DOCSLIB.ORG

List of Genes Used to Reconstruct Metabolic Map of Bin O “Ca

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
List of Genes Used to Reconstruct Metabolic Map of Bin O “Ca Table S3: List of genes used to reconstruct metabolic map of bin O “Ca. Sabulitectum silens” Glycolysis (complete) No. Gene(s) Gene product EC no. contig G1 glkA Glucokinase 2.7.1.2 contig00029 G2 pgi Glucose-6-phosphate isomerase 5.3.1.9 contig00016 G3 pfkA 6-phosphofructokinase isozyme 1 2.7.1.11 contig00003 G4 pfp Pyrophosphate--fructose 6-phosphate 1-phosphotransferase 2.7.1.90 contig00009 G5 fba Fructose-bisphosphate aldolase 4.1.2.13 contig00010 G6 tpiA Triosephosphate isomerase 5.3.1.1 contig00009 G7 gap Glyceraldehyde-3-phosphate dehydrogenase 1.2.1.12 contig00009 G8 pgk Phosphoglycerate kinase 2.7.2.3 contig00009 G9 pgk/tpi Bifunctional PGK/TIM 2.7.2.3/5.3.1.1 contig00009 G10 apgM 2,3-bisphosphoglycerate-independent phosphoglycerate mutase 5.4.2.12 contig00048 G11 eno Enolase 4.2.1.11 contig00002 G12 pyk Pyruvate kinase 2.7.1.40 contig00002 G13 ppdK Pyruvate, phosphate dikinase 2.7.9.1 contig00002 G14 pckA Phosphoenolpyruvate carboxykinase [ATP] 4.1.1.49 contig00002 Nonoxidative pentose phosphate pathway (complete) No. Gene(s) Gene product EC no. contig P1 tkt Transketolase 2.2.1.1 contig00046 P2 tal Transaldolase 2.2.1.2 contig00046 P3 rpe Ribulose-phosphate 3-epimerase 5.1.3.1 contig00051 P4 rpiB Ribose-5-phosphate isomerase B 5.3.1.- contig00002 P5 prs Ribose-phosphate pyrophosphokinase 2.7.6.1 contig00002 P6 deoB Phosphopentomutase 5.4.2.7 contig00002 P7 deoC Deoxyribose-phosphate aldolase 4.1.2.4 contig00046 Starch and sucrose metabolism (complete) No. Gene(s) Gene product EC no. contig S1 algC Phosphomannomutase/phosphoglucomutase 5.4.2.2 contig00016 S2 glgC Glucose-1-phosphate adenylyltransferase 2.7.7.27 contig00025 S3 rmlA Glucose-1-phosphate thymidylyltransferase 2.7.7.24 contig00003 S4 glgA1 Glycogen synthase 1 2.4.1.21 contig00002 S5 glgB 1,4-alpha-glucan branching enzyme GlgB 2.4.1.18 contig00079 S6 malQ 4-alpha-glucanotransferase 2.4.1.25 contig00013 Glycosyl hydrolases/transferases No. Gene(s) Gene product EC no. contig GH1 Glycosyl hydrolase family 85 3.2.1.96 contig00013 GH2 Cellulase (glycosyl hydrolase family 5) 3.2.1.-. contig00002 GH3 Glycosyl hydrolase family 94 2.4.1.-. contig00016 GT1 Glycosyltransferase family 9 (heptosyltransferase) 2.4.1.-. contig00084 GT2 Glycosyl transferases group 1 2.4.-.-. contig00003 GT3 Glycosyl transferase family 2 2.4.-.-. contig00081 Fermentation No. Gene(s) Gene product EC no. contig F1 nifJ Pyruvate-flavodoxin oxidoreductase 1.2.7.1 contig00048 F2 pta Phosphate acetyltransferase 2.3.1.8 contig00013 F3 ackA Acetate kinase 2.7.2.1 contig00009 F4 Aldehyde ferredoxin oxidoreductase, domains 2 %26 3 1.2.7.5 contig00010 F5 aldHT Aldehyde dehydrogenase, thermostable 1.2.1.5 contig00002 F6 adhT Alcohol dehydrogenase 1.1.1.1 contig00016 F7 buk2 putative butyrate kinase 2 2.7.2.7 contig00042 F8 phosphate butyryltransferase 2.3.1.19 contig00002 F9 gdhA NAD(P)-specific glutamate dehydrogenase 1.4.1.3 contig00002 F10 korA 2-oxoglutarate oxidoreductase subunit KorA 1.2.7.3 contig00003 F10 korB 2-oxoglutarate oxidoreductase subunit KorB 