Identification of Regions of the Beet Mild Curly Top Virus

View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector

Virology 341 (2005) 257 – 270 www.elsevier.com/locate/yviro

Identification of regions of the Beet mild curly top virus (family Geminiviridae) capsid protein involved in systemic infection, virion formation and leafhopper transmission

Maria J. Soto1, Li-Fang Chen, Young-Su Seo, Robert L. Gilbertson*

Department of Plant Pathology, University of California, Davis, CA 95616, USA

Received 20 March 2005; returned to author for revision 28 April 2005; accepted 6 July 2005 Available online 8 August 2005

Abstract

Plant viruses in the genus Curtovirus (family Geminiviridae) are vectored by the beet leafhopper (Circulifer tenellus) and cause curly top disease in a wide range of dicotyledonous plants. An infectious clone of an isolate of Beet mild curly top virus (BMCTV-[W4]), associated with an outbreak of curly top in pepper and tomato crops, was characterized and used to investigate the role of the capsid protein (CP) in viral biology and pathogenesis. Frameshift mutations were introduced into the overlapping CP and V2 genes, and a series of CP alanine scanning mutations were generated. All mutants replicated in tobacco protoplasts or systemically infected plants, consistent with these gene products not being required for viral DNA replication. The CP frameshift mutant and most C-terminal alanine scanning mutants did not systemically infect Nicotiana benthamiana plants or form detectable virions, and were not leafhopper-transmitted. In contrast, most N-terminal alanine scanning mutants systemically infected N. benthamiana and induced disease symptoms, formed virions and were leafhopper-transmissible; thus, these substitution mutations did not significantly alter the functional properties of this region. One N-terminal mutant (CP49-51) systemically infected N. benthamiana, but did not form detectable virions; whereas another (CP25-28) systemically infected N. benthamiana and formed virions, but was not insect-transmissible. These mutants may reveal regions involved in virus movement through the plant and/or leafhopper vector. Together, these results indicate an important role for virions in systemic infection (long-distance movement) and insect transmission, and strongly suggest that virions are the form in which BMCTV moves, long distance, in the phloem. D 2005 Elsevier Inc. All rights reserved.

Keywords: Alanine scanning mutagenesis; Capsid protein; Beet leafhopper (Circulifer tenellus); Curly top disease; Curtovirus; Geminivirus; Insect transmission; Single-stranded DNA virus; Plant virus movement

Introduction Timmermans et al., 1994; Van Regenmortel et al., 2000). In nature, curtoviruses are spread by the beet leafhopper, The curly top disease of dicotyledonous plants is caused Circulifer tenellus (Baker). Curly top disease is an by viruses in the genus Curtovirus of the family Geminivir- economically important disease of crop plants such as idae, a group of plant viruses with small circular single- common bean, pepper, sugar beet and tomato in the Western stranded DNA genomes encapsidated in unique quasi- United States and other geographic locations (Bennett, isometric particles (18 Â 30 nm) (Hanley-Bowdoin et al., 1971; Stenger and McMahon, 1997). Symptoms of curly 1999; Harrison, 1985; Rojas et al., 2005; Rybicki, 1994; top disease include stunted growth, leaf curling and yellowing, as well as necrosis and hyperplasia of the phloem (Bennett, 1971). Curtovirus infections are consid- ered to be phloem-limited; and viral replication, gene * Corresponding author. Fax: +1 530 752 5674. E-mail address: [email protected] (R.L. Gilbertson). expression and virion formation occur in the nucleus (Esau, 1 Present address: Donald Danforth Plant Science Center, 975 North 1977; Esau and Hoefert, 1973; Esau and Magyarosy, 1979; Warson Road, St. Louis, MO 63132, USA. Latham et al., 1997; Thornley and Mumford, 1979).

There are presently five recognized curtovirus species infectious clone was characterized, and a series of alanine that differ in nucleotide sequence (¨80% sequence scanning mutants were generated and assessed for repli- identity) and biological properties, such as host range cation, systemic infection, virion formation and leafhopper and symptomatology: the type member Beet curly top transmission. virus (BCTV, previously the California/Logan strain of BCTV), Beet mild curly top virus (BMCTV, previously the Worland strain of BCTV), Beet severe curly top virus Results (BSCTV, previously the CFH strain of BCTV), Horse- radish curly top virus and Spinach curly top virus (Baliji Generation and characterization of a full-length infectious et al., 2004; Klute et al., 1996; Stanley et al., 1986; BMCTV clone Stenger et al., 1990; Stenger, 1998). Curtoviruses have a monopartite genome of ¨2.9 kb and a similar genome The partial sequence of a BMCTV isolate, associated organization: seven open reading frames (ORFs) tran- with an outbreak of curly top in pepper and tomato scribed in a bidirectional fashion from a 450 bp intergenic crops in New Mexico, U.S.A. in 1995 (Guzma´n et al., region (IR) that contains the origin of viral DNA 1996), was used to design an overlapping primer pair replication (Baliji et al., 2004; Briddon et al., 1998; Klute (Patel et al., 1993). This primer pair directed the et al., 1996; Stanley et al., 1986; Stenger, 1994). The three amplification of a putative full-length (¨2.9 kbp) virion-sense ORFs, V1, V2 and V3, are highly conserved BMCTV DNA fragment from a pepper plant from this and encode the capsid protein (CP), a single-stranded (ss)/ disease outbreak (data not shown). This fragment was double-stranded (ds) DNA regulator and a putative move- cloned to generate pBMCTV-[W4]. ment protein (MP), respectively. The four complementary- The pBMCTV-[W4] insert (hereafter referred to as sense ORFs, C1, C2, C3 and C4, are more divergent and BMCTV-[W4]) is 2930 nucleotides (GenBank accession encode the replication-associated protein (Rep), a product number AY134867), and is 97%, 84% and 80% identical to involved in a recovery phenotype, an enhancer of sequences of BMCTV (accession no. U56975), BSCTV replication and a product involved in symptom develop- (accession no. U02311) and BCTV (accession no. M24597), ment, respectively (Briddon et al., 1989; Hormuzdi and respectively. The genome organization of BMCTV-[W4] is Bisaro, 1993; Latham et al., 1997; Stanley et al., 1992; similar to that of previously characterized curtoviruses, with Stenger and Ostrow, 1996). The IR is also divergent 3 virion-sense and 4 complementary-sense ORFs. The among curtovirus species and contains species-specific nucleotide and amino acid sequences of the BMCTV-[W4] repeated iterons that mediate Rep binding during the ORFs are 93%–100% identical to those of BMCTV (data process of DNA replication (Arguello-Astorga et al., 1994; not shown), with the virion-sense and C1/C4 ORFs most Hanley-Bowdoin et al., 1999; Stenger, 1998). highly conserved, and the C2 and C3 ORFs most divergent. The geminivirus CP is multifunctional and is involved The BMCTV-[W4] and BMCTV CP nucleotide and amino in virion formation, systemic infection and insect trans- acid sequences are 99% and 100% identical, respectively; mission; but it is not required for replication of viral DNA. and the IR and Rep protein high affinity binding sites are Furthermore, the role of CP in systemic infection depends 92% and 100% identical, respectively. These results on the specific geminivirus–host combination. For some establish that BMCTV-[W4] is an isolate of BMCTV. whitefly-transmitted bipartite begomoviruses in some host The BMCTV-[W4] monomer (released from pBMCTV- plant species, CP is not required for systemic infection [W4]) replicated in transfected tobacco protoplasts based on (i.e., cell-to-cell and long-distance movement) or symptom the detection of newly replicated DNA forms, beginning 1 development (Azzam et al., 1994; Gardiner et al., 1988; day post-electroporation (dpe) and increasing over the Guevara-Gonzalez et al., 1999; Ingham et al., 1995; course of the experiment (5 dpe) (data not shown). The Pooma et al., 1996; Stanley and Townsend, 1986; BMCTV-[W4] monomer was next introduced into leaves of Sudarshana et al., 1998; Wang et al., 1999). In contrast, Nicotiana benthamiana plants by particle bombardment. In CP is required for systemic infection of monopartite three independent experiments, a total of 16/18 plants begomoviruses (Rigden et al., 1993; Wartig et al., 1997), developed stunted growth and leaf epinasty, crumpling and curtoviruses (Briddon et al., 1989) and mastreviruses chlorosis symptoms by 15 days post-bombardment (dpb). (Boulton et al., 1989; Liu et al., 1998; Lazarowitz et al., Plants bombarded with gold particles only did not develop 1989). Irrespective of the type of geminivirus examined, symptoms. Consistent with these results, a diagnostic ¨1.1 the CP is essential for insect transmission (Azzam et al., kbp BMCTV CP fragment was amplified from all sympto- 1994; Ho¨fer et al., 1997; Ho¨hnle et al., 2001; Mullineaux matic plants, whereas no fragment was amplified from et al., 1984), and it is the determinant of vector specificity plants without symptoms. Similar results were obtained for (Briddon et al., 1990). the undigested multimeric construct, pBMCTV-[W4]1.2 In this study, we present the development and application (data not shown). Together, these results established that of an experimental system to investigate the role of the the cloned BMCTV-[W4] can systemically infect N. curtovirus CP in viral biology and pathogenesis. A BMCTV benthamiana and cause curly top symptoms. M.J. Soto et al. / Virology 341 (2005) 257–270 259

