Identification of Biochemical Adaptations in Hyper- Or Hypocontractile Hearts from Phospholamban Mutant Mice by Expression Proteomics

Home , Annexin, Calreticulin, Calumenin, Phospholamban

Identification of biochemical adaptations in hyper- or hypocontractile hearts from phospholamban mutant mice by expression proteomics

Yan Pan*†, Thomas Kislinger*†‡, Anthony O. Gramolini*†, Elena Zvaritch*, Evangelia G. Kranias§, David H. MacLennan*, and Andrew Emili*‡¶

*Banting and Best Department of Medical Research and ‡Program in Proteomics and Bioinformatics, University of Toronto, Toronto, ON, Canada M5G 1L6; and §Department of Pharmacology and Cell Biophysics, University of Cincinnati College of Medicine, Cincinnati, OH 45267-0575

Contributed by David H. MacLennan, December 10, 2003 Phospholamban (PLN) is a critical regulator of cardiac contractility failure. As one identified cause of progression to heart failure, through its binding to and regulation of the activity of the sarco(en- alterations in PLN content or function are likely to induce com- -do)plasmic reticulum Ca2؉ ATPase. To uncover biochemical adapta- pensatory changes in the composition of protein networks, espe tions associated with extremes of cardiac muscle contractility, we cially those responsible for maintaining appropriate Ca2ϩ-signaling used high-throughput gel-free tandem MS to monitor differences in transients within cardiomyocytes. the relative abundance of membrane proteins in standard microsomal DNA microarrays have been developed for comprehensive fractions isolated from the hearts of PLN-null mice (PLN-KO) with high screening of gene expression profiles, but the correlation between contractility and from transgenic mice overexpressing a superinhibi- mRNA abundance and the quantity of functional protein is imper- tory PLN mutant in a PLN-null background (I40A-KO) with diminished fect (12, 13). Hence, proteomic profiling procedures based on 2D contractility. Signiﬁcant differential expression was detected for a gel electrophoresis of protein mixtures have been used toward the subset of the 782 proteins identiﬁed, including known membrane- large-scale analysis of protein expression patterns associated with associated biomarkers, components of signaling pathways, and pre- heart disease (14–16). A key limitation of this approach, however, viously uninvestigated proteins. Proteins involved in fat and carbo- is that membrane proteins do not resolve well in 2D gels and are hydrate metabolism and proteins linked to G protein-signaling poorly represented. Newer gel-free proteomic methods now offer pathways activating protein kinase C were enriched in I40A-KO the potential for characterization of the global protein composition cardiac muscle, whereas proteins linked to enhanced contractile of an entire tissue or organelle with significantly less detection bias function were enriched in PLN-KO mutant hearts. These data dem- (17). The use of gel-free HPLC, coupled online to highly sensitive 2؉ onstrate that Ca dysregulation, leading to elevated or depressed electrospray tandem MS, makes it possible to measure alterations cardiac contractility, induces compensatory biochemical responses. in the levels of even relatively low-abundance membrane proteins (18). All these approaches benefit directly from access to recently ϩ ardiac muscle contraction is initiated by the entry of Ca2 ions completed genomic sequences for humans (19) and mice (20). Cinto the myoplasm from extracellular spaces and from stores in Here, we describe the development and application of a high- the sarcoplasmic reticulum (SR); relaxation is initiated by removal ϩ performance gel-free expression-profiling methodology optimized of myoplasmic Ca2 by the combined activity of a sarco(endo)plas- for assessing the differential accumulation of membrane-associated 2ϩ mic reticulum Ca ATPase (SERCA2a), a plasma membrane proteins in cardiac tissue samples derived from mouse model 2ϩ ϩ͞ 2ϩ 2ϩ Ca ATPase, and a Na Ca exchanger (1). Of myocardial Ca , systems. The approach is based on high-resolution multidimen- Ϸ Ϸ 70% fluxes through the SR in humans and 90% in mice. In both sional capillary-scale liquid chromatography-MS of purified cardiac cases, a strong positive correlation exists between the size of the SR

membrane protein fractions and the use of peptide sequence BIOCHEMISTRY 2ϩ Ca store and cardiac contractility (2). Thus the activity of coverage as a quantitative assay (21). Using this approach, we have SERCA2a is a crucial regulator of cardiac contractility and of the ␤ carried out a comprehensive proteomic comparison of the protein utilization of the cardiac reserve during periods of -adrenergic composition of microsomal membrane fractions of cardiac tissue stimulation of the heart (2). from mutant mice with a high level of contractility achieved by Phospholamban (PLN), a 6-kDa transmembrane protein, regu- 2ϩ ablation of PLN (PLN-KO) (4) and a reduced level of contractility lates SR Ca transport in cardiomyocytes by its ability to act as a achieved by the transgenic overexpression of a superinhibitory, reversible inhibitor of SERCA2a (3). The ability of PLN to monomeric form of PLN in the PLN-KO background (I40A-KO) determine cardiac contractility through its effects on the activity of (4, 22). The study revealed differential accumulation of select SERCA2a has been demonstrated through the characterization of functional categories of proteins in the cardiac muscle of the PLN-null mice, which are hypercontractile and healthy (4), and PLN-KO mutant as compared with the I40A-KO mutant, providing mice overexpressing either WT PLN (5) or superinhibitory mutant additional insight into pathophysiological changes associated with PLN molecules (6–8), which are hypocontractile and exhibit signs cardiac hypertrophy. of cardiac hypertrophy and even heart failure. In contrast to mice, PLN-null humans manifest dilated cardiomyopathy (9), as do Experimental Procedures humans expressing chronically inhibitory forms of PLN (10). Sub- Materials. Poroszyme bulk immobilized trypsin was purchased from stantial evidence also exists that the depressed contractility of ϩ Applied Biosystems. Endoproteinase Lys-C was obtained from failing human hearts results from deficiencies in basal Ca2 - signaling and in ␤-adrenergic stimulation (2, 11). In these cases, SERCA2a expression is diminished; the combination of lower Abbreviations: SERCA2a, sarco(endo)plasmic reticulum Ca2ϩ ATPase; PLN, phospholamban; SERCA2a levels and higher PLN-mediated inhibition of the re- ER, endoplasmic reticulum; SR, sarcoplasmic reticulum; KO, null; LV, left ventricular; GO, ϩ maining SERCA2a results in lower SR Ca2 stores and diminished Gene Ontology; ANF, atrial natriuretic factor; ␤-MHC, ␤-myosin heavy chain. contractility. †Y.P., T.K., and A.O.G. contributed equally to this work. It is likely that alterations in myocardial gene and protein ¶To whom correspondence should be addressed at: C.H. Best Institute, 112 College Street, expression underlie the pathophysiology of chronic cardiac dys- Toronto, ON, Canada M5G 1L6. E-mail: [email protected]. function and determine the progression to an endpoint of heart © 2004 by The National Academy of Sciences of the USA