1.2.7.3 contig00003 F11 sucD Succinyl-CoA ligase [ADP-forming] subunit alpha 6.2.1.5 contig00013 F12 gltD Glutamate synthase [NADPH] small chain 1.4.7.1 contig00002 F13 NAD-dependent malic enzyme 1.1.1.40 contig00009 F14 fumarate hydratase 4.2.1.2 contig00009 F15 citE Citrate lyase subunit beta 4.1.3.6 contig00002 F16 acsA Acetyl-coenzyme A synthetase 6.2.1.1 contig00112 F17 scpA Methylmalonyl-CoA mutase 5.4.99.2 contig00002 F18 Methylmalonyl-CoA carboxyltransferase 12S subunit 2.1.3.1 contig00002 MEP/DOXP pathway (complete) No. Gene(s) Gene product EC no. contig I1 dxs 1-deoxy-D-xylulose-5-phosphate synthase 2.2.1.7 contig00010 I2 dxr 1-deoxy-D-xylulose 5-phosphate reductoisomerase 1.1.1.267 contig00046 I3 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase 2.7.7.60 contig00002 I4 ispE 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase 2.7.1.148 contig00003 I5 ispF 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase 4.6.1.12 contig00002 I6 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase 1.17.7.1 contig00013 I7 ispH 4-hydroxy-3-methylbut-2-enyl diphosphate reductase 1.17.1.2 contig00010 I8 ispA Farnesyl diphosphate synthase 2.5.1.1 contig00009 Nicotidamide synthesis No. Gene(s) Gene product EC no. contig C1 nadB L-aspartate oxidase 1.4.3.16 contig00016 C2 nadA Quinolinate synthase A 2.5.1.72 contig00048 C3 nadC Nicotinate-nucleotide pyrophosphorylase [carboxylating] 2.4.2.19 contig00082 C4 nadD Nicotinate-nucleotide adenylyltransferase 2.7.7.18 contig00076 C5 nadE NH(3)-dependent NAD(+) synthetase 6.3.1.5 contig00009 Biotin synthesis No. Gene(s) Gene product EC no. contig C6 bioA Adenosylmethionine-8-amino-7-oxononanoate aminotransferase 2.6.1.62 contig00029 C7 bioB Biotin synthase 2.8.1.6 contig00029 C8 bioC Malonyl-[acyl-carrier protein] O-methyltransferase 2.1.1.197 contig00029 C9 bioD1 ATP-dependent dethiobiotin synthetase BioD 1 6.3.3.3 contig00029 C10 bioF 8-amino-7-oxononanoate synthase 2 2.3.1.47 contig00029 Thiamine synthesis No. Gene(s) Gene product EC no. contig C11 thiC Phosphomethylpyrimidine synthase 4.1.99.17 contig00082 C12 thiE Thiamine-phosphate synthase 2.5.1.3 contig00002 C13 thiH 2-iminoacetate synthase 4.1.99.19 contig00002 C14 thiM Hydroxyethylthiazole kinase 2.7.1.50 contig00002 C15 thiD Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase 2.7.4.7 contig00002 C16 thiL Thiamine-monophosphate kinase 2.7.4.16 contig00002 Riboflavin synthesis No. Gene(s) Gene product EC no. contig C17 ribBA Riboflavin biosynthesis protein RibBA 4.1.99.12/3.5.4.25 contig00002 C18 ribH 6,7-dimethyl-8-ribityllumazine synthase 2.5.1.78 contig00002 C19 ribE Riboflavin synthase 2.5.1.9 contig00002 C20 ribD Riboflavin biosynthesis protein RibD 3.5.4.26/1.1.1.193 contig00002 Nuo-like NADH Oxidoreductase No. Gene(s) Gene product EC no. contig N1 nuoE NADH-quinone oxidoreductase subunit E 1.6.5.11 contig00002 N1 nuoC1 NADH-quinone oxidoreductase subunit C 1 1.6.5.11 contig00002 N1 nuoD NADH-quinone oxidoreductase subunit D 1.6.5.11 contig00002 N1 nuoH NADH-quinone oxidoreductase subunit H 1.6.5.11 contig00002 N1 nuoI NADH-quinone oxidoreductase subunit I 1.6.5.11 contig00002 N1 ndhK NAD(P)H-quinone oxidoreductase subunit K 1.6.5.11 contig00002 N1 nox NADH