DOCSLIB.ORG

Expression of Calciumbuffering Proteins in Rat Intrinsic Laryngeal

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Expression of Calciumbuffering Proteins in Rat Intrinsic Laryngeal Physiological Reports ISSN 2051-817X ORIGINAL RESEARCH Expression of calcium-buffering proteins in rat intrinsic laryngeal muscles Renato Ferretti1, Maria Julia Marques2, Tejvir S. Khurana3 & Humberto Santo Neto2 1 Departamento de Anatomia, Instituto de Biociencias de Botucatu, Universidade Estadual Paulista, Botucatu, Sao~ Paulo, Brazil 2 Departamento de Biologia Estrutural e Funcional, Instituto de Biologia, Universidade Estadual de Campinas, Campinas, Sao~ Paulo, Brazil 3 Department of Physiology, Perelman School of Medicine and Pennsylvania Muscle Institute, University of Pennsylvania, Philadelphia, Pennsylvania Keywords Abstract Calcium, laryngeal muscles, Ncx, Pmca1, Serca, store-operated calcium entry. Intrinsic laryngeal muscles (ILM) are highly specialized muscles involved in phonation and airway protection, with unique properties that allow them to Correspondence perform extremely rapid contractions and to escape from damage in muscle Humberto Santo Neto, Departamento de dystrophy. Due to that, they may differ from limb muscles in several physio- Biologia Estrutural e Funcional, Instituto de logical aspects. Because a better ability to handle intracellular calcium has been Biologia, Universidade Estadual de Campinas suggested to explain ILM unique properties, we hypothesized that the profile (UNICAMP). Campinas, SP - 13083-970, of the proteins that regulate calcium levels in ILM is different from that in a Brazil. Tel: +55-19-3521-6395 limb muscle. Calcium-related proteins were analyzed in the ILM, cricothyroid Fax: 55-19-3521-6185 (CT), and tibialis anterior (TA) muscles from male Sprague–Dawley rats E-mail: [email protected] (8 weeks of age) using quantitative PCR and western blotting. Higher expres- sion of key Ca2+ regulatory proteins was detected in ILM compared to TA, Funding Information such as the sarcoplasmic reticulum (SR) Ca2+-reuptake proteins (Sercas 1 and This work was supported by CAPES/PDEE + 2+ 2+ ß~ 2), the Na /Ca exchanger, phospholamban, and the Ca -binding protein (grant #2037/10-6) and Fundacao de 2+ Amparo a Pesquisa do Estado de Sao~ Paulo calsequestrin. Parvalbumin, calmodulin and the ATPase, Ca -transporting, (FAPESP, grants 04/15526-9, 08/58491-1 and and plasma membrane 1 were also expressed at higher levels in ILM compared 13/10633-0). H.S.N. and M.J.M. are to TA. The store-operated calcium entry channel molecule was decreased in recipients of fellowships from Conselho ILM compared to the limb muscle and the voltage-dependent L-type and Nacional de Pesquisas (CNPq; 302831/2013- ryanodine receptor were expressed at similar levels in ILM and TA. These 4; 303320/2013-3; 474708/06-3). R.F. was results show that ILM have a calcium regulation system profile suggestive of a recipient of a fellowship from CAPES/PDEE better ability to handle calcium changes in comparison to limb muscles, and (2037/10-6), PROPe UNESP (2052/002/14) and CNPq (143170/08-2). this may provide a mechanistic insight for their unique pathophysiological properties. Received: 20 February 2015; Revised: 27 April 2015; Accepted: 29 April 2015 doi: 10.14814/phy2.12409 Physiol Rep, 3 (6), 2015, e12409, doi: 10.14814/phy2.12409 Introduction Dulhunty 1982; DelGaudio et al. 1995; Hoh 2005). These functions are possible due to ILM unique features that The intrinsic laryngeal muscles (ILM) are highly special- include specific fiber-type composition, high speed con- ized muscles involved in vital functions that include respi- traction, and resistance to fatigue (Hinrichsen and Dulh- ration, phonation, and airway protection (Hinrichsen and unty 1982; Hoh 2005). Their ability to precisely control ª 2015 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of 