A host range experiment was performed by bombarding hoppers membrane-fed on extracts of protoplasts electro- pBMCTV-[W4]1.2 DNA into common bean, N. benthami- porated with buffer alone did not develop symptoms. These ana, pepper, shepherd’s purse and tomato seedlings. BMCTV- results established that progeny virus, derived from the [W4] was highly infectious in N. benthamiana, whereas only cloned BMCTV-[W4] DNA, is leafhopper-transmissible. low rates of infection were obtained with the other plant A host range experiment was next performed with species (Table 1). Infected plants of all species developed leafhoppers. Insects were given AAPs of 3–5 days on curly top symptoms, including stunted and distorted growth BMCTV-[W4]-infected shepherd’s purse plants, followed and leaf curling, crumpling, distortion and discoloration by IAPs of 3–5 days on common bean, pepper, shepherd’s (chlorosis or purpling). BMCTV was detected by PCR in purse, sugar beet and tomato plants. Curly top symptoms all symptomatic plants, and not in plants without symptoms. developed in all inoculated common bean, pepper, shepherd’s purse and tomato plants; whereas sugar beet plants Leafhopper transmission of BMCTV-[W4] developed mild leaf epinasty and crumpling (Table 1). Considering the particle bombardment and leafhopper In initial experiments, beet leafhoppers were given transmission results together, the host range and sympto- acquisition access periods (AAPs) of 4 h or overnight on matology of BMCTV-[W4] are similar to that previously BMCTV-[W4]-infected N. benthamiana plants, followed by reported for BMCTV, including N. benthamiana, common an inoculation access period (IAP) of 3 days on 12 plants bean and the diagnostic mild symptom phenotype in sugar each of common bean, N. benthamiana, pepper, shepherd’s beet (Stenger et al., 1990). Our results extend the BMCTV purse and tomato (three independent experiments). None of host range to pepper, shepherd’s purse and tomato. the plants developed symptoms, nor was BMCTV detected by PCR in newly emerged leaves. Observations of leaf- Generation of BMCTV CP mutants hopper behavior revealed little or no feeding on BMCTV- infected N. benthamiana plants, indicating that it is not a To identify CP regions involved in BMCTV biology and preferred host for the insect. pathogenesis, the surface probability of the amino acids Leafhoppers were then membrane-fed on extracts of composing the CP (254 amino acids) was determined (Fig. tobacco (Nicotiana tabacum) protoplasts transfected with 1A). Peaks represent regions predicted to be at the surface pBMCTV-[W4]1.2, followed by IAPs of 3–5 days on of the folded protein, and these were generally clusters of shepherd’s purse plants. Here, all 12 shepherd’s purse plants charged amino acids, such as aspartic acid (D), glutamic exposed to the leafhoppers (three independent experiments) acid (E), lysine (K), arginine (R) and histidine (H). Fifteen developed curly top symptoms 7–10 days post inoculation such clusters were identified, and these were concentrated (dpi), and BMCTV was detected by PCR in symptomatic in the N- and C-termini (Fig. 1A). One or more amino acids leaves of representative plants. Plants exposed to leaf- within each cluster were changed to alanine residues by site-directed mutagenesis (Fig. 2A). This resulted in the generation of 15 recombinant plasmids, each having BMCTV-[W4]1.2 with a different alanine scanning muta- Table 1 tion in the CP gene (the numbers represent the position of Infectivity of cloned BMCTV-[W4] DNA or progeny virus in selected plant species after inoculation by particle bombardment or viruliferous leaf- the amino acid residues changed to alanine): pCP2-6, hoppers, respectively pCP14-16, pCP25-28, pCP34-35, pCP39-40, pCP44-46, Plant species Infectivitya pCP49-51, pCP84-87, pCP111, pCP154-158, pCP166-170, Particle bombardment Leafhopper pCP183-187, pCP195-196, pCP218-223 and pCP234-237 transmissionb (Figs. 1A and 2A). A frameshift mutation was also intro- Nicotiana benthamiana 18/18 0/6 duced into the CP gene, generating the recombinant plas- Tomato 3/18 6/6 mid, pCPFS. Pepper 1/18 6/6 The 5V end of the CP ORF overlaps the 3V end of the Common bean 1/18 6/6 V2 gene (encoding the 126 amino acid V2 protein). The Shepherd’s purse 9/701 6/6 creation of seven N-terminal CP mutants (CP2-6, CP14-16, Sugar beet NTc 6/6 Negative controld 0/18 0/6 CP25-28, CP34-35, CP39-40, CP44-46 and CP49-51) also introduced amino acid substitution and/or deletion muta- a Recombinant plasmid pBMCTV-[W4]1.2, containing a multimeric BMCTV-[W4] clone, was used as inoculum. Infectivity indicates the tions into the V2 ORF (Fig. 2B). CP2-6 has 4 amino acid number of plants with curly top symptoms (systemically infected)/total substitutions, and a C-terminal deletion of 47 amino acids. number of plants inoculated. Symptomless infections were not detected. CP14-16, CP25-28, CP34-35, CP39-40 and CP49-51 each b Leafhoppers were given AAPs of 3–5 days on BMCTV-infected have amino acid substitution mutations (Fig. 2B); whereas shepherd’s purse plants and IAPs of 3–5 days on test plants. CP44-46 has an amino acid substitution and a C-terminal c NT = not tested. d Negative controls were N. benthamiana plants bombarded with gold deletion of 9 amino acids. A frameshift mutation also was particles only or shepherd’s purse plants exposed to non-viruliferous introduced into the V2 gene, generating the recombinant leafhoppers. plasmid pV2FS. 260 M.J. Soto et al. / Virology 341 (2005) 257–270

Fig. 1. Location and biological properties of BMCTV-[W4] capsid protein (CP) alanine scanning mutants. (A) Surface probability of the BMCTV CP showing amino acids (peaks) predicted to be located at the surface of the folded protein. Alanine scanning mutations are shown on the right side of the appropriate cluster (peak), and mutants are named according to the position(s) of the amino acids changed to alanine residues. Superscript (a) denotes N-terminalCP mutants that also have mutations in the overlapping V2 ORF. BMCTV and CPFS are wild-type BMCTV-[W4] and a CP frameshift mutant, respectively. (B) Replication was assessed in tobacco protoplasts and is indicated as (+) for replication detected and (À) for replication not detected. Infectivity in Nicotiana benthamiana is indicated as number of plants systemically infected/total number of plants inoculated by particle bombardment, and symptom severity (recorded 25 days post inoculation) is indicated as follows: no asterisk = no symptoms, * = mild symptoms (mild leaf curling and distortion), ** = moderate symptoms (moderately stunted growth and obvious leaf curling and chlorosis), *** = severe symptoms (severely stunted growth and strong leaf epinasy, curling and chlorosis). Leafhopper uptake was assessed based on PCR detection of BMCTV DNA in leafhoppers following an overnight feeding on extracts of tobacco protoplasts electroporated with cloned DNA of each mutant, and is indicated as (+) for detection of viral DNA, (À) no detection and (T) for detection in a small number of tested leafhoppers. Leafhopper transmission was assessed by providing leafhoppers an overnight feeding on extracts of protoplasts electroporated with cloned DNA of each mutant, and then placing groups of five to seven insects on shepherd’s purse plants for IAPs of 3–5 days. Transmission is presented as number of plants developing symptoms and PCR-positive for BMCTV infection/total plants inoculated. Virion formation was assessed by immunosorbent electron microscopy analysis of extracts prepared from transfected protoplasts, and is indicated as (+) for virions detected and (VND) for virions not detected. M.J. Soto et al. / Virology 341 (2005) 257–270 261

phenotype (all infections were confirmed by PCR detection of BMCTV). The seven N-terminal alanine scanning mutants all systemically infected N. benthamiana, although some induced attenuated symptoms (Fig. 1B). Plants infected with CP2-6, with the 47 amino acid deletion in the C- terminus of V2 (Fig. 2B), showed slightly stunted growth and mild leaf epinasty and deformation (Fig. 4A). These symptoms were the mildest of any of the alanine scanning mutants (Fig. 1B), but were more severe than those induced by the V2 frameshift mutant. Thus, this phenotype is consistent with the role of V2 in pathogenicity, but also suggests that the truncated V2 may be functional. Mutants CP14-16 (Fig. 4B) and CP49-51 (Fig. 4D) induced moderate to severe leaf epinasty and chlorosis symptoms, which were more severe than those induced by CP2-6 but less severe than those induced by BMCTV-[W4] (e.g., Fig. 4I). These mutants encode a complete V2, with amino acid substitution mutations in the central (CP14-16) or C- terminal region (CP49-51) of the protein (Fig. 2B). Mutant CP25-28 induced leaf mottling and moderate epinasty and Fig. 2. Predicted amino acid sequences of the BMCTV-[W4] (A) capsid curling (Fig. 4C), but less stunting than BMCTV-[W4] (Fig. protein (CP) and (B) V2 protein. (A) The CP amino acid residues changed 4H); this mutant also encodes a complete V2 with amino to alanine are shaded, and the designation of each mutant is indicated beneath the altered residues. (B) Amino acid substitution and deletion acid substitutions in the central region. Mutants CP34-35, mutations introduced into the V2 protein as a consequence of generating the CP mutants. Mutations are shown beneath their corresponding position in the V2 amino acid sequence, and the designation of each mutant is indicated beneath the altered residues. Asterisks indicate stop codons.