www.pnas.org͞cgi͞doi͞10.1073͞pnas.0308174101 PNAS ͉ February 24, 2004 ͉ vol. 101 ͉ no. 8 ͉ 2241–2246 Downloaded by guest on September 25, 2021 Roche Diagnostics. SPEC Plus PT C18 solid-phase extraction Digestion of Cardiac Microsomal Fractions. One hundred micrograms pipette tips were purchased from Ansys Diagnostics (Lake Forest, of ventricular microsomal proteins, as determined by Bio-Rad CA). All other reagents were obtained from Sigma. assay, were dissolved in 1% SDS, precipitated with 5 volumes of acetone at Ϫ20°C overnight, and centrifuged at 21,000 ϫ g for 20 Mouse Breeding and Genotyping. Transgenic mice overexpressing min to remove lipids. The pellets were solubilized in 0.5% SDS at the I40A PLN mutant (4) and phospholamban-null (PLN-KO) 37°C for 2 h before dilution with an equal volume of 200 mM mice (6) were mated at least five generations to obtain I40A NH4HCO3. Endoprotease Lys-C was added to a final substrate-to- transgenic mice on a PLN-null background (I40A-KO). The strain enzyme ratio of 50:1, and the mixture was incubated at 37°Cfor of both sets of mice was 129SVJ:C57BL6. Age-matched littermate 15 h. An equal volume of 1 M guanidine-HCl was then added to the ϫ offspring were used in all experiments. FVB͞N and digests, and the samples were centrifuged at 21,000 g for 10 min SVJ129:C57BL6 mice were used as WT controls in cardiac func- to remove SDS precipitates. The supernatant was diluted with an tional analysis. In vivo left ventricular (LV) pressure hemodynamics equal volume of 100 mM NH4HCO3 (pH 8.5), and CaCl2 was added were recorded from anesthetized animals by direct LV catheter- to a final concentration of 1 mM. The sample was further digested ization through the carotid artery, and M mode and Doppler with Poroszyme-immobilized trypsin overnight at 30°C with con- tinuous agitation. The resulting peptide mixtures were absorbed on echocardiography were performed noninvasively for assessment of Ϫ LV function and dimensions, as described (6). SPEC-Plus PT C18 cartridges, washed, eluted, and stored at 80°C.

Microsomal Membrane Protein Fractions. Ventricular cardiac mus- Liquid Chromatography Tandem MS. As reported by Florens et al. cles from three individual isogenic mice were excised, combined, (21), the total cumulative amino acid coverage detected by MS and homogenized in ice-cold buffer consisting of 10 mM Tris⅐HCl provided an approximate quantitative measure of relative abun- ␮ dance between I40A-KO- and PLN-KO-derived tissue. To ensure (pH 7.4), 150 mM KCl, 20 M CaCl2, 0.25 M sucrose, 2 mM DTT, and protease inhibitor (Complete; Roche Diagnostics). The ex- the reliability of the measured sequence coverage, an equal amount of peptide (Ϸ50 ␮g, based on total protein precipitated and tracts were centrifuged at 7,700 ϫ g to remove insoluble debris, digested) generated for each sample was analyzed by 2D capillary nuclei, and mitochondria, followed by ultracentrifugation at ϩ scale liquid chromatography coupled online to automated data- 100,000 ϫ g for 60 min to isolate the membrane fraction. Ca2 dependent electrospray ion-trap tandem MS, as reported by Yates uptake assays were performed as described (6). and colleagues (23), with the adaptations described in Kislinger et al. (24). Western Blot Analysis. Protein fractions were separated by SDS͞ PAGE using standard procedures. Antibodies to SERCA2, RyR2 Protein Identification and Informatics. Peptide fragmentation prod- (Affinity BioReagents, Golden, CO), Naϩ-Ca2ϩ exchanger, plasma 2ϩ uct ion mass spectra were sequence-mapped against a nonredun- membrane Ca ATPases (Research Diagnostic, Flanders, NJ), dant set of human and mouse protein sequences obtained from the Integrin-␤1, calreticulin, PKC-␤, RACK-1, DGK-␪ (BD Transduc- ␣ ␪ ␧ SWISS-PROT and TrEMBL (25) databases by using the SEQUEST tion Laboratories, Lexington, KY), and PKC- , PKC- , and PKC- software algorithm (26) running on a multiprocessor computer (Santa Cruz Biotechnology), were used, as recommended by the cluster. A probability-based evaluation algorithm, STATQUEST (24), supplier. Signals were visualized by using horseradish peroxidase- was used for filtering of all putative matches based on a maximum conjugated goat anti-mouse secondary antibody and enhanced P value threshold corresponding to a Ն90% likelihood of correct chemiluminescence (Super Signal, Pierce) and quantified by using identification. The PERL program GOCLUST was used for automatic a Fluor-S System and QUANTITY ONE software (Bio-Rad). annotation and sorting of the positively identified proteins into specific functional categories by using the Gene Ontology (GO) Quantitative RNA Analyses. Total RNA was isolated from ventricles annotation schema obtained from the European Bioinformatics by using TRIZOL (Invitrogen), and 2 ␮g were blotted onto Institute (25, 27). nitrocellulose filters by using a slot-blot filtration manifold. Filter preparation and hybridization to specific oligonucleotide probes, Statistical Analysis. Data are presented as mean Ϯ standard error. end-labeled with [␥-32P]ATP. Hybridization signals were quantified Statistical analysis was performed by Student’s t test between WT by a Personal Molecular Imager FX System and QUANTITY ONE and transgenic mice, with a P value of Ͻ0.05 considered to be software. The oligonucleotides used were: atrial natriuretic factor significant. (ANF), 5Ј-AATGTGACCAAGCTGCGTGACACACCA- CAAGGGCTTAGGATCTTTTGCG, and ␤-myosin heavy chain Results (␤-MHC), 5Ј-GGCTCCAGGTCTGAGGGCTTCACGGG- Functional Characteristics of I40A-KO and PLN-KO Mice. I40A-KO and CACCCTTAGAGCTGGGTAGCAC. PLN-KO littermates were compared directly, and FVB͞N age-