2015 | Vol. 3 | Iss. 6 | e12409 the American Physiological Society and The Physiological Society. Page 1 This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. Calcium Proteins in Laryngeal Muscles R. Ferretti et al. airway caliber during phonation requires specific charac- pumped back into the SR by sarcoplasmic reticulum Ca2+ teristics reflected in their mechanical properties, innerva- ATPases (SERCA), extruded from the cell by the Na+/ tion pattern (Maranillo et al. 2005; Shinners et al. 2006; Ca2+ exchanger (NCX) (Berridge et al. 2003) and buffered Xu et al. 2009), regenerative capacity, response to age by the low-affinity, high capacity Ca2+-binding protein (Kersing and Jennekens 2004; Goding et al. 2005; calsequestrin (CASQ) (Beard et al. 2004). Other proteins McLoon et al. 2007), and disease (Marques et al. 2007; that also play a role in Ca2+ regulation include the T-sys- Thomas et al. 2008; Smythe 2009). Within the ILM, the tem plasma membrane Ca2+-ATPase type I (PMCA1) and posterior cricoarytenoid (PCA) muscle abducts the vocal the store-operated calcium entry (SOCE), which uses the fold, whereas the thyroarytenoid and cricothyroid (CT) SR Ca2+ sensor Orai1 Ca2+ channel (Lang et al. 2012). In adducts and tenses the vocal fold to aid in phonation and addition, cytosolic Ca2+-binding proteins, such as parval- airway protection during swallowing (Hinrichsen and bumin (PVALB), calmodulin (CaM), and regucalcin Dulhunty 1982; Hoh 2005). An interesting property of (RGN), can modify Ca2+ transients to ensure Ca2+ the ILM, in comparison to limb muscles, is their differen- homeostasis (Gailly 2002; Berridge et al. 2003; Beard et al. tial involvement in neuromuscular disorders. While ILM 2004; Yamaguchi 2005; Lang et al. 2012). are involved early in myasthenia gravis, amyotrophic lat- In this study, we evaluated the profile of calcium regu- eral sclerosis with bulbar involvement, and mitochondrial lation systems in ILM compared to limb muscle (tibialis myopathy (Debain et al. 1968; Mao et al. 2001), they are anterior, TA), in adult rats, using qPCR and Western histologically spared in Duchenne muscle dystrophy blotting. We were interested to see whether ILM shows a (DMD), except for the CT muscle (Marques et al. 2007; constitutive calcium-buffering proteins profile that could Thomas et al. 2008; Smythe 2009). predict their better capacity to handle calcium changes in The ILM play important roles in initiation of and comparison to limb muscle and EOM. We found that recovery from acute respiratory distress syndrome Ca2+ reuptake-related proteins of the sarcoplasmic reticu- (ARDS) and critical illnesses, with both swallowing and lum (Serca1, Serca2, Pln, Casq1, and Casq2) were phonation disability (Nixon et al. 2010). Additionally, expressed at higher levels in ILM in comparison to the vocal muscle paralysis is an important and frequent con- limb muscle. ILM showed higher levels of Orai1 in rela- dition seen in otolaryngology clinics, most frequently tion to TA and CaM was 17-fold increased in ILM com- caused by lesions to the recurrent laryngeal nerve (Li pared to TA. A similar pattern of gene expression of et al. 2014), although idiopathic etiologies remain com- Sercas 1 and 2 and calsequestrins was observed in the mon causes of unilateral vocal fold immobility (Rosenthal dystrophin-deficient mdx mice compared to the rat. These et al. 2007). Possible mechanisms underlying this differ- results provide a mechanistic insight into ILM physiologi- ential response of ILM to muscle diseases, compared to cal properties and response to pathophysiological condi- limb muscles, may be related to differences regarding tions. their neuromuscular junction structure or satellite cell regenerative potential (Feng et al. 2012). In the mdx Methods mouse model of DMD (Bulfield et al. 1984), we have sug- gested that ILM