et al. 2018), suggesting a population- pathogenicity in feline hosts based research for quantitative genomic analysis to understand the progression of disease. We want to study the evolution and patho- A. Mannion; Z. Shen; J. G. Fox genicity of several thousand of genomic sequences of H. pylori from Massachusetts Institute of Technology, Cambridge, MA, United States Asia, as well as from other parts of the world. For this, we are first analyzing the population structure of ~3000 public samples avail- While Helicobacter pylori (Hp) is considered a human-specific patho- able from different sources and concentrated in the EnteroBase da- gen, natural Hp infection has been detected in domestic, commer- tabase (Zhou et al. 2020) using fineSTRUCTURE (Lawson et al. 2012) cially available cats with chronic gastritis. Cat strains experimentally and other reference-based approaches. recapitulated gastritis in specific-pathogen free cats and mice. As R.C. Torres: None. D. Falush: None. the factors that influence Hp host specificity are unknown, genomes from four representative Hp strains isolated from the domestic cats and a mouse-passaged Hp cat strain were compared with 257 Hp EP6.14 | Muller's ratchet-like effect in Helicobacter pylori, a genomes from human, macaque, mouse, and gerbil natural or ex- highly recombining bacterial species perimental hosts, which are to elucidate the genetic profile for Hp colonization and pathogenicity in cats. Pan-genome phylogenetic E. Tourrette; D. Falush analysis showed the Hp cat genomes formed a distinct clade that Institut Pasteur of Shanghai, Shanghai, China neighbored strains B38, 29CaP, and G-Mx-2006-583 isolated from human patients with gastritis and gastric cancer and was distant to Helicobacter pylori can be subdivided into different subpopulations: clades containing strains capable of colonizing nonhuman animal Africa, Asia and Europe and Middle East (Falush et al. 2003, Montano species. Average nucleotide identity showed the Hp cat genomes et al. 2015). The Asian population has been formed after an out-of- were nearly identical (>99.7%) to each other and distinct from other Africa bottleneck while the European and Middle Eastern ones could strains (~95%). The pan-genome for Hp cat genomes contained 1142 be the result of an hybridization between the African and Asian pop- core and 519 accessory genes. 28 genes were unique, but comprised ulations. The African and Asian populations present similar levels of hypothetical annotations. Numerous genes were truncated, elon- genetic diversity while the mutation load is higher in the Asian pop- gated, or fragmented due to mutations, especially in polynucleotide ulation (higher dN/dS). Moreover, the sites where non-synonymous repeats regions, which may inactive or modify product function. mutations accumulated in Asian population show a deficit of Asian Disruptions frequently occurred in methyltransferase, outer mem- ancestry in European and Middle Eastern populations. This excess of brane, transporter and metabolic genes. Vacuolating cytotoxin non-synonymous mutations after a bottleneck is similar to the conse- subtype s1-i1/i2-m2 was present in the Hp cat genomes. The cag quences of the Muller's ratchet, i.e. the accumulation of deleterious pathogenicity island was absent in the Hp cat genomes. The results mutations in asexual populations (Muller 1964). Although a bottleneck from this analysis suggest Hp cat strains have a unique genetic pro- could cause the loss of the fittest bacteria, H. pylori is a highly recom- file that enabled cat colonization and resulting gastritis. bining species, which should cancel the Muller's ratchet-like effect. In A. Mannion: None. Z. Shen: None. J.G. Fox: None. this poster, we present simulations of the evolution of the African and Asian populations after the bottleneck aimed at finding the values of the parameters to reproduce this observation and explain it. EP6.13 | Current worldwide population structure of Helicobacter E. Tourrette: None. D. Falush: None. pylori

R. C. Torres; D. Falush EP6.15 | Characterization of Helicobacter pylori Infection in the Institut Pasteur of Shanghai, Shanghai, China upper gastrointestinal tract of twins

The ancient coevolution of Helicobacter pylori with its human host R. Vilchez-Vargas1; J. Skieceviciene2; J. Arstikyte2; M. Urba2; C. has generated a phylogeographic structure that culminated in the Thon1; D. Schanze1; M. Zenker1; P. Malfertheiner1; J. Kupcinskas2; formation of different populations that mirror human migrations A. Link1 (Falush et al. 2003; Linz et al. 2007). Genetic diversity of H. pylori 1Otto-von-Guericke University Hospital Magdeburg, Magdeburg, has, so far, been divided into 7 populations and 14 subpopulations Germany; 2Lithuanian University of Health Sciences Kaunas, Kaunas, (Falush et al. 2003; Linz et al. 2007; Moodley et al. 2009), while new Lithuania ones continue to be described as more samples from different regions are studied (Yahara et al. 2013; Montano et al. 2015; Thorell Introduction: Helicobacter pylori (H. pylori) is an infectious disease et al. 2017; Muñoz-Ramirez et al. 2017; Gutierrez-Escobar et al; that causes chronic gastritis, may contribute to development of 78 of 95 | ABSTRACTS preneoplastic mucosal alterations and also leads to development of insulin resistance (IR) and metabolic syndrome (MetS) has been sug- peptic ulcer disease and gastric cancer. Characterization of micro- gested as a risk factor for NAFLD, though controversy exists. This biota in monozygotic and heterozygotic twins may offer a unique retrospective study aimed to investigate a potential impact of active model to understand their contribution to H. pylori induced gas- Hp-I on NAFLD severity in morbidly obese patients underwent bari- troduodenal pathologies (but is still insufficiently utilized). atric surgery and gastric biopsy for documentation of Hp-I. Of 64 eli- Methods: In this study, we characterized bacterial communities from gible participants, 15 with active Hp-I (23.4%) showed higher rates of saliva of 20 twin pairs, upper GI tract of 25 twin pairs and feces from nonalcoholic steatohepatitis (NASH) than those without Hp-I (86.7% 99 twin pairs (total 288 samples) by high throughput sequencing. vs 26.5%, respectively; P < 0.001). Regarding histological lesions, Results: H. pylori was only detected in gastric corpus and antrum steatosis grade (P = 0.027), ballooning (P < 0.001), lobular inflamma- mucosa but not in saliva or feces. Among twins with discordant H. tion (P = 0.003) and fibrosis stage (P < 0.001) were also more severe pylori status, we observed no correlation between gastric microbi- in Hp positive patients. Equally, liver function tests, IR, dyslipidemia ome and the presence of H. pylori infection. However, among the 9 and arterial hypertension were significantly higher in Hp positive twins with concordant H. pylori positivity, there were 5 twins with patients. In conclusion, Hp-I linked with Mets was associated with the same clone of H. pylori infection while in 4 twins the subspecies higher rates of NASH severity in morbidly obese patients with active were different in comparison to paired twin siblings. Hp-Ι, findings offering potential clinical implication. Conclusions: Our preliminary results strongly suggest that H. pylori is Bilirubin ( mol/L) 7.8 ± 5.2 12.2 ± 8.3 0.013 the most predominant factor that may influence stomach microbiome μ HbA1c (%) 5.7 ± 0.6 6.0 ± 1.3 0.33 of the twins. Differences in H. pylori phylotypes suggest that H. pylori might be acquired from heterogeneous source during the childhood HOMA-IR 4.3 ± 3.9 10.1 ± 6.8 <0.001 and lifetime. Further investigations are being carried out to character- Prediabetes/Diabetes 24 (49.0) 9 (60.0) 0.46 [N (%)] ize the microbiome of saliva and the lower GI tract from twins. A. Link: B. Research Grant (principal investigator, collaborator or Arterial hypertension 18 (36.7) 10 (66.7) 0.041 [N (%)] consultant and pending grants as well as grants already received); Dyslipidemia [N (%)] 21 (42.9) 11 (73.3) 0.039 Significant; European Regional Development Fund. R. Vilchez- FLIP [N (%)] Vargas: None. J. Skieceviciene: None. J. Arstikyte: None. M. Urba: None. C. Thon: None. D. Schanze: None. M. Zenker: None. P. No NAFLD 9 (18.4) 0 (0.0) <0.001 Malfertheiner: None. J. Kupcinskas: None. NAFL 27 (55.1) 2 (13.3) NASH 13 (26.5) 13 (86.7) Severe NASH [N (%)] 6 (12.2) 7 (46.7) 0.008 ELECTRONIC POSTER NAS [N (%)] ROUND 7: HELICOBACTER AND No NAFLD 8 (16.3) 0 (0.0) 0.001 EXTRAGASTRODUODENAL DISEASE NAFL 24 (49.0) 1 (6.6) Borderline NASH 10 (20.4) 7 (46.7) EP7.01 | A potential association between Helicobacter pylori Definite NASH 7 (14.3) 7 (46.7) infection and metabolic syndrome-related nonalcoholic fatty liver Steatosis [N (%)] disease severity Grade 0 9 (18.4) 0 (0.0) 0.027 Grade 1 22 (44.9) 3 (20.0) M. Doulberis1,2,3; S. Srivastava4; S. Polyzos5; A. Papaefthymiou5,6; J. Klukowska-Rötzler3; A. Blank7; A. Exadaktylos3; D. Srivastava3; Grade 2 11 (22.4) 7 (46.7) J. Kountouras2 Grade 3 7 (14.3) 5 (33.3) 1Department of Gastroenterology and Hepatology, University of Zurich, Ballooning [N (%)] Zurich, Switzerland; 2Second Medical Clinic, School of Medicine, 0 28 (57.1) 1 (6.6) <0.001 Aristotle University of Thessaloniki, Ippokration Hospital, Thessaloniki, 1 20 (40.8) 10 (66.7) 3 Macedonia, Greece; Emergency Department, University Hospital 2 1 (2.0) 4 (26.7) 4 Inselspital, Bern, Switzerland; Department of Gastroenterology Lobular inflammation [N (%)] 5 and Hepatology, Spital Thun, Thun, Switzerland; First Laboratory 0 30 (61.2) 2 (13.3) 0.003 of Pharmacology, Aristotle University of Thessaloniki, Thessaloniki, 1 13 (26.5) 7 (46.7) Macedonia, Greece; 6Department of Gastroenterology, University 2 6 (12.2) 6 (40.0) Hospital of Larisa, Larisa, Greece; 7Institute for Pathology, University of Fibrosis stage [N (%)] Bern, Bern, Switzerland

Nonalcoholic fatty liver disease (NAFLD) emerges as an important global burden and Helicobacter pylori infection (Hp-I) linked with ABSTRACTS | 79 of 95

F0 37 (75.5) 2 (13.3) <0.001 EP7.03 | Cohort study of Helicobacter pylori infection and the F1 11 (22.4) 7 (46.7) risk of Incident osteoporosis in women F2/3 1 (2.0) 6 (40.0) T. Kim; H. Lee; Y. Min; J. Lee; J. Kim Data are presented as mean ± standard deviation (SD) for continuous, and frequencies (percentage) for categorical variables Abbreviations: Samsung Medical Center, Seoul, Republic of Korea ALT, alanine transaminase; AST, aspartate transaminase; BMI, body mass index; FLIP, fatty liver inhibition of progression; GGT, gamma- Background: Previous studies suggested a link between Helicobacter glutamyl transferase; HbA1c, glycated hemoglobin; HOMA-IR, pylori (H. pylori) infection and osteoporosis, yet large-scale longitudi- homeostatic model of assessment insulin resistance; NAS, nonalcoholic fatty liver disease activity score; NASH, nonalcoholic steatohepatitis. nal studies are lacking to elucidate this association. Methods: A cohort study of 10,482 women, who participated in M. Doulberis: None. S. Srivastava: None. S. Polyzos: None. A. a repeated health screening examination including an H. pylori- Papaefthymiou: None. J. Klukowska-Rötzler: None. A. Blank: None. specific immunoglobulin G antibody test, was conducted to evaluate A. Exadaktylos: None. D. Srivastava: None. J. Kountouras: None. the association between H. pylori and osteoporosis development. Osteoporosis was diagnosed by dual energy X-ray absorptiometry (DXA). EP7.02 | Impact of Helicobacter pylori eradication on the risk of Results: During the 77,515.3 person-years follow-up, women with incident nonalcoholic fatty liver disease H. pylori infection had a higher rate of incident osteoporosis than those who were uninfected. In a multivariable model adjusted for T. Kim; H. Lee; Y. Min; J. Lee; J. Kim age, body mass index, menopausal status, smoking status, regular Samsung Medical Center, Seoul, Republic of Korea exercise, and comorbidities including hypertension, diabetes mellitus, dyslipidemia, stroke, or ischemic heart disease, the hazard ratio Background: Previous studies reported an association between (HR) for incident osteoporosis in women with H. pylori-infection Helicobacter pylori (H. pylori) infection and nonalcoholic fatty liver compared to those without infection was 1.23 (95% confidence disease (NAFLD), yet it is now questioned about whether H. pylori interval [CI], 1.04-1.46). The association between H. pylori and the eradication reduces the risk for incident NAFLD. development of osteopenia was also evident. In the multivariable Methods: This cohort study included 3,780 adults without NAFLD analysis, menopause (HR, 1.66; 95% CI, 1.29-2.13) and increasing at baseline, who participated in a repeated health screening exami- age (HR, 1.07; 95% CI, 1.05-1.08) were significant risk factors for nation including an H. pylori-specific immunoglobulin G antibody osteoporosis, while higher BMI level (HR, 0.84; 95% CI, 0.81-0.87) test. Fatty liver was diagnosed by ultrasonography. was a protective factor of the osteoporosis risk. Results: During a median follow-up of 7.9 years, NAFLD developed Conclusions: In a cohort study, H. pylori infection was associated in 1,294 participants. Participants with persistent H. pylori infec- with an increased risk of osteoporosis, independent of risk factors tion (persistent group) had a higher incident rate of NAFLD than and confounding factors. Additional studies are needed to deter- those whose infections had previously been successfully eradicated mine whether H. pylori eradication can reduce the risk of osteoporo- (eradication group) (P < 0.001). In a multivariable model adjusted for sis in especially women. age, sex, body mass index (BMI), smoking status, alcohol intake, and T. Kim: None. H. Lee: None. J. Lee: None. J. Kim: None. Y. Min: None. metabolic variables, the persistent group exhibited a higher risk of incident NAFLD than the eradication group [hazard ratio (HR), 1.36; 95% confidence interval (CI), 1.18-1.56]. In the multivariable analy- EP7.04 | The prevalence of Helicobacter pylori and the structure sis, higher BMI (HR, 1.19; 95% CI, 1.16-1.22), current smoking (HR, of the gastric mucosa in elderly patients with GERD 1.27; 95% CI, 1.10-1.45), several metabolic abnormalities (higher glucose level, lower high-density lipoprotein cholesterol level, and V. V. Tsukanov1; E. V. Onuchina2; A. V. Vasyutin1; J. L. Tonkikh1 higher triglycerides level) were significant risk factors for NAFLD, 1FRC KSC SB RAS, Scientific Research Institute of medical problems Subgroup analysis also revealed that persistent H. pylori infection of the North, Krasnoyarsk, Russian Federation; 2Irkutsk State Medical was correlated to an increased risk of NAFLD. Academy of Postgraduate Education – Branch Campus of the FSBEI Conclusions: Persistent H. pylori infection was associated signifi- FPE RMACPE MOH Russia, Irkutsk, Russian Federation cantly with the independent development of NAFLD. H. pylori infection may have a pathophysiological role in NAFLD development and, Aim: To study the prevalence of Helicobacter pylori and the structure after successful eradication of H. pylori, the risk of incident NAFLD of the gastric mucosa in elderly patients with gastroesophageal re- might decrease. flux disease (GERD). T. Kim: None. H. Lee: None. J. Lee: None. J. Kim: None. Y. Min: None. Methods: Clinical examination, upper endoscopy with gastric mucosa biopsy were performed in 328 elderly patients with GERD (131 men and 197 women, mean age 69.0 years) and 244 GERD patients with middle age (102 men and 142 women, mean age 45.6 years). 80 of 95 | ABSTRACTS

The GERD diagnosis was based on the Montreal Consensus (Vakil Conclusion: Inverse association was noted between H. pylori infec- N. et al., 2006). Morphological evaluation of the gastric mucosa was tion and EoE. It may indicate protective effect of H. pylori infection performed using the modified Sydney system (Dixon M.F. et al., for EoE. 1996). Helicobacter pylori was determined by the morphological E. Lee: None. D. Lee: None. C. Shin: None. Y. Park: None. N. Kim: method in the biopsies preparations stained by Giemsa. None. Results: Helicobacter pylori was diagnosed in 62.2% of the elderly and in 77.9% of middle age patients with GERD (OR = 0.47; CI 0.32- 0.68; P < 0.001). The frequency of atrophy in the antrum was 71.0% EP7.06 | The features of Helicobacter pylori infection and in elderly patients and 6.9% in middle age persons (P < 0.001). In gastrointestinal manifestations of allergy in children of Eastern the gastric body these indicators were, respectively, 20.7% and 0% Siberia (P < 0.001). The frequency of intestinal metaplasia in elderly patients was 23.2% in antrum and 3.4% in gastric body; in middle age patients S. V. Smirnova; A. A. Barilo; A. A. Feizer – 4.1% in antrum (P < 0.001) and 0% in gastric body (P = 0.01). Scientific Research Institute of Medical Problems of the North – a Conclusion: In elderly GERD patients in comparison with middle age separate division of the Federal, Krasnoyarsk, Russian Federation persons with GERD, more often determined atrophy and intestinal metaplasia and less often Helicobacter pylori in the gastric mucosa, Background: The gastrointestinal tract is the often shock organ of which suggests differences in the GERD pathogenetic mechanisms allergic reactions. Gastrointestinal manifestations (GI) of allergies in the studied age groups. can be associated with Helicobacter pylori (HP) infection and com- V.V. Tsukanov: None. E.V. Onuchina: None. A.V. Vasyutin: None. J.L. bined with the damage of the other organs and systems. Tonkikh: None. Aim: To study the features of gastrointestinal manifestations of allergies and frequency of occurrence of Helicobacter pylori infection in children with allergic diseases in Eastern Siberia. EP7.05 | Clinical implication of Helicobacter pylori infection for Materials and Methods: The study included 29 children with gas- eosinophilic esophagitis: A single center experience trointestinal manifestations of allergies from Eastern Siberia. The presence of Helicobacter infection was determined by the enzyme E. Lee; D. Lee; C. Shin; Y. Park; N. Kim immunoassay (ELISA) (the concentration of total antibodies to the Seoul National University Bundang Hospital, Bundang-gu, Seongnam- CagA H. pylori antigen). The state of the gastrointestinal tract was si, Gyeonggi-do, Republic of Korea evaluated by the fibrogastroscopy (FGS). Results: We determined the structure of other allergic manifesta- Background/Aim: To investigated the relationship between EoE and tions: respiratory (allergic rhinitis, bronchial asthma and their com- Helicobacter pylori infection in the Korean population including re- bination) in 51.7% (n = 15), cutaneous (atopic dermatitis, urticaria) cent data. – 17.2% (n = 5) and dermatorespiratory – 31% (n = 9) cases. The fre- Methods: This was a single-center case-control study. We enrolled quency of occurrence of HP infection in our study was 27.5% (n = 8). patients diagnosed with EoE from 2003 to 2020 based on histol- The analyze of the FGS showed that esophagitis, bulbitis, erosive ogy with esophagus eosinophilic infiltration with ≥15 eosinophils lesions are more often in the group of non-HP-infected children, but per high-power field (HPF). A total of 48 patients were identified to they did not reach statistical significance. The incompetence of car- have EoE, and 9 patients who did not know H. pylori infection were dia were statistically significantly more often in HP-infected children excluded. Finally, 39 patients were included to the analyses. We also compared to non-HP-infected children: 100.0% (n = 8) and 57.1% incorporated 78 age- and sex-matched controls (1 case : 2 controls). (n = 12) of cases, respectively, P = 0.025. Patients with rapid urease test-positive or with the evidence of H. Conclusion: Thus, gastrointestinal manifestations of allergies in chil- pylori infection on histology were classified as H. pylori-positive. dren with allergic diseases in Eastern Siberia are often accompanied Results: Among the EoE patients, 25 (64.1%) were men and median by Helicobacter pylori infection and statistically significantly more age at the diagnosis was 18.1 years (range: 10 month-79 years.) 16 often have incompetence of the cardia. patients presented epigastric pain, 16 vomiting, 13 dysphagia, 10 S.V. Smirnova: None. A.A. Barilo: None. A.A. Feizer: None. failure to thrive. 31 patients (79.5%) had allergic diseases such as food allergy (67%), allergic rhinitis (23.1%), atopic dermatitis (10%), asthma (7.7%), chronic urticaria (5.2%), drug allergy (5.2%), and der- matographism (2.6%). Nineteen patients (49%) had peripheral eosinophilia (eosinophil count in peripheral blood of ≥500/μL). While 17 of 78 (21.8%) controls had H. pylori infection, only 2 (5.1 %) EoE patients had evidence of H. pylori infection. EoE was inversely associated with H. pylori infection (odds ratio 0.19, 95% confidence interval 0.04-0.89, P = 0.0346). ABSTRACTS | 81 of 95

EP7.07 | H. pylori prevalence in individuals with allergic disease Conclusions: Overweight and presence of siblings in a family are in the Latvian population associated with the development of asthma. Lower prevalence of H. pylori infection among asthma patients suggests that bacteria J. Aleksejeva1; D. Razuka-Ebela1,2; I. Daugule1,2; I. Polaka2; S. could have immunomodulative role in respect to the development Parshutin2; D. Santare1,2; I. Ebela1; R. Murillo3; R. Herrero3; J. Young of allergy. Park3; M. Leja1,2 J. Aleksejeva: None. D. Razuka-Ebela: None. I. Daugule: None. I. 1University of Latvia, Riga, Latvia; 2Institute of Clinical and Preventive Polaka: None. S. Parshutin: None. D. Santare: None. I. Ebela: None. Medicine, Riga, Latvia; 3International Agency for Research on Cancer, R. Murillo: None. R. Herrero: None. J. Young Park: None. M. Leja: Lyon, France None.

