(ABC) Transport System Involved in Nucleoside Uptake in Mycoplasma Bovis Strain M23, and Discovery of Its Pathogenicity Genes Nakhyung Lee Iowa State University

Iowa State University Capstones, Theses and Graduate Theses and Dissertations Dissertations

2009 Characterization of an ATP-binding cassette (ABC) transport system involved in nucleoside uptake in Mycoplasma bovis strain M23, and discovery of its pathogenicity genes Nakhyung Lee Iowa State University

Follow this and additional works at: https://lib.dr.iastate.edu/etd Part of the Veterinary Preventive Medicine, Epidemiology, and Public Health Commons

Recommended Citation Lee, Nakhyung, "Characterization of an ATP-binding cassette (ABC) transport system involved in nucleoside uptake in Mycoplasma bovis strain M23, and discovery of its pathogenicity genes" (2009). Graduate Theses and Dissertations. 10807. https://lib.dr.iastate.edu/etd/10807

This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Characterization of an ATP-binding cassette (ABC) transport system involved in nucleoside uptake in Mycoplasma bovis strain M23, and discovery of its pathogenicity genes

Nakhyung Lee

A dissertation submitted to the graduate faculty

in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

Major: Veterinary Microbiology

Program of Study Committee: Ricardo F. Rosenbusch, Major Professor Bryan Bellaire Walter Hsu Brett Sponseller Michael Wannemuehler

Iowa State University

Ames, Iowa

2009

TABLE OF CONTENTS

ABSTRACT iv

CHAPTER 1. GENERAL INTRODUCTION 1 Introduction 1 Accomplishements in this study 2 Dissertation Organization 2 Literature Review 3 Mollicutes 3 Genome of mycoplasmas 3 Growth requirements of mycoplasmas 4 Pathogenesis of mycoplasmal diseases 5 Mycoplasma bovis 8 Pathogenesis of M. bovis diseases 9 Nucleotide metabolism 11 Nucleotide synthesis by de novo pathway 11 Salvage pathway for nucleotide synthesis 12 Nucleotide metabolic pathways in Mollicutes 13 ATP-binding cassette (ABC) transport systems 14 Biological roles of ABC transport systems 15 ABC transporters in Mollicutes 15 Implication of ABC transporters in Mollicutes 17 Gene inactivation in Mollicutes 18 Gene transfer in Mollicutes 18 Transposons 19 Approaches for gene inactivation in Mollicutes 20 Literature cited 21

CHAPTER 2. GENOME CHARACTERIZATION OF MYCOPLASMA BOVIS STRAIN M23 BY MEANS OF A RANDOM INSERTION MUTANT LIBRARY 37 Abstract 37 Introduction 37 Materials and Methods 39 Results 41 Discussion 43 References 45

CHAPTER 3. CHARACTERIZATION OF AN ATP-BINDING CASSETTE TRANSPORT SYSTEM RESPONSIBLE FOR NUCLEOSIDE UPTAKE IN MYCOPLASMA BOVIS STRAIN M23 76 Abstract 76 Introduction 76 Materials and Methods 78 Results 81 Discussion 84 References 86

iii

CHAPTER 4. IDENTIFICATION OF MYCOPLAMA BOVIS GENES REQUIRED FOR RESPIRATORY TRACT PERSISTENCE AND SYSTEMIC INFECTION IN CALVES USING SIGNATURE-TAGGED MUTAGENESIS 104 Abstract 104 Introduction 104 Materials and Methods 105 Results 108 Discussion 110 References 112

CHAPTER 5. GENERAL CONCLUSIONS AND SUMMARY 126 Recommendations for Future Research 127

ACKNOWLEDGEMENTS 128

ABSTRACT

In attempts to better understand the basic physiology and pathogenicity of the bovine- pathogenic Mycoplasma bovis strain M23 , we have developed genetic tools useful for M. bovis . Using the tools, a large scale transposon insertion mutant library was generated. Genetic analysis of the mutant library revealed that 324 out of 663 genes annotated in M. bovis were disrupted by 1,142 transposition events. By comparative genomic analysis, we defined 21 non-essential genes in M. bovis from among genes categorized as essential in other mycoplasma species, thereby, further reducing the size of the minimal genome complement of an independently living organism. From the mutant library, mutants defective in the ability to uptake thymidine were isolated. These were mutants with disruptions in the genes encoding the components of an ABC transport system. Substrate uptake studies proved that all components of the transporter are absolutely required for biological function of this thymidine high-affinity ABC transporter. 3H-thymidine uptake was sensitive to the presence of several nucleosides but insensitive to both nucleobases and pentoses, indicating that the transporter possesses a substrate binding protein with specificity to a portion of the broad chemical configuration of nucleosides, but not nucleobases or the ribose moiety. To define pathogenicity factors of M. bovis , a signature-tagged mutagenesis assay was developed using the mutant library and applied to determine the genes required for establishment of systemic infection and colonization on the respiratory tract of cattle. The genes identified as defective in non-invasive mutants were a putrescine/spermidine transporter permease gene ( potC ), uncharacterized ABC transport system permease genes, and an oligopeptide ABC transport system ATP-binding domain gene ( oppF ). Mutants of the last two genes were also unable to persist on the tracheal mucosa of cattle. In summary, significant advances have been made in the characterization of the genome of M. bovis , and in the genetic manipulation of the genome. A high affinity thymidine transporter was characterized genetically and functionally, and several genes involved in pathogenicity were identified. These novel accomplishments have significantly advanced molecular knowledge about the biology and pathogenicity of this important pathogen of cattle.

CHAPTER 1. GENERAL INTRODUCTION

Introduction Mycoplasmas belong to the class Mollicutes and are distinguished from other prokaryotes by the lack of a cell wall and relatively small size of their genomes. Although mycoplasmas parasitize a broad range of species, including mammals, birds, reptiles, fish, arthropods, and plants, each mycoplasma species does generally infect the restricted host species, with high host-specificity. Some species remain commensal but most species cause diseases in the infected host. Mycoplasma bovis is a highly adapted bovine pathogen causing a variety of diseases, such as pneumonia, mastitis, arthritis, genital and ocular disorders, and other conditions in dairy and beef cattle. Due to the substantial economic losses caused by M. bovis to the cattle industry, many efforts have been made to control this pathogen. Despite such efforts, little progress has been made to develop preventive means against M. bovis diseases. This is in part because genetic tools useful for study of this pathogen have not been developed to date. Without such genetic tools, it is difficult to study this pathogen’s basic biology as well as pathogenicity at the genetic level. For example, no definite virulence determinant has been identified in this pathogen to date. As with other mycoplasmas, M. bovis diseases are generally chronic with persistence of the infection, even if serious pathological consequences are not produced, indicating that its survival in the infected host, presumably by escape from host immune responses, may be a virulence factor. In addition, the mycoplasma must acquire many biological macromolecules from the host or environment because it lacks de novo synthetic capabilities for those as a consequence of its small genome capacities. Under these circumstances, we hypothesize that the survival ability of M. bovis in the infected host is linked to its capabilities to obtain macromolecules from the infected host. Consequently, M. bovis mutants that are unable to uptake such macromolecules may not be able to persist in the infected host. To address this concept, we developed a transposon-based plasmid, useful for M. bovis mutagenesis. We then perfected “high-throughput” screening methods and used them for the construction of a random insertion library. Mutants from this library were used for both determination of a transport system responsible for the uptake of

2 thymidine as a nucleoside, and for signature-tagged mutagenesis to study in vivo persistence and tissue invasion.

Accomplishments in this study In this work, we developed a plasmid that can efficiently transform M. bovis, and used it to develop the first saturation library of random transposon mutants for this mycoplasma. Mutants from the library were then used to characterize an ABC transport system responsible for transporting nucleotide precursors from the environment. Ours is the first finding that Mollicutes possess an active ABC transport system involved in nucleotide utilization. This is a significant step in understanding how mycoplasmas can utilize essential nucleotide precursors and incorporate them into their nucleic acid, and the finding has broad application for Mollicutes other than M. bovis . In addition, we identified several non- essential genes in M. bovis , which had previously been classified as essential genes in other Mollicutes , thus narrowing the definition of a “minimal genome”. This advance will also help to better understand the biological role of these genes. Finally, we identified three putative virulence genes in the pathogenic M. bovis strain M23. The genes may be involved in establishing systemic infection and persistence in the host, and may play an important role in disease production. Since these virulence genes were non-essential, they provide opportunities to develop better preventive strategies against M. bovis by developing mutants with specific gene deletions that could be used in a modified live vaccine against M. bovis diseases.

Dissertation Organization This dissertation contains a general introduction, a literature review, three manuscripts in its main body, followed by a general summary and conclusions. Each manuscript contains an abstract, introduction, materials and methods, results, discussion, and references. The tables and figures are numbered within each manuscript. The first manuscript describes the establishment of a genetic tool, a transforming plasmid, and the development of a random insertion mutant library of M. bovis strain M23, together with a preliminary annotation of the genome. The second manuscript characterizes an ABC transport system

3 involved in transporting thymidine as a nucleoside. The third manuscript describes a signature-tagged mutagenesis assay to detect in vivo persistence and tissue invasion in cattle. Putative virulence factors in M. bovis strain M23 are identified.

Literature Review Mollicutes The genus Mycoplasma belongs to the family Mycoplasmataceae , the order Mycoplasmatales , the class Mollicutes , and phylum Firmicutes (130, 136). The class Mollicutes is a diverse group of cell wall-less organisms that have arisen by degenerative evolution from the Gram-positive bacteria branch (47, 182). The members of the Mollicutes are widely distributed in nature as parasites of many hosts, including mammals, birds, reptiles, fish, insects, arthropods, and plants (134). They possess high specificities to their hosts or colonizing tissues, in part, as a result of their nutrient needs and parasitic ways of living (22, 47, 130). There are 204 described Mollicutes species, 119 of which belong to the genus Mycoplasma which includes pathogens of medial importance to humans and veterinary species (136). Mycoplasmas are characterized as the smallest and simplest prokaryotes capable of self-replication and of leading an autonomous life (134). They are distinguishable from other bacteria by the lack of cell wall (47). The name “mycoplasma” was derived from the Greek word mykes meaning fungus and plasma from something molded to describe the fungus-like morphology (130). The terminology “mycoplasma” has been used to loosely describe all bacteria belonging to the class Mollicutes (47). Genome of mycoplasmas The genomes of Mollicutes are characterized by relatively small size in the range from 580 Kb ( Mycoplasma genitalium G-37) (53) to 1.34 Mb ( Mycoplasma penetrans strain HF-2) (151) and low G+C ratio (23-41 mol %) (47, 69, 183), compared to other bacteria. In general, the size of bacterial genome represents the number of coding genes within the chromosome. Accordingly, the estimated capacity of the M. genitalium genome would be expected to code for about 400 - 500 proteins and encodes 477 proteins by genome annotation (53). It was thought to contain the minimal set of genes required for independent life (60). Genomic analysis in mycoplasmas revealed that there are relatively greater

4 percentages of genes encoding vital functions, including DNA replication, transcription, translation rather than those of genes encoding metabolic pathways (47, 134). To date, there are 20 completely sequenced genomes from 18 species of Mollicutes , while 21 genome sequencing efforts are being completed (NCBI Microbial Genomes), which offers opportunities for genome-wide studies. Mollicutes contain 1 - 2 copies of rRNA and a limited number of tRNA genes (2, 131, 136). Most notable is the use of the UGA universal “stop codon” as a tryptophan codon in many Mollicutes (47, 62, 78, 184). However, the overall genome organization and mechanisms of transcription and translation in Mollicutes are very similar to other eubacteria (91, 133). Interestingly, due to their small genome size, Mollicutes have limited biosynthetic capabilities to produce molecules essential for biological functions, such as amino acids, vitamins, fatty acids, coenzymes, and nucleotides (14, 69, 71, 131) and consequently must acquire the molecules from the host or environment (130). Growth requirements of mycoplasmas Mollicutes are facultative anaerobes that are among the most fastidious bacteria to culture in artificial media (3, 109, 131). They require cholesterol, fatty acids, amino acids, vitamins, coenzymes, nucleic acid precursors and ions for growth (109, 133). This requirement can be met by adding animal sera and yeast extract to highly enriched medium (109, 133). Because of requirements for complicated nutrients, it has been difficult to establish a minimal medium for Mollicutes that would be crucial to study biochemical and physiological features of these organisms (109). There are a few chemically defined or semi- defined media for Mollicutes , including those for Mycoplasma gallisepticum (167), Mycoplasma hyorhinis (56), Spiroplasma mirum (63), Spiroplasma floricola and Spiroplasma citri (93), Spiroplasma sp (23, 93), and Acholeplasma laidlawii B (169). Sterols and fatty acids are essential for growth of Mollicutes , except for a few species of Acholeplasma and Asteroleplasma (36, 145). They also need many amino acids for survival which can be supplied from exogenous sources (109). Vitamins and coenzymes, such as coenzyme A, riboflavin, nicotinic acid, thiamine, pyridoxine, biotin, folinic acid, are required + 2+ 3- for growth (143). In the preparation of defined media, some ions, such as K , Mg , PO 4 , have been added to maintain osmolarity of the organism. Because of lack of de novo synthetic capabilities for purine and pyrimidine bases (112, 131, 133), Mollicutes must

