INFORMATION TO USERS

This manuscript has been reproduced from the microfilm master. UMl films the text directly from the original or copy submitted. Thus, som e thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer.

The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction.

In the unlikely event that the author did not send UMl a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.

Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps.

Photographs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6" x 9" black and white photographic prints are available for any photographs or illustrations appearing in this copy for an additional charge. Contact UMl directly to order.

Bell & Howell Information and Learning 300 North Zeeb Road, Ann Artror, Ml 48106-1346 USA 800-521-0600 UMl

MOLECULAR ANALYSIS OF SYMPTOM DEVELOPMENT AND VIRAL GENE EXPRESSION IN GEMINIVIRUS-INFECTED ARABIDOPSIS

DISSERTATION

Presented in Partial Fulfillment of the Requirements for

the Degree Doctor of Philosophy in the Graduate

School of The Ohio State University

By

Jingyung Hur, B.S. and M.S.

*****

The Ohio State University 2000

Dissertation Committee: Approved by Dr. David M. Bisaro

Dr. Randall L. Scholl Adviser Dr. Keith R Davis, Adviser

Department of Plant Biology UMl Number: 9994879

UMl

UMl Microform 9994879 Copyright 2001 by Bell & Howell Information and Learning Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17. United States Code.

Bell & Howell Information and Learning Company 300 North Zeeb Road P.O. Box 1346 Ann Arbor, Ml 48106-1346 ABSTRACT

The gemini viruses are a group of single-stranded DNA viruses with a twin icosahedrai capsid. The Geminividae family is composed of three different genera - Masirevinises,

Curtovinises, and Begomovinises grouped - according to their genomic structure, insect vector and their plant host. This group of viruses causes economically important disease in crop plants worldwide. Biologically they are interesting because they use the host replication and transcription machinery to replicate and express their genome without virus encoded polymerase activities. In this study, we looked at the interaction between one of these geminiviruses. the curtovims beet curly top virus (BCTV), with our model plant system, Arabidopsis. Symptoms caused by BCTV infection ofArabidopsis are characteristic of those observed in other hosts and include ectopic cell divisions in tissues and disruption of normal development. These symptoms are similar to phenotypes in

Arabidopsis associated with mutations in genes involved in plant hormone transport. To address the question of whether disruption of hormone transport in virus infected plants is correlated with symptom development, we used cell-cycle marker-gene promoter driven

ii reporter gene transgenic lines and auxin-up-regulated gene promoter driven reporter gene transgenic lines for viral infection studies. The results show that both cell-cycle maker- gene and auxin responsive gene were concomitantly expressed in the same region of symptomatic tissues. The auxin polar transport rate in virus infected plants was measured and this rate was significantly reduced in virus infected plants. Auxin-related mutants

Arabidopsis of were also used to see if a normal response to changed auxin concentration and the normal downstream signal transduction pathway of auxin is needed for symptoms to develop in virus infected plants. To further address the interaction between BCTV and

Arabidopsis, viral promoter activity in plants was studied using transgenic plants expressing the GUS reporter gene under control of virus sequences. The promoter region of BCTV ORF Cl was identified using reporter gene fusions in transgenic Arabidopsis.

Unlike other geminiviruses, the intergenic region was not sufficient to promote Cl expression in transgenic plants. As the promoter region was extended into the coding region of Cl, strong expression of the reporter protein was observed in vascular tissues of transgenic plants. This suggests that important transcriptional activator elements for Cl expression reside in the Cl coding area itself. Transgenic plants expressing the reporter gene under control of the complete C l promoter were inoculated with virus to find out if any viral protein, especially Cl, is down-regulating Cl expression. The results suggested that BCTV Cl protein does not auto-regulate its own expression and that Cl expression

111 is controlled differently than other geminiviruses. In the case of virion sense gene

expression, expression from the less virulent Logan promoter was stronger than expression from the CFH promoter. The viral promoters were active in seedlings, in

actively dividing tissues such as root tips and in apical meristems. As plants matured,

promoter activity diminished. Infection of mature transgenic plants by virus restored

reporter gene expression, especially in transgenic plants containing Logan virion sense- gene promoter constructs. An interesting 30 bp motif that is tandemly repeated three times in the Logan promoter but only once in CFH was identified in this study. When this motif was removed from the Logan promoter one by one, the promoter activity in transgenic plants was greatly reduced. CFH promoters with one or two extra copies of this motif did not show increased virion sense promoter activity in transgenic plants but did have increased promoter activity in the complementary sense direction. This motif has previously been identified as a late conserved element and is known to be involved in late gene expression via AL2 protein transactivation. Since BCTV does not have a functional homologue of AL2 and this motif showed different types of control of transcription in our reporter gene fusion experiment, this motif must be involved in both early and late gene expression via a control mechanism distinct from that seen in the bipartite viruses.

IV ACKNOWLEDGEMENTS

I sincerely thank my adviser, Dr. Keith Davis for his unconditional support and guidance throughout my graduate studies. He always offered me intellectual advice and constant encouragement when I need them most.

I also thank other members of my advisory and dissertation committee,

Dr. Randall Scholl, Dr. David Bisaro, Dr. Desh Pal Verma and Dr. Zhenbiao Yang for their valuable suggestions and comments.

I thank Dr. Kenneth Buckley for his help and sharing his profound knowledge in gene cloning techniques, for letting me use his vast variety of cloning vectors, and for putting up with my constant whining in the laboratory. I also would like to express my deepest thanks to Dr. Doreen Ware for her unconditional support and constant encouragement whenever I felt down. She is my real guardian angel. I am also grateful to all the other members of Davis lab and the Arabidopsis Biological Stock Center, Dr.

Rao Mulpuri, Dr. Greg Bertoni, Dr. Jennifer Koch, Dr. Emma Knee, Staci Putney, and

Jeff Cotrill, for their help and friendship. I thank my family, especially my parents, for their love, support, and supreme confidence in me since I was a little baby.

VI VITA

April 30, 1968 ...... Bom - Jinhae, Republic of Korea

1991...... B. S. Biology, Sogang University, Seoul, Korea

1992-1994 ...... Laboratory supervisor. Quality analysis laboratory, Sunkyung Pharmaceutical Co. Ltd., Seoul, Korea.

1995 - 1998 ...... M.S. Department of Plant Biology, The Ohio State University. Columbus OH, U.S.A.

1995 - 2000 ...... Graduate Teaching and Research Associate, Department of Plant Biology, The Ohio State University, Columbus OH, U.S.A.

PUBLICATIONS

1. Hur, J., Lee, S. and Davis, K. R., Molecular analysis of symptom development in BCTV infected Arabidopsis thaliana. Manuscript in preparation.

2. Hur, J. and Davis, K. R, Identification of the BCTV early gene promoter region using transgenic Arabidopsis. Manuscript in preparation.

3. Hur, J. and Davis, K. R., Regulation of BCTV late-gene expression and identification of a motif involved in this regulation. Manuscript in preparation.

Vll POSTERS PRESENTED AT SCIENTIHC MEETINGS.

1. Hur, J. and Davis, K.R., Molecular analysis of symptom development in Beet Curly Top Virus \x\ïtcied Arabidopsis thaliana. 1997, 8th International conference on Arabidopsis research, Madison, Wisconsin. 2. Buckley, K.J., Ware, D.H., Hur, J. and Davis, K.R., BCTV ORF L4 as symptom determinant in Arabidopsis. 1997, 8th International conference on Arabidopsis research, Madison, Wisconsin. 3. Hur, J and Davis, K.R., Study of gemini virus Beet Curly Top Virus (BCTV) viral promoter-reporter gene constructs. 1998, 1st Annual Plant Biology Research Symposium, Columbus, Ohio. 4. Hur, J. and Davis, K. R., Analysis of Beet Curly Top Virus (BCTV) viral promoter activity. 1998, Plant Molecular Biology and Biotechnology Symposium, Columbus, Ohio. 5. Hur, J and Davis, K.R., Study of motif in Beet Curly Top Virus (BCTV) bi-directional promoter. 1999, 2nd Annual Plant Biology and Biotechnology Research Symposium, Columbus, Ohio. 6. Hur, J and Davis, K.R., Identification of a promoter region involved in BCTV early- gene expression. 2000, 11th International conference on Arabidopsis research, Madison, Wisconsin. 7. Hur, J and Davis, K.R., Study of Beet Curly Top Virus (BCTV) bi-directional promoter activity and identification of its novel motif. 2000, The annual meeting of the American Society of Plant Physiologists., San Diego, California.

FIELDS OF STUDY

Major Field: Plant Molecular Biology

vm TABLE OF CONTENTS

Page

Abstract ...... ii

Acknowledgments ...... v

V ita...... vil

List of T ables...... xi

List of Figures...... xii

Lists of Symbols/Abreviations/Nomenclature...... xiv

Chapters:

1 Introduction...... 1

2 Molecular analysis of symptom development in BCTV-infectedArabidopsis thaliana ...... 17 2.1 Abstract ...... 17 2.2 Introduction ...... 18 2.3 Materials and Methods ...... 24 2.4 Results ...... 28 2.5 Discussion ...... 51

3 Identification of the beet curly top virus (BCTV) Cl promoter region...... 61 3.1 Abstract ...... 61 3.2 Introduction ...... 62 3.3 Materials and Methods ...... 66

IX 3.4 Results ...... 72 3.5 Discussion ...... 87

Regulation of BCTV virion sense gene expression and identification of a motif involved in viral gene expression in plants ...... 92 4.1 Abstract ...... 92 4.2 Introduction ...... 94 4.3 Materials and Methods ...... 97 4.4 Results ...... 101 4.5 Discussion ...... 116

Bibliography...... 121 LIST OF TABLES

Table Page

1.1 The members of the Gemini viridae ...... 2

2.1 Infectivity and symptom development in auxin-resistant and auxin transport mutants ofArabidopsis inoculated with BCTV Strains Logan and CFH ...... 46

3.1 The primers used to amplify promoter fragments s of C...... l 67

3.2 The viral fragments amplified to generate viral promoterrGUS fusion...... 68

XI LIST OF FIGURES

Figure Page

1.1 The Genomic structures of geminiviruses ...... 3

2.1 Symptoms of BCTV inoculated 30

2.2 Histochemical localization of CDC2, CYCl and SAUR promoter activity in transgenic Arabidopsis...... 33

2.3 Crosssections of virus infected and mock inoculated CDC2, CYCl and SAUR transgenic Arabidopsis...... 35

2.4 Quantification of CDC2, CYCl and SAUR reporter gene activity of virus infected and mock inoculated transgenic Arabidopsis...... 37

2.5 Auxin polar transport in virus-infected plants ...... 40

2.6 TUNEL assays for programmed cell death in virus infected tissues ...... 42

2.7 Symptoms caused by BCTV strains of Logan and CFH on auxin related mutants ofArabidopsis ...... 47

2.8 Viral DNA accumulation in auxin-resistant mutants and auxin-transport mutants ofArabidopsis infected with BCTV strains Logan and CFH ...... 49

3.1 Schematic illustration of constructs used for expression of reporter genes under viral promoter control...... 73

3.2 Histochemical localization of Cl promoter activity of viral intergenic region .. 75

X I1 3.3 Histochemical localization of Cl promoter activity of viral intergenic region and 5’ upstream region in transgenic Arabidopsis plants...... 77

3.4 Histochemical localization of Cl promoter activity of viral intergenic area and Cl coding region in transgenic Arabidopsis plants ...... 79

3.5 Reporter gene expression in virus infected and mock inoculated C1 promoter reporter transgenic plants...... 82

3.6 Schematic illustration of CFH Cl 5’ deletion constructs used for expression of reporter genes under truncated C 1 viral promoter control and their histochemical localization of reporter gene activity in transgenic plants...... 85

4.1 Schematic illustration of constructs used for expression of reporter genes under viral promoter control...... 102

4.2 Virion-sense promoter activity of intergenic regions of BCTV Logan and CFH ...... 103

4.3 Transactivation of virion-sense promoter of Logan by viral Infection 105

4.4 Transactivation response domain resides outside of intergenic region of CFH 107

4.5 Arabidopsis ecotype Sei-0 transgenic plants containing Logan virion-sense promoter infected with BCTV-CFH ...... 110

4.6 Repeated elements in intergenic region of BCTV Logan and CFH ...... I l l

4.7 Reporter gene expression of Logan virion-sense and complementary-sense gene promotenGUS constructs with reduced numbers of the repeated elements in their promoter region...... 112

4.8 Reporter gene expression of CFH virion-sense and complementary sense gene promotenGUS constructs with extra copies of the repeated elements in their promoter region...... 114

X lll LISTS OF SYMBOLS/ABREVIATIONS/NOMENCLATURE

ABRC Arabidopsis Biological Resource Center ACMV African Cassava Mosaic Virus BCTV Beet Curly Top Virus BeYDV Bean Yellow Dwarf Virus BGMV Bean Golden Mosaic Virus CaMV Cauliflower Mosaic Virus CP Coat Protein dsDNA Double-stranded DNA ssDNA Single-stranded DNA GPP Green Fluorescent Protein GUS P-glucuronidase MP Movement Protein MSV Maize Streak Virus Ren Replication enhancer Rep Replication initiator protein RF Replicative Form PGR Polymerase Chain Reaction SqLCV Squash Leaf Curl Virus TGMV Tobacco Golden Mosaic Virus TrAP Transcriptional Activator protein TYLCV Tomato Yellow Leaf Curl Virus pRB Retinoblastoma pRBR Plant retinblastoma-related WDV Wheat Dwarf Virus X-Gluc 5-bromo-4-chloro-3-indolyl-p-glucuronide

XIV CHAPTER I

INTRODUCTION

Geminivinis Taxonomy and Genome Structure

Geminiviruses are a family of single-stranded DNA (ssDNA) viruses which infect a variety of monocotyledonous and dicotyledonous plants causing economically significant crop losses worldwide. Geminiviruses can be divided into three major groups

- mastrevirus, curtovirus and begomovirus - by their plant host range, vector and genome structure (Lazarowitz, 1992; Rybicki, 1994; Briddon et al., 1995; Bisaro, 1996; Van

Rogen Morten et al., 1997; Hanley-Bowdoin et al, 1999; Gutierrez, 2000; Table 1.1).

The genomes of these viruses consist of either one (monopartite) or two (bipartite) single­ stranded circular DNA molecules of approximately 3 kb (Fig. 1.1). These viruses replicate their genome via double-stranded DNA (dsDNA) intermediates via a rolling circle replication process that relies on some host enzymes ( reviewed by Bisaro. 1996).

Mastre viruses have a single component genome and infect monocotyledonous plants via a leaf hopper. This group of viruses includes maize streak virus (MSV) and Mastrevirus Curtovirus Begomovirus

Origin of name Maize streak virus Beet curly top virus Bean golden mosaic virus

Genome Monopartite Monopartite Bipartite

Structure

Host Monocotyledonous plants Dicotyledonous plants Dicotyledonous plants

Insect vectors Leafhopper Leafhopper Whitefly

Members MSV, WDV, SSv, BCTV, HrCTV, TPCTV BGMV, TGMV, ACMV, SqLCV,

BeYDV, TobYDV TYLCV

Table 1.1. The members of geminiviridae Fig. 1.1. The Genomic structures of geminiviruses

Genomic maps for each geminivirus family. Mastrevirus map corresponds to wheat dwarf virus and encodes the Rep from its complementary sense transcripts after a splicing event. This group of viruses encode movement protein (MP/V2) and coat protein (CPA^I) from its virion sense transcripts. Curtovirus map corresponds to beet curly top virus. This group of viruses encode four complementary sense open reading frames - the Rep (LI). C2, C3 (REn) and C4. From virion sense direction, virus encodes three open reading frames -V I (CP),V2 and V3 (MP). In the case of CFH, there is another small open reading frame, R4; is not known if this protein is actually expressed. The begomovirus map corresponds to tomato golden mosaic virus. This group of viruses have two separate genomes in most cases. From component A, the virus encodes the Rep (ALI), TrAP (AL2), REn (AL3) and AL4 from the complementary sense direction and encodes CP (ARI) from the virion sense direction. The B component of this virus encodes one protein for each direction, designated BLI and BRI. Conserved Conserved Hairpin Hairpin Intergenic V . Region i/img Intergenic Region C4 V4

Cl V2 splice Curtovirus site •» Mastrevirus

VI C3

Conserved Conserved Hairpin Hairpin Conserved Conserved Region

AL4

ALI BLI

ARI

BRI

AL3 Begomovirus

Fig.1.1 wheat dwarf virus (WDV). In the mastrevirus group, the major complementary sense transcript is known to encode RepA protein (Dekker et al., 1991; Liu et al., 1998). RepA undergoes a splicing event to become a replication initiator (Schalk et al., 1989). In the

virion sense direction, the genome encodes two different proteins, the movement protein

(MP) and the coat protein (CP) (Wight et al., 1997; Liu et al, 1999a).

Curtoviruses infect dicotyledonous plants via a leafhopper vector and have a single component genome. A member of curtoviruses, beet curly top virus (BCTV), is used in this dissertation research. Curtoviruses encode four complementary sense genes and three virion sense genes. The first complementary sense protein. Cl, is known to be a replication initiator while the C3 protein is known to be a DNA replication enhancer

(Stanley et al., 1992b; Hormuzdi et al., 1995; Jupin et al., 1995). C4 protein is involved in symptom development and induction of cell division (Stanley and Latham, 1992;

Stanley et al., 1992; Latham et al., 1997; Buckley and Davis, unpublished data). In the virion sense direction, curtoviruses encode three polypeptides -VI (coat protein, CP). V2 and V3. VI and V3 have been shown to be involved in viral movement (Briddon et al.,

1989, Hormuzdi et al., 1993). V2 mutants accumulate reduced levels of ssDNA and higher levels of dsDNA, suggesting that V2 is involved in controlling the conversion of dsDNA to ssDNA during the virus life cycle (Hormuzdi et al., 1993). Begomovinises infect dicot plants via a whitefly vector and typically have two genomic components (A and B), although some monopartite viruses belong to this group

(Stanley et al., 1983; Howanh et al., 1985; Frischmuth et al., 1990). Begomovinises encode four different proteins in the complementary sense direction for the A component.

These are Rep, a replication initiator (Elmer et al., 1988; Etessami et al., 1991), a transcriptional activator protein (TrAP; Sunter and Bisaro, 1991; Hartiz et al., 1999), a replication enhancer (Ren; Elmer et al., 1988) and an AC4 protein. Unlike curtoviruses, mutation of the AC4 protein did not cause any detectable phenotype under a variety of different conditions (Sung et al., 1995; Pooma et al., 1996b). For the virion sense direction, the A component encodes the coat protein (CP). The B component of this group of viruses encodes proteins involved in viral movement, BCl and BVl

(Lazarowitz, 1999).

Geminivirus Replication and Transcription

Geminiviruses replicate their genome through a rolling circle mechanism to form a double-stranded replicative form (RF) which is used as a template to produce single­ stranded viral DNA (Saunders et al. 1991; Stenger et al., 1991; Bisaro, 1996). These dsDNAs also form mininucleosomes in the host nucleus and are transcribed. Since the virus does not encode any protein with DNA polymerase activity, the virus must utilize host replication enzymes to replicate its genome. Viral Rep, which is involved in

initiation of replication, is the only virus-encoded protein essential for replication. Rep has been shown to be a site-specific endonuclease which nicks plus-strand viral DNA at a conserved nonanucleotide sequence (TAATATTiAC) in the loop of the hairpin structure

to initiate replication (Stanley, 1995; Lauf et al., 1995c; Orozco et al., 1996). This nine

base hairpin structure is a common origin element to all geminiviruses (Arguello-Astorga

et al., 1994b). The origin for initiation of plus-strand DNA synthesis is located in the 5’

intergenic region (Saunders et al., 1991; Frischmuth et al., 1992; Stenger et al., 1992;

Heyraud et al., 1993a; Choi et al., 1995; Jupin et al., 1995; Orozco et al., 1998). There is

also a Rep binding site in this region, distant from the nicking site of Rep. In TGMV, the

binding site is a 13 bp direct repeat motif of 5 ' -GGT ACT A AGGT AG-3 '. Similar motifs

have been identified in other begomoviruses and curtoviruses. However, no such motif

has been found in mastre viruses (Arguello-Astorga et al.. 1994 a and b; Pontes et al.,

1994b). These Rep binding sites are essential for viral replication and recognition by Rep

is virus specific (Fontes et al., 1994a and 1994b; Choi and Stenger, 1996; Gladfelter et

al., 1997; Orozco et al., 1998). Two other elements were identified in the TGMV origin

area. The ‘AG-m otif which is located between the Rep binding site and hairpin is

essential for origin function (Orozco et al., 1998). A similar motif was also found in

SqLCV and confers a replication advantage to the virus in various plant hosts (Lazarowitz, 1991). The second element was the ‘CA-motif which is located immediately upstream of the Rep binding site. Deletion of this motif reduces replication by 20 fold (Orozco et al. 1998).

Geminiviruses are transcribed bidirectionally from their common conserved region (CR) producing both virion-sense and complementary-sense messages

(Townsend et al., 1985; Petty et al., 1988; Hanley-bowdoin et al., 1989; et al., 1989a;

Sunter et al., 1989b; Frischmuch et al., 1991; Mullineaux et al., 1993). The viral mRNA transcripts are polyadenylated and initiate downstream of transcriptional elements. This suggests that the virus is transcribed by host RNA polymerase II (Sunter et al., 1989a and

1989b). In the case of mastreviruses, it has is known that RNA splicing is needed to generate mRNAs capable of encoding functional viral proteins.