Fig. 1. Functional characteristics of I40A-KO and PLN-KO mice. (A) Western blot analysis of a microsomal fraction from ventricles of I40A-KO, PLN-KO, and WT mice demonstrating 1.8-fold overexpression of I40A PLN protein in I40A-KO transgenic mice and no expression of PLN in PLN-KO transgenic mice, with the anti- PLN monoclonal antibody ID11. p, PLN pentamer; m, monomer. (B) The apparent Ca2ϩ afﬁnity of SERCA2a in microsomal fractions of ventricular tissue was determined by measurement of the Ca2ϩ dependence of Ca2ϩ transport. (C)LV ϩdP͞dt and ϪdP͞dt were measured by direct LV catheterization in vivo in I40A- KO, PLN-KO, and WT mice. *, P Ͻ 0.05 (a signiﬁcant difference from WT).

2242 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0308174101 Pan et al. Downloaded by guest on September 25, 2021 Table 1. Base-line echocardiographic measurements of I40A-KO, PLN-KO, and WT control mice Parameter WT, n ϭ 6 140A-KO, n ϭ 8 PLN-KO, n ϭ 6

HR, beats͞min 397 Ϯ 11.5 408 Ϯ 16.3 385 Ϯ 27.1 LV EDD, mm 3.58 Ϯ 0.05 4.32 Ϯ 0.46* 3.82 Ϯ 0.38 LV ESD, mm 2.05 Ϯ 0.05 3.35 Ϯ 0.51* 2.29 Ϯ 0.31 LV AW 0.65 Ϯ 0.01 0.67 Ϯ 0.03 0.62 Ϯ 0.03* LV PW, mm 0.64 Ϯ 0.03 0.67 Ϯ 0.03* 0.62 Ϯ 0.03 LV mass, mg 77.16 Ϯ 1.65 111 Ϯ 19.97* 82.46 Ϯ 16.30 LV͞body mass, mg͞g 2.67 Ϯ 0.15 3.37 Ϯ 0.53* 2.44 Ϯ 0.53 FS, % 42.98 Ϯ 1.83 22.97 Ϯ 5.23* 40.50 Ϯ 3.08 Ejection time, ms 78.35 Ϯ 7.21 95.25 Ϯ 11.10* 51.00 Ϯ 8.69*

Vcfc, circ͞s 4.71 Ϯ 0.55 2.46 Ϯ 0.63* 8.23 Ϯ 2.02*

M mode and Doppler echocardiography were performed as described (6) and demonstrate LV hypertrophy in the 140A mouse. Values represent mean Ϯ standard error. HR, heart rate; Vcfc, velocity of circumferential shortening; EDD, end-diastolic dimension; ESD, end-systolic dimension; AW, ante- rior wall; PW, posterior wall; FS, shortening fraction. *, P Ͻ 0.05, signiﬁcant difference from WT.

