DOCSLIB.ORG

Consensus Clinical Management Guideline for Pantothenate Kinase-Associated Neurodegeneration (PKAN)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Consensus Clinical Management Guideline for Pantothenate Kinase-Associated Neurodegeneration (PKAN) YMGME-06119; No. of pages: 10; 4C: Molecular Genetics and Metabolism xxx (2016) xxx–xxx Contents lists available at ScienceDirect Molecular Genetics and Metabolism journal homepage: www.elsevier.com/locate/ymgme Consensus clinical management guideline for pantothenate kinase-associated neurodegeneration (PKAN) Penelope Hogarth a,b,ManjuA.Kurianc, Allison Gregory a,BarbaraCsányic,TamaraZagustind,TomaszKmiece, Patricia Wood f,AngelikaKluckeng, Natale Scalise h, Francesca Sofia i, Thomas Klopstock j,k,l, Giovanna Zorzi m, Nardo Nardocci m, Susan J. Hayflick a,b,⁎ a Department of Molecular & Medical Genetics, Oregon Health & Science University, Portland, USA b Department of Neurology, Oregon Health & Science University, Portland, USA c Molecular Neurosciences, Developmental Neurosciences Programme, UCL Institute of Child Health, London, UK d Department of Physiatry, Children's Healthcare of Atlanta, GA, USA e Department of Child Neurology, The Children's Memorial Health Institute, Warsaw, Poland f NBIA Disorders Association, El Cajon, CA, USA g Hoffunngsbaum e.V., Velbert, Germany h AISNAF – Associazione Italiana Sindromi Neurodegenerative Da Accumulo Di Ferro, Rossano, Italy i Science Compass, Milano, Italy j Department of Neurology, Friedrich-Baur-Institute, Ludwig-Maximilians-University, Munich, Germany k German Center for Neurodegenerative Diseases (DZNE), Munich, Germany l Munich Cluster for Systems Neurology (SyNergy), Munich, Germany m Department of Pediatric Neuroscience, IRCCS Foundation Neurological Institute C. Besta, Milan, Italy 1. Introduction search terms: ‘PKAN’, ‘pantothenate kinase-associated neurodegenera- tion’, ‘HSS’, ‘Hallervorden-Spatz syndrome’, ‘NBIA’,and‘neurodegenera- Pantothenate kinase-associated neurodegeneration (PKAN, former- tion with brain iron accumulation.’ Limited consideration was made of ly Hallervorden–Spatz syndrome, OMIM #234200) is the most common publications utilizing aggregated data from multiple NBIA disorders or neurodegeneration with brain iron accumulation (NBIA) disorder, with in which a diagnosis of PKAN could not be confirmed based on the infor- an estimated incidence of 1–3 per million [1] and accounting for about mation provided. half of NBIA cases [2]. As is the case for most rare disorders, evidence- A draft guideline was developed and submitted for review in four based guidance for the clinical management of PKAN is limited, often re- phases (approved by the OHSU IRB as protocol e8165). The first was lying instead on anecdotal evidence, case reports and small series stud- to an international group of clinical experts, each with more than ies. Despite the small number of geographically dispersed people with 10 years of experience with PKAN. Based on their recommendations, re- PKAN, clinicians with concentrated experience have developed opin- visions were made and a second phase of review was sought by leaders ions and expertise about their optimal care. Moreover, family members of international patient advocacy groups. After further revisions were and affected individuals themselves develop substantial personal expe- incorporated, a draft was shared with people with PKAN and their fam- rience in meeting their needs. In this document we have amalgamated ily members from nine affected families who commented further. Final- such professional expertise, lay experiences and published data into a ly, an open call to the NBIA community was made via the NBIAcure.org consensus guideline. This guideline summarizes what we believe are website for final reviews and comments. current best practices and therapeutic approaches for the care of people with PKAN and their families. 