5 acquire nucleic acid precursors from the environment (14, 59, 112). Precursors for nucleic acids include DNA, RNA, oligonucleotides, nucleotides, nucleosides, and nucleobases (49). It has been reported that Mollicutes easily uptake nucleic acid precursors present in the medium and incorporate them into their genome (113-115). Because Mollicutes do not possess a functional tricarboxylic acid (TCA) pathway, they can obtain energy by glycolysis, oxidation of substrates, or the arginine dihydrolase pathways (47, 109). Substrates for energy can be glucose, glycerol, sucrose, other sugars, organic acids, or arginine (48). In Mollicutes, the absence of anabolic pathways for macromolecules essential for growth implies that the organism apparently must scavenge the macromolecules from the host or environment. Interestingly, proteases and nucleases produced by Mollicutes may play roles in utilizing the exogenous macromolecules by cleaving large units (such as proteins, polypeptides, DNA, RNA, oligonucleotides) to small units (a single amino acid, nucleoside, nucleobase) that then become available for transport (49, 127, 136, 171). Pathogenesis of mycoplasmal diseases The diseases caused by mycoplasma infection occur as a result of interaction of multiple factors, including putative virulence determinants of the organism, host immune responses to infection, environmental factors, and the presence of other pathogens (171). This complex etiology makes it difficult to define a precise role of the pathogen in mycoplasma diseases. Mycoplasmas are frequently implicated in a wide range of clinical presentations in many hosts (7, 130). However, mycoplasma diseases are usually presented as chronic infections, indicating that the pathogens may be well adapted to conditions provided by the host or may not induce severe clinical manifestations due to the absence of strong virulence factors (171). Adherence . Attachment of microorganisms to the host cells is a crucial step to colonization and establishment of disease in the infected host (129, 155). In the respiratory tract, the organism adheres to epithelial cells and is able to resist being eliminated by the ciliary action and movement of the mucus blanket (31). Certain species of Mollicutes possess special organelles, named tips that allow them to attach to host cells (129). The tips have special membrane cytoadhesin proteins, such as P1, P30, P116, and HMW 1-3 in Mycoplasma pneumonia (155), MgPa in M. genitalium (74), P30 in Mycoplasma

6 gallisepticum (51). In other Mollicutes , adhesins are distributed around the membrane, such as P40 in Mycoplasma agalactiae (50), P26 protein of M. bovis (148). Attachment may facilitate for the organism the uptake of nutrient sources from the cells, while producing harmful effects on the contacted cells (129). Mycoplasmas may be able to reside on body sites for a long period of time, which may result in chronic infections. Thus, cytadhesins have long been considered a potential virulence determinant and have been extensively investigated. However, the ability to adhere to host cells, by itself, is not a definite virulence factor in Mollicutes . By-products . Several by-products released from mycoplasmas have been thought to be putative virulence determinants. Among them, hydrogen peroxide produced by mycoplasma is the most well characterized factor which is relevant to pathogenesis of mycoplasma diseases (66, 175). Hydrogen peroxide can be produced as an intermediate product during metabolic processes that yield energy via oxidative pathways of substrates (30, 171). Hydrogen peroxide production was reported in several Mollicutes , including Mycoplasma mycoides subsp. mycoides , Mycoplasma pulmonis , Mycoplasma arthritidis , Mycoplasma neurolyticum , M. gallisepticum , Mycoplasma bovirhinitis , M. bovis , and Mycoplasma felis . Ciliostasis observed in mycoplasma infection was as a consequence of hydrogen peroxide produced in Mollicutes (30). Loss of ciliary action of epithelial cells in the respiratory tract can allow the mycoplasma to colonize on the cells and facilitate the infection of other pathogens. At the mycoplasma lesion site, the consequence has been shown to be tissue disruption and disorganization (20). This cell damage may also be by-stander cell damage derived from the host response to bacterial infection (171). However, each mycoplasma can differ in the degree of severity of cell damage, and type of tissue disruption, indicating that there are some other factors involved in this. The capability of hydrogen peroxide production is not always linked with pathological change, since some non- pathogenic mycoplasmas can secrete hydrogen peroxide (122). Also, loss of virulence of Mycoplasma pneumoniae was not accompanied by a decrease in hydrogen production (134). This indicated that some other factors must be associated with the cytotoxicity of hydrogen peroxide. The possible factors would be the ability of the organism to keep close proximity to deliver a toxic effect to the cells, and a steady state concentration of toxic product to cause

7 detectable cell damage (24, 29, 32). A well characterized example is the need with M. mycoides subsp. mycoides SC to both produce hydrogen peroxide and attach to cells to result in cytotoxicity (123). Proteins . Mycoplasmas have a single membrane, on which many functional proteins are present. Among the functional proteins, nucleases are likely to be a virulence determinant in Mollicutes . Nuclease activities were found in Mycoplasma hyopneumoniae, Mycoplasma hyorhinis , and Mycoplasma penetrans (110) . Unlike oxidative cell damage, cells exposed to nucleases underwent apoptosis with typical internucleosomal DNA fragmentation (110, 120, 129, 159). Cell apoptosis can be induced by the action of either membrane-bound or purified mycoplasmal nucleases on cells of various origins and types (110, 120). This suggested that nucleases may act as a potential pathogenic determinant (120). Immunoglobulin A (IgA) protease can cleave IgA, which plays a predominant role in mucosal immunity to the organism (82). IgA protease found in Ureaplasma urealyticum cleaved IgA with selective host specificity, suggesting that the organism can resist the host’s immune responses (82). Arginine deiminase is found in arginine-utilizing species (160), including Mycoplasma arginine, Mycoplasma hominis , M. arthritidis , and Mycoplasma salivarium. It has been shown to inhibit cell proliferation by arresting the cell cycle and leads to cell death at high concentration (61). Toxins . A few toxins have been identified in Mollicutes . A neurotoxin identified in M. neurolyticum (162) was the only exotoxin reported in Mollicutes . Its toxicity was shown when the toxin was injected intravenously but not by other injection routes, implying the existence of specific receptors for the toxin in the central nervous system (162). A neurotoxic activity was found in the extracted membrane of M. gallisepticum (166). Other toxins found in Mollicutes are most likely toxic membrane proteins. An inflammatory toxin was extracted from M. bovis and its toxicity was demonstrated by experimental inoculation into the bovine udder (57). Recently, a toxin having ADP ribosylating activity was identified in M. pneumoniae (81). The toxin structure was in part similar to that of pertussis toxin, which is an exotoxin derived from Bordetella pertussis (83). Uncharacterized components derived from membranes of Mollicutes also demonstrated toxicities in animal challenge and cell culture systems. The membrane extracts behaved like bacterial endotoxins whose toxicities

8 stem from the lipid A component of lipopolysaccharide of bacterial membrane (22). Mycoplasmas have abundant lipoproteins on their membrane, but no lipid A structures (22). The toxicities derived from mycoplasma membrane extracts are presumed to reside on the lipid moiety of lipoproteins. Antigenic variation . Alteration of antigen features on the surface membrane has been considered a putative virulence factor in Mollicutes . Occurrence of antigenic variation has been reported in several Mollicutes , including M. hyorhinis (27, 185), M. bovis (8, 92), M. pulmonis (161), M. hominis (187) , M. arthritidis (40), M. gallisepticum (95), and Mycoplasma synoviae (118). The antigenic variation was as a result of random DNA rearrangement of genes encoding the surface variable proteins of mycoplasmas (146). The ability to alter antigenic properties may allow mycoplasmas to escape immune recognition and to survive in an immune competent host (22, 92, 185). Antibody-induced pressure on a mycoplasma population might allow only a specific clone, which is not recognized by the antibody pool, to replicate and become a new population of mycoplasma, whereas the majority of the population recognized by the antibody pool would eliminated (92).

Mycoplasma bovis Mycoplasma bovis is an etiological agent causing a variety of diseases in both dairy and beef cattle, which include mastitis, pneumonia, arthritis, genital disorders, skin abscesses, conjunctivitis, otitis media, and meningitis (11, 21, 116, 121). Although M. bovis causes high morbidity and relatively low mortality, this pathogen is responsible for substantial economic loss to the cattle industry (116, 121). Costs arise because of the necessity of culling cows with mastitis to prevent dissemination among the herd, poor weight gain, treatment expenses, mortality (21, 121). M. bovis was first isolated from a case of severe bovine mastitis in 1961 in the USA (65), and then given its present name in 1976 (4). Since the initial discovery, this pathogen has been isolated worldwide and its distribution and incidence of infection in herds is on the rise (21, 116). This organism is now well established as one of the most pathogenic bovine mycoplasma species among over twenty mycoplasma that are capable of colonizing the bovine (121). As with a narrow host-specificity found in other mycoplasma species, diseases caused by M. bovis are restricted to bovine species primarily from domesticated bovines, bison and buffalo (116, 121). The genome size of M.

9 bovis is 1,080 Kb with a low G+C ratio of 27 to 32.9 mol% (68). M. bovis requires highly enriched media for growth, such as Friis broth supplemented with 20% bovine fetal serum because the small genome size of this organism limits its biosynthetic capability. Metabolically, M. bovis is one of a few mycoplasma species which use neither arginine nor glucose as energy sources and utilize other organic acids, such as lactate, pyruvate (84). The major reservoirs of M. bovis are clinically healthy cattle that do not present clinical signs but harbor the organism (116, 121). The organism can reside in the respiratory tract, genital tract, semen, and milk and can be continually shed for a long period of time (116, 121). In addition, M. bovis can colonize other ruminant species without presenting clinical manifestations (116). The major route of transmission of this pathogen into M. bovis -free herds is by introduction of clinically healthy cattle that are actively shedding (21, 65, 121). The organism can then spread rapidly in the herd by direct contact between animals or by fomites (116). Pathogenesis of M. bovis diseases M. bovis is a proven pathogen associated with pneumonia, mastitis, arthritis, and genital infections in cattle (21, 121). Despite clear evidence of its pathogenic potential, little is known about its mechanisms of pathogenesis (102, 116). Rather, it has been suggested that M. bovis diseases result from combination of multiple factors which are derived from the mycoplasma, host and/or environment (116, 121). The attachment of mycoplasmas to host cells is an essential prerequisite for colonization of host cells and initiation of infection (31, 129, 142). The potential of M. bovis to adhere to bovine cells, such as alveolar macrophages (73) and neutrophils (164) has been demonstrated, indicating that M. bovis may possess some components related to attachment. The P26 protein of M. bovis has been reported to be involved with adherence processes (150). Its binding receptor may be sialic acid moieties of host cells since the adherence rate of M. bovis was significantly reduced by treating host cells with neuraminidase (148). As another component involved in attachment, variable surface proteins allow the organism to interact with host cells (149), allowing a wide range of avidity and specificity of binding. However, no difference in adherence capacity of M. bovis between pathogenic and non-