dehydrogenase 1.6.99.3 contig00002 Hyd-like (Fe) Hydrogenase No. Gene(s) Gene product EC no. contig H1 hydA Periplasmic [Fe] hydrogenase large subunit 1.12.7.2 contig00084 H1 hndC NADP-reducing hydrogenase subunit HndC 1.12.1.3 contig00084 H1 hndD NADP-reducing hydrogenase subunit HndD 1.12.1.3 contig00084 H1 nqo2 NADH-quinone oxidoreductase subunit 2 1.6.5.11 contig00084 H1 Iron hydrogenase 1 1.12.7.2 contig00084 Hnd-like Hydrogenase No. Gene(s) Gene product EC no. contig H2 hndA NADP-reducing hydrogenase subunit HndA 1.-.-.- contig00010 H2 hndC NADP-reducing hydrogenase subunit HndC 1.-.-.- contig00010 H2 hndD NADP-reducing hydrogenase subunit HndD 1.-.-.- contig00010 Hox-like Hydrogenase No. Gene(s) Gene product EC no. contig H3 hoxE bidirectional hydrogenase complex protein HoxE 1.12.1.2 contig00010 H3 hoxF NAD-reducing hydrogenase HoxS subunit alpha 1.12.1.2 contig00048 H3 hoxH NAD-reducing hydrogenase HoxS subunit beta 1.12.1.2 contig00048 H3 hoxU NAD-reducing hydrogenase HoxS subunit gamma 1.12.1.2 contig00048 H3 hoxY NAD-reducing hydrogenase HoxS subunit delta 1.12.1.2 contig00048 Hyp-like Hydrogenase chaperone No. Gene(s) Gene product EC no. contig H4 hypA hydrogenase nickel incorporation protein HypA - contig00003 H4 hypB Hydrogenase/urease nickel incorporation protein HypB - contig00003 H4 hypD Hydrogenase isoenzymes formation protein HypD - contig00048 H4 hypE Hydrogenase expression/formation protein HypE - contig00048 H4 hypF Carbamoyltransferase HypF - contig00048 V-type proton/sodium ATPase No. Gene(s) Gene product EC no. contig V1 ntpA V-type sodium ATPase catalytic subunit A 3.6.3.- contig00013 V1 ntpB V-type sodium ATPase subunit B 3.6.3.- contig00013 V1 ntpK V-type sodium ATPase subunit K 3.6.3.- contig00013 V1 ntpD V-type sodium ATPase subunit D 3.6.3.- contig00013 V1 ntpG V-type sodium ATPase subunit G 3.6.3.- contig00013 V1 atpC V-type ATP synthase subunit C 3.6.3.- contig00013 V1 atpE V-type proton ATPase subunit E 3.6.3.- contig00013 V1 V-type ATP synthase subunit I 3.6.3.- contig00013 Electron transport complex No. Gene(s) Gene product EC no. contig E1 rnfA Electron transport complex protein RnfA 1.18.1.3 contig00055 E1 rnfB Electron transport complex protein RnfB - contig00055 E1 rnfC Electron transport complex protein RnfC - contig00055 E1 rnfD Electron transport complex protein RnfD - contig00055 E1 rnfE Electron transport complex protein RnfE - contig00055 E1 rnfG Electron transport complex protein RnfG - contig00055 Phosphate uptake No. Gene(s) Gene product EC no. contig T1 pstA Phosphate transport system permease protein PstA - contig00003 T1 pstB Phosphate import ATP-binding protein PstB - contig00003 T1 pstB3 Phosphate import ATP-binding protein PstB 3 - contig00003 T1 pstC Phosphate transport system permease protein PstC - contig00003 Na+/Pi-cotransporter contig00003 Potassium uptake No. Gene(s) Gene product EC no. contig T2 trkA Trk system potassium uptake protein TrkA - contig00002 T2 trkG Trk system potassium uptake protein TrkG - contig00002 T2 trkH Trk system potassium uptake protein TrkH - contig00002 T3 ktrA Ktr system potassium uptake protein A - contig00010 T3 ktrB Ktr system potassium uptake protein B - contig00010 Iron uptake No.