Fig. 2. Distribution of the identiﬁed proteins. (A) Fraction of the identiﬁed matched mice were used as WT controls in functional analyses. proteins that could be linked to an annotation term within the GO schema. (B) I40A-KO mice showed 1.8-fold overexpression of only monomeric Number of proteins linked to the three main GO subcategories. (C) Subcellular PLN in the heart, whereas PLN-KO mice showed no PLN expres- localization of 432 proteins that mapped to the GO category ‘‘cellular compart- sion, based on Western blots using the anti-PLN monoclonal ment.’’ (D) Number of proteins predicted to have one or more transmembrane 2ϩ domains. antibody, 1D11 (Fig. 1A). The apparent Ca affinity (KCa)of SERCA2a in mouse ventricles, determined by measurement of the 2ϩ 2ϩ Ϯ ␮ Ca dependence of Ca uptake, was 0.62 0.03 MforWT, known membrane-associated proteins, were identified collectively 1.18 Ϯ 0.05 ␮M for I40A-KO, and 0.18 Ϯ 0.02 ␮M for PLN-KO in the microsomal fractions from the two mouse lines. A detailed mice (Fig. 1B); results were consistent with previous reports (4, 6). summary of the proteomics data is provided in Table 3, which is To quantify cardiac contractility in I40A-KO, PLN-KO, and WT published as supporting information on the PNAS web site. hearts, hemodynamic measurements and echocardiographic assessment in live animals were used, as described (6). Hemodynamic measurements of cardiac contractility and relaxation demonstrated that both ϩdP͞dt and ϪdP͞dt were significantly (P Ͻ 0.05) depressed in the hearts of I40A-KO mice compared with hearts of WT or PLN-KO mice (in I40A-KO, ϩdP͞dt and ϪdP͞dt were 3,256 Ϯ 290 mmHg͞s and 2,516 Ϯ 422 mmHg͞s; in WT, ϩdP͞dt and ϪdP͞dt were 4,242 Ϯ 540 mmHg͞s and 4,004 Ϯ 368 mmHg͞s; and in PLN-KO, ϩdP͞dt and ϪdP͞dt were 7,809 Ϯ 967 mmHg͞s and 4,753 Ϯ 694 mmHg͞s); results were consistent with previous reports (4, 6) (Fig. 1C). Echocardiographic studies revealed that I40A-KO mice dis- played mild cardiac hypertrophy, including significant increases in BIOCHEMISTRY LV end-diastolic and systolic dimensions, significant reductions in LV fractional shortening and velocities of circumferential shortening, and a significant increase in LV weight and the LV weight-to- body weight ratio, when compared with WT (Table 1). By contrast, PLN-KO littermates exhibited a significant decrease in ejection time and an increase in velocity of circumferential shortening, but LV weight and LV weight-to-body weight ratios were similar between PLN-KO and WT mice (Table 1). These differences are consistent with impaired contractile function and cardiac hypertrophy in the I40A-KO hearts and support previous findings in mice with 2-fold overexpression of PLN I40A on a WT PLN background (6).

Gel-Free Protein Expression Profiling. To investigate global differences in the accumulation of proteins in I40A-KO and PLN-KO Fig. 3. Adaptive levels of transmembrane and membrane-associated proteins cardiac muscle, a high-throughput gel-free tandem MS-based meth- in I40A-KO ventricular muscle. (A Left) Data obtained from the proteomic anal- odology was used for systematic monitoring and identification of yses indicating undetectable (n.d.) levels of ANF and ␤-MHC in PLN-KO hearts, the numerous proteins present in heart microsomal protein frac- with signiﬁcant protein levels in I40A-KO cardiac muscle. (A Right) RNA slot-blot ␤ tions isolated from the mutant strains. analysis demonstrating elevated transcript levels of ANF and -MHC in the I40A-KO mice. (B Left) Relative protein levels (as reﬂected by total sequence More than 200,000 uninterpreted peptide fragmentation product coverage) detected by MS. (B Right) Consistent with the proteomic data, Western ion mass spectra were sequence-mapped against a nonredundant blot analysis of ventricular membrane protein fractions from I40A-KO and set of human and mouse protein sequences obtained from the PLN-KO mice demonstrating increased expression of plasma membrane Ca2ϩ SWISS-PROT and TrEMBL (25) databases by using the SEQUEST ATPase, RyR2 (RYR), and integrin-␤1, but no change in the levels of SERCA2, software algorithm (26). A total of 782 proteins, including 170 Naϩ͞Ca2ϩexchanger (NCX1), or calreticulin (CRT).

Pan et al. PNAS ͉ February 24, 2004 ͉ vol. 101 ͉ no. 8 ͉ 2243 Downloaded by guest on September 25, 2021 Table 2. Functional grouping of differentially expressed proteins