Background: A possible protective role of the Helicobacter pylori (H. pylori) has been proposed in the development of allergic disease. EP7.09 | Strain specific pathological changes in the liver of mice The objective was to analyze the association between H. pylori infec- infected with Helicobacter pylori (H. pylori) tion and allergic diseases in Latvian population. Material/Methods: Data from participants (40-60 years) of the S. Khalid1; L. Seeneevassen2; E. Sifré2; C. Varon2; P. Spuul1 GISTAR study in Latvia were collected 2016-2019. Participants 1Tallinn University of Technology, Tallinn, Estonia; 2Université de had been tested for H. pylori (C13-UBT); data on gender, age (<50 Bordeaux, Bordeaux, France vs ≥50 years), net income (<250€ vs ≥250€), education (upper secondary/lower vs professional training/higher), smoking (never vs Background: Helicobacter pylori (H. pylori) is the most common in- current/former), body mass index (BMI <25 vs ≥25 kg/m2), waist fectious pathogen of the gastroduodenal tract. H. pylori infection circumference (females: ≤88 cm vs >88 cm; males: ≤102 cm vs is correlated to the number of human diseases, including liver dis- >102 cm), self-reported allergic disease were obtained by ques- eases. However, the data available is not unrevealing the mechanism tionnaire. H. pylori prevalence was compared for participants with/ through which H. pylori affects the development of hepatobiliary without self-reported allergic disease. Factors that showed associa- diseases and direct hepatotoxicity. We hypothesize that H. pylori tion (P < 0.09) with presence of asthma in univariate analysis were infection could lead to cellular morphological alterations with the included in multiple logistic regression model adjusting for H. pylori progressive liver function deterioration in the mice liver. status. Results: Our data suggests that different strains of H. pylori i.e., SS1 Results: In total, 2317 participants (mean age 52.27, SD ±6.86) and HPARE induced different grades of pathological changes in the were included in the analysis. Allergic disease was reported by liver samples of the infected mice. SS1 is pro-inflammatory, induces 12.56%(291/2317) of which asthma-5.1%(117/2311), urticaria- the structural changes of the hepatocytes but is weakly carcino- 2.33%(54/2317), atopic dermatitis-0.04%(1/2317), allergic rhini- genic while HPARE is highly necro-inflammatory, regulates the he- tis-0.13%(3/2311), other allergies-5.96%(138/2317). Asthma was patic morphogenesis, structural collapsing, necroptosis contributing positively associated with female gender (6.2% vs 3.2%; P = 0.001), to the fatty liver disease, bridging fibrosis, incomplete cirrhosis and age ≥50 years (5.7% vs 4.0%; P = 0.07), lower income level (7.4% vs liver cancer. The critical findings in our data were: bile duct abnor- 4.5%; P = 0.01), lower education level (6.9% vs 4.6%; P = 0.04), higher malities, active extramedullary hematopoiesis (EMP) suggesting the BMI (5.7% vs 3.3%; P = 0.05), greater waist circumference (7.0% vs chronic infection induced by H. pylori leading to angiogenesis and 3.2%; P < 0.001), higher number (≥1 vs 0) of siblings (5.4% vs 2.9%; neutrophil & erythrocytes altered profile along with nuclear hyper- P = 0.06). H. pylori was detected in 53.2%(1233/2317), was more fre- segmentation. Additionally, this study detected an abnormal distri- quent in males than females (55.9% vs 51.5%; P = 0.04), those under bution of Collagen type IV and excess deposition of the extracellular 50 years (56.7% vs 51.2%; P = 0.01). H. pylori infection was more matrix into the space of Disse which results in distortion of the prevalent in non-allergic than allergic patients (54.4% vs 44.7%; liver architecture. Moreover, immuno-histological analysis showed P = 0.002), in those without asthma vs with asthma (54.1% vs 36.8%; shorter-less distinct spirals and gull wing-like shape bacterium in the P < 0.001); no difference was found with respect to the age (<18 vs portal and sinusoidal areas. Conclusion: Our results indicate poten- ≥18 years) of asthma diagnosis (28.6% vs 38.5%; P = 0.39). H. py- tial role of H. pylori in the induction of hepatobiliary diseases and the lori, gender, age, smoking, income, education, number of siblings importance of bacterial strain in the severity of the pathology. in the family, waist circumference, BMI were included in multiple S. Khalid: None. L. Seeneevassen: None. E. Sifré: None. C. Varon: logistic regression model. In multivariate analysis asthma was sig- None. P. Spuul: None. nificantly inversely associated with H. pylori (OR = 0.5; CI 95%: 0.3- 0.7; P = 0.001), lower income (OR = 0.6; CI 95%: 0.4-0.9; P = 0.02); positively associated with female gender (OR = 1.6; CI 95%: 1.0-2.5; P = 0.05); sibling in a family (OR = 1.9; CI 95%: 0.9-3.9; P = 0.09); higher waist circumference (OR = 2.1; CI 95%: 1.4-3.3; P < 0.001). 82 of 95 | ABSTRACTS

EP7.10 | Helicobacter pylori-induced inflammatory response EP7.11 | Role of Helicobacters in Idiopathic Parkinsonism: A mediates invadosome formation and emergence of hybrid systematic review epithelial/mesenchymal phenotype in infected hepatocytes R. M. Tucker1,2; A. D. Augustin1,2; B. H. Hayee3; I. Bjarnason3; D. O. Smirnova1; K. Roots1; E. Rukavitsõna1,2; L. Kasak1; K. Karniol1; C. Taylor1,2; C. Weller1; A. Charlett1,4; S. M. Dobbs1,2,3; R. J. Dobbs1,2,3 Varon2; E. Genot2; P. Spuul1 1Pharmaceutical Sciences, King's College London, London, United 1Tallinn University of Technology, Tallinn, Estonia; 2Universite de Kingdom; 2The Maudsley Hospital, London, United Kingdom; Bordeaux, Bordeaux, France 3Gastroenterology, King's College Hospital, London, United Kingdom; 4Statistics, Modelling and Economics, National Infection Service, Public Helicobacter pylori (H. pylori) is a Gram-negative bacterium that Health England, London, United Kingdom colonizes the human gastric epithelium in about half of the world ́s population. Several studies have associated H. pylori infection with Background: Prior to discovery of Helicobacter pylori-associated the progression of liver cirrhosis and hepatocellular carcinoma. We gastritis, an excess of concurrent (1961) and previously documented have previously shown that different H. pylori strains, with distinct (1965) peptic ulcer was observed in idiopathic parkinsonism (IP). pathogenic outcomes, induce invadosomes with distinctive fea- Methods: This systematic review used an EMBASE database search, tures in infected primary hepatocytes and in hepatoma Huh7 cell with search strategy according to PRISMA guidelines. Oxford Centre line. Due to the ability to degrade extracellular matrix, invadosomes for Evidence-Based Medicine (OCEBM) based questions addressed, are considered to be potential structures of proteolytic cell inva- using the cumulative stratified evidence, were on inter-relationship sion. The central aim of our study is to investigate the mechanisms of Helicobacter and IP, benefits of eradicating Helicobacter in IP and behind invadosome formation and to understand the subversion of outcome of not treating. liver cell functions upon H. pylori infection. Our study shows that Results: Twenty-one of 204 articles reviewed met inclusion criteria. H. pylori strains with cagPAI are able to significantly activate NFĸB The common a priori assumption that any benefit from Helicobacter and upregulate the expression of IL8 and IL6 in infected Huh7 cells. eradication results from improved levodopa bioavailability is unjusti- Importantly, the inflammatory response correlated with the invado- fied: increased bioavailability is unproven and benefit occurs even in some formation. NF-kB pathway inhibitor BAY11-7082 successfully anti-parkinsonian treatment-naïve patients. The inter-relationship of managed to subdue the invadosome formation in cells infected with Helicobacter and IP is well-established (Level 1 OCEBM evidence), CagA-positive strains. CagA-positive strains also upregulated the based on registry surveys. Previous Helicobacter infection appears expression of CD44. Wound healing scratch assay indicated slowed as or more important than current to IP aetiopathogenesis. H. pylori cell migration of infected Huh7 cell compared to untreated control virulence-markers (associated with autoimmunity and immune toler- cells and altered adherence junctions between confluent Huh7 cells ance) influence risk, severity and progression of IP. The birth-cohort infected with different H. pylori strains. Interestingly, adherence effect for virulence-marker antibodies, seen in controls, is obliterated junction component β-catenin was relocated to radial junctions and in IP, suggesting causality. Successful H. pylori eradication in IP is around invadosomes. Our results suggest that pathogenic H. pylori disease-modifying, but not preventing (Level 1, based on systematic strains induce increased inflammatory response in infected hepato- reviews of randomised-controlled-trials, observational study with cytes leading to actin cytoskeleton remodeling, hybrid epithelial/ dramatic effect and non-randomised-trials). Hypokinesia regresses mesenchymal phenotype and could therefore contribute to the pro- with eradication, overall motor-severity lessens. Eradication may gression of liver diseases. influence gastrointestinal microbiota adversely, unlocking develop- O. Smirnova: None. K. Roots: None. E. Rukavitsõna: None. L. Kasak: ment of rigidity. Failed eradication worsens hypokinesia, as does None. K. Karniol: None. C. Varon: None. E. Genot: None. P. Spuul: presence/persistence of H. pylori at molecular-level only. Adequate None. prognostic assessment of not treating Helicobacter is prevented by short follow-up. Conclusions: We conclude that Helicobacter is a pathophysiological driver of IP. R.M. Tucker: None. A.D. Augustin: None. B.H. Hayee: None. I. Bjarnason: None. D. Taylor: None. C. Weller: None. A. Charlett: None. S.M. Dobbs: None. R.J. Dobbs: None. ABSTRACTS | 83 of 95

EP7.12 | H. pylori associated to irritable bowel syndrome (IBS) among non-infected 2.8% (P = 0.6558). Erosive gastritis was diagnosed in 9.2% of the infected subjects and in 10.5% without the A. Barrios; F. A. Barrios; A. Alvarez; E. Mendez infection (P = 0.7). Gastritis was diagnosed after the data of histo- Las Torres Clinic, Quetzaltenango, Guatemala logical tests. In children with H. pylori-associated diseases in stomach body we diagnosed gastritis of the 2-3 stages in 38.5% cases, in non- Background/Aims: The roll of H. pylori in the pathogenesis of the infected cases in 18.9% (P = 0.0001); in antrum 67.2% and 22.4% Irritable Bowel Syndrome (IBS) was investigated in 38 subjects, (P = 0.0001) correspondingly. In H. pylori subjects mucosa metaplasia these patients were diagnosed and treated for IBS, without any was found in 2.1%, in non-infected ones in 2.8% (P = 0.6558). improvement. Conclusion: In H. pylori schoolchildren of Siberia the associations Methods: Colonoscopy, Biopsy and CLO-test (Rapid Urease Test). of the infection with ulcer diseases and metaplasia have not been Results: Male 16 (42%) Female 22 (58%) H. pylori positive 19 (50%) marked. In bacterial invasion they showed the strengthening of gas- H. pylori negative 19 (50%). One patient in this study previously pre- tritis activity in both antrum and body of a stomach. sented Colonic Carcinoma. T.V. Polivanova: None. V.A. Vshivkov: None. Conclusion: All patients H. pylori positive received treatment and showed improvement including the patient with colonic carcinoma, which in the beginning presented 99% of stricture and after 1 month EP8.02 | Cytokines in Helicobacter pylori-associated gastritis in of treatment the stricture decreased to 50%. Accordingly to this re- children with a family predisposition to gastric pathology search we consider that the presence of H. pylori in the colonic mucosa is another important co-factor in the pathogenesis of IBS and T. V. Polivanova; V. A. Vshivkov it should be considered in the development of colonic carcinoma. Federal Research Center «Krasnoyarsk Science Center» of the Siberian A. Barrios: None. F.A. Barrios: None. A. Alvarez: None. E. Mendez: Branch of the Russian Academy of Sciences – Scientific Research None. Institute for Medical Problems of the North, Krasnoyarsk, Russian Federation

ELECTRONIC POSTER ROUND 8: Aim of the Research: To study the level of cytokines IL-2, IL-4, IL-6, PAEDIATRIC CONDITIONS IL-8, IL-18, IL-1β, FNO-α in the blood serum of H. pylori-associated gastritis in children with a family predisposition to gastric pathology. EP8.01 | The peculiarities of stomach mucosa in Helicobacter Material and Methods: 159 children with a morphologically con- pylori schoolchildren firmed diagnosis of gastritis at the age of 7-17 years were examined. The data on the presence of gastric diseases in relatives was T. V. Polivanova; V. A. Vshivkov obtained. The children underwent gastroscopy with a sampling of Federal Research Center «Krasnoyarsk Science Center» of the Siberian biopsies from the gastric mucosa. Gastritis was diagnosed in accord- Branch of the Russian Academy of Sciences – Scientific Research ance with the Sydney classification. Diagnostics of H. pylori in biopsy Institute for Medical Problems of the North, Krasnoyarsk, Russian sections was carried out after Giemsa staining. Serum cytokine con- Federation centrations determined by ELISA. Significance of feature differences was analyzed using the Mann-Whitney test. H. pylori plays an important role in the development of different Results: Studies of the cytokine profile in blood serum in school- forms of gastritis pathology: gastritis, ulcer disease, stomach mucosa children did not show significant differences depending on H. pylori metaplasia and stomach cancer. infection. However, in children with H. pylori, in case of a family his- Aim of the Research: To study the character of endoscopic and mor- tory of gastric pathology, there was an increase in IL-6 (P < 0.05), phological changes in H. pylori schoolchildren. whose functional duties in the body are the activation of the im- Materials and Methods: Our work shows the results of medical in- mune response in the acute phase of inflammation. This is an investigation for 338 schoolchildren of Siberia (Russia) with gastro- crease in IFN-α (P < 0.01) – a cytokine that functionally ensures the enterological complaints in the ages from 7 to 17 years. All of them launch of the body's immune responses to damage; and a decrease had been performed gastroscopy. For biopsy we used the samples in interleukin 8 (P < 0.05), which plays an important role in the innate from stomach antrum and body. Gastritis was evaluated using histol- immunity system. ogy indices in accordance with Sydney classification. The analysis of Conclusion: The peculiarities of the cytokine regulation of H. pylori- statistical meaning of the differences between qualitative signs was associated inflammatory process in the gastric mucosa in children 2 carried out by χ criterion. with a family predisposition to gastric pathology were obtained. Results: The prevalence of H. pylori in the examined schoolchildren T.V. Polivanova: None. V.A. Vshivkov: None. amounted 57.7%. Among them ulcer disease was diagnosed in 2.1%, 84 of 95 | ABSTRACTS