Due to the compact nature of geminivirus genomes, viral promoter sequences often overlap with the viral replication origin. Therefore, some of the c/5-elements controlling viral replication are also known to be involved in viral transcription. This would confer an advantage to the virus in controlling the various needs of replication and transcription as the virus progresses through its life cycle. Promoter Elements o f Other Geminiviruses

Of all of the geminiviruses, the begomovirus TGMV has the most well characterized promoter elements. The promoter for the ALl protein of TGMV was mapped to the common region using a transient reporter gene fusion assay in protoplast

(Eagle et al., 1994). A similar result was obtained for another begomovirus, ACMV

(Zhan et al., 1991). Since the complementary sense promoter can direct transcription in the absence of viral proteins, it is obvious that the virus promoter is recruiting host trascriptional factors. This promoter element was further mapped to a region 60 bp immediately before the AL61 transcript which encodes the ALl protein. In this 60 bp area, both a TATA box and G motif are located. Mutation in either of these two host factor interacting sequences has a detrimental effect on ALl transcription (Eagle et al.,

1997). The G box motif (CCACGTGG) is an environmentally inducible element found in promoters of plants and is conserved among geminiviruses (Arguello-Astorga et al.,

1994, de Veeten et al., 1994).

ALl (Rep) negatively regulates its own promoter through the Rep binding site.

This process is virus specific as is the case of Rep control of replication (Sunter et al.,

1993; Eagle et al., 1994; Groning et al., 1994; Glatfelter et al., 1997). Several lines of evidence suggests that this suppression is through active suppression of transcription and not an effect of steric hindrance (Eagle et al., 1994; Eagle and Hanley-Bowdoin, 1997). It has been shown that AL4 can also repress expression of ALl but AL4 does not appear to act through the ALl binding site (Groning et al., 1994). In the case of ACMV, another begomovirus, ACl (ALl equivalent) expression is also down regulated by itself but not by AC4 (Haley et al., 1992, Hong et al., 1995). In the B component of TGMV, the ELI mRNA starts at a different site from that of ALl and this transcription is not regulated by

Rep (Sunter et al., 1989a; Sunter et al., 1993).

For mastreviruses, three TATA consensus sequences which might be involved in complementary-sense transcription were identified (Boulton et al., 1991). Beyond this, little information for complementary sense transcription is available for this group of virus.

For virion-sense promoters of geminiviruses, much less is known about how they function. It has been shown that the common region and downstream sequences are enough to drive virion-sense transcription in TGMV if the viral protein AL2 is provided in trans (Groning et al., 1994; Sunter et al., 1997). But so far, no c/5-element for ARl or

BRI has been identified. Recent data showed the control of the ARl expression is complex and has multiple elements controlled by tissue specific host factors (Sunter et al., 1997). For mastrevirus virion-sense transcription, the 5’ intergenic region and its upstream elements were sufficient to drive expression (Fenoll et al., 1988). This upstream element contained two GC rich motifs and maize nuclear extract components

10 showed specific binding activity to these motifs (Fenoll et al., 1990; Arguello-Astorga et al., 1994b). In this group of viruses, WDV and CSMV showed enhanced virion-sense promoter activity in the presence of the C2 ORE (Hofer et al., 1992; Zhan et al., 1993).

Virus-Host Interaction (Rep)

As a plant grows and matures, DNA replication and cell division activities become more limited to apical meristems, developing leaves and the cambium. As they differentiate, plant cells usually cease cell division and have undetectable amount of

DNA replication enzymes (Martinez et al., 1992; Coello et al., 1992; Dai doji et al., 1992;

Staiget et al., 1993; Nagar et al., 1995). Various geminiviruses are found in mature, differentiated and non dividing cell types of infected plants (Rushing et al., 1987; Nagar et al., 1995; Lucy et al., 1996; Sudarshana et al., 1998). This suggests that geminiviruses can replicate in differentiated plant cells because they are able to induce the cells to re­ enter the S phase of the cell cycle. This idea is supported by data demonstrating that proliferating cell nuclear antigen (PCNA), the processivity factor of host nuclear DNA polymerase Ô, is found in differentiated cells of TGMV infected plants whereas none is found in healthy plants. PCNA was also found in transgenic plants expressing Rep, suggesting that Rep alone is enough to induce synthesis of PCNA.

11 Replication of animal DNA viruses in mammalian systems has been intensively studied. Animal DNA viruses such as Adenovirus and SV40 induce host replication directly through interaction with host transcription factors (Lee et al., 1991; Gruda et al.,

1993; Labrie et al., 1995; Damania et al., 1996; Eckner et al., 1996). These mammalian virus proteins bind to the retinoblastoma proteins (pRB, pl07 and pl3ü) which are regulating the Gl-S transition of cell division to turn on transcription of genes required for DNA replication and cell division (Hamel et al., 1992; Nelvins, 1992; Lam et al.,

1994; Herwig et al., 1997). This binding is through an LXCXE motif of the virus encoded protein (Ludlow, 1993; Moran, 1993; Vousden,1993).

In geminiviruses, RepA of mastreviruses binds to plant homologues of pRB, retinoblastoma related protein (pRBR), through its conserved LXCXE motif (Grail et al.,

1996; Xie et al., 1996; Ach et al., 1997; Murray, 1997). Recently, several plant pRBR have been identified from maize, tobacco, Chenopodiiim, md Arabidopsis (Grafi et al.,

1996; Xie et al., 1996; Ach et al., 1997a; Nakagami et al., 1999; Fountain et al., 1999;

Durfee et al., 2000; Kong et al., 2000). Hentley et al. (1998) showed that pRBR is preferentially expressed in mature leaf tissue which supports the proposed role of pRBR as a cell division suppressor in plant cell. A recent study showed that the Rep (ALl) of

TGMV, which does not have the conserved LXCXE motif, also binds to pRBR (Kong et

12 al., 2000). This shows that the viral protein can interact with pRBR via a mechanism that does not rely on a conserved LXCXE motif.

Virus-Host Interaction — Plasmodesmata

Another type of interaction between a virus and a plant host is the interaction between virus and the plasmodesmata (PD) of plants. PD are plasma membrane-lined cytoplasmic channels that span the cell wall and interconnect neighboring plant cells.

This interaction has been well studied with other types of plant viruses. PD have been considered as simple, non-selective pores which connect neighboring cells and function mainly as passive channels for cell to cell movement of small molecules in plants.

Recently, it has been found that PD are both structurally and functionally complex

(reviewed by Citovsky, 1993; Ghoshroy et al., 1997; Lucas and Gilbertson, 1994;

McLean et al., 1997; Mezitt et al., 1996, Wolf and Lucas, 1994). Studies with several viral movement proteins (MPs) and endogenous plant proteins like maize Knotted 1 and phloem sap proteins of some plants have shown that these proteins have the ability to increase the size exclusion limit (SEL) of PD from ten to twenty fold. This expansion of the SEL facilitates the movement of some proteins and nucleic acids through PD (Angell et al., 1996; Balachandran et al., 1997; Derrick et al., 1992; Ding et al., 1995; Fusiwara et

13 al., 1993; Lucas et al., 1995; Noueiry et al., 1994; Poirson et al., 1993; Vaguero et al.,

1994; Waigmann et al., 1994; Wolf et al., 1989).

The MPs of several plant viruses have been shown to be able to increase the SEL of PD from 1 kilodalton (kDa) to larger than 10 kDa (Angell et al., 1996; Derrick et al.,

1992; Ding et al., 1995; Fusiwara et al., 1993; Noueiry et al., 1994; Poirson et al., 1993;

Vaguero et al., 1994; Waigmann et al., 1994; Wolf et al., 1989). Most of these MPs also have the ability to potentiate cell-to-cell movement of their genome in a sequence non­ specific manner. The cell-to-cell transport of a plant encoded homeodomain protein.

Knotted 1 (KNl), has been revealed by microinjection studies (Lucas et al., 1995). This endogenous plant transcription factor has been shown to be capable of interacting with

PD and to potentiate its own movement and that of its sense RNA, movement from cell- to-cell. This suggests that macromolecules (i.e. proteins and nucleic acids) are gated selectively through PD and this selective control of PD gating might be used as an important tool to control plant development processes. Virus encoded proteins appears to be exploiting this mechanism to move to neighboring cells.

The majority of studies involving viral MPs have been mainly focused on viral movement through PD and MPs’ role in this process. Geminiviruses, which are DNA viruses, replicate in the nucleus. Therefore, in addition to cell-to-cell movement through the PD, geminiviruses also need to move from the nucleus out into the cytoplasm.

14 Studies in gemini vims movement have mostly been done on begomovimses and mastrevimses. In begomovimses, two vims-encoded proteins - BCI and BVl - are known to be involved in vims movement. It has been shown that BV1 is localized in the nucleus of vims infected plant and binds to ssDNA (Pascal et al., 1994; Nouiery et al.,

1994; Padidam et al., 1999). This protein has been proposed as a nuclear shuttle protein

(Snaderfoot et al., 1996). In the case of BCI protein, microinjection studies have been shown that this protein can move from cell to cell in host plants (Nouiery et al., 1994).

Furthermore, this protein was found to be associated with the endoplasmic recticulum- derived tubule found in vims infected plant cells, a stmcture which has been proposed to be used for cell-to-cell movement of vimses (Ward et al., 1997).

Mastre vims movement protein (VI) and coat protein (V2) do not have sequence homology with either BVl or BCI of begomovimses. However, VI and V2, are known be involved in nuclear transport and cell-to-cell movement of vims. These two vims proteins have been shown to be required for systemic infections but not for viral replication (Boulton et al., 1989; Lazarowitz et al., 1989). In recent studies, it was shown that VI of maize streak vims (MSV) binds to both ssDNA and dsDNA and can facilitate the transport of the MSV viral genome to the nucleus (Liu et al., 1997; Liu et al., 1999a).

Therefore, it has been proposed that VI functions as a nuclear shuttle protein during viral

15 infection. V2 has been localized to PD of virus infected plants and is thought be involved in cell-to-cell movement of the virus (Dikinson et al., 1996).

Viruses infect host cells and utilize host machinery to replicate and express their genome. Viruses also interact with the host for intracelllular and extracellular movement.

A consequence of these interactions can be the appearance of symptoms in the host although asymptomatic infections can occur. These symptoms vary from minor effects on plant development appearance or physiology to mortality. Very little is currently known about the precise mechanisms of symptom development and what host factors are involved in these processes. We have used the curtovirus BCTV and model plant system

Arabidopsis to study interactions between plants and the virus to develop a better understanding of virus-induced symptom development. We examined symptoms caused by virus to try to define mechanisms of symptom development in the host plant and attempt to identify specific perturbations in the normal growth and development caused by virus infection. We also localized and studied expression of viral promoters in transgenic plants expressing viral promoter driven reporter proteins. These studies are directly relevant to plant-virus interactions and provide a system that can also address basic questions relating to the control of plant cell division and differentiaton.

16 CHAPTER 2

MOLECULAR ANALYSIS OF SYMPTOM DEVELOPMENT IN BCTV-INFECTED

ARABIDOPSIS THAUANA

Abstract

Characteristics of symptoms caused by beet curly top virus (BCTV) are similar to those caused by disruption of transport of plant hormones in plants. These symptoms include stunting of plants, callus formation, uneven growth of stems and malformation of floral structures. In this study, cell-cycle-gene promoter driven GUS transgenic plants

(CDC2 and CYCI) and auxin-upregulated gene promoter driven GUS transgenic plants

(SAUR) were used to study changes in cell division and auxin concentration in virus infected plants. Both cell-cycle marker-genes and the auxin-regulated gene are concomitantly strongly expressed in symptomatic tissues and this expression is mostly confined to symptomatic tissues. Actual auxin polar transport rates in virus infected plants were measured and these rates were significantly reduced in symptomatic plants.

17 By TUNEL assay, programmed cell death was detected in symptomatic tissues of virus infected plants. Several auxin-related mutants were also infected with BCTV to define the potential role in auxin and virus symptom development in diseased plants. Most auxin-related mutants showed significantly reduced symptom development and significantly reduced levels of viral DNA upon infection with BCTV Logan, the less virulent of the two strains that were looked at. However, most of these mutants still developed significant symptoms and accumulated normal levels of viral DNA upon infecting by BCTV CFH, a more virulent strain than Logan. These results suggest that these two strains of virus have different, potentially overlapping, mechanisms of symptom development in host plants. We propose that these two viruses may interfere with one common host protein, disrupting a host signal transduction pathway responsible for symptom development in virus infected plants. In addition, BCTV CFH may interfere with another second host protein in a different signaling pathway that does not need auxin signal input to cause symptoms.

Introduction

Many plant viruses are named based on symptoms that they cause in infected plants. Hence, numbers viruses have names which include terms such as necrosis, mosaic, stunting and curling (Mattews, 1991). These viral symptoms must originate from 18 the interaction between viruses and plants and many of these symptoms suggest the strong possibility that the virus interferes with a host signal transduction cascade which is involved in coordinating developmental and physiological processes (Smith et al., 1968;

Lucas et al., 1996). Thus, host-virus systems could provide very good tools not only to investigate the mechanism of symptom development in virus infected plants but also to understand intrinsic molecular regulatory events in host signal transduction pathways.

Much effort was made by previous researchers to define physiological and metabolic changes associated with symptom development (Goodman et al., 1985). These data provide important insight into the host responses and biochemical status in diseased plants. However, these early data do not provide the molecular details of changes in host metabolism during symptom development and how the changes in host metabolism can contribute to the development of symptoms in symptomatic tissues. Changes in plant hormone level during infection by virus and the effect of those changes on symptom development in diseased plants were also studied (reviewed by Whenham et al., 1990).

Viral infection usually causes growth inhibition in plants. It is also known that the amount of abscisic acid (ABA) and ethylene increases while the amount of cytokinin, auxin and giberellin decreases in virus-infected plants. Auxin metabolism in virus infected plants was not studied as intensively as other phytohormones. Early studies showed lower levels of auxin in virus infected plants by bioassays (reviewed by Pegg,

19 1976). External application of naphthylacetic acid (NAA) and indoleacetic acid (lAA) reduced tobamovirus (TMV) multiplication while 2,4-dichlorophenoxyacetic acid (2,4-D) caused increased tobamovirus (TMV) multiplication in Samsun tobacco plants. For symptom development, high concentrations (>0.1 mM) of NAA masked mosaic symptom development (van Loon et al., 1990). In one study, lower concentrations of 2,4-D enhanced viral multiplication while higher concentration decreased tobamovirus multiplication (Sindelar et al., 1994).

The best studied system of virus and plant host interaction might be the interaction between plant plasmodesmata and viral movement protein. Recently, intensive studies have been conducted to define the role of plasmodesmata in controlling passage of macromolecules between plant cells (Fujiwara et al., 1993; Noueiry et al.,

1994; Weigmann et al., 1994; Ding et al., 1995; Lucas, 1995; Lucas et al., 1995). It has been shown that plants can selectively facilitate cell-to-cell movement of nucleic acids and proteins through their plasmodesmata. It has also been shown that viral movement proteins can exploit this mechanism and enlarge the size-exclusion-limit of plasmodesmata temporally to facilitate for cell-to-cell movement of their genome and proteins (Oparka et al., 1997). These studies demonstrated that plasmodesmata play a

major role in controlling cell-to-cell movement of signal molecules in plant cells to

orchestrate physiological functions. These studies also showed that a virus-host system

20 can be used to explore the physiological regulation system of the host. However, these studies did not adequately explain links between the enlarged size exclusion limit of the plasmodesmata in infected tissues and symptoms caused by virus; for example, how these enlarged plasmodesmata contribute to changes in host physiology to induce symptoms caused by virus or if there is any correlation between those two events.

An Arabidopsis mutant with enhanced symptom development upon viral infection has been isolated recently (Sheng et al., 1998). This mutant was reported to develop more severe symptoms -severe dwarfism and loss of apical dominance - following infection by a tobamovirus as compared to infection of wild-typeArabidopsis. External application of auxin rescued these symptoms. This mutant is interesting because it suggests that the virus is interfering with intercellular movement of auxin and that disruption of auxin flow is a major factor in causing symptom development in infected plants. However, the gene for this mutant has not been identified and it is not clear if the effect of externally applied auxin is directly complementing the mutation.

Previously, a simple plant-virus system with a genetically well-defined

Arabidopsis and a simple genomic structured Beet Curly Top Virus (BCTV) was established in this laboratory (Lee et al., 1994). BCTV is a monopartite DNA virus that infects a number of dicotyledonous plants from several different plant families (Bennett,

1971). Interestingly, two closely related strains of BCTV produce distinct symptoms in

21 several host plants in spite of their significant sequence homology: 58-87% homology of the leftward ORFs and 95% homology of the rightward ORFs (Stenger, 1994). BCTV-

Logan induces milder symptoms and has a longer latent period than BCTV-CFH.

Detailed studies between the BCTV strains, CFH and Logan, and different ecotypes of

Arabidopsis revealed that several ecotypes ofArabidopsis show a distinctive response to viral infection. Two ecotypes were found to be resistant and one ecotype was hypersensitive to BCTV-Logan. In this hypersensitive ecotype (Sei-0), virus-induced callus-like structures developed. Induction of callus-like structures has never been reported in any other studies involving geminivirus infection. Previous reports for this kind of structure have been associated with an alteration of the endogenous hormone levels of the plant tissues (Braun and Laskaris, 1942: Klein and Link, 1952; Yeoman,

1970). The induction of callus-like structures in virus-infected Sei-0 could be caused by altered hormone levels triggering extra cell division in virus infected tissues.

Symptoms caused by BCTV infection inArabidopsis also showed striking resemblance to the phenotypes of the auxin-transport mutants,pin and pinoid, with respect to malformed floral structures, and stunted inflorescences with curled tops (Okada et al., 1991; Bennett et al., 1995; Galweiler et al., 1998). We also measured auxin polar transport rates of virus infected plants and healthy plants to see virus infection causes disruption of auxin polar transport. If symptom development in virus inoculated tissues is really triggered by an altered auxin level, mutants with a disrupted response to this hormone should show an altered response to viral infection compared to wild type

Arabidopsis. Thus, we took advantage of the vast resource ofArabidopsis auxin-related

mutants to understand the links between levels of auxin and viral symptom development

in plant tissue. Many of these auxin related mutant genes are now cloned and can be categorized into three different groups for their distinctive role in auxin related response

of plants. The first group includes AXRl and TIRl which are involved in activation of a

ubiquitin related protein which presumably regulates the auxin signaling pathway (Leyser et al., 1993; del Pozo et al., 1998; Rueggeret al., 1998).a x r, l an auxin response mutant,

is insensitive to auxin and is sole member of the second group (Timpe et al., 1994).

Genes in the third group, TIR3 and AUXi, are involved in auxin transport. Also

included in this group are PINFORM and PINOID (Okada et al., 1991; Bennett et al„

1995; Bennett et al., 1996; Ruegger et al., 1997; Galweiler et al., 1998; Marchant et al.,

1999). These auxin-related mutants were infected with viruses to see their response upon

viral infection.

23 Materials and Methods

Plant Materials and Growth Condition

Two wild-type Arabidopsis ecotypes were obtained from Dr. F. Ausubel (Col-0) and Dr. R. Innes (Sei-0). The auxin resistant mutants and auxin transport mutants were obtained from the Arabidopsis Biological Resource Center (ABRC) at The Ohio State

University. Transgenic plant lines were gracefully provided by Dr. M. Van Montagu

(CDC2 and CYCI) and Dr. P. Green (SAUR). These transgenic plants contain constructs

with cdc2, cycl and saiir gene promoters fused to thegusA gene encoding P- glucuronidase (GUS).

Seed were sown in pots containing artificial soil (Coir mix, Scott©.) and were grown in a growth chamber operating at 18-22 °C, 50-80 % relative humidity and a cycle of 12 hr light and 12 hr dark. Light was supplied by fluorescent bulbs at an intensity of

100-200 (iE m ’sec '.

Virus Strains and Inoculation

BCTV strains Logan and CFH (pMLogan and pMCFH) were provided by Dr. D.

Stenger. Tandemly repeated dimers of infectious virus clones in the binary vector

pMON52I were introduced \nio Agrobacteriiim tiimefaciens strain GV3111 containing

24 pTiB6S3SE (Rogers et al., 1986) by triparental mating (Stenger et al., 1994). At the time of bolting (4-5 week after planting), plants were inoculated with infectious viral DNA by agroinoculation (Stanley et al., 1986; Stenger et al., 1992; Lee et al., 1994).

DNA Extraction and Blot Hybridization Analysis

At the indicated time period after agroinoculation, tissue was collected from shoot tips, roots, and infection origins (center of rosette) from virus-infected plants and then processed to isolate DNA (Junghans et al., 1990). Tissue was ground in liquid nitrogen and extracted with DNA extraction buffer (0.05 M Tris-HCl, pH 7.6, O.IM NaCl, 0.05 M

EDTA, 0.5 % SDS and 0.01 M P-mercaptoethethanol) followed by extraction with chloroform and phenol. Nucleic acids were precipitated with isopropanol, treated with

RNase, extracted with chloroform and phenol again and precipitated with ethanol. DNAs were resuspended in TE and the concentration was measured using a fluorimeter (Dyna

Quant™ 200, Hoefer Pharmacia Biotech Inc.). 0.5 }ig of total DNA were used for gel- electrophoresis or slot blotting and analyzed by DNA blot hybridization as previously described (Davis et al., 1991). A ^’P-labeled probe prepared by random priming reaction using pCLC, a pUC 8 derivative containing single tandemly repeated copies of the Logan and CFH genomes (Stenger et al., 1994) were used to analyze as previously described

(Lee et al., 1994).