Protein Accession no. 140A-KO PLN-KO

SR/ER associated proteins Sarcoplasmic/endoplasmic reticulum Ca2ϩATPase ATA2 MOUSE 23 23.7 — Cardiac Ca2ϩ release channel Q9ERN6 5.2 2.4 ‘ Calsequestrin, cardiac muscle isoform CAQC MOUSE 21.9 14.2 — Calreticulin CRTC MOUSE 11.5 14.7 — FKBP-rapamycin-associated protein FRAP MOUSE 1 1 — Cop-coated vesicle membrane protein p24 P24 MOUSE 6 3 ‘ Calcium/calmodulin-dependent protein kinase II Q92991 10.8 10.8 — Transitional endoplasmic reticulum ATPase TERA MOUSE 8.3 2.9 ‘ SEC22, vesicle trafﬁcking protein-like 1 Q91VU3 3.3 0 ‘ Endoplasmin ENPL MOUSE 9.2 0 ‘ Calumenin CALU MOUSE 8.3 3.2 ‘ Calnexin CALX MOUSE 11.7 11.3 — Intracellular signaling cascade Tyrosine-protein kinase BLK BLK HUMAN 2.4 0 ‘ Guanine nucleotide-binding protein, ␣-11 GB11 MOUSE 3.3 0 ‘ Guanine nucleotide-binding protein G, ␣-2 GBI2 MOUSE 6.5 0 ‘ Guanine nucleotide-binding protein ␤ subunit GBLP HUMAN 7.6 0 ‘ Guanine nucleotide-binding protein G, ␣ GBQ MOUSE 3.4 0 ‘ Myosin-IXa Q9UNJ2 0.2 0 — Multiple PDZ domain protein Q9Z1K3 2 2 — Ras-related protein RAL-A RALA MOUSE 9.7 0 ‘ Ras-related protein RAP-1A RAPA HUMAN 12.5 6.5 ‘ Transforming protein P21͞H-RAS-1 RASH MOUSE 5.8 0 ‘ Ras-related protein Rab-10 RB10 HUMAN 6 0 ‘ Ras-related protein Rab-1A RB1A HUMAN 8.8 0 ‘ Ras-related protein Rab-21 RB21 MOUSE 24.5 14.3 ‘ Ras-related protein Rab-5B RB5B HUMAN 5.6 0 ‘ Ras-related protein R-Ras RRAS MOUSE 5 0 ‘ Superoxide dismutase [Cu-Zn] SODC MOUSE 30.1 17 ‘ Cell surface receptor-linked signal transduction Adenylate kinase iscenzyme 1 KAD1 MOUSE 26.3 4.1 ‘ Glucagon receptor precursor GLR HUMAN 1.7 0 ‘ Integrin ␤-1 precursor ITB1 MOUSE 4.1 0 ‘ Carbohydrate metabolism Fructose-bisphosphate aldolase A ALFA MOUSE 7.7 3.3 ‘ ␣ enolase ENOA MOUSE 2.5 0 ‘ Phosphoglycerate kinase 1 PGK1 MOUSE 8.4 0 ‘ Phosphoglycerate mutase 2 PMG2 MOUSE 4.4 0 ‘ Triosephosphate isomerase TPIS MOUSE 13.7 0 ‘ Fatty acid regulation Fatty aldehyde dehydrogenase DHA4 MOUSE 2.9 0 ‘ Fatty acid-binding protein, heart FABH MOUSE 49.2 0 ‘ Long-chain fatty acid transport protein precursor FATP MOUSE 2.2 2.2 — Apolipoprotein A-1 precursor APA1 MOUSE 26.1 12.5 ‘ Very-low-density lipoprotein receptor precursor LDVR MOUSE 2.3 0 ‘ Ion transport Sarcoplasmic͞endoplasmic reticulum Ca2ϩ ATPase ATA2 MOUSE 23 23.7 — Sodium͞calcium exchanger 1 precursor NAC1 MOUSE 5.4 5.7 — ATPase, NaϩKϩ transporting, ␣1 polypeptide Q8VDN2 12 9.3 ‘ Cardiac Ca2ϩ release channel Q9ERN6 5.2 2.4 ‘ Plasma membrane calcium-transporting ATPase 1 ATB1 HUMAN 1.1 0 ‘ Inward rectiﬁer potassium channel 2 IRK2 MOUSE 5.6 2.1 ‘ Voltage-dependent anion-selective channel POR1 MOUSE 50.3 66.6 — Voltage-dependent anion-selective channel POR2 MOUSE 34.9 25.8 — Voltage-dependent anion-selective channel POR3 MOUSE 33.6 30 — Cytoskeleton Actin, cytoplasmic 1 ACTB HUMAN 7.7 4.8 ‘ Desmin DESM MOUSE 22.4 12.4 ‘ Ezrin EZRI MOUSE 3.1 0 ‘ Similar to ARP1 actin-related protein 1 homolog B Q8R5C5 0 6.1 ’ Cytovillin 2 Q9UJU1 0 10.6 ’ ␤-sarcoglycan SGCB MOUSE 13.8 0 ‘ Spectrin ␣ chain, erythrocyte SPCA MOUSE 7.1 0 ‘ Spectrin ␤ chain, erythrocyte SPCB MOUSE 3.5 0 ‘ Spectrin ␣ chain, brain SPCN MOUSE 6.5 5.5 — Spectrin ␤ chain, brain 1 SPCO MOUSE 4.1 0.9 ‘ Vesicle-associated membrane protein 2 VAM2 MOUSE 14.8 0 ‘ Vesicle-associated membrane protein 3 VAM3 MOUSE 16.5 0 ‘ Vimentin VIME MOUSE 15.3 2.8 ‘ Class 1 ␤-tubulin. Tubulin ␤-5 chain TBBX HUMAN 16 12.8 — Developmental processes ␣-2-HS-glycoprotein precursor A2HS MOUSE 0 6.1 ’ Annexin II ANX2 HUMAN 0 5.3 ’ Myosin light-chain alkali, nonmuscle isoform MLEN MOUSE 17.7 6.4 ‘ Myosin light-chain 1, slow-twitch͞ventricular MLEV MOUSE 0 45.1 ’ Myosin regulatory light chain 2, ventricular isoform MLRV MOUSE 15.2 7.3 ‘ Myosin heavy chain, last skeletal muscle, MYH3 MOUSE 14.5 0 ‘

Differential regulation of select subsets of functionally related proteins was found in the ventricular membrane fractions of I40A-KO transgenic mice as compared with PLN-KO mutant mice. Protein-abundance ratios are based on the percent peptide coverage obtained in each protein expression and were obtained by averaging three experiments in pooled ventricular tissues. Each protein was classiﬁed to a speciﬁc annotation category according to the GO schema. For a more complete listing of the proteomic data, see Table 3. ‘, up-regulated, ratio of I40A-KO͞PLN-KO Ն 2; ’ down-regulated, ratio of I40A-KO͞PLN-KO Յ 2; —, no change.

2244 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0308174101 Pan et al. Downloaded by guest on September 25, 2021 Each of these proteins was then mapped against the GO annotation database (24). Of the 782 proteins, 572 (73.1%) could be matched to one or more GO terms within the GO database, whereas 210 proteins could not be assigned to any defined GO term (26.9%), suggesting that they are functionally uncharacterized (Fig. 2A). The number of proteins assigned to a specific molecular function, biological process, or cellular component category within the GO database is shown in Fig. 2B. The subcellular localization of 432 proteins (55.2%) assigned to ‘‘cellular component’’ is shown in Fig. 2C. The assignment of many proteins to the endoplasmic reticulum (ER)͞SR (29), Golgi (8), plasma membrane (30), or mitochondria (116), indicated that at least a portion of each of these membrane systems was present in our microsomal preparation. The number of membrane proteins identified by our gel-free proteomic method is more than an order of magnitude greater than that seen in typical experimental systems based on 2D gel separation of Fig. 4. Activation proﬁle of PKC in I40A-KO hearts. Western blot analysis of proteins (28). Indeed, nearly 130 of these proteins were predicted PKC-␣, PKC-␤, PKC-␧, PKC-␪, and RACK-1 in both cytosolic and membrane to contain one or more transmembrane domains by TMpred protein fractions. Each band reﬂects fractions isolated from three pooled (www.ch.embnet.org͞software͞TMPRED࿝form.html; Fig. 2D). mutant hearts. The experiment was performed in duplicate.