differ from the affected limb muscles in Animals terms of their ability to handle changes in calcium due to differential levels of calcium-buffering proteins (Ferretti All animal experiments were performed in accordance et al. 2009), similarly to what is observed in the extraocu- with the ARVO Statement for the Use of Animals in lar muscles, which are also protected in dystrophy (Khur- Ophthalmic and Vision Research, using protocols ana et al. 1995; Porter et al. 1998). approved by the Institutional Animal Care and Use Com- In skeletal muscle fibers, intracellular calcium (Ca2+) mittee of the University of Pennsylvania School of Medi- plays an important role in regulating muscle force pro- cine (protocol #A3079-01) and by the Committee of the duction, metabolism, and muscle gene expression (Berch- University of Campinas (protocol #1463-1). Male told et al. 2000; Chin 2010). The sarcoplasmic reticulum Sprague–Dawley rats (n = 20; 8 weeks of age), control (SR) and T-tubule membrane proteins play central roles C57BL/10ScSnJ (Ctrl, n = 10; 8 weeks of age), and mdx in calcium regulation. In excitation contraction coupling, mice (C57BL/10ScSn-Dmdmdx/J; n = 10; 8 weeks of age) depolarization of the plasma membrane leads to the obtained from Jackson Laboratory were used in all experi- release of Ca2+ from the SR through ryanodine receptors ments. The mice and rats were housed according to insti- (RyRs), which are opened via a direct physical interaction tutional guidelines and received food and water with the dihydropyridine receptors (DHPR, CACNA1S), ad libitum during all experiments. voltage sensors localized in the T-tubules (Melzer et al. The muscles studied were the ILM (thyroarythenoid, 1995; Gailly 2002). At the end of stimulation, Ca2+ is posterior, and lateral cricoarythenoid), the cricothyroid 2015 | Vol. 3 | Iss. 6 |
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Pnas11138correction 14002..14003
    Corrections MEDICAL SCIENCES Correction for “Regulation of bone remodeling by vasopressin New, Alberta Zallone, and Mone Zaidi, which appeared in issue 46, explains the bone loss in hyponatremia,” by Roberto Tamma, November 12, 2013, of Proc Natl Acad Sci USA (110:18644–18649; Li Sun, Concetta Cuscito, Ping Lu, Michelangelo Corcelli, first published October 28, 2013; 10.1073/pnas.1318257110). Jianhua Li, Graziana Colaianni, Surinder S. Moonga, Adriana The authors note that Fig. 1 appeared incorrectly. The cor- Di Benedetto, Maria Grano, Silvia Colucci, Tony Yuen, Maria I. rected figure and its legend appear below. Fig. 1. Bone cells express Avprs. Immunofluorescence micrographs (A) and Western immunoblotting (B) show the expression of Avpr1α in osteoblasts and osteoclasts, and as a function of osteoblast (mineralization) and osteoclast (with Rankl) differentiation. The expression of Avp (ligand) and Avpr1α (receptor) in osteoblasts is regulated by 17β-estradiol, as determined by quantitative PCR (C) and Western immunoblotting (D). (Magnification: A,63×.) Because Avp is a small peptide, its precursor neurophysin II is measured. Statistics: Student t test, P values shown compared with 0 h. Stimulation of Erk phosphorylation − (p-Erk) as a function of total Erk (t-Erk) by Avp (10 8 M) in osteoclast precursors (preosteoclasts), osteoclasts (OC), and osteoblasts establishes functionality of − the Avpr1α in the presence or absence of the receptor inhibitor SR49059 (10 8 M) (E). Western immunoblotting showing the expression of Avpr2 in pre- −/− osteoclasts, OCs (F), and osteoblasts (G) isolated from Avpr1α mice, as well as in MC3T3.E1 osteoblast precursors (G). Functionality of Avpr2 was confirmed −/− by the demonstration that cells from Avpr1α mice remained responsive to AVP in reducing the expression of osteoblast differentiation genes, namely Runx2, Osx, Bsp, Atf4, Opn, and Osteocalcin (quantitative PCR, P values shown) (H).