Load more

Recommended publications
  • The Pennsylvania State University the Graduate School Department
    The Pennsylvania State University The Graduate School Department of Chemistry SUBSTRATE POSITIONING AND CHANNELING OF ESCHERICHIA COLI QUINOLINATE SYNTHASE A Thesis in Chemistry by Lauren A. Sites 2012 Lauren A. Sites Submitted in Partial Fulfillment of the Requirements for the Degree of Master of Science December 2012 ii The thesis of Lauren A. Sites was reviewed and approved* by the following: Squire J. Booker Associate Professor of Chemistry Thesis Advisor Carsten Krebs Professor of Chemistry Scott A. Showalter Assistant Professor of Chemistry Kenneth S. Feldman Professor of Chemistry Head of Department *Signatures are on file in the Graduate School iii ABSTRACT The essential cofactor nicotinamide adenine dinucleotide (NAD) is consumed in many metabolic reactions in the cell, necessitating the need to synthesize NAD. In most bacteria, the de novo pathway to form NAD begins with two unique enzymes that have been extensively studied herein. The first enzyme in the pathway, L-aspartate oxidase, performs a two-electron oxidation of L-aspartate to form iminoaspartate. This flavin containing enzyme can undergo multiple catalytic turnovers given the oxidants, fumarate or molecular oxygen, to afford the oxidized form of the enzyme. The second enzyme in the pathway, quinolinate synthase or NadA, condenses iminoaspartate and dihydroxyacetone phosphate to form quinolinic acid, the backbone of the pyridine ring of NAD. Many have postulated that these two enzymes can operate as an enzyme complex, yet no substantial evidence of this complex has been demonstrated. Investigations to examine the possible protein-protein interactions of the two enzymes were carried out, yet no obvious interaction was seen by the techniques employed.
    [Show full text]
  • Galactokinase (B) Glucokinase (C) Galactose-1-Phosphate Uridyltransferase (D) UDP-Galactose 4- Epimerase Sol
    1. Which of the following enzymes are not involved in galactose metabolism? (a) Galactokinase (b) Glucokinase (c) Galactose-1-Phosphate Uridyltransferase (d) UDP-Galactose 4- epimerase Sol. (b) Glucokinase. 2. Which of the following enzymes leads to a glycogen storage disease known as Tarui’s disease? (a) Glucokinase (b) Pyruvate Kinase (c) Phosphofructokinase (d) Phosphoglucomutase Sol. (c) Phosphofructokinase. 3. Which of the following enzymes is defective in galactosemia- a fatal genetic disorder in infants? (a) Glucokinase (b) Galactokinase (c) UDP-Galactose 4- epimerase (d) Galactose-1-Phosphate Uridyltransferase Sol. (d) Galactose-1-Phosphate Uridyltransferase. 4. Which of the following enzyme deficiency leads to hemolytic anaemia? (a) Glucokinase (b) Pyruvate Kinase (c) Phosphoglucomutase (d) Phosphofructokinase Sol. (b) Pyruvate Kinase. 5. Which of the following glucose transporters are important in fructose transport in the intestine? (a) GLUT5 (b) GLUT3 (c) GLUT4 (d) GLUT7 Sol. (a) GLUT5. 6. Which of the following is a tricarboxylic acid? (a) Acetic acid (b) Succinic acid (c) Oxaloacetic acid (d) Citric acid Sol.(d) Citric acid. 7. Which of the following enzymes plays an important role in tumour metabolism? (a) Glucokinase (b) Pyruvate Kinase M2 (c) Phosphoglucomutase (d) Phosphofructokinase Sol. (b) Pyruvate Kinase M2. 8. Which of the following metabolites negatively regulates pyruvate kinase? 1. (a) Citrate (b) Alanine (c) Acetyl CoA (d) Fructose-1,6-Bisphosphate Sol. (b) Alanine 9. The glycerol phosphate shuttle functions in___________. (a) Lipid catabolism (b) Triglyceride synthesis (c) Anaerobic glycolysis for the regeneration of NAD (d) Aerobic glycolysis to transport NADH equivalents resulting from glycolysis into mitochondria. Sol. (d) Aerobic glycolysis to transport NADH equivalents resulting from glycolysis into mitochondria.