Differential Expression of Membrane and Membrane-Associated Pro- teins in I40A-KO Cardiac Tissue Relative to PLN-KO Mutant Hearts. carbohydrate metabolism, such as the glycolytic enzymes ␣-enolase, Select subsets of the proteins detected were expressed differentially triosephosphate isomerase, fructose-biphosphate aldolase A, and in the hypertrophic I40A-KO animals relative to the PLN-KO proteins linked to fat metabolism, including fatty acid-binding mutant strain. Our proteomic analysis detected increased levels of protein, apolipoprotein A, very-low-density lipoprotein receptor, ANF and ␤-MHC, both well established markers of hypertrophy and fatty aldehyde dehydrogenase, consistent with substantive (29) in cardiac tissue from the I40A-KO line, as compared with the physiological remodeling of cell metabolism (Table 2). PLN-KO strain. We verified these observations by RNA slot-blot analysis, which showed that significantly higher levels of ANF and Activation Profile of PKC in I40A-KO. Activation of the G proteins ͞ ␤-MHC transcripts were expressed in the I40A-KO line (Fig. 3A). Gq G11 is normally associated with a characteristic pattern of PKC The levels of other known markers of cardiomyopathy, including isoform activity (11, 30). Because the proteomic data predicted plasma membrane Ca2ϩ ATPase, ryanodine receptor (RyR), and activation of G protein-signaling cascades in the I40A mutant heart, integrin-␤1, were also increased in I40A animals, with no significant we examined the levels of PKC in cardiac muscle tissue by Western changes in SERCA2, Naϩ͞Ca2ϩexchanger 1, or calreticulin levels. blot analysis. We probed both cytosolic and microsomal fractions These results were confirmed by Western blot analysis (Fig. 3B). because PKC translocation into membranes is a key feature of PKC They are consistent with the results of previous studies of PLN activation (11). The levels of both membrane-associated and solu- transgenic mice, and other models of cardiac hypertrophy, which ble cytosolic fractions of PKC␣, PKC␤, PKC␪, and RACK1 were showed that SERCA2 protein levels do not change (8) and that all increased significantly in the I40A-KO mice relative to PLN-KO RyR protein levels are perturbed by changes in PLN expression (4). (Fig. 4). By contrast, the cytosolic fraction of PKC␧ was increased These results validate our proteomic methods and confirm the significantly in I40A-KO hearts. These observations suggest that the hypertrophic state of these animals (Fig. 1). activation of PKC is closely linked to the development of cardio- We grouped the remaining differentially expressed proteins into myopathy and the emergence of cardiac hypertrophy. annotation categories. The data for a select subset is shown in Table 2. Several of the results are intriguing. First, the I40A transgenic Discussion BIOCHEMISTRY tissue showed increased levels of ER protein-sorting molecules, Physiological features of end-stage heart failure include decreases ϩ such as endoplasmin, SEC22, and COP-coated vesicle protein, in the activity of SERCA2a, in the size of SR Ca2 stores, in the ϩ whereas the levels of other stably resident ER͞SR proteins, such as amplitude of depolarization-induced Ca2 transients, and in cardiac ϩ SERCA2, calsequestrin, calumenin, and calreticulin, were not contractility (2). Thus, the potential role of Ca2 regulatory pro- perturbed. teins in human congestive heart failure is of particular mechanistic Strikingly, the levels of proteins linked to intracellular signaling interest. However, changes in the function of a single, critical were up-regulated in the I40A mutant animals. These included regulatory protein are likely to result in adaptive changes in the numerous guanine nucleotide-binding proteins (e.g., G protein ␣ expression and activity of an entire network of functionally related subunit Gq͞G11) and Ras-related proteins (e.g., R-Ras, Rab-10, proteins, ultimately leading to systemic biochemical remodeling of and RAP-1A) (Table 2). These data are consistent with compen- the heart and progression to heart failure. In this respect, knockout satory activation of G protein-dependent and Ras-related signaling and transgenic animals that develop heart failure provide the pathway(s) in the hypertrophic I40A mutant hearts (11, 30). These opportunity for investigation of a series of alterations in signaling pathways may be linked to cytoskeletal reorganization (11, 30). pathways that may lead to a single endpoint, such as dilated Consistent with this, we also observed marked changes in the levels cardiomyopathy. With this in mind, we have embarked on a of cytoskeletal proteins, such as actin, desmin, vimentin, spectrin, proteomic screening approach to identify global perturbations in and tubulin in the I40A heart, changes consistent with pernicious cardiac protein expression patterns that occur in mice exhibiting growth (Table 2). different degrees of contractility, some of which progress to cardiac The abundance of certain structural͞contractile proteins were hypertrophy. also altered in the I40A-KO heart tissue relative to the PLN-KO, To date, studies describing protein expression profiles in the including elevated levels of embryonic myosin heavy chains and pathogenesis of heart disease have focused mainly on soluble reduced levels of adult ventricular myosins (Table 2), consistent cytosolic proteins and have used 2D gel electrophoresis (14, 15). with the reversion of adult cardiac tissue to the fetal patterns of Characteristically, these studies lack comprehensive data on mem- expression observed during cardiac hypertrophy (29). The brane-bound proteins. Our study describes the development and I40A-KO animals showed increased levels of proteins linked to successful application of a robust and sensitive gel-free method for