2.1. Role of the funding source 2. Methods Leaders and members of the non-profit lay advocacy organizations that funded this work reviewed and edited this manuscript but had no This guideline largely reflects the consensus opinion of clinical ex- other role in this work. perts in PKAN. In addition, peer-reviewed publications were systemati- cally searched for, evaluated, and their conclusions incorporated into 3. Diagnosis and initial care this document when applicable. PubMed (http://www.ncbi.nlm.nih. gov/pubmed) was searched January–February 2016 using the following The diagnosis of PKAN is usually considered on the basis of clinical suspicion and radiological data. Often, the clinical features are sugges- ⁎ Corresponding author at: Molecular & Medical Genetics, mailcode L103, Oregon tive, and the diagnosis becomes strongly suspected after the character- Health & Science University, Portland, OR 97239, USA. istic brain MRI pattern is revealed. Since the PANK2 gene discovery [3], http://dx.doi.org/10.1016/j.ymgme.2016.11.004 1096-7192/© 2016 Elsevier Inc. All rights reserved. Please cite this article as: P. Hogarth, et al., Consensus clinical management guideline for pantothenate kinase-associated neurodegeneration (PKAN), Mol. Genet. Metab. (2016), http://dx.doi.org/10.1016/j.ymgme.2016.11.004 2 P. Hogarth et al. / Molecular Genetics and Metabolism xxx (2016) xxx–xxx the phenotypic spectrum of PKAN has broadened, and with it, the range pattern is found in both classic and atypical disease, though occasionally of presenting features. Greater access to early neuroimaging using MRI people with PKAN will lack this finding [6–8]. MRI changes are usually sequences that are sensitive to iron and to clinical whole exome se- evident by 3–4 years of age in classic disease if iron-sensitive sequences quencing can significantly reduce the time to diagnosis of people with are employed and may be present much earlier. By the time clear neu- early clinical manifestations. rologic features are present, the brain MRI almost always shows charac- teristic changes. If the brain MRI is not typical for PKAN in a person 3.1. Classic PKAN: presenting features strongly suspected to have this disorder, genetic testing is indicated. Classic PKAN defines the group of people with the youngest age at 3.4. Genetic testing onset and most rapid rate of disease progression. The natural history of classic PKAN is relatively homogeneous. Onset in classic PKAN occurs When PKAN is suspected, genetic testing is recommended in order to before 6 years of age in 90% (range: 6 months–12 years, mean: 3 years confirm the diagnosis. Sequencing and deletion/duplication analyses of 4months)[2]. The main presenting features are limb dystonia and spas- the PANK2 gene, which is mutated in PKAN, are needed for a complete ticity, clumsiness with frequent falls. While retinopathy is common, analysis. Genetic information is valuable for predicting prognosis, facil- clinically significant visual impairment usually lags behind the neuro- itating prenatal or pre-implantation genetic diagnosis in future preg- logical manifestations. Earlier histories of developmental delay, ADHD, nancies, and identifying other carriers in the family. Clinical genetic or toe-walking also are common. testing laboratories may be found worldwide through local medical ge- netics or neurology professionals. NBIA gene panels are now available at 3.2. Atypical PKAN: presenting features select labs and may be a more efficient and cost-effective option in some situations. For people for whom genetic testing is not possible, reason- Atypical PKAN is an inclusive term for all non-classic PKAN pheno- able confidence in the diagnosis can often be established when charac- types. The spectrum of atypical PKAN is broad and more accurately en- teristic clinical and radiographic changes are documented. In cases compasses a continuum from classic disease. Disease onset is in later where only one PANK2 mutation is identified, experts can help establish childhood, adolescence or adulthood (age range: 1–28 years, mean age: aconfident diagnosis based on clinical and MRI data. 13 years 8 months) [2,4], and the rate of progression is slower. Atypical PKAN often presents with neuropsychiatric or speech problems followed 3.5. Other recommended care at the time of diagnosis later by the development of dystonia or Parkinsonism, sometimes superimposed on a history of attention deficit hyperactivity disorder • Neurology – Establishing care with a neurologist is important to doc- (ADHD). Action-induced jaw dystonia occurring with eating or speaking ument the individual's baseline at the time of diagnosis and facilitate is an unusual clinical feature that should always prompt consideration of subsequent interventions as needed, such as initiating treatment the diagnosis of PKAN. Similarly, truncal opisthotonus is common in both with medication or referral to physical or other therapies. Given the classic and atypical disease and is highly suggestive of PKAN. progressive nature of