    [Show full text]
  • Sat-196 How to Estimate Glomerular Filtration Rate
    ISN WCN 2019 ABSTRACTS 13 (28%) patients had CKD stage 3. 6/13 had low predicted risk of Nephrology, Melbourne, Australia, 8Austin Hospital, Nephrology, Heidel- berg, Australia, 9Monash Childrens Hospital, Nephrology, Australia, progression at 5 years of whom 4/6 progressed unexpectedly. 1/13 was 10 identified as having high risk at 5 years and that 1 patient progressed to Melbourne Genomics Health Alliance, Victorian Clinical Genetics Service, Melbourne, Australia, 11Australian Genomic Health Alliance, KidGen Renal CKD5D/T. Genetics Flagship, Australia, Australia, 12Royal Childrens Hospital, 6/18 CKD 3/4 patients with predicted low risk progressed to CKD5D/ Nephrology, Melbourne, Australia T unexpectedly. 1/6 had emergency abdominal surgery, 1/6 patient had Introduction: Genomic technologies enable the rapid and cost-effective unexplained rapid progression and 4/6 had acute upper gastro-intes- fi tinal haemorrhage causing terminal decline of kidney function. sequencing of DNA and have demonstrated a de nitive diagnosis in Conclusions: The number of patients analysed was small. The 8-vari- several patient groups. The clinical utility of whole exome sequencing able equation accurately predicted high risk of progression to CKD5D/T (WES) in a kidney disease cohort is not yet well established. We in 7/9 CKD3/4 patients. describe the patient characteristics and diagnostic yield of a cohort of Conversely, 6/18 patients with predicted low risk progressed to 200 patients with suspected genetic kidney disease referred for WES via CKD5D/T. Acute medical events including upper gastro-intestinal bleed a multidisciplinary renal genetics clinic. Methods: accounted for most instances of unexpected progression. 200 sequential patients were recruited into a prospective observational cohort study through five tertiary academic centres in Victoria, Australia.
    [Show full text]
  • Steroid-Dependent Regulation of the Oviduct: a Cross-Species Transcriptomal Analysis
    University of Kentucky UKnowledge Theses and Dissertations--Animal and Food Sciences Animal and Food Sciences 2015 Steroid-dependent regulation of the oviduct: A cross-species transcriptomal analysis Katheryn L. Cerny University of Kentucky, [email protected] Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Cerny, Katheryn L., "Steroid-dependent regulation of the oviduct: A cross-species transcriptomal analysis" (2015). Theses and Dissertations--Animal and Food Sciences. 49. https://uknowledge.uky.edu/animalsci_etds/49 This Doctoral Dissertation is brought to you for free and open access by the Animal and Food Sciences at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Animal and Food Sciences by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known.
    [Show full text]
  • Calmodulin and Calmodulin-Dependent Protein Kinase II Inhibit Hormone Secretion in Human Parathyroid Adenoma
    31 Calmodulin and calmodulin-dependent protein kinase II inhibit hormone secretion in human parathyroid adenoma Ming Lu1,2,3, Erik Berglund1, Catharina Larsson1,3, Anders Ho¨o¨g4, Lars-Ove Farnebo1 and Robert Bra¨nstro¨m1 1Department of Molecular Medicine and Surgery, Karolinska Institutet, Karolinska University Hospital L1:03, SE-171 76 Stockholm, Sweden 2Department of Geriatric Endocrinology, First Affiliated Hospital of Guangxi Medical University, NanNing, People’s Republic of China 3Center for Molecular Medicine (CMM), Karolinska University Hospital, SE-171 76 Stockholm, Sweden 4Department of Oncology–Pathology, Karolinska Institutet, Karolinska University Hospital, SE-171 76 Stockholm, Sweden (Correspondence should be addressed to M Lu at Department of Molecular Medicine and Surgery, Karolinska Institutet, Karolinska University Hospital; Email: [email protected]) Abstract 2C 2C Intracellular calcium ([Ca ]i) is the most relevant modulator adenoma cells in spite of increased [Ca ]i. The inhibitory C of parathyroid hormone (PTH) secretion. Uniquely, an effect of Ca2 calmodulin on PTH secretion may be due to 2C increase in [Ca ]i results in an inhibition of PTH secretion, the absence of synaptotagmin 1 protein in parathyroid and it probably exerts its function via calcium-binding protein adenomas, as demonstrated by western blot analysis. An pathways. The ubiquitous calcium-binding proteins, calmo- increased extracellular calcium level acutely lowered the dulin and calmodulin-dependent protein kinase II (CaMKII), amount of active phosphorylated CaMKII (pCaMKII) in have well-established roles in regulated exocytosis in neurons adenoma cells in vitro, indicating the physiological importance and neuroendocrine cells. However, their roles in parathyroid of this pathway. Moreover, a negative correlation between the cells and PTH secretion are still unclear.