Replication of the BMCTV CP mutants in tobacco protoplasts

In three independent experiments, newly replicated DNA forms were detected in tobacco protoplasts transfected with the CP mutants (15 alanine scanning and the frameshift) and wild-type BMCTV-[W4] (Fig. 3). No such forms were detected in protoplasts electroporated with buffer alone. Kinetics of viral DNA replication were similar for the CP mutants and wild-type BMCTV-[W4], with highest levels of newly replicated viral DNA detected at 5 dpe (Fig. 3). Thus, these CP mutations did not affect replication of BMCTV DNA.

Capacity of BMCTV CP mutants to systemically infect N. benthamiana plants

The results of these experiments are summarized in Fig. 3. Replication of BMCTV-[W4] and capsid protein alanine scanning Fig. 1B. A high rate of systemic infection (85%) was mutants in Nicotiana tabacum protoplasts. Appropriate plasmid DNAs obtained in N. benthamiana plants bombarded with were transfected into protoplasts and replication was detected by Southern BMCTV-[W4] DNA, whereas no symptoms developed blot hybridization analysis of total nucleic acids extracted (A) 0 and (B) 5 in plants bombarded with pCPFS (the CP frameshift days post electroporation with a pBMCTV-[W4] DNA probe. Input mutant) or gold particles only. The V2 frameshift mutant inoculum and newly replicated BMCTV DNA forms are indicated with an arrow and a bracket, respectively. Mock represents protoplasts electro- systemically infected N. benthamiana, but at a lower rate porated with buffer alone. Lane M is the size marker (1-kb ladder, Gibco- (48%, 10/21 plants infected in a total of four independent BRL) and arrows on left side indicate sizes of marker fragments hybridizing experiments); and it induced a very mild or symptomless with the plasmid vector DNA of pBMCTV-[W4]. 262 M.J. Soto et al. / Virology 341 (2005) 257–270

Fig. 4. Disease symptoms induced in Nicotiana benthamiana plants infected with selected BMCTV capsid protein (CP) mutants. (A–D) Symptoms in leaves of plants infected with CP mutants, 25 days post-bombardment with BMCTV-[W4] plasmid DNA (A) CP2-6, (B) CP14-16, (C) CP25-28 and (D) CP49-51. (E) Symptoms in leaves of plants bombarded with wild-type BMCTV-[W4] DNA or (F) gold particles only. (G–I) Relative effect of infection by selected mutants on growth of Nicotiana benthamiana plants compared with plants infected by BMCTV-[W4] (BCTV) or bombarded with gold particles only (GOLD). (G) CP111 (left) compared with wild-type BMCTV-[W4] (center) and gold particles alone (right), (H) CP25-28 (center) compared with BMCTV-[W4] (right) and gold particles alone (left) and (I) CP49-51 (center) compared with BMCTV-[W4] (right) and gold particles alone (left).

CP39-40 and CP44-46 induced wild-type symptoms (Fig. infection, indicating that this region plays an important role, 1B); CP34-35 and CP39-40 each encode a complete V2 either directly or indirectly, in this process. with amino acid substitution mutations in the C-terminal region; whereas CP44-46 has a single amino acid sub- Levels of mutant viral DNA and CP in infected stitution mutation and a 9 amino acid deletion in the C- N. benthamiana plants terminus (Fig. 2B). One mutant in the central region of the CP, CP84-87, did not systemically infect N. benthamiana; PCR analyses indicated that levels of viral DNA were whereas another, CP111, induced wild-type symptoms, comparable in plants infected with CP mutants and including severely stunted growth (Figs. 1B and 4G). Of BMCTV-[W4] (i.e., similar amounts of PCR-amplified the six C-terminal mutants, CP183-187 induced wild-type BMCTV fragments were observed in EtBr-stained agarose symptoms, whereas the others (CP154-158, CP166-170, gels). Because this analysis is not quantitative, viral DNA CP195-196, CP218-223 and CP234-237) did not systemi- levels for selected mutants (CP25-28, CP34-35 and CP49- cally infect N. benthamiana (Fig. 1B). 51) and wild-type BMCTV-[W4] were further examined by BMCTV was detected by PCR in all symptomatic Southern blot hybridization analysis of total nucleic acids plants tested (a minimum of 2 plants tested per mutant), extracted from equivalent symptomatic N. benthamiana and not in plants without symptoms (all plants tested). For leaves. The presence of the appropriate mutant in each plant each mutant that systemically infected N. benthamiana, was first confirmed by DNA sequencing, as previously the presence of the appropriate CP mutation in infected described, and then a total of 9 plants infected by each leaves of at least two plants was confirmed by DNA mutant and BMCTV-[W4] were examined in each of three sequence analysis of PCR-amplified CP DNA fragments. independent experiments. Although CP25-28 and CP49-51 Thus, these substitution mutants were stable in the induced attenuated symptoms, no obvious reduction in viral BMCTV genome. ds-DNA levels was detected in any of the mutants compared Together, these results indicated that mutations intro- with BMCTV-[W4]; however, some plants infected with duced into the N-terminus of the CP did not abolish the mutant CP49-51 appeared to have a reduced level of ss- capacity of BMCTV to systemically infect N. benthamiana DNA forms (Fig. 5A). plants, although a number of N-terminal mutants had Western blot analyses with BMCTV CP antisera (aCP610 attenuated symptom phenotypes. However, because these and aCP611; Soto, 2002) revealed a protein of ¨30 kDa (the mutants also had mutations in V2, a viral pathogenicity expected size of the BMCTV CP) in BMCTV-infected N. determinant, it is not possible to identify the specific benthamiana plants, whereas no such protein was detected in mutation(s) underlying the attenuated phenotype. In con- uninfected plants (data not shown). Western blot analyses, trast, most of the C-terminal mutations prevented systemic with aCP611 antiserum, of total proteins extracted from M.J. Soto et al. / Virology 341 (2005) 257–270 263

ticles were consistently detected in extracts prepared from protoplasts transfected with BMCTV-[W4]1.2 (Fig. 6A), whereas these particles were not detected in extracts of protoplasts transfected with buffer only (Fig. 6B). The capacity of the CP mutants to form virions in this assay is summarized in Fig. 1B. Virions were detected for all mutants that established systemic infections in N. benthamiana (CP2-6, CP14-16, CP25-28, CP34-35, CP39-40, CP44-46, CP111 and CP183-187), with the exception of mutant CP49-51 (Fig. 1B). Virions were not detected for all mutants that did not establish systemic infections in N. benthamiana (CP84-87, CP154-158, CP166-170, CP218-223, CP234-237 and CPFS), with the exception of mutant CP195-196 (Fig. 1B). These results indicate a strong correlation between virion formation and systemic infection. To provide another line of evidence that mutants CP49- Fig. 5. BMCTV DNA (A) and capsid protein (CP, B) levels detected in 51, CP84-87, CP154-158, CP166-170, CP218-223, CP234- equivalent leaves of Nicotiana benthamiana plants systemically infected 237 and CPFS did not form virions, extracts of protoplasts with mutants CP25-28, CP34-35, CP49-51 or wild-type BMCTV-[W4] (BMCTV); or bombarded with gold particles only (GOLD). (A) Southern transfected with each of these mutants as well as BMCTV- blot hybridization analysis of total nucleic acids with a pBMCTV-[W4] [W4]1.2 (positive control), were treated with DNAse I. Prior DNA probe. BMCTV double-stranded (dsDNA) and single-stranded to DNAse treatment, BMCTV DNA was detected by PCR in (ssDNA) forms are shown with brackets. Lane M is the size marker (1-kb all these protoplast extracts (Fig. 7A); however, after ladder, Gibco-BRL) and arrows on left side indicate sizes of marker DNAse I treatment, BMCTV DNA was detected only in fragments hybridizing with the plasmid vector DNA of pBMCTV-[W4]. (B) Western blot analysis of total proteins with BMCTV CP antiserum. the extract of protoplasts transfected with BMCTV-[W4]1.2 (Fig. 7B). Thus, the DNA of the CP mutants, but not wild- type BMCTV-[W4], was degraded by the DNAse I. This equivalent symptomatic leaves from N. benthamiana plants result is consistent with a defect in virion formation or infected with the CP mutants and BMCTV-[W4] revealed stability for these mutants. similar levels of CP (Fig. 5B). These results are consistent with those of the Southern blot hybridization analyses showing efficient movement and accumulation of DNA of CP mutants, and indicate that the mutant CPs were expressed and stable in infected plants.