EP8.03 | Cytokeratins CK20, CK7 in assessing the severity of Material and Methods: A gastroscopy was performed with a biopsy lesions of the gastric mucosa in schoolchildren with Helicobacter taken from the gastric mucosa in 179 schoolchildren with gastroen- pylori-associated gastritis terological complaints. The age of the examined was 7-17 years. Data were obtained on the presence of digestive tract diseases in parents. T. V. Polivanova; V. A. Vshivkov H. pylori was determined by morphological method after staining Federal Research Center «Krasnoyarsk Science Center» of the Siberian biopsy sections according to Giemsa. Concentrations of cytokines Branch of the Russian Academy of Sciences – Scientific Research IL-2, IL-4 were determined in blood serum by ELISA. Significance of Institute for Medical Problems of the North, Krasnoyarsk, Russian feature differences was analyzed using the Mann-Whitney test. Federation Results: Among schoolchildren with erosive-ulcerative lesions associated with H. pylori, IL-4 was higher with a family burden in the Aim: To study the expression of CK20, CK7 proteins in the gastric pathology of the gastrointestinal tract (P = 0.006) and higher than mucosa in schoolchildren with H. pylori-associated gastritis. in schoolchildren without a destructive process (P = 0.008). In addi- Material and Methods: Eighty-nine children with gastroenterological tion, among children with an erosive-ulcerative process and with a complaints aged 7-17 years were examined. A gastroscopy was per- hereditary predisposition in the presence of H. pylori, IL-2 replication formed with a biopsy from the antrum and the body of the stomach. increased (P = 0.039); in children with H. pylori and with a hereditary Gastritis was diagnosed in accordance with the Sydney classifica- predisposition in the presence of an erosive-ulcerative process, IL-2 tion. H. pylori was determined by morphological method after stain- replication also increased (P = 0.038). ing biopsy sections according to Giemsa. The immunohistochemical Conclusion: In schoolchildren with an erosive-ulcerative process as- method was used to record the expression of cytokeratins (CK20, sociated with H. pylori and a hereditary predisposition to diseases of CK7) in the gastric mucosa. The analysis of statistical meaning of the digestive tract, there is an induction of IL-2, IL-4 replication at 2 qualitative characteristics was made by χ criterion under P < 0.05. the systemic level. Results: Expression of CK20 in the antrum mucosa was found in chil- V.A. Vshivkov: None. T.V. Polivanova: None. dren with H. pylori-associated gastritis in 19.6% and in 7.9% without H. pylori (P = 0.1423). The expression of CK7 in the antrum was detected in 43.1% and 34.2% of the examined, respectively (P = 0.3938). EP8.05 | Is CDX2 in children an immunohistochemical marker for In the gastric mucosa, expression of the CK20 protein was recorded the adverse course of gastritis? in 15.7% in schoolchildren with H. pylori and 2.6% in schoolchildren without bacteria (P = 0.0724); expression of CK7 protein was noted in T. V. Polivanova; V. A. Vshivkov 37.3% and 18.4% of cases, respectively (P = 0.0627). Federal Research Center «Krasnoyarsk Science Center» of the Siberian Conclusion: In children with H. pylori-associated gastritis, there is Branch of the Russian Academy of Sciences – Scientific Research a pronounced tendency to increase the expression of CK20, CK7 Institute for Medical Problems of the North, Krasnoyarsk, Russian in the stomach. This reflects an increase in proliferative processes Federation and, obviously, is associated with an increase in the progression of the pathological process in the stomach in children with H. pylori- Transcription intestinal differentiation factor (CDX2) in adults is associated gastritis. closely associated with atrophy and intestinal metaplasia of the gas- T.V. Polivanova: None. V.A. Vshivkov: None. tric mucosa. In this regard, protein is a marker of these processes. In children, the question has not been studied. Aim: To study the association of CDX2 with morphological changes EP8.04 | Levels of IL-2, IL-4 with erosive and ulcerative lesions in the gastric mucosa in children with gastritis. of the gastroduodenal zone associated with Helicobacter pylori in Material and Methods: A gastroscopy was performed with a biopsy schoolchildren with pathology of the digestive tract in parents from the antrum and the body of the stomach in 89 schoolchildren with gastroenterological complaints aged 7-17 years. Diagnosis of V. A. Vshivkov; T. V. Polivanova gastritis was carried out according to the modified Sydney classi- Federal Research Center «Krasnoyarsk Science Center» of the Siberian fication. H. pylori was determined in biopsy sections after Giemsa Branch of the Russian Academy of Sciences – Scientific Research staining. Immunohistochemical determination of CDX2 using CDX2 Institute for Medical Problems of the North, Krasnoyarsk, Russian antibodies (Clone: DAK-CDX2, 1:50), and EnVision Detection Federation Systems Peroxidase/DAB imaging system (Daco, Denmark). Results: CDX2 expression was observed in 4 (4.5%) examined chil- Cytokines are involved in the regulation of both immune responses dren. Cases of the appearance of the protein concerned only the and plastic processes in the organism. mucosa of the antrum. In the mucous membrane of the body of the Aim: To study the levels of IL-2, IL-4 with erosive and ulcerative le- stomach, CDX2 was not detected. In all children, gastritis was a mor- sions of the gastroduodenal zone associated with H. pylori in school- phological pathology. The relationship of protein expression with children with pathology of the digestive tract in parents. gastritis activity has not been established. The frequency of H. pylori ABSTRACTS | 85 of 95 in schoolchildren was 57.3%. Among children with CDX2 expression EP8.07 | Chronic Helicobacter pylori infection in Siberian in the antrum, H. pylori was detected in 100.0% (P = 0.0659). adolescents with gastroesophageal reflux disease (GERD) Conclusion: There is a pronounced trend in the effect of H. pylori on the expression of CDX2 in the gastric mucosa in childhood. There is S. Tereshchenko; M. Shubina; N. Gorbacheva a need for prospective studies of children with the expression of this Medical Research Institute for Northern Problems, Russian Academy of protein in the gastric mucosa. Medical Sciences, Krasnoyarsk, Russian Federation T.V. Polivanova: None. V.A. Vshivkov: None. Recently, much attention has been paid to the problem of the GERD and Helicobacter pylori (Hp) infection connection. Assumptions are EP8.06 | The relationship of blood leptin with Helicobacter pylori made about the protective role of this bacterium concerning the in children development of GERD in adult patients. However, in the children's population, such studies are not enough, and they have conflicting V. A. Vshivkov; T. V. Polivanova results. In this regard, we aimed to establish the frequency of Hp Federal Research Center «Krasnoyarsk Science Center» of the Siberian infection in Central Siberian children with GERD. Branch of the Russian Academy of Sciences – Scientific Research Methods: 553 adolescents aged 11-17, referred to a pediatric gas- Institute for Medical Problems of the North, Krasnoyarsk, Russian troenterology Centre (Krasnoyarsk, Siberia, Russia), were screened Federation by the Russian version of Gastroesophageal Reflux Disease Questionnaire (GerdQ). According to the sum of the scores for the The leptin mechanism is considered an important factor in the six GerdQ questions adolescents were split into three groups: (1) no progression of gastritis and the formation of carcinogenesis of the GERD (n = 414), (2) GERD with low impact (n = 98), and (3) GERD stomach. with high impact (n = 41). Hp presence in antral biopsy and anti-Hp- Aim of the Research: To assess the association of leptin circulating cagA antibodies in plasma were tested in 416 and 473 adolescents, in the blood with H. pylori infection in children of the Europoid and respectively. Chi-square test was used. Mongoloid populations. Results: Hp presence in antral biopsy progressively increased with Materials and Methods: Children: 24 Europoids and 60 Mongoloids GERD impact: no GERD group – 51.8 (46.2-57.3) %, GERD with aged 7-17 years with gastritis without obesity in the Central Asian low impact – 60.3 (49.1-70.4) %, and GERD with high impact – 70.6 region (South Siberia) were examined. A gastroscopy with a biopsy (53.7-83.1) %, p1-3 = 0.037. No connection was established between and blood sampling were performed. Diagnosis of gastritis was car- GERD and anti-Hp-cagA antibodies presence. ried out according to the Sydney classification. The presence of Conclusion: A direct connection between GERD presence/severity H. pylori was determined after Giemsa staining. Plasma leptin was and chronic Hp infection in Siberian adolescents was revealed. We determined by an enzyme immunoassay (Human Adiponectin ELISA suppose that Hp eradication may be helpful, especially in adoles- reagent kit, BioVendor). Inter-cohort comparison of the indices was cents with severe GERD according to GerdQ assessment. carried out using Mann-Whitney criterion under P < 0.05. S. Tereshchenko: None. M. Shubina: None. N. Gorbacheva: None. Results: Circulating leptin in the blood was 3.5 (0.1-16.4) ng/mL in children with H. pylori and 7.4 (0.9-30.2) ng/mL without H. pylori (P = 0.199). The lowest leptin values were found in infected EP8.08 | Efficacy of standard triple therapy in the eradication of Europoids – 3.0 (0.1-15.4) ng/mL, in uninfected Europoids amounted Helicobacter pylori in Siberian children: A single centre experience to 12.4 (0.1-32.2) ng/mL (P = 0.205). Among the Mongoloids, the lep- of treatment outcomes tin level in the infected was 7.7 (1.2-18.0) ng/mL, in the uninfected, it was 7.0 (2.7-19.0) ng/mL (P = 0.820). S. Tereshchenko1; E. Anisimova2; N. Gorbacheva1; M. Shubina1 Conclusion: In children of the Europoid and Mongoloid populations, 1Medical Research Institute for Northern Problems, Russian Academy of there is no association of circulating leptin in the blood with H. pylori. Medical Sciences, Krasnoyarsk, Russian Federation; 2Krasnoyarsk State V.A. Vshivkov: None. T.V. Polivanova: None. Medical University, Krasnoyarsk, Russian Federation

Standard triple therapy remains the recommended treatment regimen for Helicobacter pylori (Hp) eradication in children. Eradication success rate and efficacy vary depending on bacteria resistance rate. We aimed to study the efficacy of standard triple therapy in the Hp eradication in children from Central Siberia, in the region with high Hp chronic infection prevalence (50-70%, according to our previously reported study [1]). Methods: 31 children with recurrent abdominal pain complaints aged 9-17, referred to a pediatric gastroenterology centre (Krasnoyarsk, 86 of 95 | ABSTRACTS

Siberia, Russia) were tested for Hp presence by antral biopsy and Conclusion: Thus, Helicobacter pylori in schoolchildren is associated then prospectively retested by Hp antigen ELISA monoclonal test with a tendency to increase erosive-ulcerative lesions of the gas- in stool after triple therapy in 1.5-3 months. Twenty children were troduodenal zone. The effect of Helicobacter pylori on the formation diagnosed with erosion or peptic ulcer of the duodenal bulb by upper of GERD and on the association of erosive and ulcerative diseases endoscopic examination, and another 4 had erosion or peptic ulcer with GERD has not been established. of the stomach. Nine patients were diagnosed with GERD. Standard T.V. Polivanova: None. V.A. Vshivkov: None. triple therapy (IPP + amoxicillin + clarithromycin) was used. Results: Upon repeated testing, the HP antigen was detected in 3 children (9.7%). Thus, the level of successful eradication in our study EP8.10 | Application of liquid probiotic concentrate for was 90.3%. In 19 children recurrent abdominal pain stopped com- gastroduodenitis of Helicobacter etiology in children pletely, in 8 children a decrease in the frequency of pain was observed, and in 4 children the pain did not stop. E. Prakhin1; T. Ryabichenko2; G. Skosyreva2; O. Obukhova2; Conclusion: Thus, the success of HP eradication after triple therapy A. Kalmykova3 in Central Siberia children showed a sufficient level of achieved erad- 1Federal state budgetary scientific institution “Federal research center” ication (90.3%), which corresponds to the recommended standards. Krasnoyarsk scientific center of the Siberian branch of the Russian Reference: 1. Tereshchenko S. et al. Helicobacter. 2018. Vol. 23 Academy of Sciences (FGBNU FRC KNC SB RAS, KNC SB RAS) Research (Suppl. 1). P. 23. Institute of medical problems of the North, Krasnoyarsk, Russian S. Tereshchenko: None. E. Anisimova: None. M. Shubina: None. N. Federation; 2FGBNU Federal research center for fundamental and Gorbacheva: None. translational medicine, Research Institute of expe, Novosibirsk, Russian Federation; 3FGBOU VO “Novosibirsk state agrarian University”, Novosibirsk, Russian Federation EP8.09 | Effect of Helicobacter pylori on the formation of erosive-ulcerative lesions of the gastroduodenal zone, GERD and The aim was to study the effectiveness of “Biovestin-lacto” in the their associative relationship complex treatment of Helicobacter pylori-associated gastroduodenitis in children. The drug is made from skimmed milk fermented with T. V. Polivanova; V. A. Vshivkov pure cultures of bifidobacteria of two strains B. adolescentis MC-42, Federal Research Center «Krasnoyarsk Science Center» of the Siberian B. bifidum 791 with the addition of lactobacilli of the pharmaceutical Branch of the Russian Academy of Sciences – Scientific Research strain L. Plantarum 8RAZ and its metabolism products. The advan- Institute for Medical Problems of the North, Krasnoyarsk, Russian tage of the drug used is a high concentration of Bifidobacterium ado- Federation lescentis (109 CFU/mL), Lactobacillus plantarum (108 CFU/mL). For this purpose, 60 children aged 9-12 years were examined with a veri- The role of Helicobacter pylori in the formation of erosive and ulcera- fied diagnosis of gastroduodenitis associated with Helicobacter pylori tive diseases of the gastroduodenal zone in adults is proved. The using clinical, morphological and paraclinical diagnostic methods. association of infection with GERD is a moot point. Based on random samples, two groups were formed: first received Aim: To study the effect of Helicobacter pylori on the formation of standard eradication therapy, and the second additionally received erosive-ulcerative lesions of the gastroduodenal zone, GERD and “Biovestin-Lacto”. Control of eradication was performed 6-8 weeks their association in children. after the therapy. The use of “Biovestin-lacto” contributed to a sig- Material and Methods: Four hundred and forty-five schoolchildren nificant improvement in the effect of eradication therapy (100% with gastroenterological complaints aged 7-17 years were examined. eradication in group 2), while in the control group 1 of children Everyone underwent gastroscopy with a sampling of biopsies from after treatment, infection with Helicobacter pylori was detected in the antrum and body of the stomach. Diagnosis of Helicobacter py- 14.3%. The association with the confidence (P < 0.02) of the effect lori was carried out by morphological method after Giemsa staining. of probiotic in treatment on the severity of chronic gastroduode- GERD was diagnosed according to the Montreal Consensus. nitis (activity, intestinal metaplasia, insemination) was revealed. Results: The frequency of Helicobacter pylori in the examined children Scientific assumptions: the liquid form containing both lacto – and was 56.9%. Erosive-ulcerative lesions of the gastroduodenal zone in bifidobacteria contributes to the maximum effect of restoring the schoolchildren with Helicobacter pylori were diagnosed in 21.7% of microbiocenosis of the stomach and intestines by directly acting on cases, without infection in 14.6% (P = 0.055). 22.1% of children with the infectious agent (by reducing the inflammatory process and mu- infection and 19.3% without infection had clinical manifestations of cosal regeneration) and reducing the adhesion of Helicobacter pylori GERD (P = 0.462). Moreover, in the group of schoolchildren infected to the gastric mucosa. with Helicobacter pylori, the association of erosive-ulcerative lesions O. Obukhova: None. E. Prakhin: None. T. Ryabichenko: None. G. of the gastroduodenal zone with GERD was noted in 27.3%; in the Skosyreva: None. A. Kalmykova: None. group of schoolchildren without Helicobacter pylori in 32.1% of cases (P = 0.644). ABSTRACTS | 87 of 95

EP8.11 | H. pylori infection in symptomatic Mexican children ELECTRONIC POSTER ROUND 9: UPPER GI MICROBIOTA IN HEALTH AND DISEASE O. Y. Celestino-Perez; C. González-Romo; G. Osorno-Díaz; A. Velasco-Arellano; A. V. Lara-Ibarra; J. M. Cázares-Mendez; J. F. EP9.01 | Treatment of non-erosive reflux disease and change of Cadena-León; F. E. Zárate-Mondragon; E. Toro Monjaraz; K. R. esophageal microbiome: A prospective multicenter study Ignorosa-Arellano; R. Cervantes Bustamante; J. A. Ramírez-Mayans; E. Montijo-Barrios C. Park1; S. Seo2; J. Kim3; S. Kang4; B. Kim5; Y. Choi6; S. Lee6 Instituto Nacional de Pediatría, Mexico City, Mexico 1Hanyang University Guri Hospital, Hanyang University College of Medicine, Seoul, Republic of Korea; 2Kangdong Sacred Heart Background: The approach of Helicobacter pylori infection must be Hospital, Hallym University College of Medicine, Seoul, Republic of individualized because the association with symptoms is still contro- Korea; 3Incheon St Mary's Hospital, the Catholic University of Korea, versial. Its prevalence, clinical presentation and endoscopic findings Incheon, Republic of Korea; 4Chungnam National University School of in Mexican children are not well known. Medicine, Daejoon, Republic of Korea; 5Chung-Ang University College Objective: To determine the main gastrointestinal symptoms and of Medicine, Seoul, Republic of Korea; 6Yonsei University College of endoscopic findings in children with H. pylori infection, and to find a Medicine Severance Hospital, Seoul, Republic of Korea correlation between them. Methods: A retrospective cross-sectional study over 2 years was Introduction: The pathogenesis of non-erosive reflux disease (NERD) carried out. We included 174 children from a third level hospital has not been fully evaluated. We aimed to evaluate the treatment from Mexico, who underwent endoscopy, histology study, PCR, response of proton pump inhibitors (PPI) in patients with NERD and and culture. H. pylori infection was proven according to ESPGHAN/ changes in microbial composition and biologic marker expression on NASPGHAN consensus. esophageal mucosa after PPI therapy. Results: A H. pylori prevalence of 27.5% was found in the studied Methods: Patients was diagnosed with NERD were enrolled and re- population. There is not a statistically significant association be- ceived 20 mg of esomeprazole for 8 weeks. The treatment response tween H. pylori infection and symptoms. Among the most frequent was evaluated using the patient assessment of upper gastrointesti- endoscopic findings is antral nodularity (62.5%) which is statistically nal symptom severity index questionnaire at baseline, week 4, and associated with infection (P = 0.000), this finding has a sensitivity of week 8. Esophageal mucosal markers and oropharyngeal and es- 62.5% (CI 45.76-77.24%), specificity 70.6% (CI 62-29-78.98%), PPV ophageal microbiomes were analyzed in patients who had required 44.78% (CI 32.12-57.43%) and NPV 83.18% (CI 75.62-90.73%). upper gastrointestinal endoscopy for screening. Conclusions: The symptoms should not guide the diagnostic ap- Results: In 62 enrolled patients, complete and partial response rates proach. The presence of antral nodularity is a good predictor of H. at week 8 were 60.0% and 32.7%, respectively, for heartburn, and pylori infection, being an indicator of broadening the approach with 61.8% and 29.1%, respectively, for regurgitation. After 8 weeks of other invasive tests. PPI therapy, the expression level decreased in several inflamma- O.Y. Celestino-Perez: None. C. González-Romo: None. G. Osorno- tory cytokines, including IL-6, IL-8, and NF-κB. In the microbiome Díaz: None. A. Velasco-Arellano: None. A.V. Lara-Ibarra: None. analysis, Streptococcus, Haemophilus, Prevotella, Veillonella, Neisseria, J.M. Cázares-Mendez: None. J.F. Cadena-León: None. F.E. Zárate- and Granulicatella were prevalent regardless of timing (baseline vs Mondragon: None. E. Toro Monjaraz: None. K.R. Ignorosa-Arellano: week 8) and organs (oropharynx vs esophagus). However, the over- None. R. Cervantes Bustamante: None. J.A. Ramírez-Mayans: None. all composition of the oropharyngeal microbiome was distinguished E. Montijo-Barrios: None. from that of the esophageal microbiome (P = 0.004). After the PPI therapy, this difference was not identified. Conclusions: Half-dose of PPI for 8 weeks was effective for symptom control in NERD. It reduced the expression of several inflammatory cytokines in the esophagus. There was a significant difference in the microbial composition between oropharynx and esophagus in patients with NERD; however, it disappeared after PPI therapy. C. Park: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Significant; Hanmi Pharmaceutical. S. Seo: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Significant; Hanmi Pharmaceutical. J. Kim: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Significant; Hanmi Pharmaceutical. S. Kang: B. Research Grant (principal investigator, collaborator or consultant and pending grants as 88 of 95 | ABSTRACTS well as grants already received); Significant; Hanmi Pharmaceutical. ELECTRONIC POSTER ROUND 10: GUT B. Kim: B. Research Grant (principal investigator, collaborator or MICROBIOTA AND NON-INTESTINAL consultant and pending grants as well as grants already received); DISEASE Significant; Hanmi Pharmaceutical. Y. Choi: B. Research Grant (principal investigator, collaborator or consultant and pending grants as EP10.01 | Effect of fecal microbiota transplantation on clearance well as grants already received); Significant; Hanmi Pharmaceutical. of carbapenem-resistant enterobacteriaceae S. Lee: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Y. Shin; J. Lee; H. Kim Significant; Hanmi Pharmaceutical. Inha university hospital, Incheon, Republic of Korea