the disease, a good relationship with open com- munication between the neurologist and family is key. A child neurol- 3.3. Diagnostic MRI ogist is appropriate for children; a movement disorders neurologist is a good choice to manage adults and some older children with PKAN. People suspected to have PKAN based on clinical features should under- Co-management with a rehabilitation medicine physician is optimal go brain MRI using iron sensitive sequences such as SWI, GRE, T2* as a first in countries where this specialty expertise is available. line diagnostic investigation to identify the characteristic changes [2].The • Ophthalmology – Clinical eye examination is recommended to assess MRI abnormality, called the ‘eye-of-the-tiger’ sign, is observed on T2- visual function since retinopathy is common, especially in children weighted imaging and consists of
Load more

Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • An Overview of Biosynthesis Pathways – Inspiration for Pharmaceutical and Agrochemical Discovery
    An Overview of Biosynthesis Pathways – Inspiration for Pharmaceutical and Agrochemical Discovery Alan C. Spivey [email protected] 19th Oct 2019 Lessons in Synthesis - Azadirachtin • Azadirachtin is a potent insect anti-feedant from the Indian neem tree: – exact biogenesis unknown but certainly via steroid modification: O MeO C OAc O 2 H O OH O H O OH 12 O O C 11 O 14 OH oxidative 8 O H 7 cleavage highly hindered C-C bond HO OH AcO OH AcO OH for synthesis! H H of C ring H MeO2C O AcO H tirucallol azadirachtanin A azadirachtin (cf. lanosterol) (a limanoid = tetra-nor-triterpenoid) – Intense synhtetic efforts by the groups of Nicolaou, Watanabe, Ley and others since structural elucidation in 1987. –1st total synthesis achieved in 2007 by Ley following 22 yrs of effort – ~40 researchers and over 100 person-years of research! – 64-step synthesis – Veitch Angew. Chem. Int. Ed. 2007, 46, 7629 (DOI) & Veitch Angew. Chem. Int. Ed. 2007, 46, 7633 (DOI) – Review ‘The azadirachtin story’ see: Veitch Angew. Chem. Int. Ed. 2008, 47, 9402 (DOI) Format & Scope of Presentation • Metabolism & Biosynthesis – some definitions, 1° & 2° metabolites • Shikimate Metabolites – photosynthesis & glycolysis → shikimate formation → shikimate metabolites – Glyphosate – a non-selective herbicide • Alkaloids – acetylCoA & the citric acid cycle → -amino acids → alkaloids – Opioids – powerful pain killers • Fatty Acids and Polyketides –acetylCoA → malonylCoA → fatty acids, prostaglandins, polyketides, macrolide antibiotics – NSAIDs – anti-inflammatory’s • Isoprenoids/terpenes
    [Show full text]
  • The Effect of Vitamin Supplementation on Subclinical
    molecules Review The Effect of Vitamin Supplementation on Subclinical Atherosclerosis in Patients without Manifest Cardiovascular Diseases: Never-ending Hope or Underestimated Effect? Ovidiu Mitu 1,2,* , Ioana Alexandra Cirneala 1,*, Andrada Ioana Lupsan 3, Mircea Iurciuc 4 , 5 5 2, Ivona Mitu , Daniela Cristina Dimitriu , Alexandru Dan Costache y , Antoniu Octavian Petris 1,2 and Irina Iuliana Costache 1,2 1 Department of Cardiology, Clinical Emergency Hospital “Sf. Spiridon”, 700111 Iasi, Romania 2 1st Medical Department, University of Medicine and Pharmacy “Grigore T. Popa”, 700115 Iasi, Romania 3 Department of Cardiology, University of Medicine, Pharmacy, Science and Technology, 540139 Targu Mures, Romania 4 Department of Cardiology, University of Medicine and Pharmacy “Victor Babes”, 300041 Timisoara, Romania 5 2nd Morpho-Functional Department, University of Medicine and Pharmacy “Grigore T. Popa”, 700115 Iasi, Romania * Correspondence: [email protected] (O.M.); [email protected] (I.A.C.); Tel.: +40-745-279-714 (O.M.) Medical Student, University of Medicine and Pharmacy “Grigore T. Popa”, 700115 Iasi, Romania. y Academic Editors: Raluca Maria Pop, Ada Popolo and Stefan Cristian Vesa Received: 25 March 2020; Accepted: 7 April 2020; Published: 9 April 2020 Abstract: Micronutrients, especially vitamins, play an important role in the evolution of cardiovascular diseases (CVD). It has been speculated that additional intake of vitamins may reduce the CVD burden by acting on the inflammatory and oxidative response starting from early stages of atherosclerosis, when the vascular impairment might still be reversible or, at least, slowed down. The current review assesses the role of major vitamins on subclinical atherosclerosis process and the potential clinical implications in patients without CVD.