Virion formation

In preliminary immunosorbent electron microscopy (ISEM) experiments, twinned (geminate) virion-like par-

Fig. 7. DNAse protection assay. (A) Agarose gel showing the diagnostic 1.1 kbp BMCTV DNA fragment PCR-amplified from extracts of Nicotiana tabacum protoplasts transfected with plasmid DNA of BMCTV CP mutants for which virions were not detected with immunosorbent electron microscopy (CP49-51, CP84-87, CP154-158, CP166-170, CP218-223, CP234-237 and CPFS) and wild-type BMCTV-[W4]1.2; prior to DNAse I treatment. (B) Agarose gel showing BMCTV DNA fragments PCR-amplified from the same extracts used in panel (A) except after treatment with DNAse I. The BMCTV Fig. 6. Detection of BMCTV virions by immunosorbent electron micro- DNA fragment was not amplified from an extract prepared from protoplasts scopy. Extracts were prepared from Nicotiana tabacum protoplasts trans- electroporated with buffer only (À). Arrows on the right side indicate the 1.1 fected with (A) BMCTV-[W4]1.2 DNA or (B) buffer only. Virions were kbp BMCTV DNA fragment. Lane M is the size marker (1-kb ladder, Gibco- captured on grids coated with BMCTV capsid protein antiserum, stained BRL) and arrows on left side indicate sizes of the 1.6 and 1.0 kbp marker with uranyl acetate and viewed with an electron microscope. fragments. 264 M.J. Soto et al. / Virology 341 (2005) 257–270

Leafhopper transmission of CP mutants shepherd’s purse plants bombarded with gold particles only. Thus, these results indicated that these mutants have a defect Leafhoppers were fed overnight on extracts of proto- in leafhopper transmission. In the case of CP49-51, this is plasts transfected with plasmid DNA of each of the mutants consistent with a failure to detect virion formation; whereas or BMCTV-[W4]1.2, and then placed on shepherd’s purse for CP25-28, it indicates an inability of the virions to move plants for a 3–5 day IAP. Most N-terminal mutants (5 of 7) through the leafhopper. were leafhopper-transmitted, based upon development of The central (CP111) and C-terminal (CP183-187) mutants curly top symptoms in inoculated plants and detection of that established systemic infections in N. benthamiana and BMCTV DNA in newly emerged leaves of these plants formed virions were leafhopper-transmitted and induced (Fig. 1B). For all of these leafhopper-transmitted mutants, curly top symptoms in shepherd’s purse plants (Fig. 1B). In virion formation was detected (Fig. 1B). Mutants CP2-6 contrast, the central (CP84-87) and C-terminal mutants and CP14-16 induced mild and moderate symptoms in (CP154-158, CP166-170, CP195-196, CP218-223 and shepherd’s purse plants, respectively, whereas CP34-35, CP234-237) that did not systemically infect N. benthamiana CP39-40 and CP44-46 induced wild-type symptoms. The were not leafhopper-transmitted, based upon a lack of results with mutant CP2-6 also established that the C- symptom development in inoculated plants and a failure to terminal portion of the BMCTV-[W4] V2 protein is not detect BMCTV DNA in newly emerged leaves of these essential for insect transmission or systemic infection in plants. With the exception of CP195-196, virion formation shepherd’s purse. was not detected for these mutants (Fig. 1B). For all The two N-terminal mutants that were not leafhopper- leafhopper-transmitted mutants, the presence of the appro- transmitted, CP25-28 and CP49-51, both systemically priate CP mutant in systemically infected leaves of at least 2 infected N. benthamiana (Fig. 1B). However, we could plants for each mutant was confirmed by sequence analysis of not rule out the possibility that the failure of these mutants PCR-amplified CP fragments. Taken together, these results to infect shepherd’s purse plants in the leafhopper trans- demonstrate a strong correlation between virion formation mission experiments was due to a host-specific defect (i.e., and leafhopper transmission. these mutants were not infectious in shepherd’s purse) rather than a defect in insect transmission. Therefore, shepherd’s Leafhopper uptake of the CP mutants purse seedlings were inoculated with pBMCTV-[W4]1.2, pCP25-28 and pCP49-51 DNA by particle bombardment. To further assess the interaction of CP mutants with the Although the efficiency of this inoculation method for this leafhopper vector, we used an assay to test viral uptake and host is low (i.e., ¨1% for BMCTV-[W4]1.2; Table 2), both retention in the insect. Here, leafhoppers were fed with mutants were infectious in shepherd’s purse plants (¨0.8% protoplast extracts, overnight, and then tested for BMCTV for CP25-28 [6 infected plants/774 bombarded] and ¨0.9% by PCR. Two lines of evidence indicated that this assay for CP49-51 [4 infected plants/473 bombarded]). These detects virus-specific uptake (presumably in the gut) and infections were confirmed by PCR detection of BMCTV, retention, rather than non-specific ingestion. First, BMCTV and the presence of the appropriate mutant in each of the DNA was not detected in leafhoppers fed with solutions infected plants was confirmed by sequence analysis of PCR- containing pBMCTV-[W4]1.2 DNA, indicating that unpro- amplified CP fragments. No BMCTV DNA was detected in tected DNA was degraded in the leafhopper gut. Second, to