    [Show full text]
  • FAM210A Is a Novel Determinant of Bone and Muscle Structure And
    FAM210A is a novel determinant of bone and muscle PNAS PLUS structure and strength Ken-ichiro Tanakaa, Yingben Xuea, Loan Nguyen-Yamamotoa, John A. Morrisb,c,d, Ippei Kanazawae, Toshitsugu Sugimotoe, Simon S. Winga,f, J. Brent Richardsb,c,d, and David Goltzmana,f,1 aCalcium Research Laboratory, Metabolic Disorders and Complications Program, Research Institute of the McGill University Health Centre, Montreal, QC, Canada H4A 3J1; bDepartment of Medicine, McGill University, Montreal, QC, Canada H3T 1E2; cDepartment of Human Genetics, Jewish General Hospital, McGill University, Montreal, QC, Canada H3T 1E2; dDepartment of Epidemiology and Biostatistics, Jewish General Hospital, McGill University, Montreal, QC, Canada H3T 1E2; eInternal Medicine 1, Faculty of Medicine, Shimane University, 693-8501 Shimane, Japan; and fDivision of Endocrinology, Department of Medicine, McGill University, Montreal, QC, Canada H4A 3J1 Edited by John T. Potts, Massachusetts General Hospital, Charlestown, MA, and approved March 14, 2018 (received for review November 1, 2017) Osteoporosis and sarcopenia are common comorbid diseases, yet TOM1L2/SREBF1 locus were found to exert opposing effects on their shared mechanisms are largely unknown. We found that total body lean mass and total body less head BMD (13). SREBP- genetic variation near FAM210A was associated, through large 1, and the product of the SREBF1 gene, is known to exert op- genome-wide association studies, with fracture, bone mineral posing effects on osteoblast and myoblast differentiation (14, 15). density (BMD), and appendicular and whole body lean mass, in However, more commonly, bone loss coincides with a decrease in humans. In mice, Fam210a was expressed in muscle mitochondria muscle mass and function, suggesting that there are shared bio- and cytoplasm, as well as in heart and brain, but not in bone.
    [Show full text]
  • Bioinformatic Analyses in Early Host Response To
    Schroyen et al. BMC Genomics (2016) 17:196 DOI 10.1186/s12864-016-2547-z RESEARCH ARTICLE Open Access Bioinformatic analyses in early host response to Porcine Reproductive and Respiratory Syndrome virus (PRRSV) reveals pathway differences between pigs with alternate genotypes for a major host response QTL Martine Schroyen1†, Christopher Eisley2†, James E. Koltes3, Eric Fritz-Waters1, Igseo Choi4, Graham S. Plastow5, Leluo Guan5, Paul Stothard5, Hua Bao5, Arun Kommadath5, James M. Reecy1, Joan K. Lunney4, Robert R. R. Rowland6, Jack C. M. Dekkers1 and Christopher K. Tuggle1* Abstract Background: AregiononSus scrofa chromosome 4 (SSC4) surrounding single nucleotide polymorphism (SNP) marker WUR10000125 (WUR) has been reported to be strongly associated with both weight gain and serum viremia in pigs after infection with PRRS virus (PRRSV). A proposed causal mutation in the guanylate binding protein 5 gene (GBP5)is predicted to truncate the encoded protein. To investigate transcriptional differences between WUR genotypes in early host response to PRRSV infection, an RNA-seq experiment was performed on globin depleted whole blood RNA collectedon0,4,7,10and14dayspost-infection(dpi)from eight littermate pairs with one AB (favorable) and one AA (unfavorable) WUR genotype animal per litter. Results: Gene Ontology (GO) enrichment analysis of transcripts that were differentially expressed (DE) between dpi across both genotypes revealed an inflammatory response for all dpi when compared to day 0. However, at the early time points of 4 and 7dpi, several GO terms had higher enrichment scores compared to later dpi, including inflammatory response (p <10-7), specifically regulation of NFkappaB (p < 0.01), cytokine, and chemokine activity (p <0.01).At10and 14dpi, GO term enrichment indicated a switch to DNA damage response, cell cycle checkpoints, and DNA replication.