    [Show full text]
  • Supplementary Materials
    Supplementary Materials Figure S1. Differentially abundant spots between the mid-log phase cells grown on xylan or xylose. Red and blue circles denote spots with increased and decreased abundance respectively in the xylan growth condition. The identities of the circled spots are summarized in Table 3. Figure S2. Differentially abundant spots between the stationary phase cells grown on xylan or xylose. Red and blue circles denote spots with increased and decreased abundance respectively in the xylan growth condition. The identities of the circled spots are summarized in Table 4. S2 Table S1. Summary of the non-polysaccharide degrading proteins identified in the B. proteoclasticus cytosol by 2DE/MALDI-TOF. Protein Locus Location Score pI kDa Pep. Cov. Amino Acid Biosynthesis Acetylornithine aminotransferase, ArgD Bpr_I1809 C 1.7 × 10−4 5.1 43.9 11 34% Aspartate/tyrosine/aromatic aminotransferase Bpr_I2631 C 3.0 × 10−14 4.7 43.8 15 46% Aspartate-semialdehyde dehydrogenase, Asd Bpr_I1664 C 7.6 × 10−18 5.5 40.1 17 50% Branched-chain amino acid aminotransferase, IlvE Bpr_I1650 C 2.4 × 10−12 5.2 39.2 13 32% Cysteine synthase, CysK Bpr_I1089 C 1.9 × 10−13 5.0 32.3 18 72% Diaminopimelate dehydrogenase Bpr_I0298 C 9.6 × 10−16 5.6 35.8 16 49% Dihydrodipicolinate reductase, DapB Bpr_I2453 C 2.7 × 10−6 4.9 27.0 9 46% Glu/Leu/Phe/Val dehydrogenase Bpr_I2129 C 1.2 × 10−30 5.4 48.6 31 64% Imidazole glycerol phosphate synthase Bpr_I1240 C 8.0 × 10−3 4.7 22.5 8 44% glutamine amidotransferase subunit Ketol-acid reductoisomerase, IlvC Bpr_I1657 C 3.8 × 10−16
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al
    US 2014O155567A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk et al. (43) Pub. Date: Jun. 5, 2014 (54) MICROORGANISMS AND METHODS FOR (60) Provisional application No. 61/331,812, filed on May THE BIOSYNTHESIS OF BUTADENE 5, 2010. (71) Applicant: Genomatica, Inc., San Diego, CA (US) Publication Classification (72) Inventors: Mark J. Burk, San Diego, CA (US); (51) Int. Cl. Anthony P. Burgard, Bellefonte, PA CI2P 5/02 (2006.01) (US); Jun Sun, San Diego, CA (US); CSF 36/06 (2006.01) Robin E. Osterhout, San Diego, CA CD7C II/6 (2006.01) (US); Priti Pharkya, San Diego, CA (52) U.S. Cl. (US) CPC ................. CI2P5/026 (2013.01); C07C II/I6 (2013.01); C08F 136/06 (2013.01) (73) Assignee: Genomatica, Inc., San Diego, CA (US) USPC ... 526/335; 435/252.3:435/167; 435/254.2: (21) Appl. No.: 14/059,131 435/254.11: 435/252.33: 435/254.21:585/16 (22) Filed: Oct. 21, 2013 (57) ABSTRACT O O The invention provides non-naturally occurring microbial Related U.S. Application Data organisms having a butadiene pathway. The invention addi (63) Continuation of application No. 13/101,046, filed on tionally provides methods of using Such organisms to produce May 4, 2011, now Pat. No. 8,580,543. butadiene. Patent Application Publication Jun. 5, 2014 Sheet 1 of 4 US 2014/O155567 A1 ?ueudos!SMS |?un61– Patent Application Publication Jun. 5, 2014 Sheet 2 of 4 US 2014/O155567 A1 VOJ OO O Z?un61– Patent Application Publication US 2014/O155567 A1 {}}} Hººso Patent Application Publication Jun.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Pyruvate-Phosphate Dikinase of Oxymonads and Parabasalia and the Evolution of Pyrophosphate-Dependent Glycolysis in Anaerobic Eukaryotes† Claudio H
    EUKARYOTIC CELL, Jan. 2006, p. 148–154 Vol. 5, No. 1 1535-9778/06/$08.00ϩ0 doi:10.1128/EC.5.1.148–154.2006 Copyright © 2006, American Society for Microbiology. All Rights Reserved. Pyruvate-Phosphate Dikinase of Oxymonads and Parabasalia and the Evolution of Pyrophosphate-Dependent Glycolysis in Anaerobic Eukaryotes† Claudio H. Slamovits and Patrick J. Keeling* Canadian Institute for Advanced Research, Botany Department, University of British Columbia, 3529-6270 University Boulevard, Vancouver, British Columbia V6T 1Z4, Canada Received 29 September 2005/Accepted 8 November 2005 In pyrophosphate-dependent glycolysis, the ATP/ADP-dependent enzymes phosphofructokinase (PFK) and pyruvate kinase are replaced by the pyrophosphate-dependent PFK and pyruvate phosphate dikinase (PPDK), respectively. This variant of glycolysis is widespread among bacteria, but it also occurs in a few parasitic anaerobic eukaryotes such as Giardia and Entamoeba spp. We sequenced two genes for PPDK from the amitochondriate oxymonad Streblomastix strix and found evidence for PPDK in Trichomonas vaginalis and other parabasalia, where this enzyme was thought to be absent. The Streblomastix and Giardia genes may be related to one another, but those of Entamoeba and perhaps Trichomonas are distinct and more closely related to bacterial homologues. These findings suggest that pyrophosphate-dependent glycolysis is more widespread in eukaryotes than previously thought, enzymes from the pathway coexists with ATP-dependent more often than previously thought and may be spread by lateral transfer of genes for pyrophosphate-dependent enzymes from bacteria. Adaptation to anaerobic metabolism is a complex process (PPDK), respectively (for a comparison of these reactions, see involving changes to many proteins and pathways of critical reference 21).