Background and Aim: Carbapenemas-resistant Enterobacteriaceae EP9.03 | Helicobacter pylori and the possible probiotic (CRE) carriage could be the fatal pathogen as hospital infection. Lactobacillus salivarius co-exist in Estonian gastric biopsy sample Fecal microbiota transplantation (FMT) has been reported to be a possible option for decolonization. This study aimed to whether K. Roots1; L. Kasak1; K. Suurmaa2; I. Sarand3; P. Spuul1 FMT is effective to eradicate intestinal colonization of CRE. 1Division of Gene Technology, Department of Chemistry and Methods: Retrospective review was performed 337 patients with Biotechnology, Tallinn University of Technology, Tallinn, Estonia; CRE digestive tract colonization from August 2018 to July 2019. 2Department of Endoscopy, West Tallinn Central Hospital, Tallinn, Among them, 9 patients were received FMT for clearance of CRE Estonia; 3Division of Food Technology, Department of Chemistry and or Clostridium difficile infection, and 29 patients were selected as Biotechnology, Tallinn University of Technology, Tallinn, Estonia control groups, that were confirmed two consecutive CRE colonization and followed for more than 1 month. Successful decolonization Helicobacter pylori (H. pylori) is a gastric pathogen inducing the de- was determined by at least three consecutive negative rectal swabs velopment of chronic gastritis, peptic ulcers, and gastric cancer. [culture] within 1 month. Several studies have proved the probiotic effects of Lactobacillus Results: Median follow-up days after CRE colonization was 50.5 days species against H. pylori and their positive contribution in H. pylori (interquartile range [IQR] 36-95 days). In FMT group, median dura- eradication. Little is known about gastric microbiota habitants. Here, tion of carriage of CRE before FMT was 26 days. (IQR 10-67 days) we report a case of H. pylori and Lactobacillus salivarius (L. salivarius) A total of 14 patients (35.8%) presented free of CRE colonization co-existence in a Caucasian female patient. Gastric biopsy sample within 1 month; 5 patients (55.6%) at FMT group and 9 patients was homogenised in Brucella broth and plated on Columbia Blood (31.0%) at control group (P = 0.183). One week after FMT, 5 of 9 Agar supplemented with Vancomycin, Trimethoprim, Cefsulodin, patients were free of CRE colonization. Only 1 patient received FMT and Amphotericin B. Culture presented as a mixture of small translu- showed CRE recolonization at 28 follow-up days. Compare to CRE cent colonies and slightly bigger greyish-white colonies. Only bigger conversion rate within 1 week, FMT group was significantly higher colonies were possible to cultivate further. Colony PCR with CagA than control groups (44.4 vs 6.9%, P = 0.02). and VacA specific primers proved the presence of H. pylori, whereas Conclusion: FMT could be effective for CRE decolonization in in- MALDI-TOF-MS colony identification and later 16S rDNA sequenc- testinal tract. These data should be confirmed by larger cohorts and ing resulted as L. salivarius. The genotype of H. pylori was verified with randomized trials. PCR from DNA extracted from co-culture and was CagA-positive Y. Shin: None. J. Lee: None. H. Kim: None. with EPIYA-A, EPIYA-BT, and EPIYA-C motifs, VacA-positive with s1/ m2 alleles and UreB-positive. Whole genome sequencing (WGS) of the sample showed that the 2.05 Mb L. salivarius genome consists of EP10.02 | Gut microbiota depending on the atopic dermatitis one chromosome, one megaplasmid and four smaller plasmids. Only severity in children in Eastern Siberia 0.1% of WGS reads matched with H. pylori genome. Further research needs to be done to verify whether the results show a co-culture of A. A. Barilo; S. V. Smirnova; I. V. Borisova; A. A. Feizer H. pylori and L. salivarius or extensive genetic transfer between the Scientific Research Institute of Medical Problems of the North – a two bacteria. separate division of the Federal, Krasnoyarsk, Russian Federation K. Roots: None. L. Kasak: None. K. Suurmaa: None. I. Sarand: None. P. Spuul: None. Background: In recent years there is increasing interest in the relationship of the microbiota with atopic dermatitis (AD). Aim: To study the intestinal microbiota depending on the atopic dermatitis severity in children in Eastern Siberia. Material and Methods: The study group comprised 32 children with atopic dermatitis aged from 4 months to 18 years from Krasnoyarsk Territory (East Siberia of Russia). In our study 50.0% (16) children ABSTRACTS | 89 of 95 were female. AD severity were determined using the AD scoring sys- lowers serum ammonia by eradicating urease-producing bacteria. A tem SCORAD. We formed 2 groups depending on the disease sever- watercress extract to inhibit urease in the gut offers several poten- ity: 1 group (n = 21, mean age 3.0 ± 1.1 years) – children with AD mild tial therapeutic targets. and moderate severity (SCORAD ≤40), 2 group (n = 11, mean age K. Stewart: C. Other Research Support (supplies, equipment, receipt 8.0 ± 0.9 years) – children with AD severe severity (SCORAD > 40) of drugs or other in-kind support); Modest; the watercress company. The gut microbiota distribution was performed by bacteriological E. Ownership Interest (stock, stock options, patent or other intel- culture-based methods. lectual property); Significant; watercress research ltd. P. winyard: Results: In our study the amount of E. coli with reduced enzymatic C. Other Research Support (supplies, equipment, receipt of drugs properties more than 50% of the total number of E. coli was elevated or other in-kind support); Modest; the watercress company. E. in 2 group compared to 1 group: 18.1% (n = 2) and 0% infants, P = 0.04. Ownership Interest (stock, stock options, patent or other intellectual Carriage of Staphylococcus aureus was more often in 1 group com- property); Significant; watercress research ltd. pared to 2 group: 100% (n = 21) and 81.8% (n = 9), P = 0.04. However, the counts of Staphylococcus aureus >105 was more often in 2 group compared to 1 group: 27.2%(n = 3) and 4.7%(n = 1), P = 0.04. Carriage ELECTRONIC POSTER ROUND 11: of Candida albicans was more often in 2 group compared to 1 group: MICROBIOTA AND INTESTINAL DISEASE 63.6%(n = 7) and 28.5% (n = 6), P = 0.05. Conclusions: Thus, we identified features of AD severe severity: el- EP11.01 | Trimebutine maleate as a multidimensional- evated level of E. coli with reduced enzymatic properties, сarriage of antibacterial agent against functional dyspepsia: A prospective Candida albicans and Staphylococcus aureus >105. multicenter randomized, double-blind controlled trial A.A. Barilo: None. S.V. Smirnova: None. I.V. Borisova: None. A.A. Feizer: None. J. Kountouras1; E. Gavalas1; A. Papaefthymiou2; I. Tsechelidis1; S. Polyzos3; S. Bor4; M. Diculescu5; A. Bochenek6; K. Jadallah7; J. Rozciecha8; T. Karakan9; P. Dabrowski10; M. Tadeusz11; Z. EP10.03 | Watercress and the gut Spirchez12; O. Sezgin13; M. Gülten14; N. Farsakh7; M. Doulberis15 1Department of Medicine, Second Medical Clinic, Aristotle University of K. Stewart; P. Winyard Thessaloniki, Ippokration Hospital, Thessaloniki, Greece; 2Department Watercress Research Ltd, Newton Abbot, Devon, United Kingdom of Gastroenterology, 401 Army General Hospital of Athens, Athens, Greece; 3First Department of Pharmacology, Faculty of Medicine, We are investigating the urease inhibiting potential of Watercress Aristotle University of Thessaloniki, Thessaloniki, Greece; 4Division (Nasturtium Officinale) extracts. Bacterial urease converts urea of Gastroenterology, Ege University School of Medicine, Ismir, Turkey; to ammonia, and its extracellular presence on H pylori is a survival 5Gastroenterology and Hepatology Department, Clinic Fundeni adaptation to the stomach's acidic environment. We have demon- Institute, Bucharest, Romania; 6Centrum Badawcze Wspolczesnej strated multiple classes of urease inhibitors in watercress which Terapii, Warszawa, Poland; 7Department of Internal Medicine, King may offer an adjunctive/alternative treatment of this colonisation. Abdullah University Hospital, Irbid, Jordan; 8LexMedica, Rudolfa Phenethyl isothiocyanate is a known urease inhibitor and gives wa- Weigla 12, Krzyki, Wrocław, Poland; 9Department of Gastroenterology, tercress its peppery taste. We are developing processing methods to Gazi University School of Medicine, Ankara, Turkey; 10Department of maximise production of Phenethyl isothiocyanate, and other urease Rheumatology of Clinical Hospital 2, University of Rzeszow, Lwowska inhibitors. We aim to investigate the effects of a watercress-derived 60, Rzeszow, Poland; 11Medicor Centrum, Rzeszów, Poland; 123rd urease inhibiting extract on the gut microbiome in sarcopenic pa- Medical Clinic, University of Medicine and Pharmacy, Cluj-Napoca, tients. Commonplace in agriculture is the use of synthetic urease Romania; 13Mersin University, Faculty of Medicine, Department of inhibitors to increase the yield of animals. Unfortunately, synthetic Gastroenterology, Mersin, Turkey; 14Department of Gastroenterology, urease inhibitors have a challenging side effect profile and their UK Uludag University, Bursa, Turkey; 15Department of Gastroenterology & clinical use is limited. However, a plant-based extract which offers Hepatology, University of Zurich, Zurich, Switzerland multiple urease inhibitors working synergistically may overcome this problem. The aim is to promote the cycling of urea into amino acids Introduction: Functional dyspepsia (FD) consists a multi-factorial within the gut, thereby decreasing ammonia production. Improving disorder associated with inflammatory and neuro-motility gastroin- gut efficiency in this way may be beneficial in sarcopenia, and in testinal (GI) dysregulation also related with GI dysbiosis. This mul- sports performance/recovery. Hepatic encephalopathy (HE) through ticenter randomized double-blind study evaluated the efficacy and raised serum ammonia in liver cirrhosis is another therapeutic target. safety of trimebutine maleate (TM) in FD, following its suggested Current therapies include lactulose which increases gut transit and antibacterial role on microbiota. reduces fermentation to lower ammonia production while promoting Methods: 211 patients with FD diagnosed by Rome III criteria were proliferation of non-urease-producing bacteria such as Lactobacillus. randomized to receive TM 300 mg BID (108 patients) or placebo Similarly, the antibiotic Rifaximin (another recognised HE treatment), (103 patients) for 4 weeks. The symptoms’ relief was evaluated by 90 of 95 | ABSTRACTS two clinical scales and gastric emptying (GE), as an objective index, increase level of Bifidobacterium spp. – in 47%, changing of the was measured by the 99mTc-Meal Scintigraphy test (8 TM and 8 pla- ratio of Bacteroides spp./Faecalibacterium prausnitzii towards in- cebo participants in one center). All adverse events were recorded crease of Bacteroides – in 24%, frequency of occurrence of C. dif- during this period. ficile was 24%, frequency of occurrence of Candida spp. – 35%. In a Results: 185 (52.4% in the TM and 47.6% in the placebo arm) were number of patients, increased growth of opportunistic bacteria was analyzed. Although, both treatment arms showed a significant im- detected: Proteus vulgaris/mirabilis – 24%, Citrobacter spp. – 29%, provement in symptom relief (TM P-value: 0.015/placebo P-value: Enterobacter spp. – 12%. Fusobacterium nucleatum was identified in 0.041), TM effect during the second study period (last 2 weeks) was 18%, Parvimonas micra – in 24%. significantly better (P = 0.02). Likewise, the proportions of complete Conclusion: Patients with IBD show a downward trend in symptom relief and marked improvement were greater in the TM Lactobacillus spp. and increasing Bifidobacterium spp., whereby arm, though not significantly. Both groups showed similar effects in lacto-containing probiotics may be recommended for such patients. quality of life (P = 0.598). Regarding GE test, TM accelerated gas- There is also a relatively high incidence of F. nucleatum and P. micra tric emptying at 50 minutes (median emptying 75.5% TM vs 66.6% (indirect microbial markers of colon oncopathology), which dictates placebo, P = 0.036) and shortened the lag period though not signifi- the need for dispensary surveillance of these patients not only for cantly. Finally, safety evaluation showed similar percentages of mild the purpose of controlling the onset and maintenance of remission, adverse events. but also for the purpose of early detection of colorectal cancer. Conclusion: TM appears to be effective and safe in treating FD. The N.V. Baryshnikova: None. Y.P. Uspenskiy: None. M.A. Suvorova: potential mechanisms include the suggested motor effect in upper None. V.I. Lyudyno: None. A.N. Suvorov: None. M.A. Dmitrienko: and lower GI tract and its bacteriostatic/bactericidal activity. None. E.I. Ermolenko: None. J. Kountouras: B. Research Grant (principal investigator, collaborator or consultant and pending grants as well as grants already received); Modest; This work has been financially supported by EP11.03 | Comparison of glucose and lactulose breath test Galenica A.E. Pharmaceutical Company, Greece. E. Gavalas: None. results for detecting small intestinal bacterial overgrowth A. Papaefthymiou: None. I. Tsechelidis: None. S. Polyzos: None. S. Bor: None. M. Diculescu: None. A. Bochenek: None. K. Jadallah: A. Denina1; R. Erts1; I. Sitikova2; I. Polaka1; M. Leja1 None. J. Rozciecha: None. T. Karakan: None. P. Dabrowski: None. 1University of Latvia, Riga, Latvia; 2Digestive Disease Centre GASTRO, M. Tadeusz: None. Z. Spirchez: None. O. Sezgin: None. M. Gülten: Riga, Latvia None. N. Farsakh: None. M. Doulberis: None. Background: Lactulose and glucose breath tests are accepted in clinical practice for SIBO (Small intestinal bacterial overgrowth) de- EP11.02 | Gut microbiota disorders in patients with tection. North American and Italian guidelines are used for result inflammatory bowel diseases interpretation. Aim: To compare the results of lactulose and glucose breath tests in N. V. Baryshnikova1,2; Y. P. Uspenskiy1,3; M. A. Suvorova2; V. I. SIBO detection, and to correlate test positivity to clinical symptoms. Lyudyno2; A. N. Suvorov2; M. A. Dmitrienko4; E. I. Ermolenko2 Materials and Methods: This was a retrospective analysis of pa- 1Pavlov First St-Petersburg State Medical University, St-Petersburg, tients with abdominal symptoms having undergone diagnostics in Russian Federation; 2Institute of Experimental medicine, St-Petersburg, Digestive Disease Centre GASTRO (2015-2019). Every patient un- Russian Federation; 3Pediatric State St-Petersburg Medical University, derwent lactulose and glucose test. Breath samples were analysed St-Petersburg, Russian Federation; 4Association of Medicine and with the Quintron BreathTracker SC analyser by determining breath Analytic, St-Petersburg, Russian Federation hydrogen and methane concentrations and with the application of

CO2 correction factor. The criteria set by the North American guide- Background: Microbiota disorders is an important factor in the lines for SIBO were applied. Symptoms were recorded during the pathogenesis of digestive diseases, including inflammatory bowel breath testing period. diseases (IBD). Results: The study cohort consisted of 60 patients (50% males; me- The Aim: To assess the gut microbiota disorders in patients with IBD. dian age 42 years). Median interval between the tests was 7 days. Materials and Methods: We investigated fecal samples to determine 41.7% and 13.3% were diagnosed SIBO with lactulose and glucose features of gut microbiota in 17 patients with IBD. We used real-time test, respectively. 6.7% tested positive with both breath tests. polymerase chain reaction with fluorescent detection for fecal ex- Elevated baseline hydrogen concentrations (≥16 ppm) were present amination. Statistical processing was performed using the SPSS8.0 in 22 patients (11 patients for each test), however this elevation was software package. maintained in 10 patients undergoing lactulose, and 3 – undergo- Results: 100% of patients showed changes in gut microbiota. The ing glucose test. Methane-producers accounted for 16.7%. 20% and most frequent and significant changes were next: decrease level 28.3% reported symptoms during lactulose test and glucose test, of Lactobacillus spp. was determined in 59% of those examined, ABSTRACTS | 91 of 95 respectively. Bloating was the most common symptom reported. No EP11.05 | Fecal microbiota transplantation as treatment correlation was found between bloating and the test positivity. for recurrent Clostridiodes difficile infection in patients with Conclusions: Differences exist between the glucose and the lactu- inflammatory Bowel disease: Experiences of the Netherlands lose breath test results. donor feces bank A. Denina: None. R. Erts: None. I. Sitikova: None. I. Polaka: None. M. Leja: None. E. van Lingen; A. E. van derMeulen – de Jong; K. E. W. Vendrik; E. J. Kuijper; E. M. Terveer; J. J. Keller Leiden University Medical Center, Leiden, Netherlands EP11.04 | The prevalence of Helicobacter pylori and protozoan invasions and the impact on the performance of enzymatic Background: In patients with inflammatory Bowel disease (IBD) the digestion prevalence of co-infection with Clostridiodes difficile infection (CDI) is higher than in the general population due to the use of immuno- G. S. Isaeva1; E. V. Agafonova1; R. A. Isaeva2 suppressive medication and dysbiosis of the bacteria in the colon. 1Kazan State Medical University, Kazan Research Institute of Here we report the treatment course and efficacy of FMT provided Epidemiology and Microbiology, Kazan, Russian Federation; 2Sechenov by the Netherlands Donor Feces Bank (NDFB) for IBD patients with First Moscow State Medical University, Moscow, Russian Federation rCDI. Methods: The NDFB was founded to facilitate FMT by providing The aim is to study the prevalence of H. pylori and protozoal infes- ready to use donor feces suspensions for treatment of patients tations in chronic gastroduodenal diseases (CGDD). Materials and with rCDI in hospitals throughout The Netherlands. Prior to FMT, methods. We examined 244 patients (130 adults and 114 children) all patients were pretreated with vancomycin 250 mg for 4 days and with clinical manifestations with abdominal pain and dyspeptic syn- bowel lavage. In patients with ulcerative colitis as comorbidity, pred- dromes. All patients were examined by immunochromatographic nisone was added when there was a IBD flare simultaneous. test for the qualitative detection of H. pylori in the feces, coprologi- Results: In total, 129 patients (of which 14 suffered from IBD) were cal and protozoological methods. Results. In the group of patients treated with 143 FMTs for CDI with a cure rate of 89.9% after a sin- with CGDD the H. pylori antigen in the feces was detected in 116 gle FMT (116/129). Fourteen IBD patients were treated with FMT (9 (47.5%) patients. During protozoooscopic examination of feces, the ulcerative colitis, 2 Crohn's disease and 2 indeterminate colitis). 3/14 detection rate of Lamblia intestinalis was 22.9%, in Blastocystis spp. patients suffered from rCDI with an active episode of IBD. Of the 14 – 13.1%, Entamoeba coli 10.2%, Entamoeba spp. 9.4%. Protozoan IBD patients treated with FMT, only one patient developed a relapse invasion was detected in the groups of H. pylori+ and H. pylori− pa- of a CDI infection within 2 months (total cure rate 92%). This cure tients: infection of Lamblia intestinalis was diagnosed in 27.6% and rate does not differ from CDI patients without IBD. 18.8% of cases respectively (P < 0.05), in Blastocystis – in 16.4% Conclusion: In IBD patients with rCDI, FMT is equally effective com- and 10.2% cases (P < 0.05). Mixed infection with H. pylori and pared to other patients with rCDI. In case of concurrent activity of pathogenic protozoa, along with increased manifestations of gas- IBD, pretreatment with prednisolone in combination with vancomy- trogenic, ileocecal, enteral and acholian syndrome, signs of pancrea- cin appears to be effective. togenic and distal-colitic syndromes were detected. Monoinfection E. van Lingen: None. A.E. van der Meulen – de Jong: None. K.E.W. Lamblia intestinalis, signs of enteral, ileocecal, and acholia with Vendrik: None. E.J. Kuijper: None. E.M. Terveer: None. J.J. Keller: signs of ileocecal syndromes were detected, and when monoinfec- None. tion Blastocystis spp. signs of enteral and ileocecal syndromes were revealed. Conclusions. It is shown that intestinal protozoan and bacterial-protozoan mixed infection (H. pylori +L. intestinalis; H. pylori EP11.06 | A considerable rate of COVID-19 GI symptoms is + Blastocystis spp.) can have a negative effect on enzyme digestion associated with antimicrobial therapy: Findings from a large and are important etiopathogenetic factors of diseases of the upper western prospective cohort gastrointestinal tract. G.S. Isaeva: None. E.V. Agafonova: None. R.A. Isaeva: None. G. Ianiro; S. Porcari; C. Settanni; S. Bibbò; F. Ponziani; L. Zileri Dal Verme; F. Franceschi; G. Cammarota; A. Gasbarrini; Gemelli against COVID-19 Digestive Disease Center, Fondazione Policlinico Universitario “A. Gemelli” IRCCS, Università Cattolica del Sacro Cuore, Rome, Italy