    [Show full text]
  • Proteome Cold-Shock Response in the Extremely Acidophilic Archaeon, Cuniculiplasma Divulgatum
    microorganisms Article Proteome Cold-Shock Response in the Extremely Acidophilic Archaeon, Cuniculiplasma divulgatum Rafael Bargiela 1 , Karin Lanthaler 1,2, Colin M. Potter 1,2 , Manuel Ferrer 3 , Alexander F. Yakunin 1,2, Bela Paizs 1,2, Peter N. Golyshin 1,2 and Olga V. Golyshina 1,2,* 1 School of Natural Sciences, Bangor University, Deiniol Rd, Bangor LL57 2UW, UK; [email protected] (R.B.); [email protected] (K.L.); [email protected] (C.M.P.); [email protected] (A.F.Y.); [email protected] (B.P.); [email protected] (P.N.G.) 2 Centre for Environmental Biotechnology, Bangor University, Deiniol Rd, Bangor LL57 2UW, UK 3 Systems Biotechnology Group, Department of Applied Biocatalysis, CSIC—Institute of Catalysis, Marie Curie 2, 28049 Madrid, Spain; [email protected] * Correspondence: [email protected]; Tel.: +44-1248-388607; Fax: +44-1248-382569 Received: 27 April 2020; Accepted: 15 May 2020; Published: 19 May 2020 Abstract: The archaeon Cuniculiplasma divulgatum is ubiquitous in acidic environments with low-to-moderate temperatures. However, molecular mechanisms underlying its ability to thrive at lower temperatures remain unexplored. Using mass spectrometry (MS)-based proteomics, we analysed the effect of short-term (3 h) exposure to cold. The C. divulgatum genome encodes 2016 protein-coding genes, from which 819 proteins were identified in the cells grown under optimal conditions. In line with the peptidolytic lifestyle of C. divulgatum, its intracellular proteome revealed the abundance of proteases, ABC transporters and cytochrome C oxidase. From 747 quantifiable polypeptides, the levels of 582 proteins showed no change after the cold shock, whereas 104 proteins were upregulated suggesting that they might be contributing to cold adaptation.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Pantothenate Kinase-Associated Neurodegeneration
    Pantothenate kinase-associated neurodegeneration Description Pantothenate kinase-associated neurodegeneration (formerly called Hallervorden-Spatz syndrome) is a disorder of the nervous system. This condition is characterized by progressive difficulty with movement, typically beginning in childhood. Movement abnormalities include involuntary muscle spasms, rigidity, and trouble with walking that worsens over time. Many people with this condition also develop problems with speech ( dysarthria), and some develop vision loss. Additionally, affected individuals may experience a loss of intellectual function (dementia) and psychiatric symptoms such as behavioral problems, personality changes, and depression. Pantothenate kinase-associated neurodegeneration is characterized by an abnormal buildup of iron in certain areas of the brain. A particular change called the eye-of-the- tiger sign, which indicates an accumulation of iron, is typically seen on magnetic resonance imaging (MRI) scans of the brain in people with this disorder. Researchers have described classic and atypical forms of pantothenate kinase- associated neurodegeneration. The classic form usually appears in early childhood, causing severe problems with movement that worsen rapidly. Features of the atypical form appear later in childhood or adolescence and progress more slowly. Signs and symptoms vary, but the atypical form is more likely than the classic form to involve speech defects and psychiatric problems. A condition called HARP (hypoprebetalipoproteinemia, acanthocytosis, retinitis pigmentosa, and pallidal degeneration) syndrome, which was historically described as a separate syndrome, is now considered part of pantothenate kinase-associated neurodegeneration. Frequency The precise incidence of this condition is unknown. It is estimated to affect 1 to 3 per million people worldwide. Causes Mutations in the PANK2 gene cause pantothenate kinase-associated neurodegeneration.