Table 2 Primers used in alanine scanning mutagenesis of the BMCTV capsid protein Primer Primer Sequence (5Vto 3V) CPc2-6 GACATCGTATACGTATTAGCTGTATAGGCAGCCATACAACG AACACTT CPc14-16 CTTTGAGGATTCACAGCTGCAGCCTGGGACATCGTA CPc25-27 TCGTAGTAGTCCTCGCTGCAGCCGGCCACGCAC CPc25-28 CGAAGTCGTAGTAGTAGCCGCAGCAGCCGGCCA CPc34-35 TCTCCTCCATTGGTAAGCTGCAGAAGTCGTAGTAGTC CPc39-40 GTTTTTTGTCACAGGAGCCGCCCATTGGTATTTCCT CPc44-46 TTTAACTTCGGAGTCGCGTTAGCTGTCACAGGTCTC CPc49-51 CATATCATCATACATCGCTAAAGCCGGAGTCCTGTTT CPc84-87 TAACGTTGTTCGCTGCAGCACTAGCACCAATACCCTG CPc111 GTCATATAATTAGGAGTAGCCCAGAACGGAGA CPc154-158 AACCTCTCGTTCATCGCTGCAGCAATAGCATAAGTAGACGGCAT CPc166-170 TAGACATCAAATGAGTTGCCCAAGCAGCCGCCACAATGAACCT CTC CPc183-187 CATTGAAGGAGCCGCGTAAGTAGCAGCGCCTCCATAACCA CPc195-196 CATTGATATTCATAGGAGCCGCGTAATTCGGCATTG CPc218-223 AGTAAAGCATTCTCCGCCACTGCAGCATAGGCCCCACCACCGG CPc234-237 CATACATATTAGTATTAGCCGTATTCGCATTAACAACAACAT M.J. Soto et al. / Virology 341 (2005) 257–270 265 establish specificity in terms of geminivirus virions, leaf- Mexico, and with this species causing the disease in these hoppers were fed extracts of protoplasts electroporated with hosts in other states in the Western U.S.A. (Stenger and pBMCTV-[W4]1.2 or an infectious multimeric DNA-A McMahon, 1997). clone (pTFA-2) of the begomovirus Tomato mottle virus The infectious BMCTV-[W4] clone was used to develop (ToMoV; Gilbertson et al., 1993). Replication of BMCTV- assays to examine key aspects of viral biology: replication, [W4] and ToMoV DNA-A in the electroporated protoplasts systemic infection, virion formation and insect transmission. was confirmed by Southern blot hybridization analysis. In Multimeric BMCTV-[W4] constructs have been unstable two independent experiments, BMCTV DNA was detected in Agrobacterium tumefaciens, which has prevented the in leafhoppers fed on extracts of protoplasts electroporated development of an agroinoculation system for this isolate. with pBMCTV-[W4]1.2, whereas ToMoV DNA-A was not The reason(s) for this are not clear, as this problem has not detected in leafhoppers fed with extracts of protoplasts been reported by others (Baliji et al., 2004; Briddon et al., electroporated with pTFA-2 (data not shown). These results 1989; Stenger et al., 1991). Particle bombardment of cloned suggest that this assay reflects a specific BMCTV–leaf- monomeric or multimeric BMCTV-[W4] DNA provided hopper interaction. high rates of infectivity in the experimental host, N. Viral uptake and retention in the leafhopper vector were benthamiana, but not in other hosts. This likely reflects detected for all mutants that systemically infected N. the phloem-limited nature of curtovirus infections (Esau, benthamiana, formed virions and were leafhopper-trans- 1977; Esau and Hoefert, 1973; Esau and Magyarosy, 1979; mitted (CP2-6, CP14-16, CP34-35, CP39-40, CP44-46, Latham et al., 1997; Thornley and Mumford, 1979), and the CP111 and CP183-187) (Fig. 1B). Uptake also was detected fact that particle bombardment tends to introduce DNA into for the two mutants that formed virions but were not outer cell layers (e.g., epidermal cells; Sudarshana et al., leafhopper-transmitted: CP25-28 (systemically infected N. 1998). Thus, BMCTV may not have been able to access the benthamiana) and CP195-196 (did not systemically infect phloem of bombarded leaves. This may reflect a lack of cell- N. benthamiana). For mutant CP25-28, this result suggests to-cell movement capacity or inefficient MP function for impaired movement of virions in the leafhopper. In the case BMCTV-[W4], as shown for the phloem-limited monop- of CP195-196, it is not clear whether movement in the artite begomovirus, Tomato yellow leaf curl virus (TYLCV; leafhopper was impaired because this mutant did not Rojas et al., 2001). Although BCTV is also phloem-limited systemically infect N. benthamiana. in N. benthamiana (Latham et al., 1997), the efficacy of No uptake was detected for mutants that did not particle bombardment inoculation for this host may reflect systemically infect N. benthamiana and were not leaf- delivery of viral DNA into phloem-associated cells, and/or hopper-transmissible (CP84-87, CP154-158, CP166-170, yet undefined properties of this experimental host that allow CP218-223, CP234-237 and CPFS) (Fig. 1B). These results more extensive cell-to-cell movement of BMCTV-[W4]. In are fully consistent with the failure to detect virion contrast, leafhopper transmission provided high rates of formation for these mutants, and indicate that the unpro- BMCTV-[W4] infectivity in all hosts except N. benthami- tected viral DNA was degraded in the insect gut. In the case ana, consistent with the insect vector delivering the virus of mutant CP49-51, which systemically infected N. ben- into the phloem. This method was not suitable for N. thamiana, but did not form detectable virions and was not benthamiana because leafhoppers would not feed on it. leafhopper-transmitted, a faint BMCTV DNA fragment was Alanine scanning mutagenesis was used to alter amino detected in leafhoppers in some, but not all, uptake assays. acid residues predicted to be on the surface of the BMCTV CP and, thus, likely to be involved in protein–protein interactions (Bass et al., 1991; Giesman-Cookmeyer and Discussion Lommel, 1993). The BMCTV CP alanine scanning and frameshift mutants replicated in protoplasts, which is in In this study, a full-length clone of an isolate of BMCTV agreement with CP not being required for replication of (BMCTV-[W4]), associated with a curly top outbreak in BCTV DNA (Briddon et al., 1989). The replication of tomato and pepper crops in New Mexico, U.S.A., was mutant CP2-6, with a 47 amino acid deletion in the C- generated using PCR and overlapping primers. This clone terminus of the V2, and the capacity of the V2 frameshift was infectious (i.e., induced symptomatic systemic infec- mutant to systemically infect N. benthamiana are also in tions in various plant species), and progeny virus was agreement with previous studies showing that this protein is leafhopper-transmitted. The host range and symptomatology not required for BCTV DNA replication (Hormuzdi and of BMCTV-[W4] is similar to that described for BMCTV, Bisaro, 1993; Stanley et al., 1992). including the mild symptom phenotype in sugar beet from The finding that most N-terminal BMCTV CP mutants which the name is derived (Stenger et al., 1990; Stenger, systemically infected N. benthamiana and formed virions, 1998). We further established that BMCTV-[W4] induces whereas most C-terminal mutants did not systemically infect curly top disease in pepper and tomato, thereby completing this host nor form (detectable) virions demonstrates a strong Koch’s postulates for these hosts. This finding is consistent correlation between virion formation and long-distance with BMCTV-[W4] causing the curly top outbreak in New movement. Given that it is well established that BCTV 266 M.J. Soto et al. / Virology 341 (2005) 257–270 moves, long distance, in the phloem (reviewed in Bennett, 2003), (ii) unprotected BMCTV plasmid DNA is degraded 1971), our findings suggest that virions are the form in in the insect and (iii) begomovirus virions were not taken up which the virus moves in the phloem sieve elements (SEs). and retained. Thus, our results are fully consistent with the Although virions were not observed in SEs of BCTV- CP being the determinant of geminivirus insect transmission infected plants in several ultrastructural studies (Esau, 1977; (Azzam et al., 1994; Briddon et al., 1990; Mullineaux et al., Esau and Magyarosy, 1979), this may have been due to 1984; Noris et al., 1998), and further demonstrate that technical difficulties and/or low virion concentrations in virions are required for this process. Thus, long-distance phloem sap. However, the finding of virion-like particles in movement of BMCTV virions in the phloem is essential for highly infectious phloem exudates from BCTV-infected both systemic infection and acquisition by the leafhopper Amsinkia douglasiana plants is consistent with virions vector. moving in SEs (Magyarosy, 1980). Taken together with Given that virions are acquired by the insect vector, findings for other monopartite geminiviruses, in which CP virion-forming mutants that systemically infect plants but and virion formation is required for systemic infection are not leafhopper-transmitted may reveal CP regions (Boulton et al., 1989; Briddon et al., 1989; Lazarowitz et al., involved in the virus-insect interaction. Mutant CP25-28 1989; Noris et al., 1998; Rigden et al., 1993; Liu et al., fulfills these criteria and may reveal an N-terminal region 1998, 2001), it seems likely that virions are the predominant involved in virus movement through the leafhopper, long-distance movement form for these viruses. possibly receptor-mediated endocytosis in the gut or Two mutants deviated from the strong correlation salivary glands. Another region of the BCTV CP, residues between virion formation and systemic infection. Mutant 179–191, was recently postulated to be an adaptation for CP49-51 systemically infected N. benthamiana and induced leafhopper transmission (Bo¨ttcher et al., 2004). However, symptoms, but it did not form (detectable) virions nor was it substitution mutations in this domain (in mutant CP183- leafhopper-transmitted. This mutant may form unstable 187, Fig. 2A) did not interfere with leafhopper transmission. virions that were not detected in our protoplast assay. This Amino acid residues involved in whitefly transmission of scenario gains support from the findings that (i) all other begomoviruses also have been identified. For TYLCV, these mutants that did not form (detectable) virions did not residues were in the central region and were correlated with establish systemic infections, i.e., did not produce a form virion formation (Noris et al., 1998). For the bipartite capable of long-distance movement, and (ii) mutant CP49- begomoviruses, these residues were in the central and C- 51 was the only non-virion-forming mutant detected in the terminal regions, and were speculated to be involved in leafhopper uptake and retention assay (albeit inconsistently post-translational modification, recognition by putative and at low levels). Alternatively, this mutant may move long receptors and virion stability (Kheyr-Pour et al., 2000; distance in a non-virion form (e.g., a nucleoprotein Ho¨hnle et al., 2001). complex). However, if BMCTV can move, long distance, The finding that most C-terminal BMCTV CP mutants as either a nucleoprotein or virion, it would seem likely that did not form virions (Fig. 1B) indicates that this region is other non-virion forming mutants also would have estab- involved in proper folding of the CP, formation of CP lished systemic infections. In either case, the infectious form subunits or virion assembly. An amino acid substitution of CP49-51 effectively moves long distance in the plant, but mutant in the C-terminus of the MSV CP also prevented not in the leafhopper (Fig. 1B). In contrast, mutant CP195- virion formation, and this was attributed to interference with 196 formed virions and was taken up by leafhoppers, but it interaction of CP monomers (Liu et al., 2001). The predicted did not systemically infect N. benthamiana. This demon- structure of the MSV CP is an eight-stranded antiparallel h- strates that virion formation, alone, is not sufficient for barrel motif, with a disordered N-terminal a-helix (Zhang et systemic infection. This could be due to an inability of al., 2001). Although there is little obvious identity between CP195-196 virions to uncoat at some point in the infection the primary CP amino acid sequences of MSV and BMCTV process, or an inability to properly interact with host and/or (data not shown), the h-barrel motif is conserved among ss- viral factors during long-distance movement. DNA viruses (McKenna et al., 1996). Thus, the failure of BMCTV is transmitted by the beet leafhopper in a BMCTV C-terminal CP mutants to form virions may reflect circulative manner, i.e., the virus is acquired in the digestive disruption of the conserved h-barrel structure and/or h- tract and moves through the body of the vector to the barrel interactions. Consistent with this hypothesis, yeast salivary glands where it is released during feeding (Bennett, two-hybrid assays showed that TYLCV CP–CP interactions 1971; Soto and Gilbertson, 2003). Leafhopper uptake and were greatly impaired for C-terminal deletion mutants transmission were also strongly correlated with virion (Hallan and Gafni, 2001). formation. Although the leafhopper uptake assay does not The finding that most N-terminal CP mutants were necessarily measure acquisition per se, it reflects some infectious, formed virions and were leafhopper-transmitted degree of specificity of the BMCTV-beet leafhopper revealed that this region is tolerant of substitution muta- interaction because: (i) the overnight feeding period is genesis. The N-terminus of the MSV CP is involved in sufficient time for acquisition and movement of virus nuclear accumulation and DNA binding (Liu et al., 1997, through the insect (minimum time: 4 h; Soto and Gilbertson, 1999), and it also plays a role in particle assembly and M.J. Soto et al. / Virology 341 (2005) 257–270 267 architecture (Zhang et al., 2001). The BMCTV CP is also Alanine scanning mutagenesis targeted to the nucleus, and the N-terminus has 4 predicted nuclear localization signals and a large number of positively A 2265 bp EcoRI–SalI fragment (containing the complete charged amino acid residues (Fig. 2A; Soto, 2002). Thus, CP gene) was excised from pBMCTV-[W4] and cloned into the N-terminus of the BMCTV CP may well function in an pAlter (Promega, Madison, WI) to generate pAlter-BMCTV- equivalent manner as that of MSV. The tolerance of this ES. Alanine scanning mutants were generated using the region to substitution mutagenesis may be due to redun- primers presented in Table 2 and the Altered Sites II In Vitro dancy in the positively charged residues involved in these Mutagenesis Kit (Promega). In some cases, restriction functions. In contrast, deletion mutagenesis of this region of enzyme sites were introduced into the primers to facilitate the ACMV CP prevented virion formation, presumably due identification of the mutants. Mutations were verified by to disruption of protein–protein and protein–nucleic acid DNA sequence analysis and restriction enzyme digestion. interactions (Unseld et al., 2004). Once the appropriate mutation was confirmed, the ¨1.2 kbp In conclusion, regions of the BMCTV CP involved in SpeI fragment, containing the mutated CP sequence, was systemic infection, virion formation and insect transmission excised from pAlter-BMCTV-ES and exchanged for the were identified. Virion formation was strongly correlated corresponding fragment in pBMCTV-[W4]1.2. with systemic infection and insect transmission. This provides strong evidence that BMCTV virions are moving, CP and V2 frameshift mutants long distance, in the phloem. The N-terminus was more tolerant of mutations and contains a region involved in the A BMCTV CP frameshift mutant was generated by BMCTV–leafhopper interaction, whereas the C-terminus digesting pBMCTV-[W4]1.2 with BstXI (a unique site in was less tolerant of mutation, possibly due to involvement the 5Vregion of the CP gene). The 3Voverhang was rendered in virion formation and stability. blunt-ended with T4 DNA polymerase and the plasmid was religated. Recombinant plasmids having this 4-bp deletion were identified by restriction enzyme digestion and DNA Materials and methods sequence analysis. A BMCTV V2 frameshift mutant was generated using Cloning and characterization of an infectious clone of site-directed mutagenesis. Here, the ¨1.2 kbp SpeI frag- BMCTV ment from pBMCTV-[W4]1.2 was subcloned into pKSII and mutagenesis performed using primers pV2-F (5V- Samples of pepper and tomato plants with curly top GTCAACTTTCATAGGTAGTGATCGTTGTATGAG-3V) symptoms were obtained from New Mexico, U.S.A. in 1995. and pV2-R (5V-CCTATGAAAGTTGACCTTACACCT- The sequence of an ¨700 bp BMCTV DNA fragment, PCR- CAGTAG-3V) and the GeneTailor Site-Directed Muta- amplified from these samples (Guzma´n et al., 1996), was used genesis System (Invitrogen, Carlsbad, CA). The presence to design a primer pair overlapping a BglII site (in bold) in the of the frameshift mutation in selected clones was con- C1 ORF: BMCTVv2471 (5V-GATCGAGATCTTCCGTC- firmed by sequencing, and the ¨1.2 kbp SpeI fragment GACTTG-3V) and BMCTVc2476 (5V-CGCCTAGATCT- with the mutation was excised and exchanged for the GCTAGAGGAGGCCA-3V). PCR with this primer pair was corresponding fragment in pBMCTV-[W4]. performed with the high fidelity polymerase Vent (New England Biolabs, Beverly, MA), and PCR-amplified DNA Protoplast replication assay fragments were cloned into pCR-Blunt (Invitrogen Corpo- ration, Carlsbad, CA). DNA sequences were determined Protoplasts were prepared from N. tabacum Xanthi-nc using the dideoxynucleotide chain termination method suspension cell cultures as previously described (Fromm and Sequenase (USB, Cleveland, OH). Sequences were et al., 1987; Hou et al., 1998). Approximately 3 Â 106 assembled and analyzed with the GCG (Genetics Computer protoplasts were electroporated with ¨10 Ag of the appro- Group, Madison, WI) software package. priate BMCTV plasmid DNA using a PG200 Progenitor II (Hoefer, San Francisco) set at 290 Vand 490 AF, for 8 ms. The Construction of a multimeric BMCTV clone electroporated protoplasts were diluted with 9 ml of growth medium and kept at room temperature in the dark. Approx- A 1.2-mer construct (multimer) was generated by imately 3 Â 105 cells were removed at 0, 1, 3 and 5 dpe for digesting pBMCTV-[W4] with SpeI and BglII, and gel- DNA extraction as previously described (Hou et al., 1998). purifying the 576 bp fragment. This fragment was cloned into SpeI/BglII-digested pSL1180 (Amersham Pharmacia, Inoculation of plants with BMCTV DNA by particle Piscataway, NJ) to generate pBMCTV-[W4]0.2. The full- bombardment length BMCTV fragment, excised from pBMCTV-[W4] with BglII, was cloned into BglII-digested pBMCTV- Gold particles were coated with BMCTV plasmid DNA [W4]0.2 to generate pBMCTV-[W4]1.2. and leaves of 3–4-week-old N. benthamiana, pepper, shep- 268 M.J. Soto et al. / Virology 341 (2005) 257–270 herd’s purse and tomato plants, and hypocotyls of 3-day-old directs the amplification of a diagnostic ¨1.1 kbp BMCTV common bean seedlings (cv. Topcrop) were inoculated by DNA fragment that includes the CP gene (CP fragment; particle bombardment as previously described (Gilbertson Soto and Gilbertson, 2003). et al., 1991; Sudarshana et al., 1998). Bombarded common bean seedlings were planted in soil, and all plants were Detection of BMCTV DNA by Southern blot hybridization maintained in a greenhouse. Symptom development was analysis recorded up to 60 dpb. Total nucleic acids were extracted from N. benthamiana Leafhopper colonies and transmission experiments leaves and protoplasts as described previously (Hou and Gilbertson, 1996), fractionated in 0.9% agarose gels in TAE Beet leafhoppers were reared on healthy sugar beet buffer and transferred to Hybond N+ nylon membranes plants in screen cages kept in a controlled environment (Amersham, Arlington Heights, IL). Blots were hybridized chamber at 30 -C day/25 -C night with a 16-h photo- under high stringency conditions (Hou and Gilbertson, period. For transmission experiments, adult leafhoppers 1996) with pBMCTV-[W4] DNA labeled with [a32P]-dCTP from these colonies were given AAPs ranging from 4 h to by nick-translation (Nick Translation System, BRL, Gai- 5 days on BMCTV-infected plants, and then put into small thersburg, MD). clip-on leaf cages that were placed on leaves of healthy plants for IAPs of 3–5 days. Western blot analysis