25 Histochemical and Quantitative Analysis of GUS activity

Histochemical and quantitative assays for GUS activity were performed as described by Jefferson et al. (1987). Virus infected transgenic plants were harvested 2 to

4 week after inoculation, prefixed with cold 90% acetone for 1 hr at -20 °C, washed twice, incubated overnight in an enzymatic reaction mixture containing 0.5 mg/ml 5- bromo-4-chloro-3-indolyl-b-D-glucronic acid (X-gluc, Life technologies. Inc.) with 0.5 mM potassium ferricyanide and 0.5 mM potassium ferrocyanide as catalysts in 100 mM sodium phosphate buffer, pH 7.4 at 37 °C.

For quantitative assay, indicated parts of the virus-inoculated transgenic plants were harvested and processed for protein isolation. Tissue was ground in liquid nitrogen and extracted with extraction buffer (50 mM Na-phosphate buffer, pH 7.0, 10 mM P- mercaptoethanol, 10 mM EDTA, 0.1 % SDS and 0.1 % Triton X-100). Protein concentration was measured by the Bradford dye-binding assay (Bio-Rad Protein Assay.

Bio-Rad Inc.). 10 ^ig of protein from each sample was incubated with 1.0 ml of 2 mM 4- methylumbelliferyl-P-D-glucuronide (MUG, Sigma) at 37 °C for 30 min. 100 |al of reaction mix was aliqoted and added to a microfuge tube containing 1.9 ml of stop buffer

(0.2 M Na'CO^) to stop the reaction. Fluorescence was measured by a fluoremeter (Dyna

Quant™ 200, Hoefer Pharmacia Biotech Inc.) and the enzyme specific activity was calculated.

26 TUNEL Analysis

Tissue samples were taken from the virus inoculated plants. Tissue was vacuum infiltrated for 5 minutes in 4 % paraformaldehyde containing phosphate buffered solution

(PBS pH 6.8), then incubated overnight at 4 °C prior to embedding. Tissue was embedded in cryogel and cryosectioned in thickness of 10 - 16 |im. TUNEL analysis was performed on frozen sections using theIn Situ Cell Death Detection Kit. Fluoroscein

(Boehringer Mannheim, Indianapolis, IN). Fropidium iodide (R & D Systems,

Minneapolis, Minnesota) was used as a counterstain. Sections were viewed using a Zeiss

LSM (Thomwood, NY) confocal microscope. Fluoroscein incorporation was visualized using FITC filter sets and nuclear staining was visualized using PI filter sets.

Assay of Auxin Transport Rate In Virus Inoculated Tissues

Auxin transport assays were performed essentially according to the method of

Okada et al. (1991). Two ecotypes ofArabidopsis, Col-0 and Sei-0, were inoculated with virus when they were 4 weeks old. When symptoms were fully developed on virus inoculated plants (3-4 weeks after inoculation), inflorescence stems were harvested and cut into 2.5 cm segments. In this step, each segment was taken from the same position on each inflorescence and only one segment from each inflorescence was used for the experiment. Each segment was placed in a 1.5 ml eppendorf tube containing 0.5 X MS

(Murashinge and Skoog salt, Gibco Laboratories, Grand Island, NY) medium containing 27 ‘■*C-labeIed lAA (American Radiolabeled Chemicals, Inc., St. Louis, MO, adjusted to a final concentration of 1.75 |xM, 0.1 (iCi/ml). Samples were oriented in normal position to measure nonpolar transport and in inverted orientation to measure polar transport. After

18 hr of incubation at room temperature, each segment was washed with 0.5 X MS medium and 0.5 cm of each segment from the upper end was cut. Each piece was counted in 3 ml of a scintillation cocktail (ScintiVerse, Fisher Scientific, Fair Lawn, NJ) usina a scintillation counter.

Results

Symptom Development in BCTV Infected Arabidopsis

Infection ofArabidopsis ecotypes of Sei-0 and Col-0 with BCTV-CFH resulted in severe symptoms within two weeks. Inflorescence bolts were severely stunted and remained mostly undeveloped, floral organs were malformed, and anthocyanin accumulated in symptomatic tissues (Fig. 2.1 A and B). With BCTV-Logan infection, plants developed distinct symptoms in each ecotype, with a longer latent period than with

BCTV-CFH (Fig. 2.1C and D). Four weeks after viral inoculation, Col-0 developed milder symptoms when compared to infection by BCTV-CFH (Fig. 2. IE). These symptoms included mild stunting of inflorescences, curly tops and gnarled siliques (Fig.

28 2. ID). Sei-0 also developed milder symptoms with BCTV-Logan than with BCTV-CFH but still these symptoms were more severe than those of Logan infected Col-0 (Fig.

2.1C). Inflorescence stems of BCTV-Logan infected Sei-0 were severely swollen and developed callus-like structures (Fig. 2. IF). In some cases, new leaf-like structures were formed on these calluses (Fig. 2.1G).

Expression Patterns of Cell Cycle Genes and an Auxin-up-regulated Gene in Virus-

Infected Plants.

It was shown in previous studies that death of phloem tissues and activation of extra cell divisions occurred in symptomatic tissue area of BCTV-infected plants (Essau,

1974; Latham et al., 1995; Lee, 1995). The observation of the morphological changes in symptomatic BCTV-infected tissues also showed a strong correlation between the induction of cell division and symptom development (Lee, 1995). Two possible explanations of this induction of abnormal cell division in symptomatic tissues have been proposed (Lee, 1995). Abnormal cell division in symptomatic tissues might be induced directly by virus via activation of the cell division in symptomatic tissues. Alternatively, viral-induced cell division might be indirect due to phloem necrosis and subsequent disruption of hormone transport. To evaluate these possible mechanisms for cell division activation, we studied the expression pattern of two cell-cycle genes and a small

29 Fig. 2.1. Symptoms of BCTV inoculated Arabidopsis. (A) BCTV-CFH infected hypersusceptible ecotype Sei-0. (B) BCTV-CFH infected susceptible ecotype Col-0. (C) BCTV-Logan infected hypersusceptible ecotype Sei-0. Inserted figure is top of inflorescence showing curly top and gnarled siliques. (D) BCTV-Logan infected susceptible ecotype Col-0. Inserted figure is top of inflorescence with gnarled siliques. (E) From left, mock inoculated, BCTV-Logan infected, BCTV-CFH infected susceptible ecotype Col-0. (F) A callus formed on BCTV-Logan infected Sei-0. (G) New leaves formed on top of anthocyanic callus of BCTV-Logan infected Sei-0.

30 Fig. 2.1

31 auxin-up-regulated gene (SAUR). RNA blot analysis showed that the accumulation of both the cdc2 and saur transcript was positively correlated with virus accumulation throughout symptom development (Lee, 1995). However, these results did not allow a precise localization of cell-specific expression and thus do not provide any information concerning whether or not thecdc2 and saur transcripts are expressed in the same cells.

To better define the expression patterns of these genes, we used transgenic Arabidopsis plants (ecotype C24 for CDC2 and CYCI; ecotype RLD for SAUR) expressing reporter genes composed of promoters of the cell cycle genescdc2 and cycl and an auxin-induced saur promoter fused to thegusA gene encoding GUS. GUS activity in plants inoculated with BCTV-Logan and BCTV-CFH varied considerably and was correlated with variations in symptom development between plants (Fig. 2.2). cdc2 and cycl promoter activity in mock inoculated plants was detected primarily in the terminal regions of inflorescence shoot tips where the flower buds are emerging and in roots (Fig. 2.2A and

B; roots not shown). This expression pattern changed dramatically in BCTV-infected plants. Strong histochemical staining was observed in symptomatic regions throughout the inflorescence stem (Fig. 2.2D, E, G, and F). Similar results were obtained when saur promoter activity was examined. In mock inoculated control plants,saiir promoter activity was different from that of CDC2 and CYCI transgenic plants and was limited to the elongating region of the inflorescence stem and in developing flower buds (Fig.

32 CDC2 CYCI SAUR

Fig. 2.2. Histochemical localization of CDC2, CYCI and SAUR promoter activities in transgenic Arabidopsis. Transgenic plants expressing GUS under a CDC2 promoter (A. D and G), a CYCI promoter (B. E and H) and a SAUR promoter (C,F and I) were inoculated with agrobacterium control (A,B and C), BCTV-Logan (D,E and F) and BCTV -CFH (G,H and I), harvested 3weeks after infection and stained with X-gluc.

33 2.2C). No activity was observed in roots. This pattern of expression changed significantly in BCTV-infected plants. Strong histochemical staining was observed in symptomatic tissues, particularly at the termini of the inflorescence branches (Fig. 2.2F and I). The reporter gene expression pattern of virus infected SAUR transgenic plants were similar to that of CDC2 and CYCl transgenic plants and staining in elongation zone of SAUR plants was now diminished.

For a more detailed look at the cell cycle gene promoter activity and auxin- regulated promoter activity in virus inoculated plants, cross-sections of inflorescences were prepared (Fig. 2.3). In mock inoculated plants, the expression level from cell-cycle gene promoters and auxin-up-regulated promoters was minimal in mature tissues. In virus inoculated CDC2, CYCl and SAUR plants showed strong expression in symptomatic tissues. It is clear that the cell-cycle gene promoters and the auxin- regulated promoter are concomitantly activated in symptomatic tissues. To quantify the induction of cell cycle gene promoter and auxin promoter regulated promoter activity in symptomatic tissues, GUS activity was measured quantitatively in symptomatic tissues

(Fig. 2.4). Both CDC2 and SAUR transgenic plants showed a consistent increase in GUS activity in their shoot tips in CFH infected plants throughout a five week experimental period. In the case of CYCl, both CFH and Logan infected plants begins to decline after

34 MOCK LOGAN CFH

Fig. 23. Cross'sections of vims infected and mock inoculated CDC2, CYCl and SAUR trangenicArabidopsis. a,b and c: CDC2 transgenic plants d.e and f: CYCl transgenic plants g,h and I: SAUR transgenic plants a,d and g: mock inoculated plants b,e and h: BCTV-Logan infected plants c,f and I: BCTV-CFH infected plants

35 fourth week. However, the GUS activity in virus infected tissues was much higher than that of mock inoculated plants. GUS activity in roots in these virus infected transgenic plants had somewhat different patterns than that of shoot tips. However, after five weeks of experimental period, virus infected plants had higher GUS activity than mock inoculated plants except for one case - roots of CDC2 Logan infected plants were similar to mock inoculated plants.

Reduced Polar Auxin Transport Rate in Virus Infected Plants

Typical symptoms caused by BCTV onArabidopsis were strikingly similar to phenotypes reported for the auxin transport mutants,pin I and pinoid, ofArabidopsis.

Considered with the results obtained using BCTV-infected SAUR plants, where dramatic changes in auxin dependant expression were observed, it appears that changes in auxin production or transport might be involved in symptom development. Therefore, we conducted an experiment to measure the auxin polar transport rate in virus infected

Arabidopsis to find out if there is any change in auxin polar transport in virus infected plants. To quantify the auxin polar transport rate in virus inoculated plants, radio-labeled lAA was used. There was significant reduction in auxin polar transport in virus

36 Fig. 2.4. Quantification of CDC2, CYCl and SAUR reporter gene activity in virus- infected and mock-inoculated transgenicArabidopsis.

CDC2, CYCl SAUR promoter activity in virus inoculated and mock inoculated transgenic plants were measured by quantitative enzyme activity assays of GUS by a fluorescent assay. Each tissue type - inflorescence top, upper half of inflorescence, bottom half of inflorescence and root- was taken from equivalent parts of mock- inoculated and virus-inoculated plants.

37 CDC2 CYC1

>> > Û 3(A a a (0 3 O

Top Upper Bottom Leaf Root Upper Bottom Leaf Root

Tissue T is s u e

SAUR

5 40 •

<3 20 -

Top Upper Bottom Leaf Root

Tissue

Fig. 2.4.

38 inoculated plants compare to mock inoculated plants both in Sei-0 and Col-0 plants (Fig.

2.5). Another interesting observation from this experiment was that there was a correlation between symptom development and the rate of reduction in auxin polar transport rate. For example, auxin transport in Col-0 plants was inhibited more slowly compared to Sei-0. This correlates with a longer latent period in symptom development in Col-0 plant than in Sei-0 plants. Non-polar transport of auxin was not affected by viral infection in either Sei-0 or Col-0 plants

Programmed Cell Death in Symptomatic Tissues

We have shown that virus infection causes disruption of auxin polar transport in plants and that it is related to structural changes in vascular tissues of symptomatic plants.

In virus-infected plants, vascular tissues are severely collapsed and in some cases form a lacunae where vascular structures have been totally destroyed (Esau, 1978; Lee, 1995).

We postulated that this might be the result of programmed cell death (PCD) triggered by excess viral replication in symptomatic tissues. To test this possibility, we used TUNEL analysis to detect any PCD in symptomatic plants (Fig. 2.6). In mock inoculated plants, we could see the normal dicotyledons plant vascularture pattern (Fig. 2.6A) and no signs of DNA fragmentation in any nuclei - a typical phenomenon of PCD (Fig. 2.6B). With

Logan infected plants, we detected extra cell divisions in phloem

39 Fig. 2.5. Auxin polar transport in virus infected plants. Auxin polar transport rates in virus inoculated plants were measured using radin-laheled TAA (see Materials and Methods). Graph shows amounts of radioactive lAA transported to the upper end of the pieces of Arabidopsis inflorescence after incubation with radioactive lAA for 18 hr. In the legend, A stands for Agrobacterium mock control inoculation, L for BCTV-Logan infected plants, C for BCTV-CFH infected plants. P stands for polar transport, stem pieces were placed in inverted position in radio-labeled lAA containing tubes to measure basipetal polar transport of auxin. N stands for non-polar transport. Stem pieces were placed in normal position to measure non-polar transport.

A. Auxin polar transport rate in virus inoculated and mock inoculated plants 3 weeks after viral inoculation. B. Auxin polar transport rate in virus inoculated and mock inoculated plants 2 weeks after viral inoculation.

40 0 0 (14(3 mniroRSportetlIceaiits/inli) (14C) Iflfl Transported (coints/m ln| I—• »— N> hJ UJ U> ^ U> -Cnot/iQLnOVi hJ fsJ W W O Ui O Cn Q C/1 O ° '1 §— 9— 4— 9— 9— 9- -4- -9- -9- } ig. *

31 V Z Z k - K k W V W W W H -

n i l S 5 i I) Fig. 2.6. TUNEL assays for programmed cell death in virus infected tissues.Plants were infected with virus and symptomatic tissue was harvested, cryosectioned in 10-16 thickness and processed with the In Situ Ceil Death Detection Kit- Fluoroscein (Boehringer Mannheim, Indianapolis, IN). Propidium iodide (R & D Systems, Minneapolis, Minnesota) was used as a counterstain for nuclei.

A and D, Mock inoculated plants; B and E. BCTV Logan infected plants; C and F, BCTV CFH infected plants. A, B and C, propidium iodide stained tissue; D, E, and F, processed using In Situ Cell Death Detection Kit using fluoroscein fluorescence as signal molecule to visualize DNA fragmentation in nuclei of cells undergoing programmed cell death.

42 Fig 2.6

43 parenchyma cells (Fig. 2.6C). In these areas, cells were also going through PCD (Fig.

2.6D). In CFH infected plants, vascular tissues were completely collapsed and large lacuna were found seen (Fig. 2.6E). Cells in the periphery of the lacuna were found to be undergoing PCD (Fig. 2.6F).

Altered Response to Viral Infection o f Auxin-Related Mutants

If symptom development in virus-inoculated plants was really caused by death of phloem and a subsequent disruption of hormone transport as suggested in the previous sections, altered auxin concentration in tissues might be a key factor in development of symptoms in virus infected tissues. To investigate this possibility, we used auxin-related mutants which were originally isolated based on their insensitivity to auxin or an auxin transporter inhibitor. These auxin-related mutants should act differently from wild-type plants upon viral infection if auxin is a primary symptom-inducing factor.

With BCTV-Logan infection, the auxin-related mutants showed a significantly different response compared to infection of wild typeArabidopsis (Table 2.1 and Fig.

2.7). In general, auxin-related mutants showed either no symptoms or significantly milder symptoms. For class I mutants, which are involved in activation of the ubiquitin related protein RUB (a.xrI-3, axrl-12 and tirl), symptoms were very mild upon infection by Logan (compare Fig. 2.7A and B). Occasionally, a little anthocyanin accumulation

44 was seen in the inflorescence of Logan infectedaxrl-12 and mild curling was observed in tirl-1. With the auxin response mutant, axrl, which is insensitive to auxin, it was difficult to detect symptoms because of this mutant’s abnormal phenotype (Fig. 2.7D).

However, more plants accumulated anthocyanins in their inflorescence tips than foraxrl-

12. Finally, the auxin transport mutants,tir3 and aiLxl, also showed significantly reduced symptom development upon infection by BCTV-Logan.aitxl-7 developed milder symptoms than wild-typeArabidopsis but symptoms were slightly more severe than with other auxin mutants (Fig. 2.7C). aiuxl developed milder symptoms than aiuxl-7 in fewer plants. In the case of tir3-l, no symptoms were observed with BCTV-Logan infection, but there were fewer inflorescence bolts in virus infected plants compared to mock inoculated plants (Fig. 2.7E). It was clear that the plant’s intrinsic response to auxin is needed to develop normal symptoms in BCTV-Logan infected plants. If an altered auxin level is not recognized in plants due to their genetic backgrounds, plants failed to develop typical symptoms when infected with BCTV-Logan virus.

BCTV-CFH still induced severe symptoms in auxin-related mutants. In some cases, it was hard to determine symptoms because of the intrinsic abnormal phenotype of the mutant plants. For example, BCTV-CFH infected axrl-12, axr2 and tir3-l lacked typical symptoms such as stunting and severely malformed inflorescences (Fig. 2.7D and

45 Mutants No. of symptomatic plants Symptom severity "

Logan CFH Logan CFH

Col-0 45/45 45/45 2 2 a xrl-3 0/17* 32/32 0 3 axrl-12 5/15 31/31** ** 2** tirl-1 8/15 22/22 0.5 4 aiLxl 3/15 36/36 0.5 3 aiLxl-7 14/18 36/36 1 3 tirS-l 0/18* 22/22 ** axrl 9/12 21/21 ** 2**

Table. 2.1. Infectivity and symptom development in auxin-resistant and auxin- transport mutants of Arabidopsis inoculated with BCTV strains Logan and CFH a: 0. no symptoms 1. mild symptoms - minor leaf curling, mild stunting, slight inflorescence abnormality 2. intermediate symptoms - significant stunting, inflorescence and leaf curling, significant inflorescence abnormality 3. severe symptoms - severe stunting, severe inflorescence curling and abnormality , leaf curling, low levels of accumulation of anthocyanin 4. very severe symptoms - extremely severe stunting , extreme deformation of inflorescence, high levels of anthocyanin accumulation

* : less bolting ** ; no typical symptoms

46 D

# # *

Fig. 2.7. Symptoms caused by BCTV strains Logan and CFH in auxin-related mutants A.of thaliana. In each picture, left: mock-inoculated; center: BCTV-Logan infected; right: BCTV-CFH infected. A. Col-0, wild type; B. aiLxl-7: C. tirl: D. axr2; E. tir3-l

47 E). However, these virus inoculated plants accumulated some anthocyanin and occasionally had small swellings on their inflorescences. Other than these three mutants, all of the auxin-related mutants developed symptoms as severe as seen with wild-type

Arabidopsis (Fig. 2.7B and C). It was clear that BCTV-CFH can overcome the auxin resistance in these mutants.

Our next question in this study was, which step of virus infection requires the intrinsic response of plants to auxin? Is it the symptom development step or is it at an earlier stage such as viral replication and movement? To answer this question, we measured viral DNA accumulation in different organ types -shoot tips, infection origins and roots - of virus infected auxin-related mutants. Viral DNA content in roots and shoot tips of auxin-related mutant plants can give information about the effect of the mutations on viral long distance movement and replication. The amount of viral DNA in their infection origin (center of rosette) can provide information on the mutation effect on viral cell-to-cell movement and replication. With BCTV-Logan infection, viral DNA accumulation in all tissues of the mutant plants is significantly reduced (Fig. 2.8A and B).

For the group I mutants,axrl-3 tissues were almost free of viral DNA in all types of tissues while axrl-12 accumulated less than 20% of the amount of viral DNA compared to wild-type Arabidopsis. tirl-l accumulated less amount of viral DNA than wild-type

Arabidopsis but more than axrl-3 and axrl-12. With the auxin insensitive mutant, axr2,

48 Fig. 2.8. Virai DNA accumulation in auxin-resistant mutants (A) and auxin transport mutants (6) ofArabidopsis infected with BCTV strains of Logan and CFH. Plants were inoculated with virus and harvested 3 weeks after inoculation. Each tissue - shoot tip (S/T in graph), infection origin (I/O) and root (R/T) - was separately harvested and ground to extract DNA. Viral DNA was detected by DNA blot hybridization and quantitated using a Phosphoimager.

49 12000001 ■ Cd-O B AUXt B AUX1-7 Q Axm 1-3 1000000- □ AXR1-12 B AXR2

= 800000 I

< 600000 z o

400000 -

200000

Mock S/T-Logan i/O-togan R/T-Logan S/T-CFH l/O-CFH R/T-CFH

Tissue B.

5000000 1 ■ Col-0 B Tir 1-1 □ Tir 2-2 □ Tir 3-1 4000000 ■ □ Tir3-1/2-2 c o 3 E U3 3000000 ISU < □Z 2000000 a >

1000000

ÈL Mock S/T-Logan i/O-Logan fl/T-Logan Srr-CFH l/O-CFH RTT-CFH

T is s u e

Fig 2.8

50 viral DNA accumulation was considerably reduced - less than 50% of wild type - but considerably more than other mutants. Auxin transport mutantstir3, auxl and aicxl-7 also accumulated significantly less viral DNA in their tissues than did wild-type plants.