    [Show full text]
  • A Novel Nonsense Mutation in PANK2 Gene in Two Patients with Pantothenate Kinase-Associated Neurodegeneration
    IJMCM Case Report Autumn 2016, Vol 5, No 4 A Novel Nonsense Mutation in PANK2 Gene in Two Patients with Pantothenate Kinase-Associated Neurodegeneration Soudeh Ghafouri-Fard 1, Vahid Reza Yassaee 2, Alireza Rezayi 3, Feyzollah Hashemi-Gorji 2, Nasrin Alipour 2, ∗ Mohammad Miryounesi 2 1. Department of Medical Genetics, Shahid Beheshti University of Medical sciences, Tehran, Iran. 2. Genomic Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran. 3. Pediatric Neurology Department, Loghman Hospital, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Submmited 29 June 2016; Accepted 14 August 2016; Published 23 October 2016 Pantothenate kinase- associated neurodegeneration (PKAN) syndrome is a rare autosomal recessive disorder characterized by progressive extrapyramidal dysfunction and iron accumulation in the brain and axonal spheroids in the central nervous system. It has been shown that the disorder is caused by mutations in PANK2 gene which codes for a mitochondrial enzyme participating in coenzyme A biosynthesis. Here we report two cases of classic PKAN syndrome with early onset of neurodegenerative disorder. Mutational analysis has revealed that both are homozygous for a novel nonsense mutation in PANK2 gene (c.T936A (p.C312X)). The high prevalence of consanguineous marriages in Iran raises the likelihood of occurrence of autosomal recessive disorders such as PKAN and necessitates proper premarital genetic counseling. Further research is needed to provide the data on the prevalence of PKAN and identification of common PANK2 mutations in Iranian population. Key words : PANK2 , pantothenate kinase-associated neurodegeneration, mutation antothenate kinase-associated neurodegen- weighted which is due to iron deposition in the Peration (PKAN) syndrome is a rare autosomal periphery (hypointensity) and necrosis on its central recessive disorder characterized by progressive part (hyperintensity) (2).
    [Show full text]
  • PC22 Doc. 22.1 Annex (In English Only / Únicamente En Inglés / Seulement En Anglais)
    Original language: English PC22 Doc. 22.1 Annex (in English only / únicamente en inglés / seulement en anglais) Quick scan of Orchidaceae species in European commerce as components of cosmetic, food and medicinal products Prepared by Josef A. Brinckmann Sebastopol, California, 95472 USA Commissioned by Federal Food Safety and Veterinary Office FSVO CITES Management Authorithy of Switzerland and Lichtenstein 2014 PC22 Doc 22.1 – p. 1 Contents Abbreviations and Acronyms ........................................................................................................................ 7 Executive Summary ...................................................................................................................................... 8 Information about the Databases Used ...................................................................................................... 11 1. Anoectochilus formosanus .................................................................................................................. 13 1.1. Countries of origin ................................................................................................................. 13 1.2. Commercially traded forms ................................................................................................... 13 1.2.1. Anoectochilus Formosanus Cell Culture Extract (CosIng) ............................................ 13 1.2.2. Anoectochilus Formosanus Extract (CosIng) ................................................................ 13 1.3. Selected finished
    [Show full text]
  • Structural and Functional Characterization O
    Julius-Maximilians-Universität Würzburg Approaching antimicrobial resistance – Structural and functional characterization of the fungal transcription factor Mrr1 from Candida albicans and the bacterial ß-ketoacyl-CoA thiolase FadA5 from Mycobacterium tuberculosis Auf den Spuren der antimikrobiellen Resistenz – Strukturelle und funktionelle Charakterisierung des Transkriptionsfaktors Mrr1 aus Candida albicans und der bakteriellen β-ketoacyl-CoA thiolase FadA5 aus Mykobakterium tuberculosis Dissertation for a doctoral degree at the Graduate School of Life Sciences, Julius-Maximilians-Universität Würzburg, Section Biomedicine submitted by Christin Marliese Schäfer from Miltenberg am Main Würzburg, November 2014 Submitted on: ………………………………………………………..…… Office stamp Members of the Promotionskomitee: Chairperson: Ulrike Holzgrabe Primary Supervisor: Caroline Kisker Supervisor (Second): Joachim Morschhäuser Supervisor (Third): Nicole Sampson Date of Public Defence: …………………………………………….… Date of Receipt of Certificates: ……………………………………… Table of content Table of content Table of content ....................................................................................................................................... I Summary ................................................................................................................................................. 1 Zusammenfassung ................................................................................................................................... 4 1 Introduction ....................................................................................................................................