10 pathogenic strains has been reported (163), indicating that adherence can not serve as a stand-alone pathogenicity factor. Variable surface proteins (VSP) of M. bovis have been known to contribute to phenotype variability of this organism and to be involved in the process of cytadhesion to host cells (149). The expression of VSPs is characterized by high frequency of phase and size variation caused by non-coordinated DNA rearrangements in the region coding vsp genes (8, 92, 101, 185). Variability of antigenic features may affect the characteristic of the mycoplasma surface, resulting in avoidance of host immune recognition, and facilitating adaptation to different conditions in the host and environment (22, 92, 149). In addition, antibody-induced clonal selection on mycoplasma cells has been demonstrated in M. bovis, suggesting that any variant clone among the organism population which are resistant to antibody-mediated inhibition may be selected under the host’s immune pressure, and result in a new surviving population (92). Thus, the ability of M. bovis to alter antigenic features can be regarded as part of the strategies of the pathogen for subverting host defense systems (92, 119). It has been reported that M. bovis was able to adhere to neutrophils and macrophages and inhibit their phagocytic activity for a short period of time but was destroyed by phagocytes in the presence of antibody (72, 73). This indicated that the organism is capable of avoiding early phagocyte effects and cell-mediated immune response, helping it to survive from attack by the host immune system (164). The putative factor related to this phenomenon has not been identified yet. The occurrence of suppressive immune responses in the host infected with M. bovis has been reported (9, 10), and was characterized by both delayed- humoral immune responses and suppression of cellular-mediated immune responses (9, 10, 165). In addition, mitogen-induced lymphocyte blastogenesis was suppressed by adding M. bovis cells or culture supernatant (15, 16, 165). Recently, it was reported that a factor responsible for suppression of lymphocyte blastogenesis is the external C-terminal of a variable surface protein of M. bovis (173). This factor can be assumed to be potentially relevant to alteration of immune responses of the host. The production of hydrogen peroxide is widely believed to play an important role in mycoplasma pathogenicity (136), causing peroxidation of lipid membranes of eukaryotic cells, cell cycle arrest, and inhibition of ciliary action of the trachea (171). In M. bovis ,

11 hydrogen peroxide can be produced during the oxidation of organic acids (108). The production of hydrogen peroxide in M. bovis was variable among strains, and reduced after in vitro passages (85). In vitro passage of more than 60 times markedly reduced the virulence for the mammary gland of experimentally infected mice, compared to the original strain (168). Thus, it has been assumed that the production of hydrogen peroxide may be related to pathogenicity, but the correlation between hydrogen peroxide production and pathogenicity of M. bovis has not been confirmed in animal models. A polysaccharide toxin of M. bovis was reported as a cell-membrane associated heat- stable inflammatory toxic substance (57). No further follow-up study on this toxin was reported. Recently, biofilm formation was reported in M. bovis , which was strain-dependent and associated with specific Vsp expression; VspO and VspB expression correlated with biofilm formation (106). Since bacterial biofilm formation has been known to be associated with colonization on host cells (35), the ability of M. bovis to form a biofilm may be considered a putative virulence determinant.

Nucleotide metabolism Nucleotides have essential roles in all biological aspects of living cells, such as synthesis of carbohydrates, lipids, proteins, coenzymes, nucleic acids, and intermediates for energy-related reactions (177). Most importantly, nucleotides serve as a building block for synthesis of ribonucleic acid (RNA) and deoxyribonucleic acid (DNA). Nucleotides consist of a [deoxy-] ribose, a nucleobase (either purine or pyrimidine), and phosphate(s). Adenine, guanine, and hypoxanthine belong to purine bases, whereas uracil, cytosine, and thymine do to pyrimidine bases. The nucleotides can be synthesized by either a de novo pathway or a salvage pathway in living cells (177). Nucleotide synthesis by de novo pathway Purine ribonucleotides are synthesized from simple compounds, such as ribose, amino

acids, CO 2, NH 3, and phosphoribosyl pyrophosphate (PRPP), as a result of series of enzymatic reactions (177). For purine nucleotide, inosine monophosphate (IMP), the initial purine nucleotide, is synthesized via de novo synthetic pathway (177). Adenosine monophosphate (AMP) is synthesized from IMP by the action of adenosylsuccinate

12 synthetase and adenosuccinate lyase, whereas guanosine monophosphate (GMP) is synthesized from IMP by the action of IMP dehydrogenase and GMP synthase (177). Adenosine triphosphate (ATP) is converted from AMP by adenylate kinase (ADK) and nucleoside diphosphokinase (NDK), whereas guanosine triphosphate (GTP) is converted from GMP by the action of GMP kinase and NDK. For pyrimidine nucleotides, orotidine monophosphate (OMP), the first pyrimidine nucleotide, is synthesized from simple compounds and can be converted to uridine monophosphate (UMP) by the action of orotate phosphoribosyltransferase (177). The UMP can be used to synthesize cytidine triphosphate (CTP) from UTP by the action of CTP synthetase after UTP formation from UMP by the action of NDK. For synthesis of deoxyribonucleotides (dNTP), dexoyribonucleoside triphosphates (dATP, dCTP, dGTP) can be formed directly from the corresponding ribonucleoside triphosphates (ATP, CTP, GTP) by replacing the 2’-OH group with hydrogen by the action of ribonucleotide reductase (RNR) (177). Alternatively, they can be formed from deoxyribonucleoside diphosphates (dADP, dCDP, dGDP) by the action of NDK or from ribonucleoside monophosphate (AMP, CMP,GMP) by the action of RNR and NDK (177). For synthesis of deoxythymidine triphosphate (dTTP), deoxyuridine monophosphate (dUMP) can be synthesized from UMP, by the methylation of UMP by thymidylate synthase with a methyl donor (N 5, N 10 -10-methylenetetrahydrofolate) (177). Then, dUMP can be converted to deoxythymidine monophosphate (dTMP) by the action of thymidylate synthase, and to deoxythymidine triphosphate (dTTP) by the action of thymidylate kinase and NDK. Salvage pathway for nucleotide synthesis Certain organisms cannot synthesize nucleotides because they do not have enzymes involved in de novo pathways for nucleotide synthesis (131, 170, 177). In that case, the organism must have alternative pathways to synthesize the nucleotides essential for living organisms. In most cells, nucleic acid materials are actively broken down to nucleobases, nucleosides, nucleotides, or ribose-moieties and synthesized by their salvage pathway (170, 177). In the salvage pathway, these precursors can be converted into the corresponding new nucleotides by the multiple enzyme reactions involved in salvage processes (170, 177). As an important compound for salvaging nucleotide precursors, [deoxy-] ribose-5-phosphate can be generated from either glucose-6-phosphate derived from the oxidative branch of the pentose

13 phosphate pathway or be supplied from the environment (170). The pentose phosphate pathway is a critical component of the salvage pathway, and is involved in NADPH production, conversion of hexoses to pentoses, and pentose degradation (125, 170). Alternatively, deoxynucleotides can be supplied as pre-existing precursors from the environment and can be converted to the corresponding dNTP by phosphorylation (18). In this reaction, phosphopentomutase is a key enzyme that interconverts [deoxy]-ribose-5- phosphates and [deoxy]-ribose-1-phosphates, thus permitting pentose to ribosylate both purine and pyrimidine bases to synthesize the corresponding nucleotides (18, 128, 170). In organisms where the phosphopentomutase gene is disrupted, rich growth medium can be a source of pentose (125). Nucleosides can be deribosylated to nucleobases by purine- or pyrimidine- nucleoside phosphorylase activities, leaving ribose-moieties that can be utilized for new nucleoside synthesis. Nucleobases can be converted to the corresponding nucleoside monophosphates by the activities of adenine phosphoribosyltransferase (APRT), hypoxanthine-guanine phosphoribosyltransferase (HGPRT), and uracil phosphoribosyltransferase (UPRT) (14). In contrast to the purine salvage that extensively reutilizes purine bases, pyrimidine bases are poorly utilized and strictly regulated. Nucleotide metabolic pathways in Mollicutes The parasitic lifestyle of Mollicutes allow them a rich supply of preformed macromolecules, including nucleotide precursors (47, 49). Their nutritional fastidiousness has resulted in difficulty in determining the nutrient substances essential for growth (124). Early studies reported that various nucleotide precursors, mostly nucleobases, are required for growth of several species of Acholeplasma (132, 158). Guanine, uracil, and thymine were the simplest requirements for growth in M. mycoides subsp. mycoides (62). In further study, guanine can be converted to all purine nucleotides when guanine is a source for purine, and uracil can meet the requirements for pyrimidine nucleotide synthesis M. mycoides subsp. mycoides (144). The ability to utilize nucleotide precursors was dependent on species of Mollicutes , indicating that each mycoplasma species may possess different capabilities for nucleotide salvage. Uridine phosphate synthesis can be from uracil and PRPP by the action of UPRT, followed by NMK and NDK activities, whereas cytosine phosphate can be synthesized from UPT by the activity of CTP synthase. Alternatively, nucleotides can be

14 converted from the corresponding nucleosides by the action of cytidine/uridine kinase. Adenosine phosphates can be formed from guanosine phosphate, but the guanosine phosphates can not be formed from IMP in M. mycoides subsp. mycoides. In this case, guanine will be absolutely required for growth. Synthesis of dTMP can be from dUMP by the action of thymidylate synthase, which occurs in many bacteria (177). The dTMP can convert to dTTP by the action of thymidine kinase and thymidine deoxythymidine diphosphate kinase (177). In certain species, thymine or thymidine were absolutely required for growth, indicating that thymidylate synthase which converts dUMP to dTMP is probably absent (179). The absence of thymidylate synthase was confirmed in the sequenced genomes of M. hyopneumoniae (111), and M. mycoides subsp. mycoides (179). In this case, the dTMP pool would be dependent on the direct uptake from environment (111, 179) or by the concerted action of thymidine phosphorylase and thymidine kinase activities on uptake of thymine derivates (14).This implies that such species must have active systems to transport thymine derivatives through their impermeable membrane (17, 49, 186). The potential existence of such transporters was experimentally demonstrated in M. mycoides. subsp. mycoides (107, 112). Furthermore, several enzymes required for salvaging nucleotides have been identified in Mollicutes , such as purine phosphorylase, and phosphopentomutase. By comparative genomic analysis, the existence of putative transporters potentially involved in transporting nucleotide precursors has been deduced from several sequenced genomes of Mollicutes (17, 53, 124).

ATP-binding cassette (ABC) transport systems The ATP-binding cassette (ABC) transport systems constitute one of the largest superfamilies of paralogous sequences (38) which are widespread among living organisms (38). The structure of ABC transport system generally consists of an ATP-binding domain, one or two transmenbrane domains (TMD), and a substrate binding domain (SBP) (37). ATP-binding domains contain highly conserved motifs (Walker A and B) that bind and hydrolyze ATP, supplying energy for either uptake or efflux of various substrates (37). The TMDs are to form a membrane channel to allow substrate transport. They also possess a highly conserved motif, called EAA loop, which binds the ATPase domain on the

15 cytoplasmic side of the membrane. SBPs interact with their cognate TMDs, trigger ATP hydrolysis in the ABC transport system and initiate substrate transport, once binding with proper substrates occurs (37). In Gram-negatives, SBPs are located in the periplasmic space as soluble free forms, whereas in Gram-positive bacteria, they are anchored on the membrane via lipid tails as lipoproteins. The flexible and external SBPs are located in close proximity to the protruding cognate TMDs (37, 117). The capture of substrates via SBPs is commonly via hydrogen bonding between SBP binding pocket and specific configurations of substrates.