With BCTV-CFH infection of auxin-related mutants, accumulation of viral DNA was similar to the accumulation seen with CFH infection of wild-type plants except for axr 1-3 and axr 1-12. These two mutants accumulated less than 20% of the viral DNA seen in wild-type Col-0, in shoot tips and roots. Shoot tips of BCTV-CFH infected auxin-related mutant showed considerably less viral DNA accumulation compared to wild-type plants (Fig. 2.8). But, this difference might be due to unusually high amount of viral DNA in wild-type plants in this specific set of experiments.

Discussion

Plant viruses usually contain small genomes composed of four to ten genes which are essential for their life cycle in the host plant. Even with these simple genomes, viruses manage to replicate, move and cause characteristic symptoms in plants by exploiting intrinsic host machinery. Since each of these steps involves interaction with host factors, investigation of the viral infection process can not only provide a good

51 understanding of the interaction between virus and host, but also can shed light on understanding some intrinsic host processes.

A hypersusceptible ecotype ofArabidopsis, Sei-0, developed callus-like structures on its inflorescence in response to infection by BCTV-Logan. This symptom is unique to

Arabidopsis and has not been reported in any other plant infected with a geminivirus.

This callus-like structure formation could involve altered endogenous hormone level in plant tissues due to phloem disruption. Death of phloem tissue and activation of extra cell division were both observed in symptomatic tissue by microscopic studies. Virus localization studies demonstrated a correlation between the presence of BCTV and the activation of host cell division and death of phloem tissues. Since phloem is a major conducting tissue of nutrients and other organic metabolites in plants, disruption of phloem tissue by BCTV infection is likely to cause changes in the balance of some metabolites and hormones. It has been demonstrated that basipetal auxin transport in

BCTV-infected tomato is inhibited (Smith et al., 1968). In our system, there was a strong correlation between the amount of phloem disruption, changes in auxin transport and the severity of symptoms observed at the whole plant level. BCTV infected Sei-0 showed severe symptoms and a complete disruption of phloem bundles whereas Col-0 showed milder symptoms and more limited phloem disruption. The mechanism of phloem disruption is not clear, but it is likely that virus multiplication and accumulation in nuclei

52 may disrupt cellular functions, resulting in cell death. We have in situ data showing nuclear DNA fragmentation, a characteristic of PDC, in phloem parenchyma tissues flanking lacunae. The fact that auxin transporter mutants, pinl and pinoid, of

Arabidopsis, share significant phenotypic similarity with BCTV infectedArabidopsis, such as curled and oversized top in mature plants, stunted inflorescence stems and malformed floral organs also suggests the possibility of disrupted auxin transport as a cause of symptom development in virus infected plants.

An important aspect of phloem disruption observed in BCTV- infected

Arabidopsis was the induction of cell division within the phloem parenchyma tissues, and in the case of ecotype Sei-0, the induction of cell division in the phloem parenchyma tissues and surrounding cortex cells. Analysis of the expression of GUS reporter gene activity in transgenic plants containing constructs with promoters of the cell cycle genes, cdc2 and rycl and the auxin-induced saur promoter showed thatsaur promoter activity was induced concomitantly with cell cycle gene promoters during BCTV infection.

Histochemical staining for GUS activity showed that cells in the symptomatic tissues at the inflorescence shoot tip of the three transgenic lines exhibited high levels of promoter activity. This strongly suggests that changes in auxin concentration are involved in the induction of cell division in BCTV-infected plants. The kinetics of induction ofsaur, cdc2, and cycl promoters after virus inoculation did not show any clear differences.

53 Thus, the activation of these promoters are tightly linked in symptomatic tissues. RNA blot analysis ofcdc2 and saur transcript accumulation was for the most part consistent with the expression patterns observed in transgenic plants expressing the cdc2 and saur reporter genes (Lee, 1995). Accumulation of both transcripts induced by BCTV infection was similar with respect to both the timing and the magnitude of induction. These studies taken together with the results of the studies described in this chapter clearly demonstrate a strong correlation between auxin-induced gene expression and the activation of cell cycle genes. This suggests that the activation of cell division is caused through an auxin- mediated pathway which is activated by an increase in the local auxin concentration.

All of the information obtained through observation of symptomatic tissues, microscopic studies of internal structures of virus infected plants and expression levels of cell cycle marker genes and auxin regulated gene clearly suggest that disrupted auxin transport through the phloem is a major factor of symptom development in BCTV infected plants. Auxin transport rates of virus infected and mock inoculated plants were measured to determine if auxin transport in virus infected plants is disrupted. Our experiment showed a significant reduction of auxin polar transport in virus infected plants and this reduction occurred simultaneously with symptom development in virus infected plants. This result also adds to the correlation of altered local concentration of auxin and symptom development.

54 Another aspect of symptom development inArabidopsis that may relate to auxin effects is the severe symptoms and callus formation observed in BCTV-infected Sei-0.

These severe symptoms could be caused by the accumulation of higher levels of auxin in the inflorescence shoot tips, due to the massive disruption of phloem observed in this ecotype. In addition, it is possible that Sei-0 is simply more sensitive to changes in auxin concentrations. Tissue culture experiments with auxin and two ecotypes ofArabidopsis stem pieces showed that Sei-0 produced more callus in shorter time than Col-0 in response to plant hormones (Lee, 1995). As described previously, Sei-0 also showed more severe disruption of phloem tissues than Col-0 in symptomatic plants. Therefore, the more severe symptoms in Sei-0 might be due to both factors.

To provide more direct evidence of auxin involvement in symptom development, we used auxin-related mutants which were originally isolated due to their failure to respond to excessive auxin or auxin transporter inhibitor treatment. All of the auxin- related mutants were either asymptomatic or developed significantly milder symptoms than wild-type plants upon infection by BCTV-Logan. This clearly suggests that the intrinsic response of plant to auxin concentration is needed to develop symptoms in

Logan infected plants. To our surprise, CFH, the stronger isolate still managed to develop symptoms in most auxin-related mutants. CFH develops more severe symptoms in a shorter time period than Logan. CFH infection of the hypersusceptible Sei-0 usually

55 results in very small under developed inflorescences or no inflorescence at all, with undifferentiated tissues on symptomatic plants. For infection of auxin related mutants,

CFH did not cause as severe of symptoms as seen with Sei-0 but still caused signs of symptoms such as curly top and anthocyanin accumulation. Despite the significant sequence homology with Logan, CFH might utilize different pathways to infect the host plant or CFH could cause a higher level of auxin transport disruption such that auxin levels rise to a point where the mutations no longer confer resistance. It is also possible that altered auxin might not be the only cause for the symptoms seen in virus infected plants. One open reading frame of virus, C4, was identified as a symptom determinant by virus mutational studies (Stanley et al., 1992a; Stanley et al., 1992b). Transgenic

Arabidopsis which are overexpressing C4 under control of the CaMV 35S promoter showed phenotypes similar to symptoms caused by viral infections such as gnarled siliques, stunted inflorescences, twisted leaves and fused bolts (Buckley and Davis, unpublished data). In addition, novel phenotypes not seen on virus infected symptomatic plants were observed such as bumpy leaves. This bumpy leaf phenotype appears to be caused by extra cell divisions of the socket cells at the base of trichome due to ectopic expression of C4. Similar observations of extra cell divisions by expressing BCTV C4 in transgenic plants were also reported with Nicotiana benthamiana (Latham et al., 1997).

While generating this 35S: L4 transgenic Arabidopsis, some transformants failed to

56 develop to adult plants and developed as callus on plates. Upon transfer to MS plates, these calluses were able to grow in the absence of added hormone (Buckley and Davis, unpublished data). Therefore, the BCTV ORF C4 might play a role in symptom development in virus infected plants by disrupting auxin responses in symptomatic tissues by interfering with host auxin signal transduction pathway. Alternatively, C4 may directly interact with cell cycle regulation.

Using BCTV C4 as a bait in yeast two hybrid system, three different Arabidopsis cDNA clones were isolated (Buckley et al., manuscript in preparation). Two out of these three clones shared significant sequence homology with known proteins and give interesting insight into understanding the interaction between Arabidopsis and BCTV.

One clone is a protein kinase which shares significant homology with Shaggy/zest-white3 in drosophila and glycogen synthase kinase 3 (GSK3) in mammalian systems. These proteins are known to be involved in oncogenesis in mammalian and cell fate decisions in

Drosophila (Hunter, 1997). The second clone encodes a ubiquitin-conjugation enzyme

(E2) like protein. This is interesting because recent studies involving auxin mutants showed that auxin signal transduction occurs via ubiquitin-like pathways. More importantly, this clone only interacts with CFH ORF C4 not with Logan C4. This can provide a clue to explain how CFH and Logan have such a different effect on

Arabidopsis in spite of their high sequence homology. A recent review which tried to

57 explain auxin action at the molecular level proposed two possible sites for auxin’s actual input in a proposed ubiquitin-like protein activated auxin signal pathway. The first site was trimeric E3 enzyme base on studies in yeast, second site was phosphorylation state of target protein (Leyser et al., 1999). BCTV C4 might work in a similar fashion. C4 could interact with a GSK3-like kinase, preventing it from acting on its substrate and keeping auxin-mediated ubiquitination of target protein on. BCTV C4 also might work upstream of this, interacting with an E2 component to keep an auxin mediated pathway turned on all of the time. Only CFH C4 could do latter and therefore, CFH does not require any changes in auxin concentrations as a signal for symptom development.

It is possible an auxin response is needed only to develop symptoms in virus infected plants or it is possible that it is required at an even earlier step such as virus replication or movement. Since BCTV is a DNA virus, the virus needs to infect cells that are undergoing cell division or are in S-phase. If auxin-related mutants are failing to respond to altered auxin concentration to trigger extra cell division, resulting in less division, this might hamper the replication or cell-to-cell movement of BCTV. We measured the accumulation of viral DNA in virus infected tissue of auxin mutants. In

Logan infected auxin mutant plants, there was a significant decrease in viral DNA accumulation compared to wild-type plants. This decrease was universal to shoot tips, infection origins and roots. Therefore, either viral replication or cell-to-cell movement of

58 the virus might be affected rather than long distance movement of virus. In the case of

CFH, the auxin mutants still accumulated viral DNA almost as much as wild-type plants, except for axr 1-3 and axr 1-12. These two mutants with mutations in a gene which encodes the NH, terminal half of El, involved in activation of ubiquitin related protein

RUB, showed significantly reduced levels of viral DNA in shoot tips and roots of infected plants. These two mutants still accumulated nearly as much viral DNA as wild- type plants in their infection origin. This suggests that BCTV-CFH requires AXRl function for its long distance movement. This result also supports our speculation that

CFH protein interacts with a component of the RUB mediated auxin signal transduction pathway to keep this pathway turned on. However, a mutation in TlR l is which supposed to work in the same RUB activation pathway, did not have any effect on CFH movement. However, this might be because the tirl mutant is not a null allele for TlRl gene, since it has just one amino acid substitution of wild-type protein.

This study clearly suggests that a virus-plant system can be used to study regulation of a plant signal transduction pathway. Our observation of BCTV-infected

Arabidopsis suggests that virus induces symptoms in plants not only by causing altered hormone levels in tissues but also by directly disrupting an auxin signal transduction pathway. Recently, many components involved in the auxin signal transduction pathway have been identified by genetic studies of mutant plants and the yeast two hybrid system

59 was used to identify further components (Gray et al., 1999; Leyser et al., 1993; del Pozo et al., 1998; Ruegger et al., 1998). To date, only immediate members of the E3 complex of this pathway have been identified by yeast two hybrid approach. None of the target proteins of ubiquitnation (most likely some type of repressor) have been identified. It is possible that we can identity these downstream members of the auxin-mediated signal transduction pathway using approaches with viral proteins and its plant protein partner such as the GSK3-like kinase. Furthermore, the mechanism of auxin input in auxin signal transduction pathway can be also studied using this virus plant system.

60 CHAPTERS

IDENTinCATION OF THE BEET CURLY TOP VIRUS (BCTV) PROTEIN Cl

PROMOTER REGION

A bstract

The geminivirus, beet curly top virus (BCTV), encodes seven open reading frames (ORFs) from its 3 kb genome. One of these viral ORFs, C l, is known to play an important role in the early stage of viral infection in plants where it functions in the initiation of viral DNA replication. In other geminiviruses, important transcriptional activator elements for the Cl promoter were identified in the intergenic region of the viral genome. In addition. C l is negatively auto-regulated through binding of Cl protein to a

Cl binding site also found in this same intergenic region. In this study, we identified the putative promoter region of BCTV ORE C l using reporter gene fusions in transgenic

Arabidopsis. Unlike other geminivirus, the intergenic region was not sufficient to promote Cl expression in transgenic plants. As the promoter region was extended into

6 1 the coding region of Cl, strong expression of the reporter protein was observed in vascular tissues of transgenic plants even with deletion of intergenic regions or 5’ portions of Cl coding region. This promoter activity specificity is consistent with localization of the virus in virus infected plants. This suggests that important transcriptional activator elements for Cl expression reside in the 3’ portion of Cl coding area itself. Transgenic plants expressing a reporter gene under control of the complete

Cl promoter were inoculated with virus to find out if any viral protein, especially Cl, is down-regulating C 1 expression. Virus inoculated plants did not show any altered pattern of reporter gene expression compared to mock inoculated plants and reporter gene expression level was not reduced in virus infected plants. These results suggest that

BCTV Cl protein does not auto-regulate its own expression and that Cl expression is controlled differently in BCTV compared to other geminiviruses.

Introduction

Geminiviruses are a family of plant viruses with a single-stranded DNA (ssDNA) genome enclosed in a twin icosahedral capsid. This virus family can be divided into three different groups by their plant host range, insect vector and genomic structure

(Lazarowitz, 1992; Rybicki, 1994; Briddon et al., 1995; Van Rogen Morten et al., 1997;

62 Hanley-Bowdoin et al, 1999; Gutierrez, 2000). The first group, the mastreviruses (maize streak virus’), infects monocot plants and is transmitted through leafhopper. This group of viruses contains single-component genomes of 2.5 to 3.0 kb in length. The second group, the curtoviruses (beet curly top virus) is a group of leafhopper transmitted, dicot infecting viruses. This group also has a single-component genome (monopartite). The third group, the begomoviruses (bean golden mosaic virus), is a group of whitefly transmitted, dicot infecting virus. Viruses in this group usually carry two different circular genomes

(bipartite).

Regardless of their group, all geminiviruses share a similar genome structure - a conserved intergenic region which serves as a divergent promoter for virion sense (V, R

(rightward)) Open Reading Frames (ORFs) and complementary sense (C, L (Leftward))

ORFs. Each virus encodes I to 5 different proteins from the complementary sense direction and these are involved in viral DNA replication and symptom development. In the virion sense direction, most viruses encode coat proteins (CP) and movement proteins

(MP). One of the complementary sense proteins. Cl (also known as a Rep, equivalent of

ALl or A C l of begomovirus) is needed for viral replication (Lazarowitz et al., 1989;

Briddon et al., 1989; Etessami et al, 1991; Lazarowitz et al., 1992; Timmermans et al.,

1992; Boulton, 1993). It has also been shown that ALl of TGMV is sufficient to initiate replication of the viral genome in the presence of host proteins (Hanley-Bowdoin et al.,

63 1990). Since Rep is not a replicase. Rep may function by recruiting the host replication machinery. It is known that Rep recognizes and binds to direct repeat of GGATG in

TGMV (Fontes et al., 1994a). It has also been shown that Rep nicks at the cleavage site of the 9 base hairpin structure which is conserved among all geminiviruses to initiate plus strand DNA replication (Heyraud et al., 1993; Laufs et al., 1995; Orozco et al., 1996).

The AG-motif and the CA-motif in this region are also known to be required for viral

DNA replication. Rep is also shown to induce accumulation of a host replication factor, proliferating cell nuclear antigen (PCNA) (Nagar et al., 1995). In biochemical studies.

Rep has been shown to bind to dsDNA (Pontes et al 1992; Fontes et al., 1994a), cleave ssDNA at the hairpin structure (Lauf et al., 1995; Orozco et al., 1996) and to hydrolyze

ATP (Des biez et al., 1995; Orozco et al., 1997) to execute its proposed function of replication initiator. In addition, recent studies have shown that Rep interacts with a retinoblastoma protein (pRb), a regulator of the Gl-S transition of cell division (Ach et al., 1997; Kong et al., 2000). In the case of some animal DNA viruses, it has been known that virus-encoded protein interacts with pRB to induce host cell replication (Lee at al.,

1991; Grada et al., 1993; Labrie et al., 1995; Damania et al., 1996; Ecknet et al., 1996).

Binding to RB is through an LXCXE motif in the virus protein (Ludlow, 1993; Molan,

1993; Vousden, 1993). The Rep of MSV has this motif (Ach et al., 1997). TGMV Rep does not have the LXCXE motif but still is able to bind to plant retinoblastoma proteins

64 (Kong et al., 2000). Considering the function of Rep in the virus life cycle as a replication initiator in virus infected plant cells. Rep should be expressed in plant cells in the early stages of viral infection. The promoter region for Rep overlaps with the replication origin in most geminiviruses. The TGMV promoter, which is the most well characterized geminivirus promoter, contains both a TATA box and G box elements.

Mutation of either of these two elements leads to significant loss of promoter activity

(Eagle and Hanley-Bowdoin, 1997). Promoters of Rep in begomovirus have been studied

using mostly transient systems. In the case of TGMV, ALl (Rep equivalent) is

negatively regulated both by itself and by AL4 (Sunter et al., 1993; Groning et al., 1994).

ALl mediated repression is through ALl binding sites which reside in the ALl promoter

region (Fontes et al. 1994b; Eagle et al., 1997). In ACMV, it has been shown that the

ACl (Rep equivalent) is negatively regulated by itself but not by AC4 (Hong et al.,

1995).

In curtoviruses, expression of Cl (equivalent of Rep) has not been studied in

detail. In this study, we used transgenic Arabidopsis plants expressing Cl promoter:GUS

constructs to observe C 1 expression in plants and its regulation in virus-infected plants.

Our study shows that cw-elements of the promoter reside within the coding region of C 1

and that C l is not negatively regulated by itself.

65 Materials and Methods

Plant Materials

Arabidopsis thaliana ecotype Columbia wild-type plants were grown at 18-22°C,

50-80% relative humidity in a growth chamber with a light cycle of 12 hr of dark and 12 hr of light. Other transgenic plants were grown under same condition once they were transferred to soil from plates. Plants were fertilized as needed.

Construction of BCTV Ll-Promoter:^glucuronidase (GUS) Reporter Gene

Using primers listed in Table. 3.1, specific areas of the BCTV genome were amplified by the Polymerase Chain Reaction (PCR) using virus genomes -pMLogan

(Stenger et al., 1992) and pCFH (Stenger et al., 1990)- as templates. PCR reactions were carried out in a 100 pi reaction mixture containing 2 pi viral genome template (1 ng/pl), one set of virus specific primers (Table. 3.1), 5 units of Taq Platinum® polymerase

(GIBCO ERL, Grand Island, NY), 2 mM Mg^CL and 0.2 mM dNTPs. Amplified fragments were cloned into a T-vector (CAT-T8 vector, made by K. Buckley) and verified by sequencing. Fragments were digested with HindUl and Smal or Hindlll and

BamHI, depending on constructs, and ligated into pBI121 in front of the ^-glucuronidase

66 Name of primer Sequence of primer Restriction site Position in viral genome Logan Pi sceaatccTGGACTCCGATGA BamHI 1-20 CGAGGCT Logan P2 gcagalclTT AT A AGT AC AT AT Bglll 445-416 ACATGTAAAAAAAATG Logan P3(R3) gcagatctTTACACCTCAGTAG Bglll 710-684 CTTCTTCACTTCC Logan P4(L4) gcggatccCTTCTTCCCTGGTC BamHI 2355-2381 TTGAATCACCCTC Logan P5(LI) gc ggatccTT AC AGGGT AG AG BamHI I962-I984 TCACCTTGCG CFH PI gcggatccATTGAATCGGGCT BamHI 1-20 CTCTTCA CFH P2 gcagatctTTATAAGTACATAT Bglll 354-325 ACATGTAAAAATAACG CFH P3 gcagatctCACATCAACATCTT Bglll 159-140 TAGCTTT CFH P4 (L4) 2 CCC 2 tac gTGTTTT ACC AG P 1 BsiWI 2253-2279 CTTGAATCACC CFH P5 (R3) gcccgtacgCGCCTCAGTAGCT BsiWI 618-595 TCTTCACTTCC CFH P6 (El) acccgtacgTCTGAAAGGTCC BsiWI 445-422 CATAAAAGTTCG CFH P7 (E2) 2CCC gtac g A AGGT GT A ITT' AT BsiWI 2835-2858 AGCGAGGAGCT CFH P8 (LI) gcccgtacgCAAGGAAGTTTG BsiWI 1866-1889 ATCTTGCGAGGA

Table.3.1. Primers used to amplify fragments of BCTV sequences from viral genome and their products. * The nucleotide sequences added to 5’ end to generate unique cloning site are indicated with lower case letters. The underlined sequences represent actual restriction site. Numbers indicate their nucleotide numbers in each BCTV genome and followed the definition of Choi and Stenger (1995).