    [Show full text]
  • Yeast As a Tool to Understand the Significance of Human Disease
    G C A T T A C G G C A T genes Review Yeast as a Tool to Understand the Significance of Human Disease-Associated Gene Variants Tiziana Cervelli and Alvaro Galli * Yeast Genetics and Genomics Group, Laboratory of Functional Genetics and Genomics, Institute of Clinical Physiology CNR, Via Moruzzi 1, 56125 Pisa, Italy; [email protected] * Correspondence: [email protected] Abstract: At present, the great challenge in human genetics is to provide significance to the growing amount of human disease-associated gene variants identified by next generation DNA sequencing technologies. Increasing evidences suggest that model organisms are of pivotal importance to addressing this issue. Due to its genetic tractability, the yeast Saccharomyces cerevisiae represents a valuable model organism for understanding human genetic variability. In the present review, we show how S. cerevisiae has been used to study variants of genes involved in different diseases and in different pathways, highlighting the versatility of this model organism. Keywords: yeast; Saccharomyces cerevisiae; functional assays; Mendelian disease; cancer; human gene variants 1. Introduction The advent of next generation DNA sequences technologies allows us to identify Citation: Cervelli, T.; Galli, A. Yeast individual genetic variants, and this revolutionized the strategy for discovering the cause as a Tool to Understand the of several genetic and multifactorial diseases. The association between genetic variants Significance of Human and disease risk can potentially overturn our understanding of common disease. The Disease-Associated Gene Variants. discovery of pathways and processes that are causally involved in a disease, so far not Genes 2021, 12, 1303. https:// linked, may open the way towards the development of targeted therapies and prevention doi.org/10.3390/genes12091303 strategies.
    [Show full text]
  • The Role of the Salvage Pathway in Nucleotide Sugar Biosynthesis
    THE ROLE OF THE SALVAGE PATHWAY IN NUCLEOTIDE SUGAR BIOSYNTHESIS: IDENTIFICATION OF SUGAR KINASES AND NDP-SUGAR PYROPHOSPHORYLASES by TING YANG (Under the Direction of Maor Bar-Peled) ABSTRACT The synthesis of polysaccharides, glycoproteins, glycolipids, glycosylated secondary metabolites and hormones requires a large number of glycosyltransferases and a constant supply of nucleotide sugars. In plants, photosynthesis and the NDP-sugar inter-conversion pathway are the major entry points to form NDP-sugars. In addition to these pathways is the salvage pathway, a less understood metabolism that provides the flux of NDP-sugars. This latter pathway involves the hydrolysis of glycans to free sugars, sugar transport, sugar phosphorylation and nucleotidylation. The balance between glycan synthesis and recycling as well as its regulation at various plant developmental stages remains elusive as many of the molecular components are unknown. To understand how the salvage pathway contributes to the sugar flux and cell wall biosynthesis, my research focused on the functional identification of salvage pathway sugar kinases and NDP-sugar pyrophosphorylases. This research led to the first identification and enzymatic characterization of galacturonic acid kinase (GalA kinase), galactokinase (GalK), a broad UDP-sugar pyrophosphorylase (sloppy), two promiscuous UDP-GlcNAc pyrophosphorylases (GlcNAc-1-P uridylyltransferases), as well as UDP-sugar pyrophosphorylase paralogs from Trypanosoma cruzi and Leishmania major. To evaluate the salvage pathway in plant biology, we further investigated a sugar kinase mutant: galacturonic acid kinase mutant (galak) and determined if and how galak KO mutant affects the synthesis of glycans in Arabidopsis. Feeding galacturonic acid to the seedlings exhibited a 40-fold accumulation of free GalA in galak mutant, while the wild type (WT) plant readily metabolizes the fed-sugar.