This bond exhibits extremely high affinity to the substrate, showing a high V max and low K m. Biological roles of ABC transport systems Unlike the outer membrane of Gram-negative bacteria, the bacterial cytoplasmic membrane is impermeable to almost every solute unless a special transporter system is provided (1). However, bacteria require specific molecules essential for survival and uptake them across the cytoplasmic membrane (70). This indicates that transporters capable of transporting the molecules through the cytoplasmic membrane must exist. The importance of transporters in bacterial cells is exemplified by the fact that almost 20% of the E. coli genes so far identified are associated with transport functions (5). ABC transporters can serve as uptake or export systems in living organisms (70). The uptake function of ABC systems is absent in eukaryotes, whereas, in prokaryotes, the primary role of ABC systems is to serve as uptake systems that acquire a broad range of nutrients, such as amino acids, carbohydrates, peptides, vitamins, etc (37, 138). As exporters, ABC systems are involved in efflux of substrates, including cell surface components, proteins involved in pathogenesis, drugs, etc (37). ABC transporters in Mollicutes The necessity of active transport systems to uptake certain nutrients is obvious in Mollicutes because they lack many biosynthetic pathways essential for survival that are present in other bacteria (53). Consequently, mycoplasmas must rely on an external supply for the nutrients (134). The existence of amino acid transporters in Mycoplasma fermentans and M. hominis (135), and sugar transporters in M. gallisepticum (147) has been suggested, with these behaving like typical microbial permease systems. To obtain all required nutrients, a substantial portion of a Mollicutes genome must be diverted toward transport systems (17,

53, 134). This suggestion has been supported by annotation results of complete genomes of Mollicutes (14). Several ABC transport system have been described such as glycerol ABC, sugar ABC, oligopeptide ABC, and polyamine (spermidine/putrescine) ABC transporters. The potential existence of transport system was searched on the list of complete genomes of Mollicutes that are currently available (NCBI Microbial Genome). They include Mycoplasma agalactiae PG2 (CU179680), Mycoplasma arthritidis 158L3-1(CP001047), Mycoplasma capricolum subsp. capricolum ATCC 27343 (CP000123), Mycoplasma gallisepticum R (AE015450), Mycoplasma genitalium G37 (L43967), Mycoplasma hyopneumoniae 232 (AE017332), Mycoplasma mobile 163 K (AE017308), Mycoplasma mycoides subsp. mycoides SC str. PG1 (BX292980), Mycoplasma penetrans HF-2 (BA000026), Mycoplasma pneumoniae M129 (U00089), Mycoplasma pulmonis UAB CTIP (AL445566), and Mycoplasma synoviae 53 (AE017245). Glycerol transporters are found in M. agalactiae , M. capricolum subsp. capricolum , M. mycoides subsp. mycoides , M. synoviae , but not M. arthritidis , M. gallisepticum . In some species, an alternative protein, a glycerol facilitator protein, may serve this function, such as, is found in M. genitalium , M. hyopneumoniae , M. mobile , M. penetrans , and M. pneumoniae . Polyamine transporters are found in M. agalactiae , M. arthritidis , M. capricolum subsp. capricolum , M. genitalium , M. hyopneumoniae , M. mobile , M. mycoides subsp. mycoides , M. pneumoniae , M. pulmonis , M. synoviae but not in M. gallisepticum . Polyamines (spermidine, spermine, and putrescine) are ubiquitous polycations in cells, and they play important roles in various aspects of cell biology (140, 154). Due to absence of the polyamine synthesis pathway, existence of a polyamine transporter should be indispensible in Mollicutes . Oligopeptide transporters are found in M. agalactiae , M. arthritidis , M. capricolum subsp. capricolum , M. genitalium, M. hyopneumoniae , M. mobile , M. mycoides subsp. mycoides , M. penetrans , M. pneumoniae , M. synoviae, but not M. gallisepticum . Sugar ABC transporters are found in all Mollicutes annotated, including M. agalactiae , M. arthritis , M capricolum subsp. capricolum , M gallisepticum , M. genitalium , M. hyopneumoniae , M. mobile , M. mycoides subsp. mycoides , M. penetrans , M. pneumoniae , M. pulmonis and M. synoviae . This ubiquitous existence of sugar ABC transporters in Mollicutes suggests that this biological role could be conserved and absolutely essential for survival of Mollicutes . To

17 date, only a few active transport systems in Mollicutes have been described and characterized with experimental confirmation. In M. mycoides subsp. mycoides , the glycerol ABC transporter, gtsABC , was identified and characterized in terms of its relevance to a role in pathogenesis (123, 175). The biological role of the polyamine transporter in Streptococcus pneumonia has been described, and its relationship to virulence of the organism was demonstrated (152, 178). Unfortunately, no study has been made to characterize the biological and pathogenic roles of ABC transporters (polyamine, oligopetide, sugar ABC) in Mollicutes , except for the glycerol transporter ( gtsABC ) of M. mycoides subsp. mycoides . This may be partially due to the difficulty in generating isogenic mutants in absence of the proper genetic tools. Implication of ABC transporters in Mollicutes It has been reported that ABC transporters were involved in pathogenicity of bacteria, including Streptococcus pneumoniae (153, 178), Agrobacterium tumefaciens (105), and M. mycoides subsp. mycoides (123, 175). In M. mycoides subsp. mycoides , a virulent strain (African-) contains the glycerol transporter (gtsABC ), whereas an avirulent strain (European- ) does not (174), indicating that the ability of glycerol uptake via gtsABC is related to the pathogenicity of the organism. Hydrogen peroxide, a well-known virulence factor in Mollicutes , was produced in the virulent strain that has intact gtsABC , and the produced hydrogen peroxide injured the host cells closely in contact to mycoplasma cells (175). This is the best and only ABC transport system whose function was characterized with experimental data in Mollicutes to date (66, 123, 175). Polyamine (spermidine/putrescine) transporters are found in most species of Mollicutes annotated to date, indicating that they are involved in important biological functions (140, 154). In S. pneumoniae , inactivation of potC and potD (polyamine transporter) resulted in loss of virulence of the organism in experimentally challenged mice. In addition, mice vaccinated with the protein PotD (a substrate binding protein) were protected against systemic infection with wild type challenge (153). Furthermore, it has been shown that a potC mutant of M. bovis strain M23 lost its ability to invade deep tissues of challenged calves (Lee and Rosenbusch, unpublished data). The potC is an integral transmembrane component of polyamine ABC transporter of M. bovis , indicating that a mycoplasma polyamine transporter is involved in virulence of this organism.

Importantly, transporter component proteins involved in transport of essential substrates for survival should be biologically conserved. For example, a substrate binding protein can be a structurally stable and conserved protein among strains of a target Mollicutes species. Such proteins can be good candidates for vaccine or diagnostic tool development for Mollicutes (117).

Gene inactivation in Mollicutes Bacterial genes can be inactivated by various ways, such as conjugation, transfection, transduction, and transformation (41, 42). Using these systems, new isogenic mutants can be generated from the wild type of the organism, which provides opportunities to investigate gene functions by comparison of the mutant with wild type. Establishment of reliable genetic tools is thus a crucial step to study the basic biology of an organism. Gene transfer in Mollicutes The first transfection in Mollicutes was demonstrated by simply adding mycoplasma virus onto lawn-grown A. laidlawii (97). Other transfection methods of Mollicutes have been developed, which include polyethylene glycol (PEG)-mediated transfer (156, 157), and the electroporation method (98). Conjugation was also reported as a means of transferring the Tn 916 genetic element to M. hominis and other Mollicutes (6, 103, 141). The first attempt to transform Mollicutes was made using mycoplasmas treated with divalent cations and the PEG-mediated method (55, 156). Electroporation was used to deliver genetic material into S. citri (98). Since then, the electroporation method has been widely used to transform Mollicutes due to its high transformation frequency and its simple procedure. Autonomously replicating plasmids are a useful genetic system that is widely used in many bacteria. However, very few plasmids were found to naturally occur in Mollicutes . The first cloning vector for Mollicutes was developed using a cryptic plasmid that was isolated from M. mycoides subsp. mycoides . The plasmid carrying both the origin of replication of the chromosome ( oriC ) sequence from E. coli and tetM for antibiotic selection was constructed (12, 13, 46). Once plasmid (pIK ) isolated from the transformed host was reintroduced into M. mycoides subsp. mycoides , the plasmid was stably maintained in the transformed cells, indicating that it would be a suitable mycoplasma vector (86, 88). An alternative method to construct self-replicating oriC plasmids was developed in M. pulmonis . A plasmid carrying

19 the oriC fragment derived from M. pulmonis and the tetM gene was introduced into M. pulmonis and maintained stably in the transformed cells (34). This indicted that a short oriC region is required for construction of self-replicating plasmids in Mollicutes . With this strategy, oriC plasmids have been constructed in several species of Mollicutes and are being used for inactivation of target genes, expression of foreign proteins, or complementation tests (80, 94). Transposons Transposons are genetic elements that are able to randomly integrate into the chromosome of a recipient organism. Transposon Tn 916 , isolated from the Gram-positive Enterococcus faecalis (52), is a 18 Kb transposable element that consists of the xis-Tn/int-Tn gene for excision/integration, the tetracycline resistance ( tetM ) gene, and a set of genes ( tra ) required for intercellular transfer (28). In Mollicutes , plasmid pAM 120 carrying Tn 916 was first introduced into A. laidlawii (44), showing that the genetic element was transposed to diverse sites within the recipient chromosome. Tn 916 has been used to transform several species of Mollicutes , including M. pulmonis (44), M. hyorhinis (43), M. mycoides subsp. mycoides (87, 181), M. gallisepticum (19), M. hominis (141), and M. arthritidis (176). Transposon Tn 4001 is a 4.8Kb transposable element which was isolated from Staphylococcus aureus (99). It consists of two identical inverted repeats (IS256) of 1.35 Kb and the aacA-aphD gene encoding a bifunctional aminoglycoside modifying enzyme that confers resistance to gentamicin, tobramycin, and kanamycin (89, 99, 100). Tn 4001 has been widely used for Acholeplasma (104), and M. gallisepticum (19), M. pneumoniae (67), M. genitalium (137), M. arthritidis (45), M. pulmonis (104). Like Tn 916 , transposon Tn 4001 was randomly distributed at diverse sites in the recipient chromosome. In addition, pISM 2062 a derivative of Tn 4001 was developed with unique restriction enzyme sites (BamHI, SmaI) to facilitate genetic manipulation (90). This plasmid is widely used to generate random insertion mutants or introduce genes into the chromosome of the recipient organism. Another Tn 4001 derivative, named mini-Tn 4001tet , was constructed, whose transposase gene is located outside the transposon elements, to prevent potential re-excision of the transposon after the first transposition event (126).

Approaches for gene inactivation in Mollicutes Gene inactivation of microorganisms can be accomplished by either inactivation of a target gene or by a random insertion mutation. The direct disruption of target genes in Mollicutes was first reported in M. genitalium accomplished by double homologous recombination by using a suicide plasmid (39). Since this report, no other successful example has been reported in Mollicutes , even though the strategy is being used in many bacteria. It is thought that the homologous recombination event is extremely rare in Mollicutes , possibly due to either the absence or low activity of the enzymes involved in the homologous recombination event. An alternative method to disrupt target genes is to use an oriC plasmid that carries the homologous sequences required for cross-over between the plasmid and the target gene within the recipient chromosome. After introducing the oriC plasmid into the organism, the transformant is maintained for several passages in the presence of antibiotic pressure to facilitate the homologous recombination event between the cloned target gene in the oriC plasmid and the corresponding gene within the chromosome. Then, non-integrated plasmids can be removed by passing the cells in antibiotic-free medium. With this strategy, direct gene inactivation has been reported in S. citri (34, 139), M. capricolum subsp. capricolum (80), M. agalactiae (26), M. gallisepticum, and M. imitans (94). It would be impossible to inactivate specific target genes in certain Mollicutes like M. pneumonia where enzymes participating in homologous recombination events are not expressed. In this case, mutant defective in the gene of interest can be accomplished by generating a random mutant library followed by selection of desirable clones. Selection of a specific mutant out of the mutant library can be carried out by various methods, including phenotype change, immunoblotting, PCR assay, and direct sequencing of insertion sites in the whole library (64). In many aspects, a random insertion mutant library covering enough mutants to saturate the entire non-essential gene complement of an uncharacterized organism would provide rich opportunities to study the basic biology and functional genomics of the organism, which include the physiology, biochemical pathways, virulence determinants, essential genes, transporters, and regulatory systems, etc. This also would be a desirable approach for many Mollicutes , where genetic tools for the Mollicutes have not been developed. To date, random mutant libraries have been constructed in M. pulmonis (54), M.

21 genitalium (53), M. pneumoniae (77), M. gallisepticum (180), M. arthritidis (79) and M. bovis (Lee and Rosenbusch, unpublished data). As an application of random mutant library studies, the number of minimal genes for a self-living organism has been determined in M. genitalium , the smallest mycoplasma (58, 76). Since then, the absolute number of minimal genes has been updated, by analysis of the disrupted genes within random mutant libraries constructed in other Mollicutes (54, 58, 77). To determine putative virulence determinants of pathogenic microorganisms, signature-tagged mutagenesis using in vivo virulence assays has been used in many bacteria (25, 33, 96, 172), M. gallisepticum (75), and M. bovis (Lee and Rosenbusch, unpublished data). With recent progress in developing genetic tools, the availability of the genome sequences, and the construction of random mutant libraries, it will be possible to better understand the Mollicutes in the near future.

Literature cited 1. Ames, G. F. L. 1986. Bacterial periplasmic transport systems: structure, mechanism, and evolution. Annual Review of Biochemistry 55: 397-425.

2. Amikam, D., G. Glaser, and S. Razin. 1984. Mycoplasmas (Mollicutes) have a low number of rRNA genes. Journal of Bacteriology 158: 376-378.