67 Fragments Primers used Amplified area

Logan 1 ^ 5 Logan PI, Logan P2 Logan 1-445

Logan ,. 7 , 0 Logan PI, Logan P3 Logan 1-710 Logan 2355.445 Logan P2, Logan P4 Logan 2355-445 Logan ,962.445 Logan P2, Logan P5 Logan 1962-445 CFH ,.359 CFH PI, CFH P2 CFH 1-359

CFH ,.,5 9 CFH PI, CFH P3 CFH I-I59

CFH ,.6 ,8 CFH PI, CFH P5 CFH 1-6 IS CFH 2253-359 CFH P2, CFH P4 CFH 2253-359

CFH ,_445 CFH PI, CFH P6 CFH 1-445 CFH 2335-359 CFH P2, CFH P7 CFH 2S35-359

CFH 1366-359 CFH P2, CFH PS CFH IS66-359

Table. 3.2. Viral fragments ampllHed to generate viral promoter:GUS fusion

* Numbers indicate their nucleotide numbers in each BCTV genome and followed the definition of Choi and Stenger (1995).

68 gene replacing the 35S promoter. Each construct was confirmed by checking restriction sites. A specific name was given to each construct based on the viral nucleotide numbers that each construct contains in it (refer Table. 3.IB and see Fig. 3.1.). pBII2I plasmids containing viral promotenGUS constructs were mobilized intoAgrobacterium tiimefaciens strain GV3101 by electrophoration at 1.4 KV.

Arabidopsis Transformation

Fi\e-weck-o\d Arabidopsis plants with several inflorescences were used for transformation withAgrobacterium containing viral promotenGUS constructs. Primary inflorescences of plants were cut to encourage formation of multiple inflorescences.

Plants were well watered 1 day prior to transformation. Plants were transformed by dipping aerial parts of plants in MS medium containing Agrobacterium (modified from

Bechtold et al., 1993; Clough and Bent, 1998). For preparation of media.Agrobacterium containing pBI plasmid was sub-cultured in 5 ml LB medium for 1 day and used to inoculate 400 ml LB containing antibiotics (kanamycin and gentamycin). When the bacterial culture reached an ODg^Q of 2.4, bacterial cells were harvested by centrifugation at 5000 rpm for 10 minutes and resuspended to an ODjoo of 0.8 in MS medium containing

B5 vitamin, 5% sucrose and 400 |il per liter Silwet L-77 as a surfactant.

69 Isolation of Transgenic Plants Lines

Individual plants were transformed and seeds were collected from each plant to insure that each isolated line was independent. Seeds were surface sterilized with 100% commercial bleach and 0.03% Triton X-IOO for 8 minutes, then washed with double distilled water 5 to 6 times. Sterilized seeds were plated on MS medium containing 1% sucrose and kanamycin (50 pg/ml) and then placed in a growth chamber. Transformants were transferred to soil and T1 seeds were harvested from each transformant.

Histochemical Analysis of GUS Activity in Transgenic Plants

Plants were harvested, either from plates or from soil, and GUS activity was visualized after incubation with X-gluc following the protocol in Jefferson et al. (1987).

Microscopic Analysis of GUS Activity in Transgenic Plants

After histochemical analysis for GUS activities, plants were kept in sodium phosphate buffer and photographed with a dissection microscope equipped with a digital camera (Olympus, SZH Research Stereo).

70 Viral Infection of Transgenic Plants

BCTV strains Logan and CFH (pMLogan and pMCFH) were provided by Dr. D.

Stenger. Tandemly repeated dimers of infectious virus clones in the binary vector pMON521, were introduced inlo Agrobacterium tiimefaciens strain GV3111 containing pTiB6S3SE (Rogers et al., 1986) by triparental mating (Stenger et al., 1994). At the time of bolting (4-5 week after planting), plants were inoculated with infectious viral DNA by agroinoculation (Stanley et al., 1986; Stenger et al., 1992).

Plasmid Construction of Cl 5' Deletion

Fragments of the 3’ portion of Cl that might contain promoter elements were made by deleting portions of clone 1866-359 as follows. For deletion of nucleotides

2510-2761, the unique Nsil restriction site (at 2510) was changed into Sphl using an adapter oligo of 5’-GCTGCATGCAGCTGCA-3’. After changing the Nsil site to a Sphl site (which also cuts at nucleotide 2761), the plasmid was restricted by Sphl and religated to delete the Sphl fragment. Loss of the Sphl fragment was confirmed by checking the restriction fragment size change. For deletion of nucleotides 2510-31, the unique restriction site Mfel (at 31) was changed to Nsil using the adapter oligo of 5’-

AATTCATGCATG-3’. Sequences from nucleotides 2510-31 was removed by deletion with Nsil, followed by religation. Nucleotides 31-291 were also deleted using similar

71 strategy by changing the Mfel site into Bip I. HindlH-Smai fragments containing a specific deletion were cut and ligated with pBI121-GUS, replacing the 35S promoter as before.

Results

Intergenic Regions of BCTV CFH and Logan are not Sufficient to Drive Cl

Expression in Transgenic Plants

In TGMV, the promoter region for ALl was mapped to the common region

(intergenic region) of the virus genome (Eagle et al., 1994). Deletion studies narrowed the promoter area to the 60 bp upstream of the start of transcription (Eagle and Hanley-

Bowdoin, 1998). To identify the promoter activity of the intergenic region of both BCTV

CFH and Logan, we generated transgenic Arabidopsis lines which contain the intergenic

region fused to a GUS reporter gene (Logan^^;.,:GUS and CFH359 .,:GUS, Fig. 3.1). We used transgenic plants instead of doing a transient cell experiment in order to observe the promoter activity in different tissue types. BCTV is a phloem limited virus and the promoter for BCTV C l should be expressed in this tissue in virus infected plants. To our surprise, the intergenic region of virus was not enough to drive reporter gene expression

72 Fig. 3.1. Schematic illustration of constructs used for expression of reporter genes under viral promoter control. Intergenic region of each virus genome is marked with shaded box and open boxes are coding regions of BCTV. Open reading frames are denoted with solid line arrow. The numbers indicate their nucleotide numbers in each BCTV genome and followed the definition of Choi and Stenger (1995). Each viral genomic pieces of DNA was amplified by PCR using appropriate sets of primers (Table 3.1), verified by sequencing, and ligated into GUS reporter gene in pB II2l in place of 35S promoter. PBII2I plasmids containing fragments viral genome as promoters for GUS reporter gene were mobilized into Agrobacterium and used to generate stable transgenic lines of CI promoter: GUS constructs.

73 A. Logan constructs

ü ü______20224 .04S LSM

C 1(3038-1965) V3(446-710) ► rini70.|6S2^ ra(28Rl-56?i' V2fSl |-82fi>

< ' < — -► C3(l 942-1534) V 1(742-1504)) ►

GUS Logan 4 4 5 .,:GUS < c

GUS Logan 7 io.,:GUS

c GUS Logan 445_23 5 5 :GUS

GUS Logan :GUS < c 445-1962

B. CFH constructs

1415 ,432 HHI Cl (2927-1863) | V31355-622)

C2(2171-1553) ^ 04(2778-2525) V2(431-8H)

^ C3( 1842-1432) VK651-1415) ------► GUS CFH 359_i:GUS

GUS CFH445.,:GUS

GUS CFH gig.pGLIS

GUS CFH 359.2253:GUS < c

GUS CFH 359.1866-^US < c Fig.3.1

74 4

Fig. 3.2. Histochemical localization of early gene promoter activity of viral intergenic region. lO-day-old seedlings were harvested from MS media and incubated with X-gluc as described in text. Seedlings were observed and photographed with dissection microscope (Olympus, SZH research stereo). A) CFH 35 ,.,:GUS construct. B) Logan ^^;.|:GUS construct.

75 in transgenic plants. Transgenic lines of CFH 3j9.,:GUS showed no reporter gene

expression in any tissues (Fig. 3.2A). Transgenic lines of Logan44j.i:GUS showed weak reporter gene expression in roots, shoot apexes and newly developing leaves (Fig. 3.2B).

This weak expression diminished as plants matured (data not shown).

5 ’ Upstream Regions Do Not Contain Cis-Elements That Confer C l Expression In

Transgenic Plants

Since the intergenic region of virus was not sufficient to drive expression of viral

Cl protein in transgenic plants, we extended the putative promoter region into the 5’ upstream region of the virus. To determine if 5’ upstream region of the virus has positive elements that can contribute to expression of Cl, constructs containing the intergenic

region and 5’ upstream region were made (Logan7,o.,:GUS, CFH^^;.,:GUS and CFH^,;.

,:GUS, see Fig. 3.1). Transgenic plants containing these constructs were generated. For

CFH, CFH44J., was made to check the possibility that a positive element resides within the same distance range as for Logan (Logan intergenic region stretches from 1-445 and

CFH intergenic region stretches from 1-359). Adding an additional 8 6 bp onto the 5’ end did not activate reporter gene expression with the CFH construct. Moreover, extending the 5’ upstream region did not activate reporter gene expression for either CFH (CFHeu.

76 Fig. 3 J. Histochemical localization of early gene promoter activity of viral intergenic area and 5’ upstream region in transgenic Arabidopsis plants. Plants were grown on plates for 10 days, stained with X-gluc and observed as described in materials and methods. A) CFH 445.1 :GUS construct. B) CFH 618.1 :GUS construct. C) Logan ;m_i:GUS construct.

77 ,:GUS, Fig. 3.3B) or for Logan (Logan7,o.,:GUS, Fig. 3.3C). In the case of Logan7, 0.

,:GUS, the activity of the reporter gene disappeared with the longer construct (compare

Fig. 3.3B and Fig. 3.3C) suggesting that there might be a negative regulator between

Logan sequences 445 to 710.

The Cl Promoter Extends into the Coding Region of Cl

Neither the intergenic region nor the 5’ upstream region of the virus had detectable promoter activity in plant tissues where Cl would be expected to be expressed.

Since Cl functions as a replication initiator in virus infected cells. Cl should be expressed in virus infected cells before any viral products become abundant in plant cells.

Since BCTV is typically a phloem limited virus, the expression of Cl should be found in vascular tissues. To test whether sequences within Cl itself are required for proper expression of Cl, constructs containing regions of Cl were made and used to generate transgenic plants (see Fig. 3.1). A Logan construct, which including the entire C4 coding

and the N-terminal half of the C l coding region, (Logan^^;.2355 :GUS) only showed promoter activity in the root tip area (Fig. 3.4D). When the constructs were extended to include the C-terminal coding region of Cl (Logan^^,.GUS), the reporter gene expression was seen in the vascular tissues of roots (Fig. 3.4E) and leaves (Fig. 3.4F).

With CFH, the change was more dramatic. Adding an extra 8 6 bp (CFH 35 ^ 2S3;:GUS) or

78 Fig. 3.4. Histochemical localization of C l promoter activity of viral intergenic region and Cl coding region in transgenic Arabidopsis plants. Seedlings were grown on MS media in growth chamber and harvested 10 days after germination. Harvested plants were stained with X-gluc and observed and photographed with a dissection stereo microscope.

A) CFH 359.:s3j;GUS B) CFH 3<9.::j3:GUS C) CFH 359-1S66’GUS D) Logan w^^zGUS

E) Logan ^5 .,962 :GUS F) Logan 445.,962:GUS

79 m

Fig.3.4

80 the entire C4 coding region and Cl N-terminal coding region (CFH359 .2253 :GUS) did not activate reporter gene expression in transgenic plants (Fig. 3.4A and Fig. 3.4B).

However, adding the C-terminal coding region of Cl (CFH3j9.,g66 :GUS) activated reporter gene expression in the vascular tissues of transgenic plants, a region where C l should be expressed in virus infected plants. This pattern was consistent for more than ten independent lines and reporter gene expression was stronger for CFH constructs than for

Logan constructs. It is CFH which is the more virulent of the two viruses and is known to accumulate to higher levels in infected plants (Lee et al., 1994).

Cl Is Not Negatively Controlled By Itself or By Other Virally Encoded Proteins

In other geminiviruses, it has been shown that Cl expression is down regulated by either C l itself or C l and C4 (Sunter et al., 1993; Hong et al., 1995; Eagle et al., 1997).

To find out if Cl is regulated by any viral proteins, we simply inoculated our transgenic lines with CFH and Logan virus. In the case of the late gene promoter, it has been shown that viral infection transactivates expression of late gene products (J. Hur and K. Davis,

Chapter 4). Mock inoculated CFH,g%.359 :GUS and CFH inoculated CFH,a 66 -3M:GUS showed similar patterns of reporter gene expression (Fig. 3.5). Newly formed inflorescences, vascular tissues and roots showed a high level of reporter gene expression. Virus infected plants did not show any reduction of reporter gene expression

81 Fig. 3.5. Reporter gene expression in virus infected and mock inoculated C l promoter reporter gene transgenic plants. Left panel: mock-inoculated transgenic plants; Right panel: virus-infected transgenic plants. A and D: leaf; B and E: flowers; C and F: leaf base.

82 , ,

Fig. 3.5

83 in these tissues. In most cases, virus infected plants showed slightly stronger expression of reporter gene than mock-inoculated plants.

Neither 5 ’ Coding Region o f Cl Nor Intergenic region Is Required for Cl Promoter

Activity

By extending the promoter regions into the coding region of Cl, it was clear that the 3’ coding region of Cl is required for Cl promoter activity in transgenic plants. This result suggested that perhaps Cl could be a positive regulatory factor for its own expression. To find out if the entire Cl coding region and/or the intergenic region are required for Cl promoter activity, deletion constructs derived from the full length constructs were made (Fig. 3.6.1). A 2510-2761:GUS construct was made by deleting

CFH nucleotide 2510-2761 (251 bp) from the full length Cl promoter. A 2510-31:GUS construct was made by deleting CFH nucleotides 2510-2927 and 0-31 (448 bp) from the full length promoter. These two constructs were deleted for part of the 5’ Cl and C4 coding region and showed the same reporter gene expression as full length promoter in transgenic plants (compare Fig. 3.61 A with B and C). The third construct, A 31-

291:GUS, was made by deleting the intergenic region of CFH (31-291, 260 bp). This deletion construct also retained the same promoter activity as the full length promoter in

84 Fig. 3.6. Schematic illustration of CFH C l 5’ deletion constructs used for expression of reporter genes under truncated Cl viral promoter control and the histochemical localization of reporter activity in transgenic plants.

I. C l 5’ deletion truncated promoter construct. The numbers indicate their nucleotide numbers in CFH genome and followed the definition of Choi and Stenger (1995). Deletion construct was made from the full length Cl promoter construct (CFH

359 -1866 -GUS). Numbers in each clones name corresponds to deleted CFH sequences.

II. Hisotochemical localization of truncated C l promoter activity.

A: Full length C l promoter, CFH3 M.is66 :GUS B: A 2510-276I:GUS C: A2510-31:GUS D: A3l-29i:GUS

85 I. 2927/0 1415 1432

CU2927-1863) V3{355-622) -» 02(2170-1652) C4(277&2525) V2(431-811) ► 03(1842-1432) VU651-1415)

NsiipiO) Sphl(^76l) I

C rH M9.i866:GUS (A) 1 (31)

A25lO-276l:GUS (B)

A25lO-3l:GUS(C)

< A3l-29l:GUS(D)

Fig. 3.6

86 transgenic plants (Fig. 3.6. IID). These results show that neither C4 or the 5’ portion of the C l coding regions, nor the intergenic region of CFH is required for C l promoter activity.

Discussion

In this study, we characterized the promoter region of the BCTV protein Cl. The proposed role for C l in virus infection is as a replication initiator. Cl recognizes the replication origin and nicks at a specific sequence to initiate viral genome replication.

Since the virus is found in non-dividing cells, the virus needs to induce synthesis of host

DMA replication enzymes in the early phase of virus infection in order to replicate its genome. It has been speculated that C l is also involved in this process. The fact the ALI of TGMV is able to induce accumulation of the host replication machinery supports the notion that C l also functions in similar manner (Nagar et al., 1995). CI has also been shown to interact with the host protein pRBR, which controls the GI-S transition of the cell cycle (Graft et al., 1996; Xie et al., 1996; Horvath et al., 1998; Liu et al., 1999; Kong et al., 2000).

It has been shown that BCTV generates 4 distinct sized complementary-sense polyadenylated RNA corresponding 4 ORFs (Frischmuth et al., 1993). But, no further

87 information about mechanism of complementary -sense gene expression of BCTV in virus infected plants has been known yet. We used promoter-reporter gene fusion expressing transgenic lines to identify the expression of Cl in plants and identify the promoter elements. The promoter for ALI, which is equivalent to Cl, has been well studied in TGMV (reviewed by Haniey-Bowdoin et ai., 1999). The promoter region of

ALI overlaps with the replication origin. The essential elements for the ALI promoter are Rep binding site, TATA box and G-box. These elements are clustered at the base of the hairpin structure in the common region of TGMV, along with elements required for viral replication (Eagle and Hanley-Bowdoin, 1997). For BCTV, the Cl promoter mapped differently. The result of studies in transgenic plants showed that the common region is not sufficient to direct expression of Cl in tissues where Cl should be expressed

(Fig. 3.2). Neither the CFH nor the Logan common region conferred expression of the reporter gene in vascular tissues where the virus replicates. Our extended constructs which include the common region and 5’ upstream region also did not drive expression of the reporter gene (Fig. 3.3). Constructs encompassing the entire Cl coding region did show expression of the reporter gene in vascular tissues (Fig. 3.4C, E, and F). The expression pattern was consistent in ten independent lines and CFH constructs showed stronger expression and had a more consistent expression pattern in their vascular tissues than did Logan constructs. This expression pattern of reporter genes in transgenic plants

88 remained the same even with deletions in the 5’ portion of the Cl coding region or the intergenic region from the construct (Fig. 3.6. II B, C, and D).

Begomovirus ALI (AGI) promoter studies showed that expression of ALI is self regulated through binding of ALI to the ALI binding site (Sunter et al, 1993; Fontes et al., 1994; Hong et al., 1995; Eagle et al., 1997). Reporter gene expression level of our transgenic plants that contained the full length C l promoter was not reduced upon viral infection (Fig. 3.5). This shows that the Cl promoter of BCTV is controlled differently from that of begomoviruses. In both mock-inoculated plants and virus-inoculated plants, the expression pattern of the reporter gene was the same. Therefore, BCTV Cl does not down-regulate its own expression. On the other hand, expression of C l is controlled by some host protein in a tissue specific manner. All of our transgenic lines with the full- length Cl promoter-reporter gene construct expressed the reporter gene in vascular tissues and not in other tissues. This suggests that there is a promoter element in the coding region of Cl for Cl expression and that this element interacts with a host protein in a tissue specific manner.

Since BCTV encodes four different complementary proteins from a small region of the genome (ca 1.5 kb), most of its ORFs are closely spaced or overlap with each other. A gene for a second complementary sense protein, C2, starts where the full-length

Cl promoter ends. Therefore, there is a possibility that the promoter activity seen with

89 full-length Cl promoter might be due to a C2 promoter. C2, a positional homologue of

TGMV transcriptional activator (TrAP), is not a TrAP functional homologue (Sunter and

Bisaro, 1997). Information about C2 expression in plants and its function is not very clear. To test the possibility that expression from the full length Cl construct is due to a

C2 promoter, the fusion between the full length Cl fragment and the reporter gene was

made both as a C1:GUS and a C2:GUS transnational fusion. If the previous results with

the C1:GUS fusion are simply due to the presence of a C2 putative promoter, then the

C2:GUS fusion should show a similar expression pattern. The C2:GUS construct showed

no expression of reporter gene activity in transgenic plants. This suggests that C2 expression in plants requires virus-encoded protein. Thus, the expression pattern that we saw with the full-length Cl promoter did not appear to represent expression from a C2 promoter.

In the TGMV ALI promoter, the Rep binding site is located upstream of the

TATA box and the G-box is located between the TATA box and the conserved hairpin.

In BCTV, repeat sequences similar to Rep binding site of TGMV are located in the same

relative region from the conserved hairpin structure. The Rep binding sites of CFH and

Logan show strain specificity for viral replication with the specificity residing in the aminoterminal of C l (Choi and Stenger, 1996). In TGMV, all of the known host protein

binding cis elements -TATA Box and G-Box - are located between these the Rep binding

90 site and the hairpin structure. For both strains of BCTV, the G-box is located on the other side of the hairpin structure and no conserved TATA box motif was found in the vicinity. All of this, combined with our viral infection study of the C l promoter-reporter transgenic plants, clearly suggests that Cl expression is regulated quite differently from that of the begomovirus. It will be interesting if we can determine if C l of BCTV is interacting with a host protein which is specific to vascular tissues of plants and if this protein is interacting with cell cycle regulating proteins like pRBR. Since BCTV encodes another protein, C4, which is known to be involved in symptom development and the begomovirus equivalent of C4, AC4 and AL4, lacks this function, the Cl proteins of the two virus groups, besides sharing similar functions, might also have functions unique to its group.

91 CHAPTER 4

REGULATION OF BCTV VIRION-SENSE EXPRESSION AND IDENTIFICATION

OF A MOTIF INVOLVED IN VIRAL GENE EXPRESSION IN PLANTS

Abstract

BCTV is a ssDNA virus that causes distinct symptoms such as severe stunting, curly top, anthocyanin accumulation and malformed floral structures Arabidopsis.in The degree and timing of symptom development in virus infected plants is dependent on the

BCTV viral strain used. Infection with BCTV-CFTI results in more severe symptoms with a shorter latent period, compared with infection by BCTV-Logan. Expression of the

CFH and Logan seven open reading frames (ORFs), three rightward virion sense strand

ORFs which are involved in viral movement (late genes) and four leftward complementary sense ORFs which are involved in viral replication (early genes), is driven by a bi-directional promoter. To investigate the activity of the BCTV bi­ directional promoter in respect to late genes in plants upon infection by virus, clones

92 which express the E. coli gene encoding GUS under control of either CFH or Logan

promoter sequences were constructed and used to generate transgenic Arabidopsis plants.