    [Show full text]
  • Cheminformatics for Genome-Scale Metabolic Reconstructions
    CHEMINFORMATICS FOR GENOME-SCALE METABOLIC RECONSTRUCTIONS John W. May European Molecular Biology Laboratory European Bioinformatics Institute University of Cambridge Homerton College A thesis submitted for the degree of Doctor of Philosophy June 2014 Declaration This thesis is the result of my own work and includes nothing which is the outcome of work done in collaboration except where specifically indicated in the text. This dissertation is not substantially the same as any I have submitted for a degree, diploma or other qualification at any other university, and no part has already been, or is currently being submitted for any degree, diploma or other qualification. This dissertation does not exceed the specified length limit of 60,000 words as defined by the Biology Degree Committee. This dissertation has been typeset using LATEX in 11 pt Palatino, one and half spaced, according to the specifications defined by the Board of Graduate Studies and the Biology Degree Committee. June 2014 John W. May to Róisín Acknowledgements This work was carried out in the Cheminformatics and Metabolism Group at the European Bioinformatics Institute (EMBL-EBI). The project was fund- ed by Unilever, the Biotechnology and Biological Sciences Research Coun- cil [BB/I532153/1], and the European Molecular Biology Laboratory. I would like to thank my supervisor, Christoph Steinbeck for his guidance and providing intellectual freedom. I am also thankful to each member of my thesis advisory committee: Gordon James, Julio Saez-Rodriguez, Kiran Patil, and Gos Micklem who gave their time, advice, and guidance. I am thankful to all members of the Cheminformatics and Metabolism Group.
    [Show full text]
  • Biochemical and Proteomic Profiling of Maize Endosperm Texture and Protein Quality Kyla J
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Theses, Dissertations, and Student Research in Agronomy and Horticulture Department Agronomy and Horticulture 7-2015 Biochemical and Proteomic Profiling of Maize Endosperm Texture and Protein Quality Kyla J. Morton University of Nebraska-Lincoln Follow this and additional works at: http://digitalcommons.unl.edu/agronhortdiss Part of the Agricultural Science Commons, Agronomy and Crop Sciences Commons, Plant Biology Commons, and the Plant Breeding and Genetics Commons Morton, Kyla J., "Biochemical and Proteomic Profiling of Maize Endosperm Texture and Protein Quality" (2015). Theses, Dissertations, and Student Research in Agronomy and Horticulture. 88. http://digitalcommons.unl.edu/agronhortdiss/88 This Article is brought to you for free and open access by the Agronomy and Horticulture Department at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Theses, Dissertations, and Student Research in Agronomy and Horticulture by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. BIOCHEMICAL AND PROTEOMIC PROFILING OF MAIZE ENDOSPERM TEXTURE AND PROTEIN QUALITY by Kyla J. Morton A DISSERTATION Presented to the Faculty of The Graduate College at the University of Nebraska In Partial Fulfillment of Requirements For the Degree of Doctor of Philosophy Major: Agronomy and Horticulture (Plant Breeding and Genetics) Under the Supervision of Professor David R. Holding Lincoln, Nebraska July, 2015 BIOCHEMICAL AND PROTEOMIC ANALYSIS OF MAIZE ENDOSPERM KERNEL TEXTURE AND PROTEIN QUALITY Kyla J. Morton, Ph.D. University of Nebraska, 2015 Advisor: David R. Holding The research described herein, focuses on the biochemical and proteomic analysis of the maize endosperm and what influences kernel texture.