    [Show full text]
  • Gene Alterations Identified by Expression Profiling in Tumor-Associated Endothelial Cells from Invasive Ovarian Carcinoma
    Research Article Gene Alterations Identified by Expression Profiling in Tumor-Associated Endothelial Cells from Invasive Ovarian Carcinoma Chunhua Lu,1 Tomas Bonome,3 Yang Li,1 Aparna A. Kamat,1 Liz Y. Han,1 Rosemarie Schmandt,1 Robert L. Coleman,1 David M. Gershenson,1 Robert B. Jaffe,4 MichaelJ. Birrer, 3 and AnilK. Sood 1,2 Departments of 1Gynecologic Oncology and 2Cancer Biology, University of Texas M. D. Anderson Cancer Center, Houston, Texas; 3Cell and Cancer Biology Branch, National Cancer Institute, Bethesda, Maryland; and 4Center for Reproductive Sciences, University of California, San Francisco, San Francisco, California Abstract the promise of such approaches. However, the full spectrum of Therapeutic strategies based on antiangiogenic approaches differences in the tumor vasculature compared with its normal are beginning to show great promise in clinical studies. counterpart is not known. Identification of additional targets on However, full realization of these approaches requires tumor endothelium may allow opportunities for developing new identification of key differences in gene expression between therapeutic approaches to inhibit angiogenesis in a tumor-specific endothelial cells from tumors versus their normal counter- manner. parts. Here, we examined gene expression differences in Higher levels of proangiogenic cytokines and angiogenesis are purified endothelial cells from 10invasive epithelial ovarian associated with an increased risk of metastasis and poor prognosis cancers and 5 normal ovaries using Affymetrix U133 Plus in ovarian cancer (5, 6). To date, a small number of breast, colon, 2.0microarrays. More than 400differentially expressed genes and brain cancers have been analyzed for gene expression changes were identified in tumor-associated endothelial cells.
    [Show full text]
  • Getic Pathways Critical Issues in Contractile fibres [132]
    Journal of Neuromuscular Diseases 1 (2014) 15–40 15 DOI 10.3233/JND-140011 IOS Press Review Mass Spectrometry-Based Identification of Muscle-Associated and Muscle-Derived Proteomic Biomarkers of Dystrophinopathies Paul Dowling, Ashling Holland and Kay Ohlendieck∗ Department of Biology, National University of Ireland, Maynooth, Ireland Abstract. The optimization of large-scale screening procedures of pathological specimens by genomic, proteomic and metabolic methods has drastically increased the bioanalytical capability for swiftly identifying novel biomarkers of inherited disorders, such as neuromuscular diseases. X-linked muscular dystrophy represents the most frequently inherited muscle disease and is characterized by primary abnormalities in the membrane cytoskeletal protein dystrophin. Mass spectrometry-based proteomics has been widely employed for the systematic analysis of dystrophin-deficient muscle tissues, using patient samples and animal models of dystrophinopathy. Both, gel-based methods and label-free mass spectrometric techniques have been applied in compar- ative analyses and established a large number of altered proteins that are associated with muscle contraction, energy metabolism, ion homeostasis, cellular signaling, the cytoskeleton, the extracellular matrix and the cellular stress response. Although these new indicators of muscular dystrophy have increased our general understanding of the molecular pathogenesis of dystrophinopathy, their application as new diagnostic or prognostic biomarkers would require the undesirable usage of invasive methodology. Hence, to reduce the need for diagnostic muscle biopsy procedures, more recent efforts have focused on the proteomic screening of suitable body fluids, such as plasma, serum or urine, for the identification of changed concentration levels of muscle-derived peptides, protein fragments or intact proteins. The occurrence of muscular dystrophy-related protein species in biofluids will be extremely helpful for the future development of cost-effective and non-invasive diagnostic procedures.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Serial Analysis of Gene Expression in Normal P53 Null Mammary Epithelium