Interestingly, the less virulent strain Logan late gene promoter.GUS construct showed

stronger expression than CFH late gene promoter.GUS construct. The viral promoters

were active in seedlings and in actively dividing tissues such as root tips and apical

meristems. As plants matured, promoter activity diminished. Infection of mature

transgenic plants by virus restored reporter gene expression, especially in transgenic

plants containing Logan virion sense-gene promoter constructs. We identified an

interesting 30 bp motif that is tandemly repeated three times in the Logan promoter but

only once in CFH. Progressive deletion of these repeats resulted in decreased promoter

activity. CFH promoters in which one or two extra copies of this motif were inserted, did

not increase virion sense promoter activity in transgenic plants but increased promoter

activity in the complementary sense direction. Increased expression correlated with the

number of motifs in the promoter area. This motif has been identified as a late conserved

element and is known to be involved in late gene expression via AL2 protein

transactivation. Since BCTV does not appears to have a functional homologue of AL2

and because this motif showed different types of control of transcription in our reporter

gene fusion experiment, we propose that this motif is involved in not only late gene

93 expression but also early gene expression. This control mechanism is different from that seen in the bipartite begomoviruses.

Introduction

Beet curly top virus (BCTV) belongs to a group of viruses with a single-stranded, circular DNA genome enclosed within an icosahedral capsid. This group of viruses infects a wide host range, from monocotyledonous plants to dicotyledonous plants, and causes significant crop losses. Geminiviruses are grouped into three different genera

-mastrevirus, curtovirus and begomovirus- based on their genome structure, insect vector and plant host. This group of viruses is known to transcribe its genome divergently from its intergenic region. Two different strains of BCTV virus -Logan and CFH- used in this study encode four complementary-sense open reading frames (ORFs) and three virion- sense ORFs from their genome. It has been shown that transcription of both complementary sense and virion sense genes start from within the intergenic regions of the virus (Frischmuth et al., 1993). In the complementary sense direction, the virus encodes a replication initiator (Rep, C; Choi et al., 1995; Jupin et al., 1995), a symptom determinant (C4; Stanley et al., 1992; Latham et al., 1997) and two other ORFs, C2 and

C3. C3 is a functional homologue of AL3 of begomovirus which is a replication

94 enhancer (Hormuzdi et al., 1995). However, it has been reported that C2, which is

located in same position as AL2, is not a functional homologue of AL2 (Sunter and

Bisaro, 1997). Neither C2 nor C3 is required for infectivity by virus in most hosts

(Stanley et al., 1992; Hormuzdi et al., 1995). In the virion-sense direction, viruses encode the “late proteins”. They are VI (coat protein), V2 and V3. By mutational

studies, V2 has been shown to be involved in controlling the relative level of single-

stranded DNA and double stranded DNA level (Stanley et al., 1992; Hormuzdi, 1993).

V3 is known to be involved in viral movement. Since the virus encodes so few proteins,

the virus depends on host proteins for a significant portion of its life cycle. Of the viral

proteins only a few proteins are reported to be involved in controlling viral gene

expression. Rep has been reported to negatively regulate its own expression and in some

viruses, AL4 is also involed in Rep expression (Haley et al., 1992; Sunter et al., 1993;

Eagle et al., 1994; Groning et al., 1994; Gladfelter et al., 1997). Expression of coat

protein and BRI of begomoviruses has been shown to be regulated by virus-encoded

AL2 (Haley et al., 1991, Sunter and Bisaro 1991 and 1992). There have been efforts to

identify the c/5-element which is responsible for AL2 transactivation of these genes but

the c/j-element that AL2 specifically bind to has yet to be identified (Noris et al., 1996;

Sung and Coutts, 1996; Sunter and Bisaro, 1997). A c/5-element which is conserved

among gemini virus and is located in the intergenic region of viruses has been proposed as

95 a functional target of AL2 (Ruiz-Medrano et ai., 1999). However, sequence specific binding of AL2 to this motif has not been demonstrated.

In this study, we examined the promoter activity of the intergenic region of BCTV

CFH and Logan virus. For Logan, the intergenic region contained all of the cw-elements necessary to drive virion-sense gene expression in plants and to be transactivated by virus encoded protein. In the case of CFH, the virus required an additional 86 bp of upstream sequence to express virion-sense genes and to be transactivated by virus encoded proteins. Sei-0 transgenic plants containing the intergenic region:GUS constructs were generated and infected to see if different host factors from different ecotypes of plants respond differently for viral promoter function. Strain specificity of transactivation by virus was also tested by infecting transgenic plants with the heterologous virus strain.

We also identified a repeated motif in the intergenic region of the virus. This motif is present as three direct repeats in the Logan intergenic region and only once in the CFH intergenic region. To determine the function of this motif during viral gene expression, we deleted motifs from the Logan intergenic region and inserted additional motifs into the CFH intergenic region. The promoter activity of intergenic regions with fewer or more motifs was observed in transgenic plants and the response of these transgenic plants to infection by virus was determined.

96 Materials and Methods

Plant Materials

Arabidopsis ecotype Columbia wild-type plants were grown at 18-22 °C, 50-80% relative humidity in a growth chamber with a light cycle of 12 hr of dark and 12 hr of light. Other transgenic plants were grown under the same condition once they were transferred from plates to soil. Plants were fertilized as needed.

Construction of BCTV LI promoter:^-glucuronidase (GUS) Reporter Gene

Using primers of Logan FI, P2 and CFH PI, P2 listed in Table. 3.1, intergenic regions of the BCTV genome were amplified by Polymerase Chain Reaction (PCR) using virus genomes -pMLogan (Stenger et al., 1992) and pCFH (Stenger et al., 1990)- as templates. Conditions of PCR reaction were the same as described in Chapter 3.

Amplified fragments were cloned into a T-vector (CAT-T8 vector, made by K. Buckley) and the orientation of the integrated fragments was verified by restriction digestion.

Once a clone with the amplified insert in the correct orientation was identified, the insert was verified by DNA sequencing. Fragments were digested with HindHI and BamHI and ligated into pBI121 in front of the p-glucuronidase gene, replacing the 35S promoter.

Each construct was confirmed by checking restriction sites. PBI121 plasmids containing

97 viral DNA promoter fragments upstream of the (3-glucuronidase gene were mobilized

into Agrobacteriiim tumefaciens strain GV3101 by electrophoration.

Arabidopsis Transformation and Isolation of Transgenic Plant Lines

Transformation ofArabidopsis plants with viral virion-sense promoter :GUS constructs was done as described in Chapter 3. Wild-type Arabidopsis plants were grown in a growth chamber for five weeks and transformed by dipping the aerial part of plants in MS medium containing Agrobactiriiim with the proper pBI121 construct. ‘TO’ seeds from each transformed plant were harvested and plated on kanamycin and gentamycin containing plates to select for transformants. Viable transformants were transferred to soil to collect ‘T l ’ seeds to analyze the reporter gene expression pattern under various condition.

Histochemical Analysis of GUS Activity in Transgenic Plants and Microscopic

Analysis o f GUS Activity in Transgenic Plants

Plants were harvested, either from plates or from soil, and incubated with X-gluc to localize GUS activity following the protocol of Jefferson et al. (1987). GUS stained plants were kept in sodium phosphate buffer and photographed with a dissection microscope equipped with a digital camera (Olympus, S2H Research Stereo).

98 Transactivation of Virion-Sense Gene Promoter by Viral Infection

Transgenic plants with virion sense promoter :GUS reporter gene constructs were infected with BCTV-Logan and BCTV-CFH to see if any virus -encoded protein could transactivate the viral promoter. BCTV strains of Logan and CFH (pMLogan and pMCFH) were provided by Dr. D. Stenger. Tandemly repeated dimers of infectious virus clones in the binary vector pMON52I, were introduced into Agrobacterium tumefaciens strain G V 3111 containing pTiB6S3SE (Rogers et al., 1986; Stenger et al., 1994). L2 and

L3 ORF mutant virus (PCT74, Hormuzdi and Bisaro, 1995) was also used to infect transgenic plants. At the time of bolting (4-5 week after planting), plants were inoculated with infectious viral DNA by agroinoculation (Stanley et al., 1986; Stenger et al., 1992).

Deletion o f Direct Repeat Elements from Logan Intergenic Region

To delete one or two of these direct repeat elements from the wild-type Logan intergenic region, the plasmid containing the intergenic fragment was digested with Apal which exists once in each repeat motif and is not present in the vector sequences (see Fig.

4.4). To remove two elements, the plasmid were digested to completion with Apal and religated. The loss of two elements was verified by a change in restriction fragment size in an acrylamide gel followed by sequencing. To remove only one element, plasmids were partially digested with Apal and re ligated.

99 Clones were screened to find one that had only deleted one repeated element. The loss of one element was also verified by a change in restriction fragment size on an acrylamide gel and sequencing.

Addition of Extra Repeat Element to CFH Intergenic Region.

To add one or two more extra repeat elements to the CFH intergenic region, which normally only contains one element, plasmids containing the CFH intergenic region were digested with restriction enzyme Blpl. The Blpl site is unique to the virus intergenic region and is present only once in the middle of the repeating motif. After cutting the plasmid with Blpl, the synthesized oligos of 5’-CGAGTGGTCCCCACAA

GATTTCTTGTGGGG ACC ACT-3’ and 5 ’ -CG A A ACTTGCTT AGCTTTCTTGTGGGG

ACC ACT-3’ were added and ligated to promote incorporation of an additional motif.

The incorporation of an additional repeat was verified by a change in restriction fragment size on an acrylamide gel, followed by sequencing. Plasmids with one additional repeat motif were subjected to a second insertion round to generate a construct with a total of three tandem motif elements.

100 Construction of Virion Sense Promoter With 5 ’ Upstream Region or V3 Coding

Region.

Using primers in Table 3.1, the virion sense promoter with a 5'upstream region or the V3 coding region were amplified and ligated into pBII21 plasmid. These plasmids were introduced into agrobaterium and the agrobacterium was used to transform plants.

We used the same PCR fragments as described in Chapter 3. In this instance the reporter gene was ligated at the other end of the viral fragments to check virion sense promoter activity instead of complementary sense promoter activity.

Results

Intergenic Region has Virion-Sense Promoter Activity in BCTV-Logan but not in

BCTV-CFH.

It has been shown that the intergenic regions of mastreviruses and begomoviruses contain cw-elements required for expression of virion-sense genes (Fenoll et al., 1988;

Fenoll et al., 1990; Sunter and Bisaro et al., 1997; Ruize-Medrano et al., 1999). To determine if the intergenic region of BCTV is also able to drive virion sense genes, transgenic Arabidopsis plants containing the intergenic region as a promoter for the GUS reporter gene was made (Fig. 4.1). The intergenic regions of Logan and CFH virus were

ICI A. Logan constructs

153-L _ma _L5IM

CK3038-1965) V3(446-710)

C2f2I70-l652) C4(2881-5624) V2(511-826) < ■ -► C3( 1942-1534) V 1(742-1504)) ►

GILS.

B. CFH constructs

2927/0 1415

CK2927-1863) V3(355-622)

C2(2171-1553) €4(2778-2525) V2(431-811) < ------► C3(1842-1432) VK651-1415)

GUS C> Additional 86 bp in -GILS.. VBcoding region

Additional 86 bp in 5’ GUS c > upstream r^ion

Fig. 4.1. Schematic illustration of constructs used for expression of reporter genes under viral promoter control. Shaded boxes represent intergenic region of each virus.

102 Fig. 4.2. Virion-sense promoter activity of intergenic regions of BCTV Logan and CFH. A, Transgenic seedling containing BCTV-Logan intergenic regioniGUS construct. B, Transgenic seedling containing BCTV-CFH intergenic region:GUS construct. C, Transgenic mature plant containing BCTV-Logan intergenic regionzGUS construct.

103 amplified by PCR and ligated in front of the GUS reporter gene in virion-sense orientation to see if the intergenic region is able to drive reporter gene expression in plants. Plants with the Logan construct showed strong reporter gene expression pattern

(Fig. 4.2A). This expression was especially strong in the roots and newly developing apical stems. As the plants matured, reporter gene expression diminished (Fig. 4.2C). In the case of CFH, little or no reporter gene expression was seen in transgenic plants.

Transgenic plants with the CFH intergenic region;GUS construct had faint expression of the reporter gene at the apical dome area of the seedlings (Fig. 4.2B) but no activity in any other tissues of the seedling or mature plant. Thus, the CFH intergenic does not promote expression of virion sense genes and Is probably missing some requiredcis- elements.

Transactivation of Virion-Sense Promoter of Logan In Mature Plant By Viral

Infection.

It has been reported that virion-sense genes are regulated by virus-encoded proteins (Sunter and Bisaro, 1991 and 1992; Ruiz-Medrano, 1999). To determine if the virion-sense promoter of BCTV is also transactivated by virus-encoded proteins, transgenic plants with the virion-sense:GUS construct were infected with virus. CFH constructs, which showed little reporter gene expression in seedlings and mature plants,

104 did not show any reporter gene expression in any tissues after viral infection (data not shown). With the Logan intergenic region as virion sense promoter, reporter gene expression was transactivated by viral infection (Fig. 4.3). GUS expression was found in newly forming inflorescence top with flowers (Fig. 4.3A), vascular tissues of stems (Fig

4.3B) and vascular tissues of leaves (Fig. 4.3C). These Logan construct containing transgenic plants also exhibited same transactivation of reporter gene expression even with ORF L2/L3 mutant virus infection (data not shown). The expression pattern was similar to that of virus localization in virus infected plants - BCTV is a phloem limited virus and viral DNA accumulates at the inflorescence top in virus infected plants.

Transactivation Response Domain o f CFH Resides Outside of Intergenic Region

Since the BCTV-CFH intergenic region had little promoter activity for virion- sense gene expression even after infection by virus, we extended the promoter region to identify sequences responsible for promoter activity and transactivation response. We extended the virion-sense promoter to coding region of V3 which added 86 bp (to have same length promoter with Logan constructs) to the intergenic region. Plants containing this construct did not show any promoter activity in transgenic seedlings and were not transactivated by viral infection (data not shown). We also extended virion-sense promoter to 5‘ upstream region of intergenic region and added 86 bp of upstream

105 1

Fig. 4J. Transactivation of virion-sense promoter of Logan by viral infection. A, inflorescence and floral buds. B, stem with axillary bud and cauline leaf. C. close-up of caulin leaf vein. Plants with virion-sense promotenGUS reporter gene constructs were infected with virus and stained with X-gluc 16 days after infection.

106 sequences to intergenic region. Transgenic plants with this construct showed reporter gene expression in their roots and in newly dividing apical stems (Fig. 4.4A). These transgenic plants were inoculated with virus and the reporter gene was transactivated in flowers and roots (Fig. 4.4B and C). However, this transactivation was not as strong as seen for the Logan constructs (Fig. 4.3).

Viral Transactivation of Virion-Sense Gene Expression is not Virus Specific and

Involves Host Factor

In our previous study on viral infection of different ecotypes Arabidopsis,of we have shown that both CFH and Logan virus cause more severe symptoms inArabidopsis ecotype, Sei-0, than in Col-0 (Lee et al., 1994; Chapter 2 in this dissertation). The Logan virion sense promotenGUS construct was used to transform Sei-0 plants to see the viral promoter activity in Sei-0 plants. At the seedling stage, the reporter gene was expressed in roots and newly formed apical stems, as in Col-0 (data not shown). When the transgenic plants were infected with virus, the reporter protein expression was much more intense in Sei-0 plants than in Col-0 (compare Fig. 4.5A to Fig. 4.3.A). One more interesting fact from this experiment was that this transactivation was not virus specific.

The Logan promoter plants can be transactivated after infection by CFH (Fig. 4.5) and vise versa (data not shown).

107 %

Fig. 4.4. Transactivation response domain resides outside of intergenic region of CFH. Transgenic plant with intergenic region and 86nt of upstream sequence of CFH were infected with virus and stained with X-gluc 14 days after infection. A, uninfected seedling of CFH a 3s-359 -GUS seedling. B, flowers of virus infected CFH : 8j5 .35 q:GUS. C, roots of virus infected CFH2835.359 :GUS.

108 Repeated Elements in Intergenic Regions of BCTV Logan and CFH.

In comparing the intergenic regions of Logan and CFH, we found an interesting motif which is directly repeated three times in the Logan virus intergenic region and present only once in the CFH intergenic region (Fig. 4.6). This element is 33 nt long and is located near the virion-sense transcription start site. Part of this repeat matches a known regulatory element in geminiviruses, the Conserved Late Element (CLE;

Arguello-Astorga et al., 1994; Ruiz-Medrano et al., 1999). To find out if these repeated motifs are required for reporter gene expression in Logan transgenic plants seedling or virus infected transgenic plants, the repeated elements were deleted one by one from the

Logan promoter. For virion sense gene expression, as the number of repeated elements was reduced, the expression of reporter gene also decreased (Fig. 4.7 A, B and C; promoters with three, two and one element respectively). As the repeated elements were deleted, the transactivation of reporter gene expression in mature plants was also diminished (data not shown). In the case of complementary sense gene expression, the reduced number of elements did not affect the reporter gene expression level in transgenic seedlings (Fig. 4.7D, E and F; promoters with three, two and one element respectively).

109 s

Fig. 4.5. Arabidopsis ecotype Sei-0 transgenic plants containing Logan-virion sense promoter infected with BCTV-CFH A, Mock inoculated inflorescence top and floral buds. B, Cauline leaf of mock inoculated Sei-0 transgenic plants. C, symptomatic inflorescence top and flower buds. D, symptomatic axillary buds and cauline leaf.

110 CFH Hi2CTÇÇ£CACAaGAAACTTGCTaAGCAAGTTp^

Logan S^GGGCCCCACAGGAAACTTGCTCAGCAAGTTTT

ëf^GGGCCCCACAGGAAACTTGCTCAGCAAGTTTT c^GGGCCCCsCAGGAAACTTGCTCAGCAAGTTTT

Fig. 4.6. Repeated elements in intergenic region of BCTV Logan and CFH. Underlined sequences are known Conserved Late Elements (CLE) found in late gene promoters of gemini virus. Numbers indicate nucleotide number of BCTV-CFH and Logan. Lower case letters are mismatched nucleotides to the repeat motif in the Logan sequence. Phloem specific expression elements (CCA/TGG and CCCC) in RTBV are indicated with italics.

Ill Fig. 4.7. Reporter gene expression of Logan virion-sense and complementary-sense gene promoter;GUS reporter gene constructs with reduced number of the repeated elements in their promoter region. Repeated elements in the Logan promoter region were removed one by one and promoters with fewer repeated elements were used to direct expression of GUS reporter gene in Col-0 transgenic plants. Plants were grown on MS plates and harvested 2 weeks after germination. Harvested plants were stained with X-gluc and photographed with a stereomicroscope equipped with digital camera.

A: Transgenic plants containing virion-sense promoter with original three repeated elements. B: Transgenic plants containing virion-sense promoter with two repeated elements. C: Transgenic plants containing virion-sense promoter with one repeated element D: Transgenic plants containing complementary-sense promoter with original three repeated elements. E: Transgenic plants containing complementary-sense promoter with two repeated elements. F: Transgenic plants containing complementary-sense promoter with one repeated element.

112 B

Fig. 4.7

113 Fig. 4.8. Reporter gene expression of CFH sense and complementary sense gene promoter :GUS reporter gene constructs with extra copies of the repeated elements in their promoter region. Conserved late elements in the CFH promoter region were added to original promoter one by one and promoters with additional of repeated elements were used to direct expression of GUS reporter gene. Plants were grown on MS plates and harvested 2 weeks after germination. Harvested plants were incubated with X- gluc to localize GUS activity and photographed with a stereomicroscope equipped with digital camera.

A: Transgenic plants containing virion-sense promoter with the original one repeated element. B: Transgenic plants containing virion-sense promoter with two repeated elements. C: Transgenic plants containing virion-sense promoter with three repeated element D: Transgenic plants containing complementary-sense promoter with the original one repeated element. E: Transgenic plants containing complementary-sense promoter with two repeated elements. F: Transgenic plants containing complementary-sense promoter with three repeated elements.

114 I '

Fig. 4.8

115 To find out if this motif can enhance the CFH viral intergenic region promoter activity in seedlings or allow a transactivation response in mature plant, one or two additional copies of the repeated motif were added to the CFH virion-sense and

complementary sense promoter. As the repeated elements were added one by one, the

virion-sense gene expression in seedlings increased (Fig. 4.8A, B, and C; with original one motif, two motif, three motif, respectively). However, transgenic plants containing constructs with added motifs were not transactivated when infected with virus (data not

shown). Surprisingly, the complementary-sense promoter showed increased reporter gene expression as more repeated elements were added (Fig. 4.8D, E, and F; with original one motif, two motif and three motif).

Discussion

Geminiviruses encodes several proteins from their divergent promoter. Some of

these proteins are involved in early stages of viral infection, such as replication initiation

while others are involved later stages of the life cycle, such as viral movement. Precise

temporal control of protein expression should be necessary for the virus to replicate and

move to other cells in an efficient manner. Only a few virus encoded proteins -ALI, AL4

116 and AL2- are known to be involved In expression of other virus proteins (Haley et al.,

1991; Sunter and Bisaro, 1991, 1992 and 1997). However, it has been also suggested that host factors play a role in viral gene expression in a tissue specific manner (Sunter and

Bisaro, 1997). In this study, we observed the promoter activity of the intergenic region of two BCTV virus strains for virion-sense gene expression. The intergenic region of Logan had sufficient promoter elements to drive virion-sense gene expression in transgenic plants. However, this promoter driven reporter gene expression diminished as the plant matured. In mature plants, reporter gene expression was restored by viral infection even with L2/L3 mutant virus. This shows that the virion-sense promoter is regulated by a host factor(s) based on the developmental status of the plant and that some virus encoded protein (not L2 or L3) can transactivate promoter in mature tissue. In the CFH genome, we identified a c/^-element present in the 5’ upstream region (86 bp) of the intergenic region, which along with the intergenic region, is required for virion-sense gene expression in seedlings and for transactivation upon infection by virus in mature plants.