3. Arraes, F. B. M., M. J. A. de Carvalho, A. Q. Maranhao, M. M. Brigido, F. O. Pedrosa, and M. S. S. Felipe. 2007. Differential metabolism of Mycoplasma species as revealed by their genomes. Genetics and Molecular Biology 30: 182-189.

4. Askaa, G., and H. Erno. 1976. Elevation of Mycoplasma agalactia e subsp. bovis to species rank: Mycoplasma bovis (Hale et al.) comb. nov. International Journal of Systematic Bacteriology 26: 323-325.

5. Bachmann, B. J. 1990. Linkage map of Escherichia coli K-12, edition 8. Microbiology and Molecular Biology Reviews 54: 130-197.

6. Barroso, G., and J. Labarere. 1988. Chromosomal gene transfer in Spiroplasma citri . Science 241: 959-961.

7. Baseman, J. B., and J. G. Tully. 1997. Mycoplasma: sophisticated, reemerging, and burdened by their notority. Emerging Infectious Diseases 3: 21-32.

8. Behrens, A., M. Heller, H. Kirchhoff, D. Yogev, and R. Rosengarten. 1994. A family of phase- and size-variant membrane surface lipoprotein antigens (Vsps) of Mycoplasma bovis . Infection and Immunity 62: 5075-5084.

9. Bennett, R. H., E. J. Carroll, and D. E. Jasper. 1977. Skin-sensitivity reactions in calves inoculated with Mycoplasma bovis antigens: humoral and cell-mediated responses. American Journal of Veterinary Research 38: 1721-1730.

10. Bennett, R. H., and D. E. Jasper. 1977. Immunosuppression of humoral and cell- mediated responses in calves associated with inoculation of Mycoplasma bovis . American Journal of Veterinary Research 38: 1731-1738.

11. Bennett, R. H., and D. E. Jasper. 1978. Systemic and local immune responses associated with bovine mammary infections due to Mycoplasma bovis : resistance and susceptibility in previously infected cows. American Journal of Veterinary Research 39: 417-423.

12. Bergemann, A. D., and L. R. Finch. 1988. Isolation and restriction endonuclease analysis of a mycoplasma plasmid. Plasmid 19: 68-70.

13. Bergemann, A. D., J. C. Whitley, and L. R. Finch. 1989. Homology of mycoplasma plasmid pADB201 and staphylococcal plasmid pE194. Journal of Bacteriology 171: 593-595.

14. Bizarro, C. V., and D. C. Schuck. 2007. Purine and pyrimidine nucleotide metabolism in Mollicutes. Genetics and Molecular Biology 30: 190-201.

15. Boothby, J. T., D. E. Jasper, J. G. Zinkl, C. B. Thomas, and J. D. Dellinger. 1983. Prevalence of mycoplasmas and immune responses to Mycoplasma bovis in feedlot calves. American Journal of Veterinary Research 5: 831-838.

16. Boothby, J. T., C. E. Schore, D. E. Jasper, B. I. Osburn, and C. B. Thomas. 1988. Immune responses to Mycoplasma bovis vaccination and experimental infection in the bovine mammary gland. Canadian Journal of Veterinary Research 52: 355-359.

17. Bork, P., C. Ouzounis, G. Casari, R. Shneider, C. Sander, M. Dolan, W. Gilbert, and P. M. Gillevet. 1995. Exploring the Mycoplasma capricolum genome: a minimal cell reveals its physiology. Molecular Microbiology 16: 955-967.

18. Bzowska, A., E. Kulikowska, and D. Shugar. 2000. Purine nucleoside phosphorylases: properties, functions, and clinical aspects. Pharmacology & Therapeutics 88: 349-425.

19. Cao, J., P. A. Kapke, and F. C. Minion. 1994. Transformation of Mycoplasma gallisepticum with Tn 916 , Tn 4001 , and integrative plasmid vectors. Journal of Bacteriology 176: 4459-4462.

20. Carson, J. L., A. M. Collier, and S. C. Hu. 1980. Ultrastructural observations on cellular and subcellular aspects of experimental Mycoplasma pneumoniae disease. Infection and Immunity 29: 1117-1124.

21. Caswell, J. L., and M. Archambault. 2007. Mycoplasma bovis pneumonia in cattle. Animal Health Research Reviews 8: 161-186.

22. Chambaud, I., H. Wroblewski, and A. Blanchard. 1999. Interactions between mycoplasma lipoproteins and the host immune system. Trends in Microbiology 7: 493-499.

23. Chang, C. J., and T. A. Chen. 1982. Spiroplasmas: cultivation in chemically defined medium. Science 215: 1121-1122.

24. Cherry, J. D., and D. Taylor-Robinson. 1970. Growth and pathogenesis of Mycoplasma mycoides var. capri in chicken embryo tracheal organ cultures. Infection and Immunity 2: 431-438.

25. Chiang, S. L., J. J. Mekalanos, and D. W. Holden. 1999. In vivo genetic analysis of bacterial virulence. Annual Review of Microbiology 53: 129-154.

26. Chopra-Dewasthaly, R., M. Marenda, R. Rosengarten, W. Jechlinger, and C. Citti. 2005. Construction of the first shuttle vectors for gene cloning and homologous recombination in Mycoplasma agalactiae . FEMS Microbiology Letters 253: 89-94.

27. Citti, C., and K. S. Wise. 1995. Mycoplasma hyorhinis vlp gene transcription: critical role in phase variation and expression of surface lipoproteins. Molecular Microbiology 18: 649-660.

28. Clewell, D. B., S. E. Flannagan, and D. D. Jaworski. 1995. Unconstrained bacterial promiscuity: the Tn 916 -Tn1545 family of conjugative transposons. Trends in Microbiology 3: 229-236.

29. Cohen, G., and N. L. Somerson. 1969. Glucose-dependent secretion and destruction of hydrogen peroxide by Mycoplasma pneumoniae . Journal of Bacteriology 98: 547- 551.

30. Cole, B. C., J. R. Ward, and C. H. Martin. 1968. Hemolysin and peroxide activity of Mycoplasma species. Journal of Bacteriology 95: 2022-2030.

31. Collier, A. M. 1983. Attachment by Mycoplasma and its role in diseases. Reviews of Infectious Dieseases 5: S685-S690.

32. Collier, A. M., and J. B. Baseman. 1973. Organ culture techniques with mycoplasma. Annals of the New York Academy of Sciences 225: 277-289.

33. Collins, D. M., B. Skou, S. White, S. Bassett, L. Collins, R. For, K. Hurr, G. Hotter, and G. W. de Lisle. 2005. Generation of attenuated Mycobacterium bovis strains by signature-tagged mutagenesis for discovery of novel vaccine candidates. Infection and Immunity 73: 2379-2386.

34. Cordova, C. M. M., C. Lartigue, P. Sirand-Pugnet, J. Renaudin, R. A. F. Cunha, and A. Blanchard. 2002. Identification of the origin of replication of the Mycoplasma pulmonis chromosome and its use in oriC replicative plasmids. Journal of Bacteriology 184: 5426-5435.

35. Costerton, J. W., K. J. Cheng, G. G. Geesey, T. I. Ladd, J. C. Nickel, M. Dasgupta, and T. J. Marrie. 1987. Bacterial biofilms in nature and disease. Annual Review of Microbiology 41: 435-464.

36. Dahl, J. 1988. Uptake of fatty acids by Mycoplasma capricolum . Journal of Bacteriology 170: 2022-2026.

37. Davidson, A. L., and J. Chen. 2004. ATP-binding cassette transporters in bacteria. Annual Review of Biochemistry 73: 241-268.

38. Davidson, A. L., E. Dassa, C. Orelle, and J. Chen. 2008. Structure, function, and evolution of bacterial ATP-binding cassette systems. Microbiology and Molecular Biology Reviews 72: 317-364.

39. Dhandayuthapani, S., W. G. Rasmussen, and J. B. Baseman. 1999. Disruption of gene mg218 of Mycoplasma genitalium through homologous recombination leads to an adherence-deficient phenotype. Proceedings of the National Academy of Sciences of the United States of America 96: 5227-5232.

40. Droesse, M., G. Tangen, I. Gummelt, H. Kirchhoff, L. R. Washburn, and R. Rosengarten. 195. Major membrane proteins and lipoproteins as highly variable immunogenic surface components and strain-specific antigenic markers of Mycoplasma arthritidis . Microbiology 141: 3207-3219.

41. Dybvig, K. 1992. Gene transfer, p. 355-361. In J. Maniloff, R. N. McElhaney, L. R. Finch, and J. Baseman (ed.), Mycoplasmas: molecular biology and pathogenesis. American Society for Microbiology, Washington.

42. Dybvig, K. 1990. Mycoplasmal genetics. Annual Review of Microbiology 44: 81- 104.

43. Dybvig, K., and J. Alderete. 1988. Transformation of Mycoplasma pulmonis and Mycoplasma hyorhinis : Transposition of Tn 916 and formation of cointegrate structures. Plasmid 20: 33-41.

44. Dybvig, K., and G. H. Cassell. 1987. Transposition of gram-positive transposon Tn 916 in Acholeplasma laidlawii and Mycoplasma pulmonis . Science 235: 1392- 1394.

45. Dybvig, K., C. T. French, and L. L. Voelker. 2000. Construction and use of derivatives of transposon Tn4001 that function in Mycoplasma pulmonis and Mycoplasma arthritidis . Journal of Bacteriology 182: 4343-4347.

46. Dybvig, K., and M. Khaled. 1990. Isolation of a second cryptic plasmid from Mycoplasma mycoides subsp. mycoides . Plasmid 24: 153-155.

47. Dybvig, K., and L. L. Voelker. 1996. Molecular biology of mycoplasmas. Annual Review of Microbiology 50: 25-57.

48. Fenske, J. D., and G. E. Kenny. 1976. Role of arginine deiminase in growth of Mycoplasma hominis. Journal of Bacteriology 126: 501-510.

49. Finch, L. R., and A. Mitchell. 1992. Sources of nucleotides, p. 211-230. In J. Maniloff, R. N. McElhaney, L. R. Finch, and J. B. Baseman (ed.), Mycoplasmas; Molecular biology and pathogenesis. American Society for Microbiology, Washington DC.

50. Fleury, B., D. Bergonier, X. Berthelot, E. Peterhans, J. Frey, and E. M. Vilei. 2002. Characterization of P40, a cytadhesin of Mycoplasma agalactiae . Infection and Immunity 70: 5612-5621.

51. Fleury, B., D. Bergonier, X. Berthelot, Y. Schlatter, J. Frey, and E. M. Vilei. 2001. Characterization and analysis of a stable serotype-associated membrane protein (P30) of Mycoplasma agalactiae . Journal of Clinical Microbiology 39: 2814-2822.

52. Franke, A. E., and D. B. Clewell. 1981. Evidence for a chromosome-borne resistance transposon (Tn 916 ) in Streptococcus faecalis that is capable of "conjugal" transfer in the absence of a conjugative plasmid. Journal of Bacteriology 145: 494- 502.

53. Fraser, C. M., J. D. Gocayne, O. White, M. D. Adams, R. A. Clayton, R. D. Fleischmann, C. J. Bult, A. R. Kerlavage, G. Sutton, J. M. Kelley, J. L. Fritchman, J. F. Weidman, K. V. Small, M. Sandusky, J. Fuhrmann, D. Nguyen, T. R. Utterback, D. M. Saudek, C. A. Phillips, J. M. Merrick, J. Tomb, B. A. Dougherty, K. F. Bott, P. C. Hu, T. S. Lucier, S. N. Peterson, H. O. Smith, C. A. Hutchison, and J. C. Venter. 1995. The minimal gene complement of Mycoplasma genitalium . Science 270: 397-403.

54. French, C. T., P. Lao, A. E. Loraine, B. T. Matthews, H. Yu, and K. Dybvig. 2008. Large-scale transposon mutagenesis of Mycoplasma pulmonis . Molecular Microbiology 69: 67-76.

55. Furness, G., and A. M. Cerone. 1979. Preparation of competent single-cell suspensions of Mycoplasma hominis tets and Mycoplasma salivarium tets for genetic transformation to tetracycline resistance by DNA extracted from Mycoplasma hominis tetr . The Journal of Infectious Diseases 139: 444-451.

56. Gardella, R. S., and R. A. Del Giudice. 1995. Growth of Mycoplasma hyorhinis cultivar alpha on semisynthetic medium. Applied and Environmental Microbiology 61: 1976-1979.