Leafhopper-protoplast feeding assay Total proteins were extracted from N. benthamiana leaf tissue as previously described (Hou et al., 2000). Fifteen A protoplast feeding assay was modified from one used microliters of the total protein extract was fractionated by for studying aphid transmission of luteoviruses (Wang et al., SDS-PAGE, and electroblotted to PVDF membranes (Milli- 1995). Tobacco protoplasts were transfected with the pore). Blots were probed with CP polyclonal antisera appropriate BMCTV plasmid DNA, and kept for 5 days at (aCP610 or 611; Soto, 2002) diluted 1:1000 in TBST (10 room temperature. Cells were collected by centrifugation mM Tris, pH 8.0; 0.25 M NaCl; 0.5% Tween 20). The CP (600Âg for 5 min), washed with 10 mM sodium phosphate (primary) antibody was detected with goat anti-rabbit buffer (pH 7.0) and resuspended in 200 Al of this buffer. horseradish peroxidase conjugate (1:2000 dilution), and This cell suspension was sonicated with a Vibra Cell Model visualized with the Renaissance Western Blot Chemilumi- VC50 sonicator (Sonic and Materials Inc., Danbury, CT) for nescence Kit (NEN, Boston, MA). 2 s (twice), and cellular debris removed by centrifugation (8000Âg for 5 min). This extract was mixed with an equal Immunosorbent electron microscopy (ISEM) volume of 30% sucrose solution, and a drop of blue food coloring (McCormick and Co., Inc, Hunt Valley, MD) was Extracts from protoplasts transfected with BMCTV added for monitoring insect feeding. Non-viruliferous adult plasmid DNA were prepared as previously described, and leafhoppers were placed into a clear plastic tube (7.8 cm the presence of virions determined by ISEM (Roberts et al., long Â 2.7 cm wide). One end of the tube was covered with 1984). Formvar/carbon coated grids (Electron Microscopy a cloth screen, and the other end with parafilm. The Sciences, Fort Washington, PA) were floated on a 10 Aldrop protoplast extract (¨400 Al) was placed on the parafilm of BMCTV CP antiserum (aCP611), diluted 1:500 with 10 and then covered with another piece of parafilm. Leaf- mM sodium phosphate buffer (pH 7.0), for 1 h at 37 -C. hoppers were allowed to membrane-feed on extracts over- Grids were washed with drops of phosphate buffer and night at room temperature. Groups of five to seven insects blotted dry. These BMCTV CP antibody-coated grids were were exposed to leaves of healthy shepherd’s purse plants then placed on a 10 Al drop of protoplast extract, and kept in for IAPs of 3–5 days, and plants were kept in a controlled a moist chamber overnight at 4 -C. Grids were washed in growth chamber at 30 -C day/25 -C night with a 16-h distilled water and stained by floating on a 10 Aldropof2% photoperiod. Plants were observed for symptom develop- uranyl acetate for ¨10 s. The grids were examined with a ment, and tested for BMCTV infection as described below. Philips 410LS transmission electron microscope (20,000Â magnification). DNA extraction and PCR detection of BMCTV in plants and insects DNAse protection assay