Background: Gastrointestinal symptoms are commonly described in patients with COVID-19, but most reports are retrospective and come from Eastern countries. 92 of 95 | ABSTRACTS

Objective: Our aim was to evaluate prospectively gastrointestinal primary low-grade, MALT-lymphoma of the stomach associated with symptoms in Western patients with COVID-19. H. pylori infection were considerated. Methods: We assessed gastrointestinal symptoms in all inpa- Results: Among the 63 patients with stage IE low grade gastric tients with COVID-19 at our hospital, through the Gastrointestinal MALT lymphoma, 37 were excluded, ongoing follow-up (7), follow- Symptoms Rating Scale (GSRS), both at admission and after the start up loss (7), transfer-out (4), surgery for gastric outlet obstruction of therapy. Univariate and multivariate analysis for critical clinical (1), Diffused large B-cell lymphoma with feature of MALT (DLBCL- picture and death were obtained. MALT) (4) and H. pylori negative gastric MALT-lymphoma (14). In 18 Results: Of 420 enrolled patients, 247 patients (59%) reported at out of patients lymphoma remission occurred at follow-up without least one gastrointestinal symptom, of which the most common any further therapy following H. pylori eradication. Only one patient were diarrhoea (37%), nausea (19%), urgency (17%), loose stools who had achieved remission after H. pylori eradication had recur- (16%) and Upper gastrointestinal pain (14%). One-hundred-and- rence. The remaining all 7 patients treated with radiotherapy alone seventeen patients (47%) were symptomatic at admission, while due to lymphoma persistence after successful eradication achieved 130 patients (53%) developed symptoms only after the start of complete remission. Median age was 55 years (range, 31-67). Median COVID-19 therapy. Upper gastrointestinal symptoms, including total radiation dose was 30.6 Gy (range, 30.0-30.6 Gy) delivered in heartburn (15/117 vs 4/130, P = 0.007), acid reflux (15/117 vs 6/130, 1.7-Gy fractions within 4 weeks to the stomach. P = 0.02), hunger pains (10/117 vs 1/130, P = 0.003), nausea (43/117 Conclusion: Radiotherapy is effective in achieving complete re- vs 35/130, P = 0.04), and rumbling (11/117 vs 3/130, P = 0.02), were mission in low grade MALT lymphoma unresponsive to H. pylori more frequent at admission, while diarrhoea appeared more com- eradication. monly after antimicrobial therapy (57/117 vs 98/130, P < 0.0001). S. Suk: None. S. Park: None. D. Cheung: None. J. Kim: None. Gastrointestinal symptoms (OR 2.35, P = 0.04) independently predicted critical clinical picture. Conclusion: In our cohort the majority of patients with COVID-19 ELECTRONIC POSTER ROUND 13: GUT presented with gastrointestinal symptoms, which had two separate MICROBIOTA MANIPULATION patterns according to the timing of their appearance (at admission vs after antimicrobial therapy) and predicted a worse clinical picture. EP13.01 | Initial experience of the first Brazilian stool bank with Our results may be useful to disentangle characteristics and rele- fecal microbiota transplantation for recurrent Clostridioides difficile vance of the gastrointestinal involvement in patients with COVID-19. infection G. Ianiro: None. S. Porcari: None. C. Settanni: None. S. Bibbò: None. F. Ponziani: None. L. Zileri Dal Verme: None. F. Franceschi: None. G. D. A. A. Terra; L. V. Coelho; E. G. Vilela; R. O. Silva; K. S. Lima; L. A. Cammarota: None. A. Gasbarrini: None. Leão; R. I. F. A. Passos UFMG, Belo Horizonte, Brazil

ELECTRONIC POSTER ROUND 12: Background: Clostridioides difficile infection (CDI) is the major cause MICROBIOTA AND CANCER of nosocomial diarrhea related to use of antibiotics in Brazil. The treatment of recurrent CDI is a challenge in countries where fecal EP12.01 | The clinical outcomes of treatment for low microbiota transplantation (FMT) is not widely available. In addition, grade gastric mucosa associated lymphoid tissue lymphoma data on effectiveness and safety of TMF in emerging countries are unresponsive to Helicobacter pylori eradication scarce. The main objective of this study is to evaluate the efficacy of FMT in treatment of recurrent CDI in a Brazilian university center. S. Suk; S. Park; D. Cheung; J. Kim Methods: In a prospective pilot study, FMT was performed using Yeouido St. Mary's Hospital, The Catholic University of Korea, Seoul, frozen samples from our stool bank. Donors were screened accord- Republic of Korea ing to international guidelines and national regulatory aspects. FMT success was defined as cessation of diarrhea within 8 weeks. Background and Aim: The most appropriate management strategy Results: Over 2 years, ten patients with recurrent CDI underwent for gastric mucosa associated lymphoid Tissue (MALT) lymphoma FMT by colonoscopy. Median age was 68 years (IQR: 34-76), and not responding to H. pylori eradication is unclear. We evaluated the 63.6% were women. Majority had severe CDI (54.5%) and a me- efficacy of treatment for low grade gastric MALT lymphoma unre- dian of three previous episodes (IQR: 2-3). Overall success was sponsive to H. pylori treatment. 90%. Failure occurred in two procedures and were not related to Methods: The electronic medical record database was reviewed at severity of CDI (P = 0.273), bowel preparation (P = 0.345), comor- a university hospital (Yeouido St. Mary's Hospital), Seoul, Korea. bidities (P = 0.809), number of previous episodes (P = 0.457), or do- A total of 63 patients were found to be diagnosed during the last nors (P = 0.164). No serious adverse events were described during 5 years, from Jan 2015 to Mar 2020. Our study concerning on an average follow-up of 408.6 ± 284.8 days. Mild adverse events ABSTRACTS | 93 of 95 occurred in 54.5% of cases, mostly abdominal discomfort on the first ELECTRONIC POSTER ROUND 14: day after the procedure. MICROBIOTA DETECTION AND ANALYSES Conclusions: FMT is a safe and effective treatment for recurrent CDI in small cohort of Brazilian patients. The implantation of a stool bank EP14.01 | Circulating blood microbiome signatures in patients allowed to apply properly all the requirements needed to perform with liver cirrhosis: Association between clinical parameters, FMT in the country. circulating taxa and inflammatory cytokines L.V. Coelho: None. D.A.A. Terra: None. E.G. Vilela: None. R.O. Silva: None. K.S. Lima: None. L.A. Leão: None. R.I.F.A. Passos: None. R. Gedgaudas1,2; J. Skiecevičienė2; A. Franke3; G. Streleckienė2; S. Juzėnas2; L. Kupčinskas2,1; J. Kupčinskas1,2 1Lithuanian University of Health Sciences Kaunas Clinics Department EP13.02 | Impact of high fat diets with different content of of Gastroenterology, Kaunas, Lithuania; 2Lithuanian University of unsaturated fatty acids on hydrogen gas generation by the gut Health Sciences Institute for Digestive Research, Kaunas, Lithuania; microbiota in rats 3Institute of Clinical Molecular Biology, Kiel, Germany

A. Y. Ivanova1,2; I. Shirokov3; S. Trunov1,2; N. Y. Samodurova4; O. Aim of the Study: To assess structure of circulating microbiome in Medvedev1,2 patients with liver cirrhosis. 1Lomonosov Moscow State University, Moscow, Russian Federation; Introduction: Intestinal microbiome to plays a significant role in the 2Institute of Experimental Cardiology of National Medical Research course of liver disease. Several studies have shown specific circulat- Center for Cardiology, Moscow, Russian Federation; 3Bauman Moscow ing microbiome profiles in patients with liver disease. We have aimed State Technical University, Moscow, Russian Federation; 4Voronezh to assess circulating microbiome in patients with various degrees of State Medical University named after N.N. Burdenko, Voronezh, portal hypertension (PH) and look for possible correlation with in- Russian Federation flammatory cytokines and intestinal permeability markers. Methods: Study was conducted in Department of Gastroenterology Impact of high fat diets with different content of unsaturated fatty of Lithuanian University of Health Sciences, Kaunas Clinics. 58 pa- acids on hydrogen gas generation by the gut microbiota in rats. tients with liver cirrhosis and 46 healthy control (HC) subjects were Objective: Hydrogen gas is one of the metabolites by anaerobic mi- enrolled. 16S rRNA gene sequencing was used to determine bacte- crobial fermentation in the gut. Recent studies confirmed its antioxi- rial composition of blood plasma samples. Levels of IL-6, IL-8, LPS dant, antiapoptotic, anti-inflammatory, cytoprotective and signaling and FABP2 were measured in cirrhotics and HC subjects. properties. Consumption of different fatty acids can exert its biolog- Results: Blood microbiome in both PH patients and HC subjects was ical effect by modulating the gut microbiome. The aim of our study predominated by Proteobacteria, Bacteroidetes, Actinobacteria and was to identify the influence of diets on the endogenous hydrogen Firmicutes. α-diversity was significantly higher in cirrhotic patients. gas total production (sum of breath and flatulence). Bacterial community structure showed a significant clustering be- Methods: Experiment was performed on male Wistar rats randomly tween HC and PH patients. Genus Prevotella was associated with divided into five groups. Each group was fed by the respective ex- higher degree of portal hypertension and worse liver function, while perimental diet for 18 weeks. Normal diet control («ND») and high- abundance of Escherichia/Shigella – with liver function. Levels of fat diets with different fats (30% fat): palm oil «PO», butter «B», trans IL-6 and IL-8 correlated with Child-Turcotte-Pugh and MELD scores, fat «TF», plant-derived fat «PDF». Hydrogen levels were measured while FABP2 – with PH level and MELD score, LPS discriminated cir- before and after diet supplementation for 18 week by breath test at rhotics and HC. Several taxa correlated with these markers. 0, 3, 6 and 8 hours. Conclusions: Cirrhotic patients have distinct circulating microbiome Results: Hydrogen excretion after diet administration «PO» and profile. Levels of Prevotella and Escherichia/Shigella correlated with «PDF» showed significant higher hydrogen gas level that of «ND», re- clinical parameters of liver cirrhosis. Several taxa correlated with in- spectively, 23.45 ± 3.01 ppm (P = 0.046) and 32.43 ± 6.24 (P = 0.033) flammatory cytokines and intestinal permeability markers. ppm vs 15.82 ± 1.72 ppm. R. Gedgaudas: None. J. Skiecevičienė: None. A. Franke: None. Conclusions: Results demonstrate that intake plant derived fats G. Streleckienė: None. S. Juzėnas: None. L. Kupčinskas: None. J. with higher percentage of unsaturated fats causes increased hydro- Kupčinskas: None. gen production by the gut microbiota. The results can be explained by the increasing the abundance of hydrogen-producing microbes or by the inhibition of activity of methane generating ones. It was suggested that adherence to a diet rich in unsaturated fatty acids is useful for prevention diseases associated with oxidative damage. A.Y. Ivanova: None. I. Shirokov: None. S. Trunov: None. N.Y. Samodurova: None. O. Medvedev: None. 94 of 95 | ABSTRACTS

EP14.02 | Laboratory assessment of a device prototype for product. However, this approach is limited by the long incubation methane and hydrogen breath testing time, labor consumption and lack of discrimination in the number of live, dead and viable but non-cultivated microorganisms (VBNC). E. Kolomina1; M. Dmitrienko1; V. Pazenko1; I. Jahatspanian2 Flow cytometry method (FCM) is a new method for assessing the 1AMA Co Ltd, St. Petersburg, Russian Federation; 2ITMO University, St. number of live bacteria in single and multi-strain probiotic products. Petersburg, Russian Federation All results were compared to the ISO 19344:2015 standard method which specifies a standardized method for the quantification of bac- Background: Hydrogen Breath tests are limited due to the presence teria and analyses were conducted in parallel with the traditional of specific microbes, which consume hydrogen (H2) to form meth- PCM. The study has showed that FCM can be applied to probiotic ane (CH4). In this study we conducted laboratory assessment of a enumeration and viability assessment. We focused on microbial prototype device based on MOX sensors with modified surface and cells viability and vitality based on two different physiological pa- adjusted for methane and hydrogen detection. rameters: membrane integrity and measurement of the activity of Materials: A prototype was based on two MOX sensors with two dif- cellular oxido-reductases. No significant differences were found for ferent heating temperatures. It was necessary to decrease the cooling AFU/g obtained using the two protocols for the samples analyzed, effect of inserted breath/gas samples since the temperature is the key indicating a high degree of equivalence for data obtained for the dif- to good sensor performance. To solve this problem the special circula- ferent staining protocols that measure different parameters of bac- tion scheme was designed. The assessment of sensor performance was terial viability. Results indicated that flow cytometry provides better conducted with 150 mL gas sample. Signals were obtained using target performances than the traditional PCM. Furthermore using FCM we gases in concentrations similar to exhaled concentrations (0-100 ppm have opportunity for easier, faster and more accurate routine quality with a step of 10 ppm for H2 and 20 ppm for CH4). Cross-reactivity control to assess bacterial viability. was assessed by H2S (1 ppm) and acetone (20 ppm). To form required K.A. Sielatycka: None. W. Juzwa: None. J. Śliwa-Dominiak: None. M. gas concentrations and conditions similar to human breath the calibra- Kaczmarczyk: None. I. Łoniewski: None. W. Marlicz: None. tion gases were mixed with humid air using a syringe. Results and Discussions: The sensors showed high sensitivity to target gases. Detection limit for hydrogen was 1 ppm, for methane was EP14.04 | In-depth comparison of different platforms for high 12.3 ppm. The hydrogen sensor showed no reaction toward CH4, throughput sequencing microbiome analyses of gastric mucosa acetone and H2S. The signal obtained by methane sensor toward H2S and acetone was significantly lower than the signal to methane. R. Vilchez-Vargas1; R. Gedgaudas2; M. Gemmell3; B. Oosternlinck4; Humidity of gas sample showed no effect on the performance of C. Then5; J. Bornschein5; J. Kupcinskas2; A. Smet4; G. Hold6; the sensors. A. Link1 Conclusion: The device prototype has promising results for simul- 1Otto-von-Guericke University Hospital Magdeburg, Magdeburg, taneous measurement of methane and hydrogen. The device in the Germany; 2Lithuanian University of Health Sciences Kaunas, Kaunas, future may be used for non-invasive diagnosis of gut disorders. Lithuania; 3University of Liverpool, Liverpool, United Kingdom; E. Kolomina: None. M. Dmitrienko: None. V. Pazenko: None. I. 4University of Antwerp, Antwerp, Belgium; 5University of Oxford, Jahatspanian: None. Oxford, United Kingdom; 6University of New South Wales, Sydney, Australia

EP14.03 | Multiparameter flow cytometric enumeration of the Introduction: To understand the role of the microbiome in human commercial probiotic products disease, it is important to assess large sample numbers – potentially including different sample cohorts and geographical regions. For K. A. Sielatycka1; W. Juzwa2; J. Śliwa-Dominiak1; M. Kaczmarczyk3; collection of the data, various different sampling approaches and I. Łoniewski1; W. Marlicz1 protocols including bioinformatic platforms are applied which have 1Sanprobi, Szczecin, Poland; 2Department of Biotechnology and Food the potential to introduce bias into the results obtained. We wanted Microbiology, Poznan University of Life Sciences, Poznan, Poland; to assess the variability introduced by applying different bioinfor- 3Department of Clinical and Molecular Biochemistry, Pomeranian matic analysis platforms to the same data set. Medical University, Szczecin, Poland Methods: Five research groups, from Antwerp (Belgium), Oxford (United Kingdom), Kaunas (Lithuania), Sydney (Australia) and The key in probiotics manufacture is to indicate the amount of Magdeburg (Germany) applied their custom-built pipelines (Qiime, bacteria in the final product to ensure that the product adheres to mothur and dada2) and databases for taxonomy annotations regulatory standards and information on product label. Bacterial (Greengenes, Silva and rdp) to the same input files (fastQ format). counting studies are necessary before each clinical trial for probi- The data set comprised 16S rRNA amplicon sequencing from 79 otics. The plate count method (PCM) is widely used in the probi- gastric tissue samples from patients with normal gastric mucosa, otic industry to determine the number of microorganisms in a final ABSTRACTS | 95 of 95 chronic gastritis and gastric cancer patients with/without H. pylori Conclusions: Understanding the differences introduced by differ- infection. ent bioinformatics pipelines is essential. A standardized analysis Results: Preliminary results shown high differences in the number approach is needed for reproducible microbiome analysis from high- of reads obtained after applying the different analysis pipelines. In throughput sequencing data. addition, some differences in taxonomic annotation that might af- A. Link: B. Research Grant (principal investigator, collaborator or fect the statistical differences between groups were observed. consultant and pending grants as well as grants already received); For instance with regard to stomach, the genera Campylobacter or Significant; European Regional Development Fund. R. Vilchez-Vargas: Helicobacter were not within the phylum Proteobacteria (as classi- None. R. Gedgaudas: None. M. Gemmell: None. B. Oosternlinck: fied in Bergey's Manual of Systematic Bacteriology), but they are None. C. Then: None. J. Bornschein: None. J. Kupcinskas: None. A. annotated as “Campilobacterota”. Comparison between different Smet: None. G. Hold: None. pipelines using different databases for taxonomic annotations was potentially associated with reporting bias.