57. Geary, S. J., M. E. Tourellotte, and J. A. Cameron. 1981. Inflammatory toxin from Mycoplasma bovis : isolation and characterization. Science 211: 1032-1033.

58. Glass, J. I., N. Assad-Garcia, N. Apperovich, S. Yooseph, M. R. Lewis, M. Maruf, C. A. Hutchison, H. O. Smith, and J. C. Venter. 2006. Essential genes of a minimal bacterium. Proceedings of the National Academy of Sciences of the United States of America 103: 425-430.

59. Glass, J. I., E. J. Lefkowitz, J. S. Glass, C. R. Heiner, E. Y. Chen, and G. H. Cassell. 2000. The complete sequence of the mucosal pathogen Ureaplasma urealyticum . Nature 407: 757-762.

60. Goffeau, A. 1995. Life with 482 genes. Science 270: 445-446.

61. Gong, H., F. Zolzer, G. von Recklinghausen, J. Rossler, S. Breit, W. Havers, T. Fotsis, and L. Schweigerer. 1999. Arginine deiminase inhibits cell proliferation by arresting cell cycle and inducing apoptosis. Biochemical and Biophysical Research Communications 261: 10-14.

62. Guindy, Y. S., T. Samuelsson, and T. I. Johansen. 1989. Unconventional codon reading by Mycoplasma mycoides tRNAs as revealed by partial sequence analysis. Biochemical Journal 258: 869–873.

63. Hackett, K. J., A. S. Ginsberg, S. Rottem, R. B. Henegar, and R. F. Whitcomb. 1987. A defined medium for a fastidious Spiroplasma. Science 237: 525-527.

64. Halbedel, S., and J. Stulke. 2007. Tools for the genetic analysis of Mycoplasma. International Journal of Medical Microbiology 297: 37-44.

65. Hale, H. H., C. F. Helmboldt, W. N. Plastridge, and E. F. Stula. 1962. Bovine mastitis caused by Mycoplasma species. Cornell Veterinarian 52: 582-591.

66. Hames, C., S. Halbedel, M. Hoppert, J. Frey, and J. Stulke. 2009. Glycerol metabolism is important for cytotoxicity of Mycoplasma pneumoniae . Journal of Bacteriology 191: 747-753.

67. Hedreyda, C. T., K. K. Lee, and D. C. Krause. 1993. Transformation of Mycoplasma pneumoniae with Tn4001 by electroporation. Plasmid 30: 170-175.

68. Hermann, R. 1992. Genome structure and organization, p. 157-168. In B. J. (ed.), Mycoplasmas: molecular biology and pathogenesis. American Society for Microbiology, Washington.

69. Herrmann, R. 1992. Genome structure and organization, p. 157-168. In J. Maniloff, R. N. McElhaney, L. R. Finch, and J. Baseman (ed.), Mycoplasmas: molecular biology and pathogenesis. American Society for Microbiology, Washington.

70. Higgins, C. F. 1992. ABC transporters: from microorganisms to man. Annual Review of Cell Biology 8: 67-113.

71. Himmelreich, R., H. Hilbert, H. Plagens, E. Pirkl, B. C. Li, and R. Herrmann. 1996. Complete sequence analysis of the genome of the bacterium Mycoplasma pneumoniae . Nucleic Acid Research 24: 4420-4449.

72. Howard, C. J. 1984. Comparison of bovine IgG1, IgG2 and IgM for ability to promote killing of Mycoplasma bovis by bovine alveolar macrophages and neutrophils. Veterinary Immunology and Immunopathology 6: 321-326.

73. Howard, C. J., G. Taylor, J. Collins, and R. N. Gourlay. 1976. Interaction of Mycoplasma dispar and Mycoplasma agalactiae subsp. bovis with bovine alveolar macrophages and bovine lacteal polymorphonuclear leukocytes. Infection and Immunity 14: 11-17.

74. Hu, P. C., U. Schaper, A. M. Collier, W. A. Clyde, Jr, M. Horikawa, Y. S. Huang, and M. F. Barile. 1987. A Mycoplasma genitalium protein resembling the Mycoplasma pneumoniae attachment protein. Infection and Immunity 55: 1126-1131.

75. Hudson, P., T. S. Gorton, L. Papazisi, K. Cecchini, S. Frasca, Jr., and S. J. Geary. 2006. Identification of a virulence-associated determinant, dihydrolipoamide dehydrogenase ( lpd ), in Mycoplasma gallisepticum through in vivo screening of transposon mutants. Infection and Immunity 74: 931-939.

76. Hutchison, C. A., III, S. N. Peterson, S. R. Gill, R. T. Cline, O. White, C. M. Fraser, H. O. Smith, and J. Craig Venter. 1999. Global transposon mutagenesis and a minimal mycoplasma genome. Science 286: 2165-2169.

77. Hutchison, C. A., S. N. Peterson, S. R. Gill, R. T. Cline, O. White, C. M. Fraser, H. O. Smith, and J. C. Venter. 1999. Global transposon mutagenesis and a minimal mycoplasma genome. Science 286: 21652169.

78. Inamine, J. M., K. C. Ho, S. Loechel, and P. C. Hu. 1990. Evidence that UGA is read as a tryptophan codon rather than as a stop codon by Mycoplasma pneumoniae , Mycoplasma genitalium, and Mycoplasma gallisepticum . Journal of Bacteriology 172: 504-506.

79. Janis, C., D. Bischof, G. Gourgues, J. Frey, A. Blanchard, and P. Sirand-Pugnet. 2008. Unmarked insertional mutagenesis in the bovine pathogen Mycoplasma mycoides subsp. mycoides SC: characterization of a lppQ mutant. Microbiology 154: 2427-2436.

80. Janis, C., C. Lartigue, J. Frey, H. Wroblewski, F. Thiaucourt, A. Blanchard, and P. Sirand-Pugnet. 2005. Versatile use of oriC plasmids for functional genomics of Mycoplasma capricolum subsp. capricolum . Applied and Environmental Microbiology 71: 2888-2893.

81. Kannan, T. R., and J. B. Baseman. 2006. ADP-ribosylating and vacuolating cytotoxin of Mycoplasma pneumoniae represents unique virulence determinant among bacterial pathogens. Proceedings of the National Academy of Sciences of the United States of America 103: 6724-6729.

82. Kapatais-Zoumbos, K., D. K. Chandler, and M. F. Barile. 1985. Survey of immunoglobulin A protease activity among selected species of Ureaplasma and Mycoplasma : specificity for host immunoglobulin A. Infection and Immunity 47: 704- 709.

83. Katada, T., and M. Ui. 1982. ADP ribosylation of the specific membrane protein of C6 cells by islet- activating protein associated with modification of adenylate cyclase activity. Journal of Biological Chemistry 257: 7210-7216.

84. Khan, L. A., G. R. Loria, A. S. Ramirez, R. A. Nicholas, R. J. Miles, and M. D. Fielder. 2005. Biochemical characterisation of some non fermenting, non arginine hydrolysing mycoplasmas of ruminants. Veterinary Microbiology 109: 129-134.

85. Khan, L. A., R. J. Miles, and R. A. Nicholas. 2005. Hydrogen peroxide production by Mycoplasma bovis and Mycoplasma agalactiae and effect of in vitro passage on a Mycoplasma bovis strain producing high level of H 2O2. Veterinary Research Communications 29: 181-188.

86. King, K. W., and K. Dybvig. 1994. Mycoplasma cloning vectors derived from plasmid pKMK1. Plasmid 31: 49-59.

87. King, K. W., and K. Dybvig. 1991. Plasmid transformation of Mycoplasma mycoides subspecies mycoides is promoted by high concentrations of polyethylene glycol. Plasmid 26: 108-115.

88. King, K. W., and K. Dybvig. 1994. Transformation of Mycoplasma capricolum and examination of DNA restriction modification in M. capricolum and Mycoplasma mycoides subsp. mycoides . Plasmid 31: 308-311.

89. Kleckner, N. 1981. Transposable elements in prokaryotes. Annual Review of Genetics 15: 341-404.

90. Knudtson, K. L., and F. C. Minion. 193. Construction of Tn4001lac derivatives to be used as promoter probe vectors in mycoplasmas. Gene 137: 217-222.

91. Koonin, E. V., A. R. Mushegian, and K. E. Rudd. 1996. Sequencing and analysis of bacterial genomes. Current Biology 6: 404-416.

92. Le Grand, D., M. Solsona, R. Rosengarten, and F. Poumarat. 1996. Adaptive surface antigen variation in Mycoplasma bovis to the host immune response. FEMS Microbiology Letters 144: 267-275.

93. Lee, I. M., and R. E. Davis. 1983. Chemically defined medium for cultivation of several epiphytic and phytopathogenic spiroplasmas. Applied and Environmental Microbiology 46: 1247-1251.

94. Lee, S.-W., G. F. Browning, and P. F. Markham. 2008. Development of a replicable oriC plasmid for Mycoplasma gallisepticum and Mycoplasma imitans , and gene disruption through homologous recombination in M. gallisepticum . Microbiology 154: 2571-2580.

95. Levisohn, S., R. Rosengarten, and D. Yogev. 1995. In vivo variation of Mycoplasma gallisepticum antigen expression in experimentally infected chickens. Veterinary Microbiology 45: 219-231.

96. Lichtensteiger, C. A., and E. R. Vimr. 2001. Signature-tagged mutagenesis to identify virulence genes in Salmonella choleraesuis , p. 193199, PorkNet, Swine Research Report.

97. Liss, A., and J. Maniloff. 1972. Transfection mediated by Mycoplasmatales viral DNA. Proceedings of the National Academy of Sciences of the United States of America 69: 3423–3427.

98. Lorenz, A., W. Just, M. da Silva Cardoso, and G. Klotz. 1988. Electroporation- mediated transfection of Acholeplasma laidlawii with mycoplasma virus L1 and L3 DNA. Journal of Virology 62: 3050-3052.

99. Lyon, B. R., J. W. May, and R. A. Skurray. 1984. Tn4001: a gentamicin and kanamycin resistance transposon in Staphylococcus aureus . Molecular General Genetics 3: 554-6.

100. Lyon, B. R., and R. Skurray. 1987. Antimicrobial resistance of Staphylococcus aureus : genetic basis. Microbiology and Molecular Biology Reviews 51: 88-134.

101. Lysnyansky, I., Y. Ron, and D. Yogev. 2001. Juxtaposition of an active promoter to vsp genes via site-specific DNA inversions generates antigenic variation in Mycoplasma bovis . Journal of Bacteriology 183: 5698-5708.

102. Lysnyansky, I., D. Yogev, and S. Levisohn. 208. Molecular characterization of the Mycoplasma bovis p68 gene, encoding a basic membrane protein with homology to p48 of Mycoplasma agalactiae . FEMS Microbiology Letters 278: 234-242.

103. Mahairas, G. G., J. A. Cao, and F. C. Minion. 1990. Genetic exchange of transposon and integrative plasmid markers in Mycoplasma pulmonis. Journal of Bacteriology 172: 2267-2272.

104. Mahairas, G. G., and F. C. Minion. 1989. Random insertion of the gentamicin resistance transposon Tn 4001 in Mycoplasma pulmonis . Plasmid 21: 43-47.

105. Matthysse, A. G., H. A. Yarnall, and N. Young. 1996. Requirement for genes with homology to ABC transport systems for attachment and virulence of Agrobacterium tumefaciens . Journal of Bacteriology 178: 5302-5308.

106. McAuliffe, L., R. J. Ellis, K. Miles, R. D. Ayling, and R. A. J. Nicholas. 2006. Biofilm formation by mycoplasma species and its role in environmental persistence and survival. Microbiology 152: 913-922.

107. Mcivor, R. S., and G. E. Kenny. 1978. Differences in incorporation of nucleic acid bases and nucleosides by various Mycoplasma and Acholeplasma species. Journal of Bacteriology 135: 483-489.

108. Miles, R. J. 1992. Catabolism in mollicutes. Journal of General Microbiology 138: 1773-1783.

109. Miles, R. J. 1992. Cell nutrient and growth, p. 23-40. In J. Maniloff, R. N. McElhaney, L. R. Finch, and J. B. Baseman (ed.), Mycoplasmas: molecular biology and pathogenesis. American Society for Microbiology, Washington.

110. Minion, F. C., K. J. Jarvill-Taylor, D. E. Billings, and E. Tigges. 1993. Membrane-associated nuclease activities in mycoplasmas. Journal of Bacteriology 175: 7842-7847.