    [Show full text]
  • Letters to Nature
    letters to nature Received 7 July; accepted 21 September 1998. 26. Tronrud, D. E. Conjugate-direction minimization: an improved method for the re®nement of macromolecules. Acta Crystallogr. A 48, 912±916 (1992). 1. Dalbey, R. E., Lively, M. O., Bron, S. & van Dijl, J. M. The chemistry and enzymology of the type 1 27. Wolfe, P. B., Wickner, W. & Goodman, J. M. Sequence of the leader peptidase gene of Escherichia coli signal peptidases. Protein Sci. 6, 1129±1138 (1997). and the orientation of leader peptidase in the bacterial envelope. J. Biol. Chem. 258, 12073±12080 2. Kuo, D. W. et al. Escherichia coli leader peptidase: production of an active form lacking a requirement (1983). for detergent and development of peptide substrates. Arch. Biochem. Biophys. 303, 274±280 (1993). 28. Kraulis, P.G. Molscript: a program to produce both detailed and schematic plots of protein structures. 3. Tschantz, W. R. et al. Characterization of a soluble, catalytically active form of Escherichia coli leader J. Appl. Crystallogr. 24, 946±950 (1991). peptidase: requirement of detergent or phospholipid for optimal activity. Biochemistry 34, 3935±3941 29. Nicholls, A., Sharp, K. A. & Honig, B. Protein folding and association: insights from the interfacial and (1995). the thermodynamic properties of hydrocarbons. Proteins Struct. Funct. Genet. 11, 281±296 (1991). 4. Allsop, A. E. et al.inAnti-Infectives, Recent Advances in Chemistry and Structure-Activity Relationships 30. Meritt, E. A. & Bacon, D. J. Raster3D: photorealistic molecular graphics. Methods Enzymol. 277, 505± (eds Bently, P. H. & O'Hanlon, P. J.) 61±72 (R. Soc. Chem., Cambridge, 1997).
    [Show full text]
  • 1577 MOLECULAR BIOLOGY of PYRIDINE NUCLEOTIDE and NICOTINE BIOSYNTHESIS Akir
    [Frontiers in Bioscience 9, 1577-1586, May 1, 2004] MOLECULAR BIOLOGY OF PYRIDINE NUCLEOTIDE AND NICOTINE BIOSYNTHESIS Akira Katoh and Takashi Hashimoto Graduate School of Biological Sciences, Nara Institute of Science and Technology, Ikoma, Nara 630-0192, Japan TABLE OF CONTENTS 1. Abstract 2. Introduction 3. de novo NAD biosynthesis in bacteria: Aspartate pathway 4. de novo NAD biosynthesis in animals: Kynurenine pathway 5. de novo DNA biosynthesis in plants: Precursor feeding studies 6. de novo NAD biosynthesis in plants: Aspartate pathway 7. de novo NAD biosynthesis in plants: Kynurenine pathway 8. NAD salvage pathway in bacteria, yeast and mammals 9. NAD salvage pathway in plants 10. Nicotine biosynthesis in tobacco 11. Pathway regulation 12. Acknowledgment 13. References 1. ABSTRACT Nicotinamide adenine dinucleotide (NAD) is a the pyruvate dehydrogenase complex in the citric acid ubiquitous coenzyme in oxidation-reduction reactions. cycle. Recent animal and fungal studies show that it also plays important roles in transcriptional regulation, NAD also regulates gene expression by longevity, and age-associated diseases. NAD is modulating activities of some animal transcription synthesized de novo from aspartic acid in E. coli or factors (2). NADH enhances the heterodimerization of from tryptophan in animals, by way of quinolinic acid. BMAL1 and BMAL2, the transcription factors involved Although the number of biochemical studies on NAD is in the circadian clock (3), and their DNA binding very limited, a bioinformatic search of genome activity, whereas NAD attenuates these activities. The databases suggests that Arabidopsis (dicots) synthesizes binding of the co-repressor CtBP to transcriptional NAD from aspartic acid whereas rice (monocots) may repressors is reported to be regulated by NAD and utilize both aspartate and tryptophan as starting amino NADH (4).