In spite of the significant sequence homology between them, it has been reported that

CFH and Logan Rep still show strain specificity for recognition of the origin of replication (Stenger 1994, Choi and Stenger, 1996). In our transactivation experiments by viral infection, transgenic plants with the Logan intergenic region were transactivated by CFH virus and vise versa. Therefore, transactivation of virion-sense gene expression

117 by the virus encoded process in not virus strain specific. Another interesting observation in our viral infection studies of transgenic plants containing the intergenic region:GUS construct was that the hypersusceptible ecotype Sei-0 responded to viral infection stronger than Col-0. This strongly suggests a host factor involvement in transactivation by virus-encoded protein and different host factors may be involved in Sei-0 and Col-0.

In the case of TGMV, the virus-encoded protein AL2 has been shown to transactivate expression of coat protein and BRI in plants (Sunter and Bisaro, 1991, 1992 and 1997).

The fact that no sequence specific binding of AL2 has been reported, suggests that this process might involve (a) host protein(s) which recognize or bind to a cw-element in intergenic region of virus and in turn binds to AL2. In mammalian DNA virus studies, there are several examples of viral transcription factors which do not bind directly to the viral promoter but do so indirectly by binding to a host factor which binds to specific sequences within the viral promoter (reviewed by Martin and Green, 1992).

From our intergenic-region-study, we identified an interesting repeating motif in this region by comparing sequences of the two viruses. This motif is 33 bp long and directly repeated three times in the Logan intergenic region and only once in CFH.

Deletion of this motif from the Logan virus intergenic region resulted in loss of promoter activity in virion-sense protein expression and loss of transactivation by virus encoded proteins. Deletion of this motif did not affect complementary sense gene expression in

118 transgenic plants. This suggests that this motif is not involved in complementary sense gene expression in Logan or alternatively, this motif does function in complementary sense gene expression but two tandem conserved TATA boxes present near the transcription start site of Logan virus can replace this function. To our surprise, addition of more motifs to the CFH intergenic region did not increase virion-sense promoter activity. However, these additional motifs did increase complementary sense promoter activity. These results suggest that the direct repeat motif is involved in expression of viral genes differently for each virus.

This repeated motif includes sequences known as the Conserved Late Element

(CLE), an element which has been identified in late gene promoters of several geminiviruses (Ruiz-Medrano et al., 1999). This sequence has been proposed as a functional target for AL2 transactivation. It has been shown that BCTV C2 is not a functional homologue of AL2 and of the two C2s from BCTV Logan and CFH, only

CFH C2 has the conserved zinc-finger like domain found in AL2. The fact that both

CFH and Logan can transactivate virion-sense gene expression in transgenic plants suggests that the interaction between the viral proteins and the promoter region is not through this zinc-finger like domain. This repeated motif also contains the sequence elements (CCA/TGG and CCCC, see Fig. 4.6) which are needed for phloem specific expression of Rice Tungro Bacilliform Virus (RTBV; Yin and Beachy, 1995; Yin et al.,

119 1997a and b). A host leucine zipper protein which binds to this motif has been identified and this protein was able to stimulate RTBV virus motif dependent transcription in vitro

(Yin et al., 1997b). It will be interesting if the repeated motif in BCTV can be used to identify host proteins that are involved in transcriptional activation of viral genes, in a tissue specific manner.

In summary, we observed virion-sense promoter activity of the viral intergenic region and identified a repeated motif in this region which is possibly involved in viral gene expression in host plants. The expression of reporter gene from this intergenic region was dependant on the host cell type and also regulated by virus-encoded protein

which interact with some unknown host factors.

120 BIBLIOGRAPHY

Ach, R. A., T. Durfee, A. B. Miller, P. Taranto, L. Haniey-Bowdoin, P. C. Zambryski and W. Gruissem (1997).RRBI and RRB2 encode maize retinoblastoma- related proteins that interact with a plant D-type cyclin and geminivirus replication protein. Mol Cell Biol 17(9): 5077-86.

Angell, S. M., C. Davies and D.C. Baulcombe (1996). Cell-to-cell movement of potato virus X is associated with a change in the size-exclusion limit of plasmodesmata in trichome cells of Nicotiana clevelandii. Virology 216(1): 197-201.

Arguello-Astorga, G., L. Herrera-Estreila and R. Rivera-Bustamante(1994a). Experimental and theoretical definition of geminivirus origin of replication.Plant Mol Biol 26(2): 553-6.

Arguello-Astorga, G. R., R. G. Guevara-Gonzalez, L. R. Herrera-Estreila and R. F. Rivera-Bustamante(1994b). Geminivirus replication origins have a group-specific organization of iterative elements: a model for replication.Virology 203(1): 90-100.

Balachandran, S., V. Xiang, C. Schobert, G. A. Thompson and W. J. Lucas (1997). Phloem sap proteins from cucurbita maxima and ricinus communis have the capacity to traffic cell to cell through plasmodesmata.Proc Natl Acad Sci U SA 94(25): 14150-5.

Bechtold, N., Ellis, J., Pelletier, G (1993). In planta Agrobacteriiim gene transfer by infilteration of adult Arabidopsis thaliana Paris, plants. C. R. Acad. Sci. Paris, Life Sciences.

Bennett, C. W. (1971). The curly top disease ofsugarbeet and other St. plants. Paul, Minnesota, Am. Phytopathol. Soc.

121 Bennett, M. J., A. Marchant, H. G. Green, S. T. May, S. P. Ward, P. A. Millner, A. R. Walker, B. Schulz and K. A. Feldmann (1996). Arabidopsis AUXl gene: a permease-like regulator of root gravitropism.Science 273(5277): 948-50.

Bennett, S. R. M., Alvarez, J., Bossinger, G., Smyth, D. R. (1995). Morphogenesis in Pinoid mutants in Arabidopsis thaliana. Plant Journal8(4): 505-520.

Bisaro, D. M. (1996). Geminivirus DNA replication. DNA Replication in Eukaryotic Cells. M. L. DePamphlis. Cold Spring Harbor, Cold Spring Harbor Laboratory Press: 833-854.

Boulton, M. I., Stelnkellner, H., Donson, J., Markham, P. G., King, D. I., Davis, J. W. (1989). Mutational analysis of the virion-sense of maize streak virus.J. o f Gen. Virol. 70: 2309-2323.

Boulton, M. I., King, D. I., Donson, J., and Davies, J. W. (1991). Point substitutions in a promoter-like region and the VI gene affect the host range and symptoms of maize streak virus. Virology 183: 114-121.

Boulton, M. I., C. K. Pallaghy, M. Chatani, S. MacFarlane and J. W. Davies (1993). Replication of maize streak virus mutants in maize protoplasts: evidence for a movement protein. Virology 192(1): 85-93.

Braun, A. C., Laskaris, T. (1942). Tumor formatin by attenuated crown bacteria in the presence of growth promoting substances.Proc Natl Acad SciSA2S: U 468-477.

Briddon, R. W., Markham, P.G. (1995). Geminiviridae. Virus taxonomy: Sixth report o f the International Committee on Taxonomy ofF. Viruses.A. Murphy, Fauquet, C.M., Bishop, D. H. L., Gabrial, S. A., Jarvis, A. W., Martelli, G. P., Mayo, M. A., Summers, M. D. Wien and New York, Springer-Verlag.

Briddon, R. W., J. Watts, P. G. Markham and J. Stanley (1989a). The coat protein of beet curly top virus is essential for infectivity.Virology 172(2): 628-33.

Briddon, R. W., J. Watts, P. G. Markham and J. Stanley (1989b). The coat protein of beet curly top virus is essential for infectivity.Virology 172(2): 628-33.

122 Choi, I. R. and D. C. Stenger (1995). Strain-specific determinants of beet curly top geminivirus DNA replication. Virology 206(2): 904-12.

Choi, I. R. and D. C. Stenger (1996). The strain-specific cis-acting element of beet curly top geminivirus DNA replication maps to the directly repeated motif of the ori.Virology 226(1): 122-6.

Christensen, S. K., N. Dagenais, J. Chory and D. Weigel (2000). Regulation of auxin response by the protein kinase PINOID. Cell 100(4): 469-78.

Citovsky, V. (1993). Probing plasmodesmal transport with plant viruses.Plant Physiol 102: 1071-1076.

Clough, S. J. and A. F. Bent (1998). Floral dip: a simplified method for Agrobacterium- mediated transformation of Arabidopsis thaliana. Plant J16(6): 735-43.

Coello, P., R. Rodriquez, E. Garcia and J. M. Vazquez-Ramos (1992). A DNA polymerase from maize axes: its purification and possible role.Plant Mol Biol 20(6): 1159-68.

Daidoji, H., Y. Takasaki and P. K. Nakane (1992). Proliferating cell nuclear antigen (PCNA/cyclin) in plant proliferating cells: immunohistochemical and quantitative analysis using autoantibody and murine monoclonal antibodies to PCNA.Cell Biochem Fiinct 10(2): 123-32.

Damania, B. and J. C. Alwine (1996). TAP-like function of SV40 large T antigen. Genes Dev 10(11): 1369-81.

Davis, K. R., Schott, E., and Ausubei, F. M. (1991). Virulence of selected phytopathogenic pseudomonads inArabidopsis thaliana. Mol. Plant-Microbe Interact. 2: 477-488. de Vetten, N. C. and R. J. Ferl (1994). Two genes encoding GFI4 (14-3-3) proteins in Zea mays. Structure, expression, and potential regulation by the G-box binding complex. Plant Physiol 106(4): 1593-604.

123 Dekker, E. L., C. J. Woolston, Y. B. Xue, B. Cox and P. M. Mullineaux (1991). Transcript mapping reveals different expression strategies for the bicistronic RNAs of the geminivirus wheat dwarf virus. Nucleic Acids Res 19(15): 4075-81. del Pozo, J. C., Timpte, C., Tan, S., Callis, J., Estelle, M. (1998). The uniquitin-related protein RUBl and auxin response in Arabidopsis. Science 280: 1760-1763.

Derrick, P. M., Baker, H ., Oparka, K. J. (1992).Increase in plasmodesmatal permeability during cell-to-cell spread of tobacco rattle virus from individually inoculated cells. Plant Cell 4: 1405-1412.

Dickinson, V. J., J. Haider and C. J. Woolston (1996). The product of maize streak virus ORF V 1 is associated with secondary plasmodesmata and is first detected with the onset of viral lesions.Virology 220(1): 51-9.

Ding, B., Q. Li, L. Nguyen, P. Palukaitis and W. J. Lucas(1995). Cucumber mosaic virus 3a protein potentiates cell-to-cell trafficking of CMV RNA in tobacco plants. Virology 207(2): 345-53.

Eagle, P. A. and L. Hanley-Bowdoin(1997). cis elements that contribute to geminivirus transcriptional regulation and the efficiency of DNA replication.J Virol 71(9): 6947-55.

Eagle, P. A., B. M. Orozco and L. Hanley-Bowdoin (1994). A DNA sequence required for geminivirus replication also mediates transcriptional regulation.Plant Cell 6(8): 1157-70.

Eckner, R., J. W. Ludlow, N. L. Lill, E. Oldread, Z. Arany, N. Modjtahedi, J. A. DeCaprio, D. M. Livingston and J. A. Morgan (1996). Association of p300 and GBP with simian virus 40 large T antigen. Mol Cell Biol 16(7): 3454-64.

Elmer, J. S., L. Brand, G. Sunter, W. E. Gardiner, D. M. Bisaro and S. G. Rogers (1988). Genetic analysis of the tomato golden mosaic virus. H. The product of the ALI coding sequence is required for replication. Nucleic Acids Res I6(14B): 7043-60.

Esau,K. (1975). Hyperplastic phloem and its plastids in spinach infected with the curly top virus. Amer. J. Sot. 65: 772-783.

124 Etessami, P., J. Watts and J. Stanley (1989). Size reversion of African cassava mosaic virus coat protein gene deletion mutants during infection of Nicotiana benthamiana.J Gen Virol 70(Pt 2): 277-89.

Fenoll, C., Black, D.M. and Howell, S.H. (1988). The intergenic region of maize streak virus contains promoter elements involved in rightward transcription of the viral genome. The EMBO Journal 7(6): 1589-1596.

Fenoll, C., Schwarz, JJ., Black, D.M., Schneider, M., and Howell, S.H. (1990). The intergenic region of maize streak virus contains a GC-rich element that activates rightward transcription and binds maize nuclear factors. Plant Molecular Biology 15: 865-877.

Fontes, E. P., P. A. Eagle, P. S. Sipe, V. A. Luckow and L. Hanley-Bowdoin (1994a). Interaction between a geminivirus replication protein and origin DNA is essential for viral replication. J Biol Cliem 269(11): 8459-65.

Fontes, E. P., H. J. Gladfelter, R. L. Schaffer, I. T. Petty and L. Hanley-Bowdoin (1994b). Geminivirus replication origins have a modular organization.Plant Cell 6(3): 405-16.

Fontes, E. P., V. A. Luckow and L. Hanley-Bowdoin (1992). A geminivirus replication protein is a sequence-specific DNA binding protein. Plant Cell 4(5): 597-608.

Fountain, M. D., Murray, J. A. H., Beck, E. (1999). Isolation of a full a length cDNA encoding a retinoblastoma protein from suspension cultured photoautotrophic Chenopodiiim nibnim L. cells. Plant Physiol 119: 363.

Frischmuth, S., T. Frischmuth, J. R. Latham and J. Stanley (1993). Transcriptional analysis of the virion-sense genes of the geminivirus beet curly top virus.Virology 197(1): 312-9.

Frischmuth, T., Zimmat, G., Jeske, H. (1990). The nucleotide sequence of abutilon mosaic virus reveals prokaryotic as well as eukaryotic features.Virology 178: 461-468.

Frischmuth, T. and J. Stanley (1992). Characterization of beet curly top virus subgenomic DNA localizes sequences required for replication.Virology 189(2): 808-11.

125 Fujiwara, T., Giesman-Cookmeyer, D., Ding, B., Lommei, S.A., Lucas, W.(1993). Cell-to-cell trafficking of macromolecules through plasmodesmata potentiated by the red clover necrotic mosaic virus movement protein.Plant Cell 5: 1783-1794.

Galweiler, L., C. Guan, M. I. A, E. Wisman, K. Mendgen, A. Yephremov and K. Palme(1998). Regulation of polar auxin transport by AtPINl in Arabidopsis vascular tissue [see comments]. Science 282(5397): 2226-30.

Ghoshroy, S., Lartey, R. Sheng, J., Citovsky, V. (1997). Transport of proteins and nucleic acids through plasmodesmata. Annu. Rev. Plant Physiol. Plant Mol. 48: Biol. 27- 49.

Gladfelter, H. J., P. A. Eagle, E. P. Fontes, L. Batts and L. Hanley-Bowdoin (1997). Two domains of the ALI protein mediate geminivirus origin recognition.Virology 239(1): 186-97.

Goodman, R. N., Kiraly, Z., Wood, K.R. (1985). The Biochemistry and physiology of plant disease. University of Missouri Press.

Grafi, G., R. J. Burnett, T. Helentjaris, B. A, Larkins, J. A. DeCaprio, W. R. Sellers and W. G. Kaelin, Jr.(1996). A maize cDNA encoding a member of the retinoblastoma protein family: involvement in endoreduplication.Proc Natl Acad Sci U SA 93(17): 8962-7.

Gray, W. M., J. C. del Pozo, L. Walker, L. Hobble, E. Risseeuw, T. Banks, W. L. Crosby, M. Yang, H. Ma and M. Estelle(1999). Identification of an SCF ubiquitin- ligase complex required for auxin response in Arabidopsis thaliana. Genes Dev 13(13): 1678-91.

Gray, W. M., A. Ostin, G. Sandberg, C. P. Romano and M. Estelle(1998). High temperature promotes auxin-mediated hypocotyl elongation in Arabidopsis.Proc Natl Acad Sci (75 A 95(12): 7197-202.

Groning, B. R., R. J. Hayes and K. W. Buck(1994). Simultaneous regulation of tomato golden mosaic virus coat protein and ALI gene expression: expression of the AL4 gene may contribute to suppression of the ALI gene.J Gen Virol 75(Pt 4): 721-6.

126 Gruda, M. C., J. M. Zabolotny, J. H. Xiao,I. Davidson and J. C. Alwine (1993). Transcriptional activation by simian virus 40 large T antigen: interactions with multiple components of the transcription complex.Mol Cell Biol 13(2): 961-9.

Gutierrez, C. (2000). DNA replication and cell cycle in plants: learning from geminiviruses. Embo J 19(5): 792-9.

Haley, A., X. Zhan, K. Richardson, K. Head and B. Morris (1992). Regulation of the activities of African cassava mosaic virus promoters by the ACl, AC2, and AC3 gene products. Virology 188(2): 905-9.

Hamel, P. A., B. L. Gallie and R. A. Phillips (1992). The retinoblastoma protein and cell cycle regulation.Trends Genet 8(5): 180-5.

Hanley-Bowdoin, L., Elmer, J.S., Rogers, S.G. (1990). Expression of functional replication protein from tomato golden mosaic virus in transgenic tobacco plants.Proc. Natl. Acad. Sci. USA 87: 1446-1450.

Hanley-Bowdoin, L., J. S. Elmer and S. G. Rogers (1989). Functional expression of the leftward open reading frames of the A component of tomato golden mosaic virus in transgenic tobacco plants. Plant Cell 1(11): 1057-67.

Hanley-Bowdoin, L., S. B. Settlage, B. M. Orozco, S. N agar and D. Robertson (1999). Geminiviruses: models for plant DNA replication, transcription, and cell cycle regulation [In Process Citation].CritRev Plant sciences, 18(1): 71-106.

Hartitz, M. D., G. Sunter and D. M. Bisaro (1999). The tomato golden mosaic virus transactivator (TrAP) is a single- stranded DNA and zinc-binding phosphoprotein with an acidic activation domain. Virology 263(1): 1-14.

Herwig, S. and M. Strauss (1997). The retinoblastoma protein: a master regulator of cell cycle, differentiation and apoptosis.Eur J Biochem 246(3): 581-601.

Heyraud, P., V. Matzeit, M. Kammann, S. Schaefer, J. Schell and B. Gronenborn (1993a). Identification of the initiation sequence for viral-strand DNA synthesis of wheat dwarf virus. Embo J 12(11): 4445-52.

127 Heyraud, F., V. Matzeit, S. Schaefer, J. Schell and B. Gronenborn (1993b). The conserved nonanucleotide motif of the geminivirus stem-loop sequence promotes replicational release of virus molecules from redundant copies.Biochimie 75(7): 605-15.

Hofer, J. M., E. L. Dekker, H. V. Reynolds, C. J. Woolston, B. S. Cox and P. M. Mullineaux (1992). Coordinate regulation of replication and virion sense gene expression in wheat dwarf virus. Plant Cell 4(2): 213-23.

Hong, Y. and J. Stanley (1995). Regulation of African cassava mosaic virus complementary-sense gene expression by N-terminal sequences of the replication- associated protein ACl. J Gen Virol 76(Pt 10): 2415-22.

Horm uzdi, S. G. and D. M. Bisaro (1993). Genetic analysis of beet curly top virus: evidence for three virion sense genes involved in movement and regulation of single- and double- stranded DNA levels. Virology 193(2): 900-9.

Hormuzdi, S. G. and D. M. Bisaro (1995). Genetic analysis of beet curly top virus: examination of the roles of L2 and L3 genes in viral pathogenesis.Virology 206(2): 1044-54.

Howarth, A. J., Caton, J., Bossert, M. Goodman, R. M. (1985). Nucleotide sequence of bean golden mosaic virus and a model for gene regulation in geminiviruses. Proc Natl Acad Sci U SA 82(3572-3576).

Hunter, T. (1997). Oncoprotein networks.Cell 88: 333-346.

Huntley, R., S. Healy, D. Freeman, P. Lavender, S. de Jager, J. Greenwood, J. Makker, E. Walker, M. Jackman, Q. Xie, A. J. Bannister, T. Kouzarides, C. Gutierrez, J. H. Doonan and J. A. Murray (1998). The maize retinoblastoma protein homologue ZmRb-1 is regulated during leaf development and displays conserved interactions with G 1/S regulators and plant cyclin D (CycD) proteins.Plant Mol Biol 37(1): 155-69.

Jefferson, R. A., Kavanagh, T. A., Bevan, M. W. (1987). GUS fusions: P- Glucuronidase as a sensitive and versatile gene fusion marker in higher plants. The EMBO Journal 6: 3901-3907.

128 Junghans, H., Melzlaff, M(1990). A simple and rapid methods for the preparation of total plant DNA. Bio Techniques 8: 176.

Jupin, I., F. Hericourt, B. Benz and B. Gronenborn (1995). DNA replication specificity of TYLCV geminivirus is mediated by the amino-terminal 116 amino acids of the Rep protein. FEES Lett 362(2): 116-20.

Klein, R. M. a. L., G. K. K. (1952).Studies on the metabolism of plant neoplasms. V. Auxin as a promoting agent in the transfomation of normal to crown gall tumor cells. Proc Natl Acad Sci U SA 38: 1066-72.