DOI: 10.1111/hel.12746

AUTHOR INDEX

A Barrio, J: EP2.16 Abdulkhakov, Rustam: EP2.11 Barrio, Jesús: EP2.11, EP2.15, EP2.18, EP2.32, EP2.34, EP2.36 Acosta, Carmen R.: EP2.47 Barrio, Josefa: EP2.29 Agafonova, Elena V.: EP11.04 Barrios, Adriana: EP7.12 Ageeva, Elizaveta S.: EP3.12 Barrios, F A.: EP7.12 Ahn, Ji Yong: EP2.42 Baryshnikova, Natalia V.: EP1.02, EP11.02 Aladellie, Layth: EP1.05 Beales, Ian L. Phillip.: EP1.01 Alarcón, Teresa: EP2.49, EP3.15 Beglinger, Christoph: EP2.10, EP2.12, EP2.22, EP2.24, EP2.25 Alboraie, Mohamed: EP2.38 Bénéjat, Lucie: EP2.43 Alcaide, Noelia: EP2.18, EP2.34 Benghezal, Mohammed: EP6.08 Alcedo, Javier: EP2.33 Beniashvili, Zaza: EP2.03 Aleksanin, Sergey: EP2.51 Beresniak, Ariel: EP1.01 Alekseenko, Sergey: EP2.32 Bermejo, Fernando: EP2.16, EP2.34 Aleksejeva, Jelizaveta: EP7.07 Bibbò, Stefano: EP11.06 Almela Notari, P: EP2.16 Bird-Lieberman, Elizabeth: EP3.18 Almela, Pedro: EP2.33 Bjarnason, Ingvar: EP7.11 Alonso-Galán, Horacio: EP2.33 Blanco, Angel J. Vieira.: EP4.17, EP4.19, EP6.11 Alvarez, A: EP7.12 Blank, Annika: EP7.01 Alves, Jairo S.: EP3.06 Bochenek, Anna: EP11.01 Angelov, Todor: EP1.03 Boeuf, Hélène: EP3.22 Angueira, Teresa: EP2.34 Bogomolov, Pavel: EP2.32 Anisimova, Elena: EP8.08 Boltin, Doron: EP2.02, EP2.03 Antón, Rosario: EP2.34 Bontems , Patrick: EP2.29 Areia, Miguel: EP2.13, EP2.16, EP2.21, EP2.32, EP2.36 Bor, Serhat: EP11.01 Ariño, Ines: EP2.10, EP2.12, EP2.22, EP2.24, EP2.25, EP2.33 Bordin, Dmitry S.: EP2.10, EP2.11, EP2.12, EP2.13, EP2.16, EP2.17, Arstikyte, Justina: EP6.15 EP2.22, EP2.24, EP2.25, EP2.26, EP5.07 Ascencio, Felipe: EP2.52 Borisova, Irina V.: EP10.02 Ash, Stephen: EP3.18 Bornschein, Jan: EP1.01, EP14.04, EP3.18 Atiakshin, Dmitry: EP1.08, EP1.09 Botargués, Josep María: EP2.33 Augustin, Aisha D.: EP7.11 Boyanova, Lyudmila: EP2.10, EP2.12, EP2.22, EP2.24, EP2.25 Axon, A. T. R: EP2.10, EP2.12, EP2.17, EP2.22, EP2.24, EP2.25 Brennan, Denise: EP6.05 Breugelmans, Tom: EP3.14 B Brglez Jurecic, Natasa: EP2.11, EP2.32, EP2.36 Bäck, Magnus: EP1.05 Bruce, Michael: EP3.11 Backert, Steffen: EP3.03, EP3.04, EP3.05, EP4.01, EP4.02, EP4.03, Bruden, Dana: EP3.11 EP6.09 Bruno, Marco: EP3.21, EP3.21 Bacon, Sarah: EP4.21 Bruyndonckx, Robin: EP2.43 Baert, Filip: EP2.35 Brzozowski, Tomasz: EP3.24 Balaguer, Francesc: EP3.18 Bujanda, Luis: EP2.10, EP2.11, EP2.12, EP2.13, EP2.16, EP2.18, Bang, Chang Seok: EP2.08 EP2.21, EP2.22, EP2.24, EP2.25, EP2.32, EP2.33, EP2.34, EP2.36 Banoub, Hany: EP2.29 Burgos, Diego: EP2.16, EP2.18 Barbosa, Alfredo J. A.: EP3.06 Burgos-Santamaría, Diego: EP2.36 Barbosa, Mônica S.: EP4.17, EP4.19, EP5.09, EP6.11 Butorin, Nikolay N.: EP4.11 Barenys, Merce: EP2.15, EP2.33 Buzás, György M.: EP2.01, EP2.10, EP2.12, EP2.17, EP2.22, EP2.24, Barilo, Anna A.: EP10.02, EP7.06 EP2.25

Bytzer, Peter: EP2.10, EP2.12, EP2.22, EP2.24, EP2.25 Coenen, Samuel: EP2.43 Córdova, Henry: EP3.18 C Cosme, Angel: EP2.22, EP2.24, EP2.25 Cabral, José: EP2.29 Costa, Geison M.: EP2.47 Cadena-León, José F.: EP8.11 Cseh, Aron: EP2.29 Caldas, Maria: EP2.10, EP2.12, EP2.13, EP2.16, EP2.18, EP2.22, Cualla, Daniella: EP2.47 EP2.24, EP2.25, EP2.32, EP2.33, EP2.34 Curado, Maria P.: EP5.09 Calvet, Xavier: EP2.15, EP2.18, EP2.36 Curran, Niamh: EP6.05 Cammarota, Giovanni: EP11.06 Czyz, Jaroslaw: EP3.24 Campillo, Ana: EP2.15, EP2.34 Capelle, Lisette G.: EP2.10, EP2.12, EP2.22, EP2.24, EP2.25 D Cardona-Deazza, Jose Luis: EP3.21 Dabrowski, Piotr: EP11.01 Cardoso, Daniela M. Milhomem.: EP4.17, EP6.11 Dai, Shi-xue: EP6.06 Carlos Machado, Jose: EP2.17 Dai, Wei: EP1.06 Carneiro, Lilian C.: EP4.17, EP5.09, EP6.11 Daugule, Ilva: EP7.07 Casswall, Thomas: EP2.29 de Campos, Natália A. Pires.: EP5.09 Castañeda, Johan S.: EP2.47 De Filippis, Barbara: EP2.46 Castano-Rodriguez, Natalia: EP3.20, EP3.21 De la Coba, Cristóbal: EP2.18, EP2.33 Castro-Fernandez, M: EP2.22, EP2.24, EP2.25 de Laffolie, Jan: EP2.29 Castro-Fernandez, Manuel: EP2.10, EP2.11, EP2.12, EP2.15, EP2.16, De Man, Joris: EP3.14 EP2.18, EP2.21, EP2.32, EP2.33, EP2.34, EP2.36 De Winter, Benedicte: EP3.14 Cázares-Mendez, Josefina M.: EP8.11 Debowski, Aleksandra W.: EP6.08 Celestino-Perez, Omaha Y.: EP8.11 Dekhnich, Natalia: EP2.39, EP6.07 Cellini, Luigina: EP2.44, EP2.46 Delchier, Jean Charles: EP2.36 Cerbone, R.: EP2.41 Dell, Anne: EP6.08 Cerezo-Ruiz, Antonio: EP2.15 Deng, Xinli: EP1.06 Cervantes Bustamante, Roberto: EP8.11 Denina, Arta: EP11.03 Charlett, André: EP7.11 D'Ercole, Simonetta: EP2.44, EP2.46 Chartorizhskaya, Natalia: EP1.07 DeSchepper, Heiko: EP3.18 Cheung, Dae Young: EP12.01 Di Campli, Emanuela: EP2.46 Chiang, Tsung-Hsien: EP2.40 Di Fermo, Paola: EP2.44, EP2.46 Chiaro, Andrea: EP2.29 Di Giulio, Mara: EP2.44, EP2.46 Chitas, Rute: EP2.31 Di Lodovico, Silvia: EP2.44, EP2.46 Chmiela, Magdalena: EP4.22, EP4.23 Di Maira, Tommaso: EP2.15, EP2.18 Cho, Soo-Jeong: EP2.48, EP3.13 Diculescu, Mircea: EP11.01 Choe, Younghee: EP3.27 Dmitrienko, Marina A.: EP1.02, EP2.37, EP11.02, EP14.02 Choi, Jinju: EP2.48 Dobbs, R J.: EP7.11 Choi, Kee Don: EP2.42 Dobbs, Sylvia M.: EP7.11 Choi, Myung-Gyu: EP3.27 Domingo-Serrano, L: EP2.49 Choi, Yoon Jin: EP9.01 Domínguez-Cajal, Manuel: EP2.16,EP2.18, EP2.32, EP2.33 Chun, Hoon Jae: EP4.18 Domínguez-Jiménez, Jose Luis: EP2.33 Chung, Hyunsoo: EP2.48 Dong, Lu: EP2.04 Chung, Jun-Won: EP2.08 Douglas, Atiyekeogbebe Rita: EP6.05 Chung, Su Jin: EP2.48 Doukas, Michael: EP3.21 Chyb, Maciej: EP4.22 Doulberis, Michael: EP11.01, EP7.01 Ciamarra, P.: EP2.41 Dubosarskiy, Y. S.: EP2.37 Ciccaglione, Antonio F.: EP2.44 Dubus, Pierre: EP3.22 Cilleruelo Pascual, Maria Luz: EP2.29 Dutova, Anastasia: EP1.07 Cine, Eva: EP2.27 Dzerve, Zane: EP3.18 Ciupkeviciene, Egle: EP5.03, EP5.04 Dziuba, Anna: EP4.20 Cobo-Alvarado, Alba R.: EP3.21 Coelho, Luiz Gonzaga V.: EP3.06, EP13.01 E Coelho, Maria Clara: EP3.06 Ebela, Inguna: EP7.07 AUTHOR INDEX | 3 of 9

Elgazzar, Amr: EP2.38 Gavalas, Emmanuel: EP11.01 Elmanova, Nina: EP3.08, EP4.06, EP4.07 Geboes, Karen: EP3.14 Elrakeeb, Adel: EP2.38 Gedgaudas, Rolandas: EP14.01, EP14.04 Eltayyeb, Sawsan Hanem: EP2.38 Gemmell, Matthew: EP14.04 Embutnieks, Yulia V.: EP2.26, EP5.07 Genot, Elisabeth: EP7.10 Ermolenko, Elena I.: EP2.37, EP11.02 Ghete, Tabita D.: EP4.03 Ermolenko, Konstanin: EP2.37 Gingold-Belfer, Rachel: EP2.02 Erőss, Bálint: EP1.04 Giraud, Julie: EP3.22 Erts, Renars: EP11.03 Gisbert, Javier P.: EP2.03, EP2.05, EP2.06, EP2.10, EP2.11, EP2.12, Espada, Marta: EP2.11, EP2.17, EP2.18, EP2.20, EP2.32 EP2.13, EP2.15, EP2.16, EP2.17, EP2.18, EP2.19, EP2.20, EP2.21, Estevinho, Berta N.: EP2.14 EP2.22, EP2.24, EP2.25, EP2.32, EP2.33, EP2.34, EP2.36 Exadaktylos, Aristomenis K: EP7.01 Gladyshev, Nikita S.: EP2.37 Glisic, Tijana: EP5.08 F Glupczynski, Youri: EP2.43 Facchiano, A.: EP2.41 Goldis, Adrian: EP2.10, EP2.12, EP2.22, EP2.24, EP2.25 Fadeenko, Galina: EP2.10, EP2.12, EP2.13, EP2.22, EP2.24, EP2.25, Gomes, Celio G.: EP3.06 EP2.32 Gomes, Paula: EP2.14 Fadieienko, Galina D.: EP2.45 Gomez Rodriguez, Blas Jose: EP2.15, EP2.18 Falkeis-Veits, Christina: EP3.05 Gómez, Barbara: EP2.15, EP2.18 Falush, Daniel: EP6.13, EP6.14 Gómez, Judith: EP2.33 Farsakh, Niazy Abu: EP11.01 Gomez-Camarero, Judith: EP2.18, EP2.36 Fassan, Matteo: EP3.18 Gómez-Rodriguez, Blas José: EP2.16, EP2.34 Feizer, Albina A.: EP10.02, EP7.06 Gonciarz, Weronika: EP4.22, EP4.23 Ferman, Raisa: EP6.02, EP6.03 Gong, Meiliang: EP2.50 Fernández Moreno, Nuria: EP2.13, EP2.15 González-Cordero, Pedro Luis: EP2.34 Fernandez, Nuria: EP2.18, EP2.33 González-Romo, Carolina: EP8.11 Fernández-Bermejo, Miguel: EP2.16, EP2.33 Goossens, Herman: EP2.43 Fernandez-Esparrach, Gloria: EP3.18 Gopko, Olexandr: EP2.28 Fernandez-Moreno, Nuria: EP2.21 Gorbacheva, Nina: EP4.14, EP8.07, EP8.08 Fernández-Salazar, Luis: EP2.11, EP2.16, EP2.18, EP2.32, EP2.33 Gościniak, Grażyna: EP2.30 Ferrer, Luis: EP2.18 Granata, L.: EP2.41 Fiedler, Florian: EP4.02 Gravina, A. G.: EP2.41 Figuerola, Ariadna: EP2.18 Gravina, Antonietta: EP2.21, EP2.16 Fiorini, Giulia: EP2.10, EP2.12, EP2.13, EP2.21, EP2.22, EP2.24, Gu, Liqun: EP2.04 EP2.25, EP2.36 Gülten, Macit: EP11.01 FitzGerald, Rebecca: EP4.15, EP6.05 Gutiérrez-Escobar, Andrés J.: EP3.04 Fonseca, Diana R.: EP2.14 Fontan, Leticia: EP3.15 H Forster, Michael: EP3.23 Haems, Lise: EP2.35 Fox, James G.: EP6.12 Haick, Hossam: EP3.16 Franceschi, Francesco: EP11.06 Han, Yingjie: EP1.06, EP2.50 Franco, Juan D.: EP2.47 Harrer, Aileen: EP3.03 Franke, Andre: EP14.01 Haslam, Stuart M.: EP6.08 Frode Lerang, Frode: EP2.10 Hatzigeorgiou, Artemis: EP3.19 Fuhler, Gwenny M.: EP3.21 Hayee, Bu' H.: EP7.11 Hegyi, Péter: EP1.04 G Heinzle, Christine: EP3.16 Gama, Aline R.: EP4.19, EP6.11 Heluwaert, Fréderic: EP2.10, EP2.12, EP2.16 Gan, Xueyang: EP1.06 Herrero, Rolando: EP7.07 Garre, Ana: EP2.10, EP2.11, EP2.12, EP2.13, EP2.18, EP2.33, EP2.34 Hervent, Anne-Sophie: EP2.35 Garrido, Jesús: EP2.10, EP2.12 Hinojosa, Jenifer: EP2.18 Gasbarrini, Antonio: EP11.06, EP2.10, EP2.11, EP2.12, EP2.16, Hirsch, Jonathan: EP2.03 EP2.21, EP2.22, EP2.24, EP2.25, Hoebeke, Martin: EP2.43 4 of 9 | AUTHOR INDEX

Hofmann, Robin: EP1.05 Karniol, Karmen: EP7.10 Hold, Georgina: EP14.04, EP3.18 Kasak, Lagle: EP7.10, EP9.03 Homan, Matjaž: EP2.29 Kasparov, Eduard V.: EP4.10 Horefti, Elina: EP3.26 Kavaliauskaite, Gabriele: EP5.04 Hou, Xiaohua: EP2.04 Kekic, Dusan: EP6.04 Hu, Jun-yu: EP6.06 Kelleher, Dermot: EP4.15 Hu, Renwei: EP6.08 Keller, Josbert J.: EP11.05 Huang, Te-Din D.: EP2.43 Khalid, Sadia: EP7.09 Huang, Yi-lan: EP6.06 Kikuste, Ilze: EP3.01, EP3.02, EP3.16 Huerta, Alain: EP2.34 Kim, Beom Jin: EP6.01, EP9.01 Huguet, Jose Maria: EP2.11, EP2.15, EP2.16, EP2.18, EP2.32, Kim, Byung-Wook: EP2.08 EP2.33, EP2.34 Kim, Do Hoon: EP2.42 Kim, Dong Uk: EP3.17 I Kim, Gwang Ha: EP3.17 Ianiro, Gianluca: EP11.06 Kim, Heung gil: EP10.01 Ignorosa-Arellano, Karen R.: EP8.11 Kim, Hyun Jin: EP2.08 Isaeva, Guzel S.: EP11.04 Kim, Jae G.: EP6.01 Isaeva, Regina A.: EP11.04 Kim, Jae J.: EP7.02, EP7.03 Iskova, Iryna: EP5.11 Kim, Jeong Wook: EP6.01 Ivanchic, Nataly: EP6.07 Kim, Ji Hyun: EP2.08 Ivanova, Anastasiia Y.: EP13.02 Kim, Jie-Hyun: EP2.08 Iyo, E: EP2.16 Kim, Jin Il: EP12.01, EP2.08 Iyo, Eduardo: EP2.15, EP2.34 Kim, Joo Sung: EP3.13 Kim, Joon Sung: EP2.08, EP9.01 J Kim, Jue Lie: EP2.48 Jadallah, Khaled: EP11.01 Kim, Ki Bae: EP2.08 Jahatspanian, Igor: EP14.02 Kim, Na Young: EP2.08 Jeon, Seong Woo: EP2.08 Kim, Nayoung: EP2.09, EP7.05 Jhi, Joon Hyung: EP3.17 Kim, Sang Gyun: EP2.48, EP3.13 Jimenez-Moreno, Manuel: EP2.18, EP2.16 Kim, Seung Han: EP4.18 Jonaitis, Laimas: EP2.05, EP2.06, EP2.10, EP2.11, EP2.12, EP2.13, Kim, Sung Eun: EP2.08 EP2.17, EP2.22, EP2.24, EP2.25, EP2.32, EP2.36, EP5.03, EP5.04 Kim, Tae Jun: EP7.02, EP7.03 Jonaitis, Paulius: EP2.05, EP2.06, EP5.03, EP5.04 Kim, Won Shik: EP4.18 Jonaityte, Ieva R.: EP5.03, EP5.04 Kim, Yoo Jin: EP2.09 Joo, Moon Kyung: EP2.08, EP4.18 Kiršners, Arnis: EP2.27 Jorge Perez Lasala, Jorge: EP2.11 Kiudelis, Gediminas: EP2.06 Józan, Jolán: EP2.01 Klemenak, Martina: EP2.29 Jung, Hwoon-Yong: EP2.42 Kliaritskaia, Iryna: EP5.11 Jung, Kee Wook: EP2.42 Klukowska-Rötzler, Jolanta: EP7.01 Juzėnas, Simonas: EP14.01 Klyaritskaya, Iryna: EP5.10 Juzwa, Wojciech: EP14.03 Knorr, Jakob: EP4.02 Kolencukova, Oksana: EP4.14 K Koletzko, Sibylle: EP2.29 Kaakoush, Nadeem: EP3.20 Kollia, Panagoula: EP3.19 Kaczmarczyk, Mariusz: EP14.03 Kolomina, Elena: EP14.02 Kalach , Nicolas: EP2.29 Kontizas, Eleftherios: EP3.19 Kalmykova, Anna: EP8.10 Kori, Michal: EP2.29 Kambas, Konstantinos: EP4.16 Korkut Ugras, Meltem: EP2.29 Kang, Hee Jun: EP2.23 Kotilea, Kalliroy: EP2.29 Kang, Sun Hyung: EP9.01 Kountouras, Jannis: EP11.01, EP7.01 Karakan, Tarkan: EP11.01 Kovacheva-Slavova, Mila: EP1.03 Karamitros, Timokratis: EP3.19 Kozlov, Roman: EP2.39, EP6.07 Karayiannis, Yiannis: EP3.19, EP4.16 Krahl, Andreas: EP2.29 AUTHOR INDEX | 5 of 9