    [Show full text]
  • Detoxification of Lignocellulose-Derived Microbial Inhibitory Compounds by Clostridium Beijerinckii NCIMB 8052 During Acetone-Butanol-Ethanol Fermentation
    Detoxification of Lignocellulose-derived Microbial Inhibitory Compounds by Clostridium beijerinckii NCIMB 8052 during Acetone-Butanol-Ethanol Fermentation DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Yan Zhang Graduate Program in Animal Sciences The Ohio State University 2013 Dissertation Committee: Thaddeus C. Ezeji, Advisor Steven C. Loerch Sandra G. Velleman Zhongtang Yu Venkat Gopalan Copyrighted by Yan Zhang 2013 Abstract Pretreatment and hydrolysis of lignocellulosic biomass to fermentable sugars generate a complex mixture of microbial inhibitors such as furan aldehydes (e.g., furfural), which at sublethal concentration in the fermentation medium can be tolerated or detoxified by acetone butanol ethanol (ABE)-producing Clostridium beijerinckii NCIMB 8052. The response of C. beijerinckii to furfural at the molecular level, however, has not been directly studied. Therefore, this study was to elucidate mechanism employed by C. beijerinckii to detoxify lignocellulose-derived microbial inhibitors and use this information to develop inhibitor-tolerant C. beijerinckii. Towards the long-term goal of developing inhibitor-tolerant Clostridium strains, the first objective was to evaluate ABE fermentation by C. beijerinckii using different proportions of Miscanthus giganteus hydrolysates as carbon source. Compared to the growth of C. beijerinckii in control medium, C. beijerinckii experienced different degrees of inhibition. The degree of inhibition was dose-dependent, and C. beijerinckii did not grow in P2 medium with greater than 25% (v/v) Miscanthus giganteus hydrolysates. To improve tolerance of C. beijerinckii to inhibitors, supplementation of P2 medium with undiluted (100%) Miscanthus giganteus hydrolysates with 4 g/L CaCO3 resulted in successful growth of and ABE production by C.
    [Show full text]
  • The Microbiota-Produced N-Formyl Peptide Fmlf Promotes Obesity-Induced Glucose
    Page 1 of 230 Diabetes Title: The microbiota-produced N-formyl peptide fMLF promotes obesity-induced glucose intolerance Joshua Wollam1, Matthew Riopel1, Yong-Jiang Xu1,2, Andrew M. F. Johnson1, Jachelle M. Ofrecio1, Wei Ying1, Dalila El Ouarrat1, Luisa S. Chan3, Andrew W. Han3, Nadir A. Mahmood3, Caitlin N. Ryan3, Yun Sok Lee1, Jeramie D. Watrous1,2, Mahendra D. Chordia4, Dongfeng Pan4, Mohit Jain1,2, Jerrold M. Olefsky1 * Affiliations: 1 Division of Endocrinology & Metabolism, Department of Medicine, University of California, San Diego, La Jolla, California, USA. 2 Department of Pharmacology, University of California, San Diego, La Jolla, California, USA. 3 Second Genome, Inc., South San Francisco, California, USA. 4 Department of Radiology and Medical Imaging, University of Virginia, Charlottesville, VA, USA. * Correspondence to: 858-534-2230, [email protected] Word Count: 4749 Figures: 6 Supplemental Figures: 11 Supplemental Tables: 5 1 Diabetes Publish Ahead of Print, published online April 22, 2019 Diabetes Page 2 of 230 ABSTRACT The composition of the gastrointestinal (GI) microbiota and associated metabolites changes dramatically with diet and the development of obesity. Although many correlations have been described, specific mechanistic links between these changes and glucose homeostasis remain to be defined. Here we show that blood and intestinal levels of the microbiota-produced N-formyl peptide, formyl-methionyl-leucyl-phenylalanine (fMLF), are elevated in high fat diet (HFD)- induced obese mice. Genetic or pharmacological inhibition of the N-formyl peptide receptor Fpr1 leads to increased insulin levels and improved glucose tolerance, dependent upon glucagon- like peptide-1 (GLP-1). Obese Fpr1-knockout (Fpr1-KO) mice also display an altered microbiome, exemplifying the dynamic relationship between host metabolism and microbiota.
    [Show full text]