Pan et al. PNAS ͉ February 24, 2004 ͉ vol. 101 ͉ no. 8 ͉ 2245 Downloaded by guest on September 25, 2021 the direct identification and assessment of changes in the levels of The significant changes observed in cytoskeletal, structural, and membrane-associated proteins in heart tissue from animals exhib- contractile proteins in the I40A heart are consistent with a tissue iting differential contractility. This form of proteome mapping that is undergoing substantial structural remodeling, as would be circumvents many of the technical limitations associated with expected in a hypertrophic heart. Indeed, increases in protein levels gel-based proteomics technology (31) and enables comprehensive of collagens, integrins, myosin light chains, and tubulins have all characterization of the global protein components of isolated been documented in mouse or human models of cardiac hypertro- membranous fractions (23, 24). phy (37, 38). Our ability to detect changes in the levels of these We have started with two well characterized models of dysregu- 2ϩ proteins (Table 2) is entirely consistent with previous reports and lation of Ca signaling: the hypercontractile PLN-null mouse and further validates our proteomics analyses. the PLN superinhibitory transgenic model that develops mild The apparent changes in mitochondrial components, including cardiac hypertrophy. These animals were chosen because they proteins involved in carbohydrate and fat metabolism, indicate represent polar extremes of cardiac contractility in mice, neither of which progress to heart failure. Mice lacking PLN display an substantial changes in energy metabolism in the I40A heart. Again, augmentation of both cardiac contractility and rate of relaxation, such changes would be anticipated given extensive documentation without any long-term pathological effects (5, 32). In contrast, the in other models of cardiac hypertrophy (39). However, because I40A-KO null mutant mice exhibit ventricular dilation and de- these proteins were detected in a preparation that is enriched for creased contractile function, as observed by echocardiography microsomes, and not mitochondria, it will be particularly appro- (Table 1), and impairment of force development and relaxation, as priate to confirm these changes in isolated mitochondrial fractions. assessed by hemodynamic measurements. They also develop mild In summary, we have successfully adapted a gel-free MS proce- cardiac hypertrophy, manifested by a statistically significant in- dure for the investigation of cardiomyopathy. The most significant crease in LV mass (Table 1), and up-regulation of embryonic and advantage of such an approach is the ability to investigate mem- contractile protein genes such as ANF and ␤-MHC, as confirmed brane proteins, a limitation of gel-based systems. This investigation by MS (Fig. 3). is an example of applying emerging mass spectrometric technology Within this set of differentially expressed proteins, we found to the proteomic analysis of heart disease. Continuation of these altered abundance of a number of components of specific G studies through the careful investigation of additional models of protein-signaling pathways in I40A-KO cardiac muscle, as com- heart disease and other subcellular compartments, in particular, ͞ pared with PLN-KO mice. The accumulation of Gq 11 and mitochondrial, cytosolic, and nuclear fractions, and further refine- RACK1 detected in I40A-KO (Table 2 and Fig. 4) suggests that ͞ ͞ ments to the quantitative nature of the procedure should provide activation of Gq G11 PKC-dependent signaling pathways occurs additional insight into the pathophysiological mechanisms of car- during impaired cardiac function in the I40A-KO heart. The diac hypertrophy leading to heart failure. increased levels of PKC␣, PKC␤, PKC␧, PKC␪, and RACK1 in both cytosolic and membrane fractions in the I40A-KO heart (Fig. We thank Alex Ignatchenko for expert assistance in programming and 4) are consistent with this model. This finding is similar to previous computation. This work was supported by grants from the Natural Science reports on the response of cultured cardiomyocytes to agonist ͞ and Engineering Research Council of Canada and Genome Canada (to binding to Gq G11 protein-coupled receptors (33, 34) and in vivo A.E.), by Heart and Stroke Foundation of Ontario Grant T-5042 and CIHR transgenic overexpression of Gq (35, 36) that also implicate PKC in Grants MT-12545 and MOP-49493 and the Neuromuscular Research the development of cardiac hypertrophy. However, because we Partnership Program (to D.H.M.), and by National Institutes of Health examined only one subcellular fraction and did not carry out a grants (to E.G.K.). Y.P and A.O.G. were supported by fellowships from the global proteomic assessment of all other cellular fractions, inter- Heart and Stroke Foundation of Ontario; T.K. was supported by a fellow- pretation of these data must be considered tentative. ship from the Josef Schormu¨ller Geda¨chtnisstiftung.