111. Minion, F. C., E. J. Lefkowitz, M. L. Madsen, B. J. Cleary, S. M. Swartzell, and G. G. Mahairas. 2004. The genome sequence of Mycoplasma hyopneumoniae strain 232, the agent of swine mycoplasmosis. Journal of Bacteriology 186: 7123-7133.

112. Mitchell, A., and L. R. Finch. 1977. Pathways of nucleotide biosynthesis in Mycoplasma mycoides subsp. mycoides . Journal of Bacteriology 130: 1047-1054.

113. Mitchell, A., I. L. Sin, and L. R. Finch. 1978. Enzymes of purine metabolism in Mycoplasma mycoides subsp. mycoides . Journal of Bacteriology 134: 706-712.

114. Neale, G., A. Mitchell, and L. R. Finch. 1983. Enzymes of pyrimidine deoxyribonucleoside metabolism in Mycoplasma mycoides subsp. mycoides . Journal of Bacteriology 156: 1001-1005.

115. Neale, G. A. M., A. Mitchell, and L. R. Finch. 1984. Uptake and utilization of deoxynucleoside 5'-monophosphates by Mycoplasma mycoides subsp. mycoides . Journal of Bacteriology 158: 943-947.

116. Nicholas, R. A., and R. D. Ayling. 2003. Mycoplasma bovis : disease, diagnosis, and control. Research in Veterinary Science 74: 105-112.

117. Nicolas, M. F., F. G. Barcellos, P. N. Hess, and M. Hungria. 2007. ABC transporter in Mycoplasma hyopneumoniae and Mycoplasma synoviae : insight into evolution and pathogenicity. Genetics and Molecular Biology 30: 202-211.

118. Noormohammadi, A. H., P. F. Markham, K. G. Whithear, I. D. Walker, V. A. Gurevich, D. H. Ley, and G. F. Browning. 1997. Mycoplasma synoviae has two distinct phase-variable major membrane antigens, one of which is a putative hemagglutinin. Infection and Immunity 65: 2542-2547.

119. Nussbaum, S., I. Lysnyansky, K. Sachse, S. Levisohn, and D. Yogev. 2002. Extended repertoire of genes encoding variable surface lipoproteins in Mycoplasma bovis strains. Infection and Immunity 70: 2220-2225.

120. Paddenberg, R., A. Weber, S. Wulf, and H. G. Mannherz. 1998. Mycoplasma nucleases able to induce internucleosomal DNA degradation in cultured cells possess many characteristics of eukaryotic apoptotic nucleases. Cell Death & Differentiation 5: 517-528.

121. Pfutzner, H., and K. Sachse. 1996. Mycoplasma bovis is an agent of mastitis, pneumonia, arthritis and genital disorders in cattle. Revue Scientifique et Technique / Office International des Epizooties 15: 1477-1494.

122. Pijoan, C. 1974. Secretion of hydrogen peroxide by some common pig mycoplasmas. Veterinary Record 95: 316-217.

123. Pilo, P., E. M. Vilei, E. Peterhans, L. Bonvin-Klotz, M. H. Stoffel, D. Dobbelaere, and J. Frey. 2005. A metabolic enzyme as a primary virulence factor of Mycoplasma mycoides subsp. mycoides small colony. Journal of Bacteriology 187: 6824-6831.

124. Pollack, J. D. 2002. The necessity of combining genomic and enzymatic data to infer metabolism function and pathway in the smallest bacteria: amino acid, purine and pyrimidine metabolism in Mollicutes . Frontiers in Bioscience 7: d1762-1781.

125. Pollack, J. D., M. V. Williams, and R. N. McElhaney. 1997. The comparative metabolism of the mollicutes (Mycoplasmas): the utility for taxonomic classification and the relationship of putative gene annotation and phylogeny to enzymatic function in the smallest free-living cells. Critical Reviews in Microbiology 23: 269-354.

126. Pour-El, I., C. Adams, and F. C. Minion. 2002. Construction of mini-Tn 4001 tet and its use in Mycoplasma gallisepticum . Plasmid 47: 129-137.

127. Randall, C. C., and L. G. Gafford. 1965. Lability of host-cell DNA in growing cell cultures due to mycoplasma. Science 149: 1098-1099.

128. Rasmussen, O. F., M. H. Shirvan, H. Margalit, C. Christiansen, and S. Rottem. 1992. Nucleotide sequence, organization and characterization of the atp genes and the

encoded subunits of Mycoplasma gallisepticum ATPase. Biochemical Journal 285: 881-888.

129. Razin, S. 1999. Adherence of pathogenic mycoplasmas to host cells. Bioscience Reports 19: 367-372.

130. Razin, S. 1992. Mycoplasma taxonomy and ecology, p. 3-22. In J. Maniloff, R. N. McElhaney, L. R. Finch, and J. Baseman (ed.), Mycoplasmas: molecular biology and pathogenesis. American Society for Microbiology, Washington.

131. Razin, S. 1978. The mycoplasmas. Microbiological Reviews 42: 414-470.

132. Razin, S. 1962. Nucleic acid precursor requirements of Mycoplasma laidlawii . Journal of General Microbiology 28: 243-250.

133. Razin, S. 1973. Physiology of mycoplasmas. Advances in Microbial Physiology 10: 1-80.

134. Razin, S. 1969. Structure and function in Mycoplasma. Annual Review of Microbiology 23: 317-356.

135. Razin, S., L. Gottfried, and S. Rottem. 1968. Amino acid transport in Mycoplasma. Journal of Bacteriology 95: 1685-1691.

136. Razin, S., D. Yogev, and Y. Naot. 1998. Molecular biology and pathogenicity of mycoplasmas. Microbiology and Molecular Biology Reviews 62: 1095-1156.

137. Reddy, S. P., W. G. Rasmussen, and J. B. Baseman. 1996. Isolation and characterization of transposon Tn 4001 -generated, cytadherence-deficient transformants of Mycoplasma pneumoniae and Mycoplasma genitalium . FEMS Immunology and Medical Microbiology 15: 199-211.

138. Ren, Q., K. H. Kang, and I. T. Paulsen. 2004. TransportDB: a relational database of cellular membrane transport systems. Nucleic Acid Research 32: D284-288.

139. Renaudin, J., A. Marais, E. Verdin, S. Duret, X. Foissac, F. Laigret, and J. M. Bove. 1995. Integrative and free Spiroplasma citri oriC plasmids: expression of the Spiroplasma phoeniceum spiralin in Spiroplasma citri . Journal of Bacteriology 177: 2870-2877.

140. Rhee, H. J., E. J. Kim, and J. K. Lee. 2007. Physiological polyamines: simple primordial stress molecules. Journal of Cellular and Molecular Medicine 11: 685-703.

141. Roberts, M. C., and G. E. Kenny. 1987. Conjugal transfer of transposon Tn 916 from Streptococcus faecalis to Mycoplasma hominis. Journal of Bacteriology 169: 3836-3839.

142. Rodriguez, F., D. G. Bryson, H. J. Ball, and F. Forster. 1996. Pathological and immunohistochemical studies of natural and experimental Mycoplasma bovis pneumonia in calves. Journal of Comparative Pathology 115: 151-162.

143. Rodwell, A. W. 1969. A defined medium for Mycoplasma strain Y. Journal of General Microbiology 58: 39-47.

144. Rodwell, A. W. 1960. Nutrition and metabolism of Mycoplasma mycoides var. mycoides . Annals of the New York Academy of Sciences 79: 499-507.

145. Romano, N., S. Rottem, and S. Razin. 1976. Biosynthesis of saturated and unsaturated fatty acids by a T-strain mycoplasma (Ureaplasma). Journal of Bacteriology 128: 170-173.

146. Rosengarten, R., and K. S. Wise. 1990. Phenotypic switching in mycoplasmas: phase variation of diverse surface lipoproteins. Science 247: 315-318.

147. Rottem, S., and S. Razin. 1969. Sugar transport in Mycoplasma gallisepticum . Journal of Bacteriology 97: 787-792.

148. Sachse, K., C. Grajetzki, R. Rosengarten, I. Hanel, M. Heller, and H. Pfutzner. 1996. Mechanisms and factors involved in Mycoplasma bovis adhesion on host cells. Zentralbl Bakteriol 284: 80-92.

149. Sachse, K., J. H. Helbig, I. Lysnyansky, C. Grajetzki, W. Muller, E. Jacobs, and D. Yogev. 2000. Epitope mapping of immunogenic and adhesive structures in repetitive domains of Mycoplasma bovis variable surface lipoproteins. Infection and Immunity 68: 680-687.

150. Sachse, K., H. Pfutzner, M. Heller, and I. Hanel. 1993. Inhibition of Mycoplasma bovis cytadherence by a monoclonal antibody and various carbohydrate substances. Veterinary Microbiology 36: 307-316.

151. Sasaki, Y., J. Ishikawa, A. Yamashita, K. Oshima, T. Kenri, K. Furuya, C. Yoshino, A. Horino, T. Shiba, T. Sasaki, and M. Hattori. 2002. The complete genomic sequence of Mycoplasma penetrans , an intracellular bacterial pathogen in humans. Nucleic Acids Research 30: 5293-5300.

152. Shah, P., D. G. Romero, and E. Swiatlo. 2008. Role of polyamine transport in Streptococcus pneumoniae response to physiological stress and murine septicemia. Microbial Pathogenesis 45: 167-172.

153. Shah, P., and E. Swiatlo. 2006. Immunization with polyamine transport protein PotD protects mice against systemic infection with Streptococcus pneumoniae . Infection and Immunity 74: 5888-5892.

154. Shah, P., and E. Swiatlo. 2008. A multifaceted role for polyamines in bacterial pathogens. Molecular Microbiology 68: 4-16.

155. Simecka, J. W., J. K. Davis, M. K. Davidson, S. E. Ross, C. T. Stadtlander, and G. H. Cassell. 1992. Mycoplasma diseases of animals, p. 391-415. In J. Maniloff, R. N. McElhaney, L. R. Finch, and J. Baseman (ed.), Mycoplasmas: molecular biology and pathogenesis. American Society for Microbiology, Washington.

156. Sladek, T. L., and J. Maniloff. 1983. Polyethylene glycol-dependent transfection of Acholeplasma laidlawii with mycoplasma virus L2 DNA. Journal of Bacteriology 155: 734-741.

157. Sladek, T. L., and J. Maniloff. 1985. Transfection of REP- mycoplasmas with viral single-stranded DNA. Journal of Virology 53: 25-31.

158. Smith, D. W., and P. C. Hanawalt. 1968. Macromolecular synthesis and thymineless death in Mycoplasma laidlawii B. Journal of Bacteriology 96: 2066-2076.

159. Sokolova, I. A., A. T. Vaughan, and N. N. Khodarev. 1998. Mycoplasma infection can sensitize host cells to apoptosis through contribution of apoptotic-like endonuclease(s). Immunology & Cell Biology 76: 526-534.

160. Sugimura, K., T. Ohno, I. Azuma, and K. Yamamoto. 1993. Polymorphism in genes for the enzyme arginine deiminase among Mycoplasma species. Infection and Immunity 61: 329-331.

161. Talkington, D. F., M. T. Fallon, H. L. Watson, R. K. Thorp, and G. H. Cassell. 1989. Mycoplasma pulmonis V-1 surface protein variation: occurrence in vivo and association with lung lesions. Microbial Pathogenesis 7: 429-436.

162. Thomas, A., F. Aleu, M. W. Bitensky, M. Davidson, and B. Gesner. 1966. Studies of PPLO infection. II. The neurotoxin of Mycoplasma neurolyticum . Journal of Experimental Medicine 124: 1067-1082.

163. Thomas, A., K. Sachse, I. Dizier, C. Grajetzki, F. Farnir, J. G. Mainil, and A. Linden. 2003. Adherence to various host cell lines of Mycoplasma bovis strains differing in pathogenic and cultural features. Veterinary Microbiology 91: 101-113.

164. Thomas, C. B., P. V. Ess, L. J. Wolfgram, J. Riebe, P. Sharp, and R. D. Schultz. 1991. Adherence to bovine neutrophils and suppression of neutrophils chemilunescence by Mycoplasma bovis . Veterinary Immunology and Immunopathology 27: 365-381.

165. Thomas, C. B., J. Mettler, P. Sharp, J. Jensen-Kostenbader, and R. D. Schultz. 1990. Mycoplasma bovis suppression of bovine lymphocyte response to phytohemagglutinin. Veterinary Immunology and Immunopathology 26: 143-155.