    Oncogene (2002) 21, 6366 – 6376 ª 2002 Nature Publishing Group All rights reserved 0950 – 9232/02 $25.00 www.nature.com/onc Serial analysis of gene expression in normal p53 null mammary epithelium C Marcelo Aldaz*,1, Yuhui Hu1, Rachael Daniel1, Sally Gaddis1, Frances Kittrell2 and Daniel Medina2 1The University of Texas M.D. Anderson Cancer Center, Department of Carcinogenesis, Smithville, Texas, TX 78957, USA; 2Baylor College of Medicine Department of Molecular and Cellular Biology, Houston, Texas, TX 77030, USA Much evidence has accumulated implicating the p53 gene function although activating mutations were also as of importance in breast carcinogenesis. However, observed. Usually p53 abnormalities associate with much still remains to be uncovered on the specific poorer clinical outcome. This, likely, is the consequence downstream pathways influenced by this important of the known critical roles of p53 in regulating the cell activator/repressor of transcription. This study investi- cycle, apoptosis, DNA repair and maintaining genome gated the effects of a p53 null genotype on the stability (Levine, 1997). The loss of wild type p53 transcriptome of ‘normal’ mouse mammary epithelium function is clearly an important event in breast using a unique in vivo model of preneoplastic transforma- tumorigenesis as documented both in human and murine tion. We used SAGE for the comparative analysis of p53 systems (Donehower et al., 1995; Elledge and Allred, wild type (wt) and null mammary epithelium unexposed 1994). However, the exact mechanisms by which such and exposed to hormonal stimulation. Analysis of the lack of normal gene function leads to cancer formation hormone exposed samples provided a comprehensive view and progression are only beginning to be understood.
    [Show full text]
  • This Electronic Thesis Or Dissertation Has Been Downloaded from Explore Bristol Research
    This electronic thesis or dissertation has been downloaded from Explore Bristol Research, http://research-information.bristol.ac.uk Author: Al Ahdal, Hadil Title: Investigating the role of miR-21 in adult neurogenesis General rights Access to the thesis is subject to the Creative Commons Attribution - NonCommercial-No Derivatives 4.0 International Public License. A copy of this may be found at https://creativecommons.org/licenses/by-nc-nd/4.0/legalcode This license sets out your rights and the restrictions that apply to your access to the thesis so it is important you read this before proceeding. Take down policy Some pages of this thesis may have been removed for copyright restrictions prior to having it been deposited in Explore Bristol Research. However, if you have discovered material within the thesis that you consider to be unlawful e.g. breaches of copyright (either yours or that of a third party) or any other law, including but not limited to those relating to patent, trademark, confidentiality, data protection, obscenity, defamation, libel, then please contact [email protected] and include the following information in your message: •Your contact details •Bibliographic details for the item, including a URL •An outline nature of the complaint Your claim will be investigated and, where appropriate, the item in question will be removed from public view as soon as possible. Investigating the role of miR-21 in adult neurogenesis Hadil Mohammad Al Ahdal Faculty of Health Sciences Bristol Medical School A dissertation submitted to the University of Bristol in accordance with the requirements for award of the degree of Doctor of Philosophy in the Faculty of Health Sciences, Bristol Medical School 64,598 words Abstract MicroRNAs (miRNAs) are a class of small non-coding RNAs that act as post- transcriptional regulators and play important roles in neurodegenerative diseases and brain disorders (Nelson et al.
    [Show full text]