Kong, L. J., B. M. Orozco, J. L. Roe, S. Nagar, S.Ou, H. S. Feller, T. Durfee, A. B. Miller, W. Gruissem, D. Robertson and L. Hanley-Bowdoin (2000). A geminivirus replication protein interacts with the retinoblastoma protein through a novel domain to determine symptoms and tissue specificity of infection in plants [In Process Citation], y 19(13): 3485-95.

Labrle, C., B. H. Lee and M. B. Mathews(1995). Transcription factors RFXl/EF-C and ATF-1 associate with the adenovirus ElA-responsive element of the human proliferating cell nuclear antigen promoter.Nucleic Acids Res 23(18): 3732-41.

Lam, E. W. andN. B. La Thangue (1994).DP and E2F proteins: coordinating transcription with cell cycle progression.Curr Opin Cell Biol 6(6): 859-66.

Latham, J. R., Saunders, K., Pinner, M S., Stanley,(1997). J. Induction of plant cell division by beet curly top virus gene C4. The Plant Journal 11(6): 1273-1283.

Laufs, J., I. Jupin, C. David, S. Schumacher, F. Heyraud-Nltschke and B. Gronenborn (1995a). Geminivirus replication: genetic and biochemical characterization of Rep protein function, a review.Biochimie 77(10): 765-73.

Laufs, J., S. Schumacher, N. Gelsler, L Jupin and B. Gronenborn(1995b). Identification of the nicking tyrosine of geminivirus Rep protein.FEES Lett 377(2): 258- 62.

Laufs, J., W. Traut, F. Heyraud, V. Matzeit, S. G. Rogers, J. Schell and B. Gronenborn (1995c). In vitro cleavage and joining at the viral origin of replication by

129 the replication initiator protein of tomato yellow leaf curl virus.Proc Natl Acad Sci U SA 92(9): 3879-83.

Lazarowitz, S. G., Finder, A. J., Damsteegt, V. D ., Rogers, S. G. (1989). Maize streak virus genes essential for systemic spread and symptom development. The EMBO Journal 8: 1023.

Lazarowitz, S. G. (1992). Geminivirus: genome structure and gene function.Critical reviews in Plant Sciences 11(4): 327-349.

Lazarowitz, S. G. (1999). Probing plant cell structure and function with viral movement proteins. Curr Opin Plant Biol 2(4): 332-8.

Lazarowitz, S. G. and I. B. Lazdins (1991). Infectivity and complete nucleotide sequence of the cloned genomic components of a bipartite squash leaf curl geminivirus with a broad host range phenotype.Virology 180(1): 58-69.

Lee, S. (1995). Genetic and Molecular analysis of interactions betweenArabidopsis and Beet Curly Top Virus. Plant Biologv Department. Columbus, The Ohio State University.

Lee, S., D. C. Stenger, D. M. Bisaro and K. R. Davis (1994). Identification of loci in Arabidopsis that confer resistance to geminivirus infection. Plant J6(4): 525-35.

Lee, W. S., C. C. Kao, G. O. Bryant, X. Liu and A. J. Berk (1991). Adenovirus El A activation domain binds the basic repeat in the TATA box transcription factor. Cell 67(2): 365-76.

Leyser, H. M., C. A. Lincoln, C. Timpte, D. Lammer, J. Turner and M. Estelle (1993). Arabidopsis auxin-resistance gene AXRl encodes a protein related to ubiquitin- activating enzyme El. Nature 364(6433): 161-4.

Leyser, O. and T. Berleth (1999). A molecular basis for auxin action [see comments]. Semin Cell Dev Biol 10(2): 131-7.

Liu, H., M. I. Boulton and J. W. Davies (1997). Maize streak virus coat protein binds single- and double-stranded DNA in vitro. J Gen Virol 78(Pt 6): 1265-70.

130 Liu, L., M. S. Pinner, J. W. Davies and J. Stanley (1999a). Adaptation of the geminivirus bean yellow dwarf virus to dicotyledonous hosts involves both virion-sense and complementary-sense genes. J Gen Virol 80(Pt 2): 501-6.

Liu, L., K. Saunders, C. L. Thomas, J. W. Davies and J. Stanley (1999b). Bean yellow dwarf virus RepA, but not rep, binds to maize retinoblastoma protein, and the virus tolerates mutations in the consensus binding motif. Virology 256(2): 270-9.

Liu, Y., D. J. Robinson and B. D. Harrison (1998). Defective forms of cotton leaf curl virus DNA-A that have different combinations of sequence deletion, duplication, inversion and rearrangement. J Gen Virol 79(Pt 6): 1501-8.

Lucas, W. J. (1995). Plasmodesmata: intercellular channels for macromolecular transport in plants. Curr Opin Cell Biol 7(5): 673-80.

Lucas, W. J., Balachandran, S., Park, J., Wolf, S. (1996). Plasmodesmal companion cell-mesophyll communication in the control over carbon metabolism and phloem transport: insights gained from viral movement proteins.Journal of Experimental Botany 47: 1119-1128.

Lucas, W. J., S. Bouche-Pillon, D. P. Jackson, L. Nguyen, L. Baker, B. Ding and S. Hake (1995). Selective trafficking of KNOTTED 1 homeodomain protein and its mRNA through plasmodesmata [see comments].Science 270(5244): 1980-3.

Lucas, W. J. a. G., R. L. (1994). Plasmodesmata in relation to viral movement within leaf tissues. Annu. Rev. Phytopathol 32(387-411).

Lucy, A. P., Boulton, M. L, Davies, J. W. Maule, A. J. (1996). Tissue specificity of Zea mays infection by maize streak virus. Mol. Plant-Microbe Interact. 22-31. 9:

Ludlow, J. W. (1993). Interactions between SV40 large-tumor antigen and the growth suppressor proteins pRB and p53. Faseb J 7{i0): 866-71.

Marchant, A., J. Kargul, S. T. May, P. Muller, A. Delharre, C. Perrot-Rechenmann and M. J. Bennett (1999). AUXl regulates root gravitropism in Arabidopsis by facilitating auxin uptake within root apical tissues. Embo J 18(8): 2066-73.

131 Martin, K. J., Green, M. R. (1992). Transcriptional activation by viral immediate early proteins: Variations on a common theme.Transcriptional Regulation. K. R. Y. S. L. McKnight. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory Press: 695-725.

Martinez, M. C., J. E. Jorgensen, M. A. Lawton, C. J. Lamb and P. W. Doerner (1992). Spatial pattern of cdc2 expression in relation to meristem activity and cell proliferation during plant development. Proc Natl Acad Sci U SA 89(16): 7360-4.

Matthews, R. E. F. (1991). Plant virology. New York, Academic Press, Inc.

McLean, B. G., F. D. Hempei and P. C. Zambryski (1997). Plant intercellular communication via plasmodesmata.Plant Cell 9(7): 1043-54.

Mezitt, L. A. and W. J. Lucas (1996). Plasmodesmal cell-to-cell transport of proteins and nucleic acids. Plant Mol Biol 32(1-2): 251-73.

Moran, E. (1993). Interaction of adenoviral proteins with pRB and p53.Faseb J 7(10): 880-5.

Mullineaux, P. M., J. E. Rigden, I. B. Dry, L. R. Krake and M. A. Rezaian (1993). Mapping of the polycistronic RNAs of tomato leaf curl geminivirus.Virology 193(1): 414-23.

Murray, J. A. H. (1997). The retinoblastoma protein is in plants!Trends Plant Sci. 2: 82-84.

Nagar, S., T. J. Pedersen, K. M. Carrick, L. Hanley-Bowdoin and D. Robertson (1995). A geminivirus induces expression of a host DNA synthesis protein in terminally differentiated plant cells. Plant Cell 7(6): 705-19.

Nakagami, H., M. Sekine, H. Murakami and A. Shinmyo (1999). Tobacco retinoblastoma-related protein phosphorylated by a distinct cyclin-dependent kinase complex with Cdc2/cyclin D in vitro. Plant J18(3): 243-52.

Nevins, J. R. (1992). E2F: a link between the Rb tumor suppressor protein and viral oncoproteins.Science 258(5081): 424-9.

132 Noris, E., I. Jupin, G. P. Accotto and B. Gronenborn (1996). DNA-binding activity of the C2 protein of tomato yellow leaf curl geminivirus.Virology 217(2): 607-12.

Noueiry, A. O., W. J. Lucas and R. L. Gilbertson (1994). Two proteins of a plant DNA virus coordinate nuclear and plasmodesmal transport. Cell 76(5): 925-32.

Okada, K., Ueda, J., Komaki, M.K., Beil, C J., Shimura, Y (1991). Requirement of the auxin polar transport system in early stages ofArabidopsis floral bud formation. Plant Cell 3: 677-684.

Oparka, K. J., D. A. Prior, S. Santa Cruz, H. S. Padgett and R. N. Beachy (1997). Gating of epidermal plasmodesmata is restricted to the leading edge of expanding infection sites of tobacco mosaic virus (TMV).Plant J12(4): 781-9.

Orozco, B. M., H. J. Gladfelter, S. B. Settlage, P. A. Eagle, R. N. Gentry and L. Hanley-Bowdoin (1998). Multiple cis elements contribute to geminivirus origin function. Virology 242(2): 346-56.

Orozco, B, M. and L. Hanley-Bowdoin (1996). A DNA structure is required for geminivirus replication origin function.J Virol 70(1): 148-58.

Padidam, M., S. Sawyer and C. M. Fauquet (1999). Possible emergence of new geminiviruses by frequent recombination. Virology 265(2): 218-25.

Pascal, E., A. A. Sanderfoot, B. M. Ward, R. Medville, R. Turgeon and S. G. Lazarowitz (1994). The geminivirus BRI movement protein binds single-stranded DNA and localizes to the cell nucleus. Plant Cell 6(7): 995-1006.

Pegg, G. R. (1976). Endogenous auxins in healthy and diseased plants. Encyclopedia of plant physiology new series. R. Heitetuss, Williams, P.M. Berlin, Springer-Verlag. 4: 369.

Petty, I. T., Coutts, R. H., Buck, K. W. (1988). Transcriptional mapping of the coat protein gene of tomato golde mosaic virus. /.o f Gen. Virol. 69: 1359-1365.

Poirson, A., A. P. Turner, C. Giovane, A. Berna, K. Roberts and T. Godefroy- Colburn (1993). Effect of the alfalfa mosaic virus movement protein expressed in transgenic plants on the permeability of plasmodesmata. / GenVirol 74(Pt 11): 2459-61. 133 Pooma, W. and I. T. Petty (1996). Tomato golden mosaic virus open reading frame AL4 is genetically distinct from its C4 analogue in monopartite gemini viruses.J Gen W ro/77(Pt8): 1947-51.

Rogers, S. G., Horsch, R. B., and Fraley, R. T. (1986). Gene trasfer in plants: Production of transformed plants using Ti plasmid vectors. In Methods in Enzymology. A. Weissbach, Weissbach, H. New York, Academic Press, Inc. 118: 627-640.

Ruegger, M., E. Dewey, W. M. Gray, L. Hobbie, J. Turner and M. Estelle (1998). The TIRl protein of Arabidopsis functions in auxin response and is related to human SKP2 and yeast grrlp. Genes Dev 12(2): 198-207.

Ruegger, M., E. Dewey, L. Hobbie, D. Brown, P. Bernasconi, J. Turner, G. Muday and M. Estelle (1997). Reduced naphthylphthalamic acid binding in the tir3 mutant of Arabidopsis is associated with a reduction in polar auxin transport and diverse morphological defects.Plant Cell 9(5): 745-57.

Rulz-Medrano, R., R. G. Guevara-Gonzalez, G. R. Arguello-Astorga, Z. Monsalve- Fonnegra, L. R. Herrera-Estrella and R. F. Rivera-Bustamante (1999). Identification of a sequence element involved in AC2-mediated transactivation of the pepper huasteco virus coat protein gene. Virology 253(2): 162-9.

Rushing, A. E., Sunter, G., Gardiner, W. E., Dute, R.R., Bisaro, D. M. (1987). Ultrastructural aspects of tomato golden mosaic virus infection in tobacco. Phytopathology 77: 1231-1236.

Rybicki, E. P. (1994). A phylogenetic and evolutionary justification for three genera of Geminiviridae. Arch Virol 139(1-2): 49-77.

Sanderfoot, A. A., D. J. Ingham and S. G. Lazarewitz (1996). A viral movement protein as a nuclear shuttle. The gemini virus BRI movement protein contains domains essential for interaction with ELI and nuclear localization.Plant Physiol 110(1): 23-33.

Saunders, K., A. Lucy and J. Stanley (1991). DNA forms of the geminivirus African cassava mosaic virus consistent with a rolling circle mechanism of replication.Nucleic Acids Res 19(9): 2325-30.

134 Schalk, H. J., V. Matzeit, B. Schiller, J. Schell and B. Gronenborn (1989). Wheat dwarf virus, a geminivirus of graminaceous plants needs splicing for replication. Embo J 8(2): 359-64.

Sheng, J., R. Lartey, S. Ghoshroy and V. Citovsky (1998). An Arabidopsis thaliana mutant with virus-inducible phenotype. Virology 249(1): 119-28.

Sindelar, L. a. S., M. (1994). Effect of 2,4-dichlorophenoxyacetic acid on tobacco mosaic virus multiplication in tobacco protoplasts and leaf discs.J. Plant Physiol. 144: 620-622.

Smith, S. H., McCall, S.R., Harris, J.H. (1968). Auxin transport in Curly Top Virus- infected tomato. Phytophysiology 58: 1669-1670.

Staiger, C. and J. Doonan (1993). Cell division in plants. Ciirr Opin Cell Biol 5(2): 226-31.

Stanley, J., Gay, M. R. (1983). Nucleotide sequence of cassava latent virus DNA replication. Nature 301: 2660-2662.

Stanley, J., Markham, P.G., Callis, R.J., and Pinner, M S. (1986). The nucleotide sequence of an infectious clone of the genimi virus beet curly top virus.The EMBO Journal 5(8): 1761-1767.

Stanley, J. (1995). Analysis of African cassava mosaic virus recombinants suggests strand nicking occurs within the conserved nonanucleotide motif during the initiation of rolling circle DNA replication.Virology 206(1): 707-12.

Stanley, J. and J. R. Latham (1992a). A symptom variant of beet curly top geminivirus produced by mutation of open reading frame C4. Virology 190(1): 506-9.

Stanley, J., J. R. Latham, M. S. Pinner, I. Bedford and P. G. Markham (1992b). Mutational analysis of the monopartite geminivirus beet curly top virus.Virology 191(1): 396-405.

Stenger, D. C., Carbonaro, D., and Duffus, J.E. (1990). Genomic characterization of phenotypic variants of beet curly top virus.J. o f Gen. Virol. 71: 2211-2215.

135 Stenger, D. C., Davis, K.R. and Bisaro, D M. (1992). Limited replication of Tomato Golden Mosaic Virus DNA in expiants of nonhost species.Mol. Plant-Microbe Interact. 5(6): 525-527.

Stenger, D. C. (1994). Complete nucleotide sequence of the hypervirulent CFH strain of beet curly top virus. Mol Plant Microbe Interact 7(1): 154-7.

Stenger, D. C., K. R. Davis and D. M. Bisaro (1994). Recombinant beet curly top virus genomes exhibit both parental and novel pathogenic phenotypes.Virology 200(2): 677- 85.

Stenger, D. C., G. N. Revington, M. C. Stevenson and D. M. Bisaro (1991). Replicational release of geminivirus genomes from tandemly repeated copies: evidence for rolling-circle replication of a plant viral DNA.Proc Natl Acad Sci U SA 88(18): 8029-33.

Sudarshana, M. R. and P. H. Berger (1998). Nucleotide sequence of both genomic RNAs of a North American tobacco rattle virus isolate.Arch Virol 143(8): 1535-44.

Sung, Y. K. and R. H. Coutts (1995). Pseudorecombination and complementation between potato yellow mosaic geminivirus and tomato golden mosaic geminivirus.J Gen Viron6(Pl 11): 2809-15.

Sung, V. K. and R. H. Coutts (1996). Potato yellow mosaic geminivirus AC2 protein is a sequence non-specific DNA binding protein. FEBS Lett 383(1-2): 51-4.

Sunter, G., Gardiner, W. E., Bisaro, D. M. (1989a). Identification of tomato golden mosaic virus-specific RNAs in infected plants. Virology 170: 243-250.

Sunter, G. and D. M. Bisaro (1989b). Transcription map of the B genome component of tomato golden mosaic virus and comparison with A component transcripts.Virology 173(2): 647-55.

Sunter, G. and D. M. Bisaro (1991). Transactivation in a geminivirus: AL2 gene product is needed for coat protein expression. Virology 180(1): 416-9.

136 Sunter, G. and D. M. Bisaro (1992). Transactivation of geminivirus ARl and BRI gene expression by the viral AL2 gene product occurs at the level of transcription.Plant Cell 4(10): 1321-31.

Sunter, G. and D. M. Bisaro (1997). Regulation of a geminivirus coat protein promoter by AL2 protein (TrAP): evidence for activation and derepression mechanisms. Virology 232(2): 269-80.

Sunter, G., M. D. Hartitz and D. M. Bisaro (1993). Tomato golden mosaic virus leftward gene expression: autoregulation of geminivirus replication protein.Virology 195(1): 275-80.

Timmermans, M. C., O. P. Das and J. Messing (1992). Trans replication and high copy numbers of wheat dwarf virus vectors in maize cells. Nucleic Acids Res 20(15): 4047-54.

Timpte, C., A. K. Wilson and M. Estelle (1994). The axr2-l mutation of Arabidopsis thaliana is a gain-of-function mutation that disrupts an early step in auxin response. Genetics 138(4): 1239-49.

Townsend, R., Stanley, J., Curson, S. J., Short, M. N. (1985). Major polyadenylated transcripts of cassava latent virus and location of the gene encoding coat protein.The EMBO Journal 4: 33-37. van Loon, L. C., van Kooten, O., Linders, E. G. A., Meurs, C., and Wijdeveld, M. M. G. (1990). Recognition and disease development in the tobacco-TMv system.In Recognition and Response in plant-vinis Interaction. R. S. S. Fraser. Berlin (Germany), Springer-Verlag: 311-328.

Van Regenmortel, M. H., D. H. Bishop, C. M. Fauquet, M. A. Mayo, J. ManilofF and C. H. Calisher (1997). Guidelines to the demarcation of virus species [news].Arch Virol 142(7): 1505-18.

Vaquero, C., A. P. Turner, G. Demangeat, A. Sanz, M. T. Serra, K. Roberts and I. Garcia-Luque (1994). The 3a protein from cucumber mosaic virus increases the gating capacity of plasmodesmata in transgenic tobacco plants.J Gen Virol 75(Pt 11): 3193-7.

Vousden, K. (1993). Interactions of human papillomavirus transforming proteins with the products of tumor suppressor genes.Faseb 7 7(10): 872-9. 137 Waigmann, E., W. J. Lucas, V. Citovsky and P. Zambryski (1994). Direct functional assay for tobacco mosaic virus cell-to-cell movement protein and identification of a domain involved in increasing plasmodesmal permeability. Proc Natl Acad Sci U SA 91(4): 1433-7.

W ard, B. M., R. Medvilie, S. G. Lazarowitz and R. Turgeon (1997). The geminivirus ELI movement protein is associated with endoplasmic reticulum-derived tubules in developing phloem cells. J Virol 71(5): 3726-33.

Whenham, R. J. a. F., R. S. S. (1990). Recognition and disease development in the tobacco-TMV system.In Recognition and Response in plant-vinis interaction. R. S. S. Fraser. Berlin (Germany), Springer-Verlag: 287-310.

Wolf, S., Deom, C.M., Beachy, R.N., Lucas, W. J. (1989). Movement proteins of tobacco mosaic virus modifies plasmodesmatal size exclusion limit.Science 246: 377- 379.

Wolf, S., Lucas, W. J. (1994). Virus movement proteins and other molecular probes of function. Plant, Cell and Environment 17: 573-585.

Wright, E. A., T. Heckel, J. Groenendijk, J. W. Davies and M. I. Boulton (1997). Splicing features in maize streak virus virion- and complementary-sense gene expression. P la n ts 12(6): 1285-97.

Xie, Q., A. P. Sanz-Burgos, G. J. Hannon and C. Gutierrez (1996). Plant cells contain a novel member of the retinoblastoma family of growth regulatory proteins.Embo J 15(18): 4900-8.

Yeoman, M. M. (1970). Early development in callus cultures.Int. Rev. Cytol 29: 383- 409.

Yin, Y. and R. N. Beachy (1995). The regulatory regions of the rice tungro bacilliform virus promoter and interacting nuclear factors in rice (Oryza sativa L.).Plant J7(6): 969- 80.

Yin, Y., L. Chen and R. Beachy (1997). Promoter elements required for phloem- specific gene expression from the RTBV promoter in rice.Plant J12(5): 1179-88. 138 Yin, Y., Q. Zhu, S. Dai, C. Lamb and R. N. Beachy (1997). RF2a, a bZIP transcriptional activator of the phloem-specific rice tungro bacilliform virus promoter, functions in vascular development. Embo J 16(17): 5247-59.

Zhan, X., K. A. Richardson, A. Haley and B. A. Morris (1993). The activity of the coat protein promoter of chloris striate mosaic virus is enhanced by its own and C1-C2 gene products. Virology 193(1): 498-502.

Zhan, X. C., A. Haley, K. Richardson and B. Morris (1991). Analysis of the potential promoter sequences of African cassava mosaic virus by transient expression of the beta- glucuronidase gene. J Gen Virol 72(Pt 11): 2849-52.

139