Krstic, Miodrag: EP5.08, EP6.04 Levi, Zohar: EP2.02 Krupa, Agnieszka: EP4.20 Li, Hong: EP6.08 Kryvy, Valeriy: EP5.10, EP5.11 Li, Yuan: EP1.06 Krzysiek-Maczka, Gracjana: EP3.24 Liao, Tingting: EP6.08 Krzyżek, Paweł: EP2.30 Lielause, Alise: EP2.27 Kudou, Kentarou: EP2.04 Lim, Chul-Hyun: EP2.23 Kuijper, Ed J.: EP11.05 Lim, Joo Hyun: EP3.13 Kuipers, Ernst J.: EP3.21 Lima, Karine S.: EP13.01, EP3.06 Kunovský, L: EP2.16 Lima, Rosa: EP2.29 Kupcinskas, Juozas: EP14.04, EP2.05, EP2.06, EP3.14, EP3.18, Lind, Judith: EP3.04 EP3.23, EP3.25, EP5.03, EP5.04, EP6.15, EP14.01 Link, Alexander: EP14.04, EP3.14, EP3.18, EP3.25, EP6.15 Kupcinskas, Limas: EP2.05, EP2.06, EP2.10, EP2.11, EP2.12, EP2.13, Litvinova, Irina: EP4.14 EP2.16, EP2.17, EP2.22, EP2.24, EP2.25, EP5.03, EP5.04, EP14.01 Liu, Chuan: EP5.01 Kuzmenkov, Alexey: EP2.39 Liu, Miao: EP1.06 Łoniewski, Igor: EP14.03 L Lopes, Ana Isabel: EP2.29 Lahat, Adi: EP2.03 López-Saavedra, Javier: EP3.15 Lambrecht, Guy: EP2.35 López-Torreblanca, María: EP3.15 Lamichhane, Binit: EP6.08 Lorenzana-Sánchez., Isabel: EP3.15 Lamy, Vincent: EP2.10, EP2.12, EP2.22, EP2.24, EP2.25 Lucendo, Alfredo: EP2.11, EP2.13, EP2.15, EP2.16, EP2.18, EP2.21, Lanas, Ángel: EP2.34 EP2.32, EP2.33, EP2.36 Lara-Ibarra, Ana V.: EP8.11 Luo, Yong: EP6.08 Lareva, Natalia: EP1.07 Luzina, Elena: EP1.07 Lario, Sergio: EP2.15 Lyudyno, Victoria I.: EP11.02 Lazebnik, Leonid: EP1.07 Lyutakov, Ivan: EP3.18 Le Thi, Thu Giang: EP2.29 Leão, Laiane A.: EP13.01 M Lecompte-Saint-Jean, Paul: EP4.21 Machado, Jose Carlos: EP2.10, EP2.12, EP2.22, EP2.24, EP2.25 Lee, Ayoung: EP2.48 Maev, Igor V.: EP2.26, EP5.07 Lee, Boem Jae: EP4.18 Magi, Gloria: EP2.44 Lee, Bong Eun: EP2.08, EP3.17 Malfertheiner, Peter: EP1.01, EP2.16, EP3.25, EP6.15 Lee, Dong Ho: EP2.09, EP7.05 Mannion, Anthony: EP6.12 Lee, Eun Ji: EP7.05 Mantzaris, Gerasimos: EP3.26 Lee, Gin Hyug: EP2.42 Marceau, Michael: EP6.08 Lee, Hyuk: EP7.02, EP7.03 Marcos Pinto, Ricardo: EP2.13, EP2.16, EP2.21 Lee, Jeong Hoon: EP2.08, EP2.42 Marinho, Frederico P.: EP3.06 Lee, Ju Yup: EP2.08 Marlicz, Wojciech: EP14.03, EP2.22, EP2.24, EP2.25 Lee, Jun Haeng: EP7.02, EP7.03 Mars, Katarina: EP1.05 Lee, jung hwan: EP10.01 Marshall, Barry J.: EP6.08 Lee, Moon Won: EP3.17 Martin, Océane: EP3.22, EP4.21 Lee, Sang Kil: EP9.01 Martinez Cerezo, Francisco José: EP2.15 Lee, Sang Woo: EP4.18 Martinez-Gonzalez, Beatriz: EP3.26, EP4.16 Lee, Sung Hak: EP3.27 Martínez-Junquera, Elena: EP3.15 Lee, Yi-Chia: EP2.40 Martínez-Rodríguez, A J.: EP2.49 Lehours, Philippe: EP2.43, EP3.22, EP4.21 Martins, M. Cristina L.: EP2.14 Lehr, Konrad: EP3.25 Martins, Maria C. L.: EP2.31 Leiherer, Andreas: EP3.16 Maslova, Ganna: EP4.13 Leiro, Victoria: EP2.14 Mata Romero, Pilar: EP2.11, EP2.15, EP2.18, EP2.36 Leja, Marcis: EP11.03, EP2.10, EP2.12, EP2.13, EP2.17, EP2.22, Matejic, Olivera: EP5.08 EP2.24, EP2.25, EP2.27, EP2.32, EP3.01, EP3.02, EP3.16, EP3.18, Matusiewics, Krzysztof: EP2.29 EP7.07 McNamara, Deirdre: EP4.15, EP6.05 Lerang, Frode: EP2.12, EP2.17, EP2.22, EP2.24, EP2.25 Medvedev, Oleg: EP13.02 Lescinska, Anna Marija: EP3.01 Mego, Marianela: EP2.15, EP2.33 6 of 9 | AUTHOR INDEX

Mégraud, Francis: EP2.03, EP2.05, EP2.06, EP2.10, EP2.11, EP2.12, Nikiforova, Yana V.: EP2.45 EP2.13, EP2.15, EP2.16, EP2.17, EP2.18, EP2.21, EP2.22, EP2.24, Nilsson, Hans-Olof: EP6.08 EP2.25, EP2.32, EP2.33, EP2.34, EP2.36, EP2.43, EP3.22 Niv, Yaron: EP2.02, EP2.03, EP2.10, EP2.12, EP2.22, EP2.24, EP2.25, Mendez, E: EP7.12 EP2.36 Meng, Fandong: EP2.04 Nolen, Leisha: EP3.11 Meng, Fansen: EP1.06, EP2.50 Nostro, Antonia: EP2.44 Mentis, Andreas F.: EP3.19, EP3.26 Ntouli, Vassiliki: EP2.32 Meza, Beatriz: EP2.52 Nunes, Cláudia: EP2.31 Mezmale, Linda: EP3.01, EP3.02, EP3.16 Nuñez, Óscar: EP2.15, EP2.16, EP2.34 Mi, Yang: EP5.01 Nyssen, Olga P.: EP2.03, EP2.05, EP2.06, EP2.10, EP2.11, EP2.12, Michailou, Elissavet: EP4.16 EP2.13, EP2.15, EP2.16, EP2.17, EP2.18, EP2.19, EP2.20, EP2.21, Michopoulos, Spyridon: EP3.26, EP4.16 EP2.22, EP2.24, EP2.25, EP2.32, EP2.33, EP2.34, EP2.36 Middelburg, Tim: EP3.18 Miele, Erasmo: EP2.29 O Miguel, Marina P.: EP4.17 Obukhova, Olga: EP8.10 Mikolajczyk-Chmiela, Magdalena: EP4.20 O'Connor, Anthony: EP3.18 Milivojevic, Vladimir: EP2.10, EP5.08, EP6.04 Oh, Jung Hwan: EP2.23 Miller, Keri: EP3.11 Oliveira, Ana Karoline S.: EP4.17, EP4.19, EP6.11 Milosavljevic, Tomica: EP2.10, EP2.12, EP2.22, EP2.24, EP2.25, O'Morain, Colm: EP2.03, EP2.05, EP2.06, EP2.10, EP2.11, EP2.12, EP5.08, EP6.04 EP2.13, EP2.15, EP2.16, EP2.17, EP2.18, EP2.21, EP2.22, EP2.24, Min, Yang Won: EP7.02, EP7.03 EP2.25, EP2.32, EP2.33, EP2.34, EP2.36, EP4.15, EP6.05 Miranda, A.: EP2.41 Onuchina, Elena V.: EP7.04 Misak , Zrinjka: EP2.29 Oosterlinck, Baptiste: EP3.14 Mitchell, Hazel: EP3.20 Oosternlinck, Baptiste: EP14.04 Mitrovics, Jan: EP3.01 O'Reilly, Lauren: EP6.05 Mochalski, Pawel: EP3.02, EP3.16 Ortega, Guillermo J.: EP2.19 Modollel, Ines: EP2.18, EP2.36 Ortuño, Juan: EP2.16, EP2.18, EP2.32, EP2.33, EP2.36 Molina-Castro, Silvia: EP3.22 Osorno-Díaz, Georgina: EP8.11 Molina-Infante, Javier: EP2.10, EP2.12, EP2.16, EP2.18, EP2.22, Ovcharenko, Elizaveta: EP3.08, EP4.06, EP4.07 EP2.24, EP2.25, EP2.32, EP2.33 Mololell, Inés: EP2.34 P Molostova, Anastasia S.: EP2.37 Pabón-Carrasco, Manuel: EP2.33 Mommersteeg, Michiel C.: EP3.21 Pachathundikandi, Suneesh K.: EP3.04 Montanaro, A.: EP2.41 Padilla, Marta: EP3.01 Montijo-Barrios, Ericka: EP8.11 Pajares-Villaroya, Ramón: EP2.34 Moon, Sang Gon: EP2.23 Paluch, Emil: EP2.30 Moraes, Felipe A. de Sousa.: EP5.09 Papadopoulou, Alexandra: EP2.29 Moreira, Letitia: EP3.18 Papaefthymiou, Apostolis: EP11.01, EP7.01 Moskalenko, Olga: EP3.08, EP4.06, EP4.07 Park, Chan Hyuk: EP9.01 Moura, Ana: EP2.14 Park, Jae Yong: EP6.01 Muendlein, Axel: EP3.16 Park, Jong-Jae: EP4.18 Mulloy, Barbara: EP6.08 Park, Seon-Young: EP2.08 Muñoz, Angela B.: EP6.10 Park, Soo-Heon: EP12.01 Muñoz, Raquel: EP2.17, EP2.22, EP2.24, EP2.25 Park, Su Jin: EP3.17 Murillo, Raul: EP7.07 Park, Young Soo: EP2.09, EP7.05 Muzica, Cristina: EP5.02 Parkhomenko, Viktoria: EP2.28 Parreira, Paula: EP2.14, EP2.31 N Parshutin, Sergei: EP7.07 Na, Hee Kyong: EP2.42 Paršutins, Sergejs: EP2.27 Nakov, Radislav: EP3.18 Passos, Raissa I.: EP3.06, EP13.01 Nash, Sarah: EP3.11 Pazenko, Vladislav: EP14.02 Neddermann, Matthias: EP3.04 Pellicano, Rinaldo: EP2.16, EP2.32, EP2.36 Nieuwenburg, Stella A. V..: EP3.18 Peppelenbosch, Maikel P.: EP3.21 AUTHOR INDEX | 7 of 9

Peretyat'ko, Olga V.: EP4.10 Reyes, Juan J.: EP2.47 Pérez, Cristina F.: EP2.10, EP2.12 Rhie, Su Yeon: EP6.01 Pérez-Aisa, Angeles: EP2.10, EP2.11, EP2.12, EP2.13, EP2.15, Ribeiro, Henrique G.: EP3.06 EP2.16, EP2.18, EP2.21, EP2.22, EP2.24, EP2.25, EP2.32, EP2.33, Rodionov, Gennadii: EP2.51 EP2.34, EP2.36 Rodrigo, Luis: EP2.10, EP2.12, EP2.16, EP2.22, EP2.24, EP2.25, Pérez-Lasala, Jorge: EP2.10, EP2.12, EP2.16, EP2.22, EP2.24, EP2.32, EP2.34 EP2.25, EP2.32, EP2.34, EP2.36 Rodrigo-Sáez, Luis: EP2.11, EP2.18, EP2.36 Perona, Monica: EP2.15, EP2.16, EP2.18, EP2.34 Rodrigues, Aline G.: EP4.17 Petkevicius, Vytenis: EP5.04 Rogalidou, Maria: EP2.29 Petraki, Kalliopi: EP4.16 Rokkas, Theodore: EP2.10, EP2.12, EP2.16, EP2.17, EP2.22, EP2.24, Phull, Perminder: EP2.36 EP2.25 Pi, Xuenan: EP6.08 Roma, Eleftheria: EP2.29 Pih, Gyu Young: EP2.42 Romano, M: EP2.16, EP2.41 Plavnik, Roman G.: EP2.26, EP5.07 Romano, Marco: EP2.21 Polaka, Inese: EP2.27, EP11.03, EP3.01, EP3.02, EP7.07 Roots, Kaisa: EP7.10, EP9.03 Polivanova, Tamara V.: EP4.10, EP5.05, EP5.06, EP8.01, EP8.02, Rozciecha, Jerzy: EP11.01 EP8.03, EP8.04, EP8.05, EP8.06, EP8.09 Rūdule, Aiga: EP2.27 Polyzos, Stergios A: EP7.01, EP11.01 Ruiz-Zorrilla, Rafael: EP2.32, EP2.34 Pontas, Christos: EP3.26 Rukavitsõna, Elina: EP7.10 Pontes, Jaqueline C.: EP6.11 Ryabichenko, Tatiana: EP8.10 Ponziani, Francesca Romana: EP11.06 Popovic, Dusan: EP5.08 S Popovici, Elena V.: EP5.02 Sablin, Oleg: EP2.51 Porcari, Serena: EP11.06 Sablina, Anastasiya: EP2.51 Porras-Hurtado, Gloria L.: EP3.21 Saenz, Andres F.: EP2.47 Pozzati, Liliana: EP2.16, EP2.18, EP2.33 Salazar-Carmona, Hector A.: EP3.21 Prakhin, Efim: EP8.10 Salhi, Hocine: EP1.01 Priadko, K.: EP2.41 Samodurova, Natalya: EP1.08, EP1.09, EP13.02 Priedola, Jana: EP2.27 Santaella, Inmaculada: EP2.13, EP2.21 Pritchard, David M.: EP1.01 Santare, Daiga: EP7.07 Prodanov, M: EP2.49 Santos-Fernández, Javier: EP2.15, EP2.36 Przytulski, Krzysztof: EP2.10, EP2.12 Sanz-Garcia, Ancor: EP2.19 Ptak-Belowska, Agata: EP3.24 Saracino, Ilaria Maria: EP2.21 Puig, Ignasi: EP2.05, EP2.06, EP2.10, EP2.12, EP2.13, EP2.15, Sarand, Inga: EP9.03 EP2.16, EP2.17, EP2.18, EP2.21, EP2.22, EP2.24, EP2.25, EP2.32, Sarsenbaeva, Aiman: EP2.13 EP2.33, EP2.34 Schanze, Denny: EP3.25, EP6.15 Pulikov, Anatoliy S.: EP4.10 Seabra, Catarina L.: EP2.14, EP2.31 Pūpola, Dārta: EP2.27 Seeman, Sara: EP3.11 Seeneevassen, Lornella: EP3.22, EP4.21, EP7.09 R Semenikhina, Ekaterina: EP5.10 Radionova, Tetiana: EP4.13 Seo, Seung In: EP9.01 Ramirez, Maria José: EP2.15 Seo, Seung Young: EP2.08 Ramírez-Mayans, Jaime A.: EP8.11 Serra, Miquel: EP2.21 Ramos, Amanda F. Paes. Landim.: EP4.19, EP5.09, EP6.11 Settanni, Carlo Romano: EP11.06 Ramos, Ana Flavia P.: EP3.06 Sezgin, Orhan: EP11.01 Ranin, Lazar: EP6.04 Sgouras, Dionyssios N.: EP3.19, EP3.26, EP4.16 Rankovic, Ivan: EP5.08, EP6.04 Sha, Weihong: EP2.04 Rasmussem, Lucas T.: EP4.17, EP4.19, EP6.11 Shani, Gidi: EP3.16 Ražuka-Ebela, Danute: EP2.27, EP7.07 Shantyr’, Igor: EP2.51 Rea, Francesca: EP2.29 Shen, Yalin: EP6.08 Realdon, Stefano: EP3.18 Shen, Zeli: EP6.12 Rechcinski, Tomasz: EP4.23 Shi, Ying: EP6.08 Resina, Elena: EP2.17, EP2.18, EP2.22, EP2.24, EP2.25 Shin, Cheol Min: EP2.09, EP7.05 8 of 9 | AUTHOR INDEX