    [Show full text]
  • O O2 Enzymes Available from Sigma Enzymes Available from Sigma
    COO 2.7.1.15 Ribokinase OXIDOREDUCTASES CONH2 COO 2.7.1.16 Ribulokinase 1.1.1.1 Alcohol dehydrogenase BLOOD GROUP + O O + O O 1.1.1.3 Homoserine dehydrogenase HYALURONIC ACID DERMATAN ALGINATES O-ANTIGENS STARCH GLYCOGEN CH COO N COO 2.7.1.17 Xylulokinase P GLYCOPROTEINS SUBSTANCES 2 OH N + COO 1.1.1.8 Glycerol-3-phosphate dehydrogenase Ribose -O - P - O - P - O- Adenosine(P) Ribose - O - P - O - P - O -Adenosine NICOTINATE 2.7.1.19 Phosphoribulokinase GANGLIOSIDES PEPTIDO- CH OH CH OH N 1 + COO 1.1.1.9 D-Xylulose reductase 2 2 NH .2.1 2.7.1.24 Dephospho-CoA kinase O CHITIN CHONDROITIN PECTIN INULIN CELLULOSE O O NH O O O O Ribose- P 2.4 N N RP 1.1.1.10 l-Xylulose reductase MUCINS GLYCAN 6.3.5.1 2.7.7.18 2.7.1.25 Adenylylsulfate kinase CH2OH HO Indoleacetate Indoxyl + 1.1.1.14 l-Iditol dehydrogenase L O O O Desamino-NAD Nicotinate- Quinolinate- A 2.7.1.28 Triokinase O O 1.1.1.132 HO (Auxin) NAD(P) 6.3.1.5 2.4.2.19 1.1.1.19 Glucuronate reductase CHOH - 2.4.1.68 CH3 OH OH OH nucleotide 2.7.1.30 Glycerol kinase Y - COO nucleotide 2.7.1.31 Glycerate kinase 1.1.1.21 Aldehyde reductase AcNH CHOH COO 6.3.2.7-10 2.4.1.69 O 1.2.3.7 2.4.2.19 R OPPT OH OH + 1.1.1.22 UDPglucose dehydrogenase 2.4.99.7 HO O OPPU HO 2.7.1.32 Choline kinase S CH2OH 6.3.2.13 OH OPPU CH HO CH2CH(NH3)COO HO CH CH NH HO CH2CH2NHCOCH3 CH O CH CH NHCOCH COO 1.1.1.23 Histidinol dehydrogenase OPC 2.4.1.17 3 2.4.1.29 CH CHO 2 2 2 3 2 2 3 O 2.7.1.33 Pantothenate kinase CH3CH NHAC OH OH OH LACTOSE 2 COO 1.1.1.25 Shikimate dehydrogenase A HO HO OPPG CH OH 2.7.1.34 Pantetheine kinase UDP- TDP-Rhamnose 2 NH NH NH NH N M 2.7.1.36 Mevalonate kinase 1.1.1.27 Lactate dehydrogenase HO COO- GDP- 2.4.1.21 O NH NH 4.1.1.28 2.3.1.5 2.1.1.4 1.1.1.29 Glycerate dehydrogenase C UDP-N-Ac-Muramate Iduronate OH 2.4.1.1 2.4.1.11 HO 5-Hydroxy- 5-Hydroxytryptamine N-Acetyl-serotonin N-Acetyl-5-O-methyl-serotonin Quinolinate 2.7.1.39 Homoserine kinase Mannuronate CH3 etc.
    [Show full text]