PCR analysis was performed as previously described Extracts from protoplasts transfected with BMCTV (Rojas et al., 1993; Soto and Gilbertson, 2003). BMCTV plasmid DNA were prepared as previously described. DNA was amplified by PCR with a degenerate primer pair, Aliquots of 300 Al were adjusted to 1.5 mM MgCl2, and pAL1v1978 and PCRc1 (Rojas et al., 1993); or the BMCTV 2 Al (100 units) of DNAse I (Gibco BRL, Grand Island, NY) primer pair, BMCTVv377 and BMCTVc1509, which was added. Samples were incubated for 2 h at 37 -C, and the M.J. Soto et al. / Virology 341 (2005) 257–270 269 reaction was stopped by adding EDTA to a final concen- inclusion in Amsinckia infected with the curly top virus. J. Ultrastruct. tration of 2 mM and heating samples at 65 -C for 10 min. Res. 66, 11–21. Fromm, M., Callis, J., Taylor, L.P., Walbot, V., 1987. Electroporation of Samples were extracted with an equal volume of phenol/ DNA and RNA into plant protoplasts. Methods Enzymol. 153, chloroform, and nucleic acids recovered by ethanol precipi- 351–365. tation. The presence of BMCTV DNA in these nucleic acid Gardiner, W., Sunter, G., Brand, L., Elmer, J.S., Rogers, S.G., Bisaro, D.M., preparations was determined by PCR with the BMCTV 1988. Genetic analysis of tomato golden mosaic virus: the coat protein primer pair. is not required for systemic spread or symptom development. EMBO J. 7, 899–904. Giesman-Cookmeyer, D., Lommel, S.A., 1993. Alanine scanning mutagenesis of a plant virus movement protein identifies three functional Acknowledgments domains. Plant Cell 5, 973–982. Gilbertson, R.L., Faria, J.C., Hanson, S.F., Morales, F.J., Ahlquist, P., We thank Drs. Bryce Falk and Diane Ullman for Maxwell, D.P., Russell, D.R., 1991. Cloning of the complete DNA genomes of four bean-infecting geminiviruses and determining their assistance with leafhoppers, Dr. Pablo Guzma´n for providing infectivity by electric discharge particle acceleration. Phytopathology the overlapping primers, Dr. Drake Stenger for providing a 81, 980–985. full-length clone of BCTV and Rick Harris for assistance Gilbertson, R.L., Hidayat, S.H., Paplomatas, E.J., Rojas, M.R., Hou, Y.-M., with electron microscopy. This research was supported in Maxwell, D.P., 1993. Pseudorecombination between infectious cloned part by a Faculty Research Grant from the UC Davis College DNA components of tomato mottle and bean dwarf mosaic geminiviruses. J. Gen. Virol. 74, 23–31. of Agricultural and Environmental Sciences to RLG and a Guevara-Gonzalez, R.G., Ramos, P.L., Rivera-Bustamante, R.F., 1999. Jastro Shields Research Award and BID-CONICIT fellow- Complementation of coat protein mutants of pepper huasteco gemini- ship (Venezuela) to MJS. virus in transgenic tobacco plants. Phytopathology 89, 540–545. Guzma´n, P., Goldberg, N., Liddell, C.M., Gilbertson, R.L., 1996. Detection and partial characterization of beet curly top geminivirus (BMCTV) isolates infecting beans, peppers and tomatoes in California and New References Mexico. Annu. Rep. Bean Improv. Coop. 39, 75–76. Hallan, V., Gafni, Y., 2001. Tomato yellow leaf curl virus (TYLCV) capsid Arguello-Astorga, G.R., Guevara-Gonzalez, R.G., Herrera-Estrella, L.R., protein (CP) subunit interactions: implications for viral assembly. Arch. Rivera-Bustamante, R.F., 1994. Geminivirus replication origins have a Virol. 146, 1765–1773. group-specific organization of iterative elements: a model for repli- Hanley-Bowdoin, L., Settlage, S.B., Orozco, B.M., Nagar, S., Robertson, cation. Virology 203, 90–100. D., 1999. Geminiviruses: models for plant DNA replication, tran- Azzam, O., Frazer, J., De La Rosa, D., Beaver, J.S., Ahlquist, P., Maxwell, scription, and cell cycle regulation. Crit. Rev. Plant Sci. 18, 71–106. D.P., 1994. Whitefly transmission and efficient ssDNA accumulation of Harrison, B.D., 1985. Advances in geminivirus research. Annu. Rev. bean golden mosaic geminivirus require functional coat protein. Phytopathol. 23, 55–82. Virology 204, 289–296. Ho¨fer, P., Bedford, I.D., Markham, P.G., Jeske, H., Frischmuth, T., 1997. Baliji, S., Black, M.C., French, R., Stenger, D.C., Sunter, G., 2004. Coat protein gene replacement results in whitefly transmission of an Spinach curly top virus: a newly described Curtovirus species from insect nontransmissible geminivirus isolate. Virology 236, 288–295. southwest Texas with incongruent gene phylogenies. Phytopathology Ho¨hnle, M., Ho¨fer, P., Bedford, I.D., Briddon, R.W., Markham, P.G., 94, 772–779. Frischmuth, T., 2001. Exchange of three amino acids in the coat protein Bass, S.H., Mulkerrin, M.G., Wells, J.A., 1991. A systematic mutational results in efficient whitefly transmission of a nontransmissible Abutilon analysis of hormone-binding determinants in the human growth mosaic virus isolate. Virology 290, 164–171. hormone receptor. Proc. Natl. Acad. Sci. U.S.A. 88, 4498–4502. Hormuzdi, S.G., Bisaro, D.M., 1993. Genetic analysis of beet curly top Bennett, C.W., 1971. The Curly Top Disease of Sugar Beet and Other virus: evidence for three virion sense genes involved in movement and Plants. The American Phytopathological Society, St. Paul, MN. regulation of single- and double-stranded DNA levels. Virology 193, Monogr. 7. 900–909. Bo¨ttcher, B., Unseld, S., Ceulemans, H., Russell, R.B., Jeske, H., 2004. Hou, Y.-M., Gilbertson, R.L., 1996. Increased pathogenicity in a pseudo- Geminate structures of African cassava mosaic virus. J. Virol. 78, recombinant bipartite geminivirus correlates with intermolecular recom- 6758–6765. bination. J. Virol. 70, 5430–5436. Boulton, M.I., Steinkellner, H., Donson, J., Markham, P.G., King, D.I., Hou, Y.-M., Paplomatas, E.J., Gilbertson, R.L., 1998. Host adaptation and Davies, J.W., 1989. Mutational analysis of the virion-sense genes of replication properties of two bipartite geminiviruses and their pseudo- maize streak virus. J. Gen. Virol. 70, 2309–2323. recombinants. Mol. Plant Microbe Interact. 11, 208–217. Briddon, R.W., Watts, J., Markham, P.G., Stanley, J., 1989. The coat protein Hou, Y.-M., Sanders, R., Ursin, V.M., Gilbertson, R.L., 2000. Transgenic of beet curly top virus is essential for infectivity. Virology 172, 628–633. plants expressing geminivirus movement proteins: abnormal pheno- Briddon, R.W., Pinner, M.S., Stanley, J., Markham, P.G., 1990. Geminivi- types and delayed infection by Tomato mottle virus in transgenic rus coat protein gene replacement alters insect specificity. Virology 177, tomatoes expressing the Bean dwarf mosaic virus BV1 or BC1 proteins. 85–94. Mol. Plant Microbe Interact. 13, 297–308. Briddon, R.W., Stenger, D.C., Bedford, I.D., Stanley, J., Izadpanah, K., Ingham, D.J., Pascal, E., Lazarowitz, S.G., 1995. Both bipartite geminivirus Markham, P.G., 1998. Comparison of a beet curly top virus isolate movement proteins define viral host range, but only BL1 determines originating from the Old World with those from the New World. Eur. J. viral pathogenicity. Virology 207, 191–204. Plant Pathol. 104, 77–84. Kheyr-Pour, A., Bananej, K., Dafalla, G.A., Caciagli, P., Noris, E., Esau, K., 1977. Virus-like particles in nuclei of phloem cells in spinach Ahoonmanesh, A., Lecoq, H., Gronenborn, B., 2000. Watermelon leaves infected with the curly top virus. J. Ultrastruct. Res. 61, 78–88. chlorotic stunt virus from the Sudan and Iran: sequence comparisons Esau, K., Hoefert, L.L., 1973. Particles and associated inclusions in sugar and identification of a whitefly-transmission determinant. Phytopatho- beet infected with the curly top virus. Virology 56, 454–464. logy 90, 629–635. Esau, K., Magyarosy, A.C., 1979. Nuclear abnormalities and cytoplasmic Klute, K.A., Nadler, S.A., Stenger, D.C., 1996. Horseradish curly top is a 270 M.J. Soto et al. / Virology 341 (2005) 257–270