Shin, Tae-Seop: EP6.01 Sticht, Heinrich: EP3.04 Shin, yong woon: EP10.01 Streleckiene, Greta: EP3.23, EP14.01 Shirokov, Ivan: EP13.02 Strzalka, Malgorzata: EP3.24 Shtygasheva, Olga V.: EP3.12, EP4.11 Stubbs, Keith A.: EP6.08 Shubina, Margarita: EP8.07, EP8.08 Suk, Sunah: EP12.01 Shun, Chia-Tung: EP2.40 Sundqvist, Martin: EP1.05 Shvets, Oleg: EP2.10, EP2.12, EP2.13, EP2.17, EP2.22, EP2.24, Suurmaa, Külliki: EP9.03 EP2.25 Suvorov, Alexander N.: EP1.02, EP11.02, EP2.37 Sielatycka, Katarzyna A.: EP14.03 Suvorova, Maria A.: EP11.02 Sifré, Elodie: EP3.22, EP4.21, EP7.09 Svarval, Alena: EP2.37, EP6.02, EP6.03 Siles, M N.: EP2.49 Sykora, Josef: EP2.29 Silva, Antonio Márcio T. Cordeiro.: EP6.11 Szczyrk, Urszula: EP3.24 Silva, Lucas L. de Lima.: EP4.17, EP4.19, EP5.09, EP6.11 Silva, Rodrigo O.: EP13.01 T Silva, Teodoro C.: EP4.19 Tadeusz, Mazurek: EP11.01 Silvan, J M.: EP2.49 Tang, Hong: EP6.08 Simovic, Isidora: EP3.21 Tang, Xiaoqiong: EP6.08 Simsek, Halis: EP2.10, EP2.12, EP2.22, EP2.24, EP2.25 Tao, Hongjin: EP2.50 Simsekn, Ilkay: EP2.17 Targosz, Aneta: EP3.24 Sinha, Chavi: EP6.05 Tastsoglou, Spiros: EP3.19 Sinyakov, Alexandr: EP3.07, EP3.08, EP3.09, EP3.10, EP4.04, EP4.05, Tavares, Marta: EP2.29 EP4.06, EP4.07, EP4.08, EP4.09 Tay, Alfred: EP6.08 Sitikova, Irena: EP11.03 Taylor, David: EP7.11 Sjomina, Olga: EP2.27 Tegtmeyer, Nicole: EP3.03, EP3.04, EP3.05, EP4.01, EP4.02, EP4.03 Šķenders, Girts: EP2.27 Teixeira, Cátia: EP2.14 Skibo, Irina I.: EP2.26, EP5.07 Tepes, Bojan: EP2.10, EP2.11, EP2.12, EP2.13, EP2.16, EP2.17, Skiecevičienė, Jurgita: EP3.23, EP6.15, EP14.01 EP2.22, EP2.24, EP2.25, EP2.32, EP2.36 Skorko-Glonek, Joanna: EP6.09 Tereshchenko, Sergey: EP4.14, EP8.07, EP8.08 Skosyreva, Galina: EP8.10 Terra, Daniel A. A.: EP13.01 Skrypnyk, Igor: EP2.28, EP4.13 Terveer, Elisabeth M.: EP11.05 Ślefarska, Daria: EP3.16 Then, Chee Kin: EP14.04 Śliwa-Dominiak, Joanna: EP14.03 Thon, Cosima: EP3.25, EP6.15 Smet, Annemieke: EP14.04, EP3.14, EP3.18 Tiffon, Camille: EP3.22 Smirnova, Olga: EP3.07, EP3.08, EP3.09, EP3.10, EP4.04, EP4.05, Tito, Llucia: EP2.15, EP2.18 EP4.06, EP4.07, EP4.08, EP4.09, EP7.10 Titó, Llúcia: EP2.34 Smirnova, Svetlana V.: EP10.02, EP7.06 Tivanova, Elena: EP2.26, EP5.07 Smith, Sinéad: EP4.15, EP6.05 Tolmanis, Ivars: EP3.01, EP3.02, EP3.16, EP3.18 Soares, Giovana A. Sampaio.: EP5.09 Tomaszewska, Agata: EP4.23 Song, Ho June: EP2.42 Tomic, Dragan: EP5.08 Song, Hyun Joo: EP2.08 Tonkic, A: EP2.22, EP2.24, EP2.25 Sougioultzis, Stavros: EP3.26 Tonkic, Ante: EP2.10, EP2.12 Sousa, Gabriela R.: EP5.09 Tonkikh, Julia L.: EP4.10, EP4.11, EP7.04 Spaander, M.C.W.: EP3.21 Toro Monjaraz, Erick: EP8.11 Spaander, Manon C.: EP3.18 Torres, Javier: EP2.52 Spirchez, Zeno: EP11.01 Torres, Roberto C.: EP6.13 Spuul, Pirjo: EP7.09, EP7.10, EP9.03 Tourrette, Elise: EP6.14 Srivastava, David S: EP7.01 Tran-Nguyen, Terry: EP3.18 Srivastava, Simone: EP7.01 Trespalacios, Alba A.: EP2.47, EP6.10 Staedel, Cathy: EP3.22 Triapyshko, Andrey: EP2.39 Stamiri, Dionyssia: EP3.26 Trifan, Anca: EP5.02 Starkova, Darya: EP6.02, EP6.03 Tropcheva, Rositsa: EP1.03 Steponaitiene, Ruta: EP3.25 Trunov, Sergey: EP13.02 Stewart, Kyle: EP10.03 Trushin, Ivan: EP2.39 AUTHOR INDEX | 9 of 9

Tsapieva, A. N.: EP2.37 Vologzhanina, Liudmila: EP2.10, EP2.11, EP2.12, EP2.13 Tsapyak, Tatyana: EP5.10, EP5.11 Vörhendi, Nóra: EP1.04 Tsechelidis, Ioannis: EP11.01 Voynovan, Irina: EP2.11 Tsukanov, Vladislav: EP3.08, EP4.06, EP4.07, EP4.10, EP4.11, Vshivkov, Vitaliy A.: EP4.10, EP5.05, EP5.06, EP8.01, EP8.02, EP4.14, EP7.04 EP8.03, EP8.04, EP8.05, EP8.06, EP8.09 Tucker, Rosalind M.: EP7.11 Vujasinovic, Miroslav: EP2.11

U W Urba, Mindaugas: EP6.15 Waked, Bruno: EP2.35 Urbonas, Tadas: EP3.18 Wang, Gangshi: EP1.06, EP2.50 Urbonas, Vaidotas: EP2.29 Wang, Jiangbin: EP2.04 Urruzuno , Pedro: EP2.29 Wang, Xuning: EP2.50 Ushal, Inna: EP2.51 Wärme, Jonatan: EP1.05 Uspenskiy, Yury P.: EP1.02, EP11.02 Weigt, Jochen: EP3.18 Weller, Clive: EP7.11 V Werkstetter, Katharina: EP2.29 Vaira, Dino: EP2.10, EP2.11, EP2.12, EP2.13, EP2.16, EP2.21, Whelan, Aishling: EP6.05 EP2.22, EP2.24, EP2.25, EP2.32, EP2.36 Windle, Henry: EP4.15 Vale, Filipa F.: EP6.10 Winyard, Paul: EP10.03 Valkov, Hristo: EP1.03 Wittkop, Linda: EP2.43 van der Meulen - de Jong, Andrea E.: EP11.05 Wrobel, Tomasz: EP3.24 van Lingen, Emilie: EP11.05 van Nieuwenburg, S.A.V.: EP3.21 X Vanags, Aigars: EP3.02 Xie, Li: EP2.04 Vanden Bulcke, Alexander: EP2.35 Xie, Yan: EP6.08 Vangravs, Reinis: EP2.27 Varela, Pilar: EP2.18 Y Varon, Christine: EP3.22, EP4.21, EP7.09, EP7.10 Yang, Chang-Hun: EP4.18 Vasyutin, Alexander V.: EP4.10, EP4.11, EP7.04 Yang, Tiandi: EP6.08 Veijola, Lea Irene: EP2.10, EP2.12, EP2.22, EP2.24, EP2.25 Yang, Tiankuo: EP6.08 Velasco-Arellano, Andrea: EP8.11 Yoon, Hyuk: EP2.09 Veliks, Viktors: EP3.02 Young Park, Jin: EP7.07 Venciene, Rigonda: EP2.06 Yu, B.: EP3.21 Vendrik, Karuna E. W.: EP11.05 Venerito, Marino: EP2.10, EP2.12, EP2.16, EP2.22, EP2.24, EP2.25 Z Vervaeke, Steven: EP2.35 Zárate-Mondragon, Flora E.: EP8.11 Vieth, Michael: EP3.05 Zarkova, Kristine: EP3.01 Vilchez-Vargas, Ramiro: EP14.04, EP3.25, EP6.15 Zarzecka, Urszula: EP6.09 Vilela, Eduardo G.: EP13.01 Zenker, Martin: EP3.25, EP6.15 Vinasco-Pacheco, Karla: EP3.20 Zhang, Shutian: EP2.04 Vindigni, Stephen: EP3.11 Zheng, Peng y.: EP5.01 Vladimirov, Borislav: EP1.03 Zileri Dal Verme, Lorenzo: EP11.06 Vologhzanina, L: EP2.22, EP2.24, EP2.25

DOI: 10.1111/hel.12747

KEYWORD INDEX

A Breath test: EP14.02 Accuracy: EP1.04 Active fluorescent units: EP14.03 C Acute upper gastrointestinal bleeding: EP5.08 CagA: EP4.01, EP4.02, EP4.23 Adolescents: EP8.07 CagA Helicobacter pylori: EP5.05 ADP-heptose: EP4.03 CagA, vacA, dupA: EP6.11 Alaska Native: EP3.11 CagY: EP3.04 Allergic disease: EP7.07 Cancer-associated fibroblasts: EP3.24 Allergic diseases: EP7.06 Carbapenemas-resistant Enterobacteriaceae: EP10.01 Ammonia: EP10.03 CDX2: EP8.05 Amoxicillin: EP2.51 Cell lines: EP3.16 Anti-H. pylori antibody: EP3.13 Cell-free DNA: EP3.23 Anti-Helicobacter therapy: EP2.45 Changes in gastric mucosa: EP1.07 Anti-inflammatory properties: EP2.49 CHD: EP4.23 Antibacterial: EP2.31 Children: EP5.05, EP5.06, EP8.02, EP8.04, EP8.05, EP8.06, EP8.08, Antibiotic: EP2.40 EP8.09, EP8.11 Antibiotic resistance: EP2.24, EP2.25, EP2.30, EP6.01, EP6.05 Chronic atrophic gastritis: EP2.45, EP4.04, EP4.05, EP4.06, EP4.07, Antibiotic Resistance Breakers: EP2.44 EP4.08 Antibiotic susceptibility: EP2.29 Chronic gastritis: EP4.09, EP4.13 Antibiotic-free strategies: EP2.14 CircRNA and LncRNA: EP6.06 Antibiotics: EP2.02 Circulating microbiome: EP14.01 Antimicrobial peptides: EP2.14 Circulating tumor cell: EP3.17 Antimicrobials: EP11.06 Cirrhosis: EP14.01 Antioxidant: EP13.02 Clarithromycin: EP2.23, EP2.27, EP2.35, EP2.38, EP2.43, EP6.02, Antioxidant properties: EP2.49 EP6.05 Antioxidant protection: EP3.09, EP3.10, EP4.08, EP4.09 Clarithromycin resistance: EP1.03 Antioxidant response: EP4.21 Clarithromycin resistance–guided tailored therapy: EP2.48 Apoptosis: EP4.10 Clostridioides difficile infection: EP13.01 Asthma: EP7.07 Comparative genomics: EP6.12 Atherosclerosis: EP4.20 Cortactin: EP3.03, EP4.02 Atopic dermatitis: EP10.02 Cost-effectiveness: EP3.15 Atrophic gastritis: EP2.51, EP3.27 COVID-19: EP11.06 Autophagy: EP3.21 Cytokeratins: EP8.03 Autoprobiotics: EP2.37 Cytokines: EP4.04, EP8.02, EP8.04

B D Bariatric: EP7.01 Diabetes mellitus: EP4.13 BCGOnko: EP4.22 Diagnostic: EP1.02 Belgium: EP2.35 Diffuse type: EP3.13 Bioinformatics: EP14.04, EP6.10 DNA damage repair: EP3.19 Biopsies: EP3.18 Domestic cats: EP6.12 Bismuth: EP2.27 Duodenal ulcer: EP4.10, EP4.11 Bismuth containing therapy: EP2.09 Dup A: EP4.19 Bismuth quadruple therapy: EP2.41 Duration: EP2.06 Brazil: EP5.09 Dysbiosis: EP11.01

Dyspepsia: EP1.01, EP11.01, EP5.04 Gastrointestinal symptoms: EP11.06 GastroPanel: EP3.06 E Gastroscopy: EP3.18 Education: EP5.06 Genetic diversity: EP6.14 Effectiveness: EP2.27 GERD: EP7.04 Efficacy of treatment: EP2.26 Glutathione: EP3.10, EP4.09 Elderly: EP1.06, EP7.04 Grape seed extracts: EP2.49 Elongation/hummingbird phenotype: EP4.01 Guinea pig: EP4.22 Empirical H. pylori eradication: EP4.18 Gut microbiota: EP10.02 Endoscopy: EP8.11 Enzymatic digestion: EP11.04 H Eosinophilic esophagitis: EP7.05 H. pylori strains: EP6.03 Epidemiology: EP3.11, EP5.09 Helicobacter pylori CagA: EP3.19 Epithelial cell: EP4.15 Helicobacter pylori eradication: EP12.01 Epstein-Barr virus co-infection: EP3.26 Helicobacter pylori stool antigen test: EP1.06 ER stress: EP3.21 Helicobacter pylori vaccine: EP2.52 Eradication: EP2.02, EP2.05, EP2.06, EP2.08, EP2.10, EP2.11, Helicobacter pylori gastritis: EP2.37 EP2.12, EP2.13, EP2.15, EP2.16, EP2.17, EP2.18, EP8.08, EP8.10 Hepatic carcinoma: EP7.09 Eradication rates: EP2.39, EP2.48, EP5.10 Hepatocytes: EP7.10 Eradication success: EP2.29 Heptan: EP6.08 Eradication therapy: EP2.51 Hippo pathway: EP3.22 Eradication treatment: EP1.07 HP resistance to clarithromycin: EP1.07 Erosive oesophagitis: EP2.04 Hp-EuReg: EP2.03 Erosive-ulcerative lesions: EP8.09 Hydrogen: EP14.02 Esophageal microbiome: EP9.01 Hydrogen gas: EP13.02 Eupatilin: EP2.28 Evolution: EP6.14 I Idiopathic Parkinsonism: EP7.11 F Ilex: EP2.47 Fatty liver disease: EP7.02, EP7.09 Immune response: EP4.11 Fecal microbiota transplantation: EP10.01, EP11.05, EP13.01 Immunogenic: EP2.52 Fibrogastroscopy: EP7.06 Immunoglobulins: EP4.05 FineSTRUCTURE: EP6.13 Immunomorphological aspects: EP1.09 First-line: EP2.03, EP2.33 Immunophenotype: EP4.11 Fluoroquinolone: EP6.01, EP6.05 In vitro activity: EP6.07 Focal adhesion: EP6.06 In vitro and in vivo studies: EP2.44 Fourth line: EP2.36 Increase the effectiveness of eradication: EP2.45 Infection: EP2.19, EP2.20, EP2.21, EP2.22, EP2.24, EP2.25 G Inflammation: EP14.01 Galleria mellonella model: EP2.46 Inflammatory bowel disease: EP11.02, EP11.05 Gastric biopsy: EP9.03 Integrin receptors: EP4.01 Gastric cancer: EP3.01, EP3.02, EP3.08, EP3.09, EP3.10, EP3.11, Invadosomes: EP7.10 EP3.12, EP3.13, EP3.15, EP3.16, EP3.17, EP3.20, EP3.21, EP3.22, Irritable bowel syndrome: EP7.12 EP3.23, EP3.25 Gastric carcinogenesis: EP3.19 J Gastric juice: EP3.02 JAKSTAT pathway: EP3.22 Gastric malignancies: EP3.26 Gastric pathology: EP5.09 L Gastritis: EP2.02 Lactate: EP3.20 Gastroduodenitis: EP8.10 Lactic acid-producing bacteria: EP3.20 Gastroesophageal junctional cancer: EP3.27 Lactobacillus salivarius: EP9.03 Gastroesophageal reflux disease: EP8.07 Lactulose and glucose breath tests: EP11.03 Gastrointestinal manifestations: EP7.06 Lamblia intestinalis: EP11.04 KEYWORD INDEX | 3 of 4

Leptin: EP8.06 Oligomerization: EP6.09 levofloxacin: EP2.43 Oral epithelial cell lines: EP4.03 Lipid peroxidation: EP3.09, EP4.08 Osteoporosis: EP7.03 Lipopolysaccharide: EP6.08 Oxygen: EP4.14 Liver fibrosis: EP7.09 Low grade gastric mucosa associated lymphoid tissu: EP12.01 P Passiflora: EP2.47 M Pathologies: EP6.11 Macrolides: EP6.07 PDZ domains: EP6.09 Macrophage: EP4.15 Pediatric patients: EP2.29 Macrophages-foam cells: EP4.20 Perianal Crohn's disease: EP6.06 MALToma: EP4.18 Phylogeny: EP4.17 Mast cells: EP1.08 Phytotherapy: EP2.30 Matrix metalloproteinase-9: EP4.16 Plate count units: EP14.03 Meta-analysis: EP1.04, EP2.01 Point mutations: EP6.04 Methane: EP14.02 Population structure: EP6.13 Metronidazole: EP5.01 Prevalence: EP2.35, EP5.02, EP5.03, EP5.07 Metronidazole resistance: EP2.50 Probiotics: EP8.10, EP14.03, EP2.01, EP2.41 Microbiome: EP14.04, EP3.25, EP6.15 Prognosis: EP3.14 Microbiota: EP11.02, EP11.03 Proliferation: EP4.10 Molecular mimicry: EP4.23 Prophages: EP6.10 Monocytes: EP3.08, EP4.06, EP4.07, EP4.14 Protease: EP6.09 MUC13: EP3.14 MUC5AC: EP4.22 R Mucins: EP3.14 Rac1: EP3.03 Mucous membrane: EP1.08 Radiotherapy: EP12.01 Multidrug resistance: EP2.44, EP2.46 Recurrent Clostridiodes difficile infection: EP11.05 Multiplex Polymerase Chain Reaction: EP2.23 Reinfection rates: EP5.11 Mutation: EP6.01 Rescue therapy: EP2.36 Myocardial infarction: EP1.05 Resistance: EP2.38, EP5.01, EP6.02, EP6.04 Resveratrol phenol derivatives: EP2.46 N Risk factors: EP3.12 Nanostructured lipid carriers: EP2.31 Neoplasia: EP3.05 S NERD: EP9.01 Schoolchildren: EP8.01, EP8.03 NETs: EP4.16 Screening: EP1.03 Neutralizing antibodies: EP2.52 Second-line: EP2.34 Neutrophil extracellular Traps: EP4.16 Selective rapid urease test: EP1.02 Neutrophilic granulocytes: EP3.07 Sensors: EP3.01 Nifuratel: EP2.39 Serological test: EP5.03 Nitric oxide system: EP4.13 Siberia: EP5.05 Nonalcoholic fatty liver disease: EP7.01 Small intestinal bacterial overgrowth: EP11.03 Nonspecific immunity: EP3.07 Somatic mutations: EP3.23 Nonsteroidal anti-inflammatory drugs-gast: EP2.28 Spain: EP2.33, EP2.34 Normal gastric epithelial cells: EP3.24 Staphylococcus aureus: EP10.02 North Eastern Romania: EP5.02 Statin: EP2.32 Notch: EP4.15 Stomach: EP14.04, EP8.01 Nrf2: EP4.21 Stool bank: EP13.01 Surveillance: EP2.43 O Sydney: EP3.18 OLGA system: EP3.06 Symptoms: EP8.11 OLGIM system: EP3.06 4 of 4 | KEYWORD INDEX

T U Test-and-treat: EP1.01 Unsaturated fatty acids: EP13.02 The 23S rRNA Clar gene region: EP6.02 Urea breath test: EP1.01, EP1.05 The genomic polymorphism: EP6.03 Urease: EP10.03 Third line: EP2.36 Toll-like receptor 5: EP3.04, EP3.05 V Transcriptome analysis: EP2.50 VacA: EP4.02 Transforming growth factor beta: EP3.24 Vav2: EP3.03 Treatment: EP2.10, EP2.11, EP2.12, EP2.13, EP2.15, EP2.16, EP2.17, Virulence factors: EP4.17, EP4.19 EP2.18, EP2.19, EP2.20, EP2.21, EP2.22, EP2.32, EP2.37 Volatile organic compound: EP3.01, EP3.02, EP3.16 Trimebutine: EP11.01 Vonoprazan: EP2.04 Tryptase: EP1.09 Twins: EP6.15 W TWIST: EP3.17 Watercress: EP10.03 Type IV secretion: EP4.03