1. Bers, D. M. (2002) Excitation-Contraction Coupling and Cardiac Contractile Force (Kluwer, 20. Waterston, R. H., Lindblad-Toh, K., Birney, E., Rogers, J., Abril, J. F., Agarwal, P., Boston). Agarwala, R., Ainscough, R., Alexandersson, M., An, P., et al. (2002) Nature 420, 2. MacLennan, D. H. & Kranias, E. G. (2003) Nat. Rev. Mol. Cell. Biol. 4, 566–577. 520–562. 3. Simmerman, H. K., Collins, J. H., Theibert, J. L., Wegener, A. D. & Jones, L. R. (1986) 21. Florens, L., Washburn, M. P., Raine, J. D., Anthony, R. M., Grainger, M., Haynes, J. D., J. Biol. Chem. 261, 13333–13341. Moch, J. K., Muster, N., Sacci, J. B., Tabb, D. L., et al. (2002) Nature 419, 520–526. 4. Luo, W., Grupp, I. L., Harrer, J., Ponniah, S., Grupp, G., Duffy, J. J., Doetschman, T. & 22. Koss, K. L. & Kranias, E. G. (1996) Circ. Res. 79, 1059–1063. 75, Kranias, E. G. (1994) Circ. Res. 401–409. 23. Washburn, M. P., Wolters, D. & Yates, J. R., III. (2001) Nat. Biotechnol. 19, 242–247. 5. Kadambi, V. J., Koss, K. L., Grupp, I. L. & Kranias, E. G. (1998) J. Mol. Cell. Cardiol. 30, 24. Kislinger, T., Rahman, K., Radulovic, D., Cox, B., Rossant, J. & Emili, A. (2003) Mol. Cell. 1275–1284. Proteomics. 2, 96–106. 6. Zvaritch, E., Backx, P. H., Jirik, F., Kimura, Y., de Leon, S., Schmidt, A. G., Hoit, B. D., Lester, J. W., Kranias, E. G. & MacLennan, D. H. (2000) J. Biol. Chem. 275, 14985–149891. 25. Bairoch, A. & Apweiler, R. (2000) Nucleic Acids Res. 28, 45–48. 7. Zhai, J., Schmidt, A. G., Hoit, B. D., Kimura, Y., MacLennan, D. H. & Kranias, E. G. (2000) 26. Eng, J. K., McCormack, A. L. & Yates, J. R. I. (1994) J. Am. Soc. Mass Spectrom. 11, 976–989. J. Biol. Chem. 275, 10538–10544. 27. Hubbard, T., Barker, D., Birney, E., Cameron, G., Chen, Y., Clark, L., Cox, T., Cuff, J., 8. Haghighi, K., Schmidt, A. G., Hoit, B. D., Brittsan, A. G., Yatani, A., Lester, J. W., Zhai, J., Curwen, V., Down, T., et al. (2002) Nucleic Acids Res. 30, 38–41. Kimura, Y., Dorn, G. W., II, MacLennan, D. H., et al. (2001) J. Biol. Chem. 276, 24145–24152. 28. Molloy, M. P. (2000) Anal. Biochem. 280, 1–10. 9. Haghighi, K., Kolokathis, F., Pater, L., Lynch, R. A., Asahi, M., Gramolini, A. O., Fan, G. C., 29. Chien, K. R., Knowlton, K. U., Zhu, H. & Chien, S. (1991) FASEB J. 5, 3037–3046. Tsiapras, D., Hahn, H. S., Adamopoulos, S., et al. (2003) J. Clin. Invest. 111, 869–876. 30. Dorn, G. W., II. (2002) J. Cardiac Failure 8, S370–S373. 10. Schmidt, A. G., Haghighi, K., Frank, B., Pater, L., Dorn, G. W., Walsh, R. A. & Kranias, 31. Corthals, G. L., Wasinger, V. C., Hochstrasser, D. F. & Sanchez, J. C. (2000) Electrophoresis E. G. (2003) J. Mol. Cell. Cardiol. 35, 867–870. 21, 1104–1115. 11. Molkentin, J. D. & Dorn, I. G., II. (2001) Annu. Rev. Physiol. 63, 391–426. 32. Slack, J. P., Grupp, I. L., Dash, R., Holder, D., Schmidt, A., Gerst, M. J., Tamura, T., 12. Anderson, L. & Seilhamer, J. (1997) Electrophoresis 18, 533–537. Tilgmann, C., James, P. F., Johnson, R., et al. (2001) J. Mol. Cell. Cardiol. 33, 1031–1140. 13. Haynes, P. A., Gygi, S. P., Figeys, D. & Aebersold, R. (1998) Electrophoresis 19, 1862–1871. 33. Dunnmon, P. M., Iwaki, K., Henderson, S. A., Sen, A. & Chien, K. R. (1990) J. Mol. Cell. 14. Corbett, J. M., Why, H. J., Wheeler, C. H., Richardson, P. J., Archard, L. C., Yacoub, M. H. Cardiol. 22, 901–910. & Dunn, M. J. (1998) Electrophoresis 19, 2031–2042. 34. Henrich, C. J. & Simpson, P. C. (1988) J. Mol. Cell. Cardiol. 20, 1081–1085. 15. Macri, J., McGee, B., Thomas, J. N., Du, P., Stevenson, T. I., Kilby, G. W. & Rapundalo, 35. D’Angelo, D. D., Sakata, Y., Lorenz, J. N., Boivin, G. P., Walsh, R. A., Liggett, S. B. & Dorn, S. T. (2000) Electrophoresis 21, 1685–1693. 16. Buscemi, N., Doherty-Kirby, A., Sussman, M. A., Lajoie, G. & Van Eyk, J. E. (2003) Mol. G. W., II. (1997) Proc. Natl. Acad. Sci. USA 94, 8121–8126. Cell. Biochem. 251, 145–151. 36. Sakata, Y., Hoit, B. D., Liggett, S. B., Walsh, R. A. & Dorn, G. W., II. (1998) Circulation 17. Arrell, D. K., Neverova, I. & Van Eyk, J. E. (2001) Circ. Res. 88, 763–773. 97, 1488–1495. 18. Aebersold, R. & Mann, M. (2003) Nature 422, 198–207. 37. Hein, S., Kostin, S., Heling, A., Maeno, Y. & Schaper, J. (2000) Cardiovasc. Res. 45, 273–278. 19. Venter, J. C., Adams, M. D., Myers, E. W., Li, P. W., Mural, R. J., Sutton, G. G., Smith, 38. Delcayre, C. & Swynghedauw, B. (2002) J. Mol. Cell. Cardiol. 34, 1577–1584. H. O., Yandell, M., Evans, C. A., Holt, R. A., et al. (2001) Science 291, 1304–1351. 39. Carvajal, K. & Moreno-Sanchez, R. (2003) Arch. Med. Res. 34, 89–99.

2246 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0308174101 Pan et al. Downloaded by guest on September 25, 2021