distinct subgroup II geminivirus species with rep and C4 genes derived curtovirus Beet mild curly top virus (Family Geminiviridae) in the beet from a subgroup III ancestor. J. Gen. Virol. 77, 1369–1378. leafhopper. Phytopathology 93, 478–484. Latham, J.R., Saunders, K., Pinner, M.S., Stanley, J., 1997. Induction of Stanley, J., Townsend, R., 1986. Infectious mutants of cassava latent plant cell division by beet curly top virus gene C4. Plant J. 11, virus generated in vivo from intact recombinant DNA clones 1273–1283. containing single copies of the genome. Nucleic Acids Res. 14, Lazarowitz, S.G., Pinder, A.J., Damsteegt, V.D., Rogers, S.G., 1989. Maize 5981–5998. streak virus genes essential for systemic spread and symptom develop- Stanley, J., Markham, P.G., Callis, R.J., Pinner, M.S., 1986. The nucleotide ment. EMBO J. 8, 1023–1032. sequence of an infectious clone of the geminivirus beet curly top virus. Liu, H., Boulton, M.I., Davies, J.W., 1997. Maize streak virus coat protein EMBO J. 5, 1761–1768. binds single- and double-stranded DNA in vitro. J. Gen. Virol. 78, Stanley, J., Latham, J.R., Pinner, M.S., Bedford, I., Markham, P.G., 1992. 1265–1270. Mutational analysis of the monopartite geminivirus beet curly top virus. Liu, H., Davies, J.W., Stanley, J., 1998. Mutational analysis of bean yellow Virology 191, 396–405. dwarf virus, a geminivirus of the genus Mastrevirus that is adapted to Stenger, D.C., 1994. Complete nucleotide sequence of the hypervirulent dicotyledonous plants. J. Gen. Virol. 79, 2265–2274. CFH strain of beet curly top virus. Mol. Plant Microbe Interact. 7, Liu, H., Boulton, M.I., Thomas, C.L., Prior, D.A.M., Oparka, K.J., Davies, 154–157. J.W., 1999. Maize streak virus coat protein is karyophyllic and Stenger, D.C., 1998. Replication specificity elements of the Worland strain facilitates nuclear transport of viral DNA. Mol. Plant Microbe Interact. of beet curly top virus are compatible with those of the CFH strain but 12, 894–900. not those of the Cal/Logan strain. Phytopathology 88, 1174–1178. Liu, H., Lucy, A.P., Davies, J.W., Boulton, M.I., 2001. A single amino acid Stenger, D.C., McMahon, C.L., 1997. Genotypic diversity of beet curly top change in the coat protein of Maize streak virus abolishes systemic virus populations in the western United States. Phytopathology 87, infection, but not interaction with viral DNA or movement protein. Mol. 737–744. Plant Pathol. 2, 223–228. Stenger, D.C., Ostrow, K.M., 1996. Genetic complexity of a beet curly top Magyarosy, A.C., 1980. Beet curly top virus from phloem exudate of virus population used to assess sugar beet cultivar response to infection. Amsinckia douglasiana. Ann. Appl. Biol. 96, 295–299. Phytopathology 86, 929–933. McKenna, R., Bowman, B.R., Ilag, L.L., Rossmann, M.G., Fane, B.A., Stenger, D.C., Carbonaro, D., Duffus, J.E., 1990. Genomic character- 1996. Atomic structure of the degraded procapsid particle of the ization of phenotypic variants of beet curly top virus. J. Gen. Virol. bacteriophage G4: induced structural changes in the presence of calcium 71, 2211–2215. ions and functional implications. J. Mol. Biol. 256, 736–750. Stenger, D.C., Revington, G.N., Stevenson, M.C., Bisaro, D.M., 1991. Mullineaux, P.M., Donson, J., Morris-Krsinich, B.A., Boulton, M.I., Replicational release of geminivirus genomes from tandemly repeated Davies, J.W., 1984. The nucleotide sequence of maize streak virus copies: evidence for rolling cicle replication of a plant viral DNA. Proc. DNA. EMBO J. 3, 3063–3068. Natl. Acad. Sci. U.S.A. 88, 8029–8033. Noris, E., Vaira, A.M., Caciagli, P., Masenga, V., Gronenborn, B., Accotto, Sudarshana, M.R., Wang, H.L., Lucas, W.J., Gilbertson, R.L., 1998. G.P., 1998. Amino acids in the capsid protein of tomato yellow leaf curl Dynamics of bean dwarf mosaic geminivirus cell-to-cell and long- virus that are crucial for systemic infection, particle formation, and distance movement in Phaseolus vulgaris revealed, using the green insect transmission. J. Virol. 72, 10050–10057. fluorescent protein. Mol. Plant Microbe Interact. 11, 277–291. Patel, V.P., Rojas, M.R., Paplomatas, E.J., Gilbertson, R.L., 1993. Cloning Thornley, W., Mumford, D., 1979. Intracellular location of beet curly top biologically active geminivirus DNA using PCR and overlapping virus antigen as revealed by fluorescent antibody staining. Phytopatho- primers. Nucleic Acids Res. 21, 1325–1326. logy 69, 738–740. Pooma, W., Gillette, W.K., Jeffrey, J.L., Petty, I.T.D., 1996. Host and viral Timmermans, M.C.P., Das, O.P., Messing, J., 1994. Geminiviruses and their factors determine the dispensability of coat protein for bipartite uses as extrachromosomal replicons. Annu. Rev. Plant Physiol. Plant geminivirus systemic movement. Virology 218, 264–268. Mol. Biol. 45, 79–112. Rigden, J.E., Dry, I.B., Mullineaux, P.M., Rezaian, M.A., 1993. Muta- Unseld, S., Frischmuth, T., Jeske, H., 2004. Short deletions in nuclear genesis of the virion-sense open reading frames of tomato leaf curl targeting sequences of African cassava mosaic virus coat protein geminivirus. Virology 193, 1001–1005. prevent geminivirus twinned particle formation. Virology 318, 90–101. Roberts, I.M., Robinson, D.J., Harrison, B.D., 1984. Serological relation- Van Regenmortel, M.H.V., Bishop, D.H.L., Fauquet, C., 2000. Virus ships and genome homologies among geminiviruses. J. Gen. Virol. 65, Taxonomy: Classification and Nomenclature of Viruses: Seventh Report 1723–1730. of the International Committee on Taxonomy of Viruses. Academic Rojas, M.R., Gilbertson, R.L., Russell, D.R., Maxwell, D.P., 1993. Use of Press, San Diego. degenerate primers in the polymerase chain reaction to detect whitefly- Wang, J.Y., Chay, C., Gildow, F.E., Gray, S.M., 1995. Readthrough protein transmitted geminiviruses. Plant Dis. 77, 340–347. associated with virions of barley yellow dwarf luteovirus and its Rojas, M.R., Jiang, H., Salati, R., Xoconostle-Cazares, B., Sudarshana, potential role in regulating the efficiency of aphid transmission. M.R., Lucas, W.J., Gilbertson, R.L., 2001. Functional analysis of Virology 206, 954–962. proteins involved in movement of the monopartite begomovirus, Wang, H.L., Sudarshana, M.R., Gilbertson, R.L., Lucas, W.J., 1999. Tomato yellow leaf curl virus. Virology 291, 110–125. Analysis of cell-to-cell and long-distance movement of a bean dwarf Rojas, M.R., Hagen, C., Lucas, W.J., Gilbertson, R.L., 2005. Exploiting mosaic geminivirus-green fluorescent protein reporter in host and chinks in the plant’s armor: evolution and emergence of geminiviruses. nonhost species: identification of sites of resistance. Mol. Plant Microbe Ann. Rev. Phytopathol. 43, 16.1–16.39. Interact. 12, 345–355. Rybicki, E.P., 1994. A phylogenetic and evolutionary justification for three Wartig, L., Kheyr-Pour, A., Noris, E., De Kouchkovsky, F., Jouanneau, F., genera of Geminiviridae. Arch. Virol. 139, 49–77. Gronenborn, B., Jupin, I., 1997. Genetic analysis of the monopartite Soto, M.J., 2002. Functional analysis of the virion-sense encoded tomato yellow leaf curl geminivirus: roles of V1, V2, and C2 ORFs in proteins of beet curly top virus and studies of the virus-beet viral pathogenesis. Virology 228, 132–140. leafhopper vector (Circulifer tenellus) interaction. PhD Thesis, Zhang, W., Olson, N.H., Baker, T.S., Faulkner, L., Agbandje-McKenna, M., University of California-Davis. Boulton, M.I., Davies, J.W., McKenna, R., 2001. Structure of the maize Soto, M.J., Gilbertson, R.L., 2003. Distribution and rate of movement of the streak virus geminate particle. Virology 279, 471–477.