166. Thomas, L. 1967. The neurotoxins of M. neuolyticum and M. gallisepticum . Annals of the New York Academy of Sciences 143: 218-224.

167. Thomas, W. B., C. M. Lyman, R. W. Moore, and L. C. Grumbles. 1969. A partially defined (synthetic) medium for Mycoplasma gallisepticum . American Journal of Veterinary Research 30: 2021-2026.

168. Thorns, C. J., and E. Boughton. 1980. Effect of serial passages through liquid medium on the virulence of Mycoplasma bovis for the mouse mammary gland. Research in Veterinary Science 29: 328-332.

169. Tourtellotte, M. E., H. J. Morowitz, and P. Kasimer. 1964. Defined medium for Mycoplasma laidlawii . Journal of Bacteriology 88: 11-15.

170. Tozzi, M. G., M. Camici, L. Mascia, F. Sgarrella, and P. L. Ipata. 2006. Pentose phosphates in nucleoside interconversion and catabolism. FEBS Journal 273: 1089- 1101.

171. Tryon, V. V., and J. Baseman. 1992. Pathogenic determinants and mechanisms, p. 457-471. In J. Maniloff, R. N. McElhaney, L. R. Finch, and J. Baseman (ed.), Mycoplasmas: molecular biology and pathogenesis. American Society for Microbiology, Washington.

172. van Diemen, P. M., F. Dziva, M. P. Stevens, and T. S. Wallis. 2005. Identification of enterohemorrhagic Escherichia coli O26:H- genes required for intestinal colonization in calves. Infection and Immunity 73: 1735-1743.

173. Vanden Bush, T. J., and R. F. Rosenbusch. 2004. Characterization of a lympho- inhibitory peptide produced by Mycoplasma bovis . Biochemical and Biophysical Research Communications 315: 336-341.

174. Vilei, E. M., E.-M. Abdo, J. Nicolet, A. Botelho, R. Goncalves, and J. Frey. 2000. Genomic and antigenic differences between the European and African/Australian clusters of Mycoplasma mycoides subsp. mycoides SC. Microbiology 146: 477-486.

175. Vilei, E. M., and J. Frey. 2001. Genetic and biochemical characterization of glycerol uptake in Mycoplasma mycoides subsp. mycoides SC: Its impact on H 2O2 production and virulence. Clinical and Diagnostic Laboratory Immunology 8: 85-92.

176. Voelker, L. L., and K. Dybvig. 1996. Gene transfer in Mycoplasma arthritidis : transformation, conjugal transfer of Tn 916 , and evidence for a restriction system recognizing AGCT. Journal of Bacteriology 178: 6078-6081.

177. Voet, D., and J. G. Voet. 1990. Nucleotide metabolism, p. 740-768, Biochemistry. John Wiley & Sons, New York.

178. Ware, D., Y. Jiang, W. Lin, and E. Swiatlo. 2006. Involvement of potD in Streptococcus pneumoniae polyamine transport and pathogenesis. Infection and Immunity 74: 352-361.

179. Westberg, J., A. Persson, A. Holmberg, A. Goesmann, J. Lundeberg, K. E. Johansson, B. Pettersson, and M. Uhlen. 2007. The genome sequence of Mycoplasma mycoides subsp. mycoides SC type strain PG1 T, the causative agent of contagious bovine pleuropneumoniae(CBPP). Genomic Research 14: 221-227.

180. Whetzel, P. L., L. L. Hnatow, J. Keeler, Calvin L., and J. E. Dohms. 2003. Transposon mutagenesis of Mycoplasma gallisepticum . Plasmid 49: 34-43.

181. Whitley, J. C., and L. R. Finch. 1989. Location of sites of transposon Tn 916 insertion in the Mycoplasma mycoides genome. Journal of Bacteriology 171: 6870- 6872.

182. Woese, C. R. 1987. Bacterial evolution. Microbiology and Molecular Biology Reviews 51: 221-271.

183. Woese, C. R., J. Maniloff, and L. B. Zablen. 1980. Phylogenetic analysis of the mycoplasmas. Proceedings of the National Academy of Sciences of the United States of America 77: 494-498.

184. Yamao, F., S. Iwagami, Y. Azumi, A. Muto, S. Osawa, N. Fujita, and A. Ishihama. 1988. Evolutionary dynamics of tryptophan tRNAs in Mycoplasma capricolum . Molecular General Genetics 212: 364-9.

185. Yogev, D., R. Rosengarten, R. Watson-McKown, and K. S. Wise. 1991. Molecular basis of Mycoplasma surface antigenic variation: a novel set of divergent genes undergo spontaneous mutation of periodic coding regions and 5' regulatory sequences. The EMBO Journal 10: 4069-4079.

186. Youil, R., and L. R. Finch. 1988. Isolation and characterization of Mycoplasma mycoides subsp. mycoides mutants deficient in nucleoside monophosphate transport. Journal of Bacteriology 170: 5922-5924.

187. Zhang, Q., and K. S. Wise. 1996. Molecular basis of size and antigenic variation of a Mycoplasma hominis adhesin encoded by divergent vaa genes. Infection and Immunity 64: 2737-2744.

CHAPTER 2. GENOME CHARACTERIZATION OF MYCOPLASMA BOVIS STRAIN M23 BY MEANS OF A RANDOM INSERTION MUTANT LIBRARY

Abstract Mycoplasma bovis is the etiological agent for several diseases of cattle and causes substantial economic losses to the cattle industry. Despite its economic significance, limited progress has been made in understanding the biology and pathogenicity of this mycoplasma, due to the lack of efficient tools to genetically manipulate the pathogen. In this study, we constructed a Tn 4001 -based plasmid (pRIT-1) carrying tetracycline resistance. Using plasmid pRIT-1, a total of 1,340 random mutants of the pathogenic M. bovis strain M23 was generated, sequenced, and evaluated. By comparison with the annotated Mycoplasma agalactiae PG2 genome and the arbitrarily annotated M. bovis PG45 genome, we obtained 1,142 distinct transposon insertion sites in the chromosome of M. bovis mutants. With further analysis, 324 genes out of 663 genes assigned to M. bovis were disrupted by transposon insertion events. Relative to genes categorized as essential in other mycoplasmas, 21 were identified as dispensable genes in M. bovis . The availability of a random mutant library will open an avenue to study the biology and pathogenesis of M. bovis .

Introduction The availability of a large number of complete genome sequences has significantly aided functional exploration of the genes of a variety of microorganisms (20, 28). In addition to the increasing genomic information, there have been many advances in molecular techniques used to define functions of bacterial genes, including bioinformatics, comparative genomics, and functional genomics (1, 22, 28). This combination of massive databases and advanced techniques has resulted in markedly improved understandings about bacterial biology. However, there are still challenges remaining in determining the function of many genes encoded by microorganisms, including those genes involved in pathogenicity of specific prokaryotes (22, 23, 28). One of the possible ways to address this issue is to generate a large number of mutants and then determine the phenotypes of the resulting organisms (1, 4, 11). Thus, establishment of global mutagenesis approaches can be a significant step

38 towards dissecting the biological function of genes of uncharacterized microorganisms. This global mutagenesis strategy has been proven as a powerful method to study bacterial biology as well as to determine virulence factors in numerous bacterial pathogens (1). In Mollicutes , the complete genome sequences of 13 strains representing 11 species are currently in the public domain, and at least 12 additional strains are currently being sequenced. Despite this wealth of mycoplasma genomic sequence data, relatively limited progress has been made in studying functional genomics because of a lack of tools to genetically manipulate these organisms. Global mutagenesis has been initially employed in Mycoplasma genitalium (7), the smallest self-replicating microorganism, and further expanded to Mycoplasma pneumoniae (13), Mycoplasma arthritidis (6), and Mycoplasma pulmonis (8). In a pathogenicity study, signature-tagged mutagenesis was used to identify a virulence-associated gene in Mycoplasma gallisepticum (12). To search for desirable mutants, a large scale transposon mutagenesis has been applied in Mycoplasma mycoides subsp. mycoides (14). Mycoplasma bovis is a pathogen that causes substantial economic losses to the cattle industry. This pathogen is responsible for calf pneumonia, mastitis, arthritis, and other conditions (21, 25). The economic significance of this pathogen has led to extensive studies to develop diagnostic methods and preventive measures against M. bovis disease, the latter with limited success due to a lack of knowledge about pathogenicity markers. The limited availability of genetic tools for this pathogen has made it difficult to study the basic biology and pathogenicity of the microorganism, and thus to improve approaches for prevention and control of M. bovis infection. Transformation of M. bovis with a transposon-based plasmid was reported as feasible in a preliminary study (3). Here, we report the construction of a transposon-carrying plasmid that is able to confer tetracycline resistance, and the development of a random insertion mutant library from the pathogenic M. bovis strain M23. Sequencing of transposon insertion sites on the mutants allowed the preliminary assignment of inserts to genes defined on an unannotated genome database for M. bovis . This mutant library now provides opportunity to explore the biology and pathogenicity of M. bovis .

Materials and Methods Bacterial strains and culture conditions The pathogenic M. bovis strain M23 has been isolated from a respiratory infection case in calves (27), and was grown in modified Friis medium (16) supplemented with 20%

fetal calf serum in 2% CO 2 at 37˚C. Strain M23 was used as the parent strain to generate transposon insertion mutants. This strain is highly sensitive to tetracycline (complete inhibition of growth at 2 µg/ml tetracycline). Mycoplasma transformants were selected on Friis agar plates (2 µg/ml tetracycline) and maintained in Friis broth (2 µg/ml tetracycline). For plasmid manipulation, Escherichia coli DH5 α was grown in Luria-Bertani (LB) broth or agar. Either ampicillin (50 µg/ml) or tetracycline (5 µg/ml) was added to LB broth or plates, as required.

Plasmid construction Plasmid pISM 2062 (15), pISM 1002 (19), and mini-Tn4001 tet (26) were graciously provided by F.C. Minion (Iowa State University). Plasmid pISM 2062 was used as a parent plasmid for constructs. It harbors a modified Tn 4001 containing the aacA-aphD gene for resistance to gentamicin/tobramycin/kanamycin (2). pISM 1002 that carries tetracycline resistance gene derived from Tn 916 was used to clone the tetM. The 4.98 Kb HincII fragment containing the tetM gene from plasmid pISM 1002 was collected from an agarose gel resolved by electrophoresis and purified (Gel Extraction Kit, Qiagen). Plasmid pISM 2062 was digested with SmaI, treated with calf intestinal alkaline phosphatase, and purified (PCR Purification Kit, Qiagen). SmaI-digested pISM 2062 was ligated to the tetM fragment derived from pISM 1002. The resulting plasmid (Figure 1) was named pRIT-1. The plasmid pRIT-1 construction was confirmed by restriction enzyme digestion and direct sequencing. The plasmid was amplified in E. coli DH5 α and used for M. bovis transformation.

Transformation and mutant recovery Mycoplasma transformation was performed as described previously (3, 26). Briefly, one ml of mycoplasma grown to the designated growth phase in Friis broth was harvested by centrifugation (10,000 g, 20 min, at 4 ˚C). The cells were washed three times in 1 ml chilled

40 electroporation (EP) buffer (8 mM Hepes, 272 mM sucrose, pH 7.4) by centrifugation as described above. After the final wash, the cell pellet was resuspended in 100 l of chilled EP buffer and placed on ice. A designated amount of plasmid DNA (pRIT-1, pISM 2062, or mini-tn 4001 tet) was added to the cells and the mixture placed on ice for 30 min. The cells were subjected to electroporation at 2.5 kV and 36 µF in electroporation cuvettes with 2 mm gap. The electroporated cells were transferred to 900 l of antibiotic-free Friis broth and allowed to recover at 37°C for 2hr. An aliquot (100 l) of the cells was then spread onto Friis agar plates (2 µg/ml tetracycline) at dilution sufficient to recover about 20 colonies per 150 mm plate. The plates were placed at 37°C until colonies appeared after 4-5 days. A total of 3,155 transformed colonies was picked using glass Pasteur pipettes, grown in 2 ml Friis broth (2 µg/ml tetracycline), and stored at – 70 °C for further analysis.

Analysis of Tn 4001 insertion site To analyze the Tn 4001 insertion site in individual clones, total genomic DNA was extracted from 10 ml Friis broth culture (DNA Blood Mini Kit, Qiagen). Five µg of genomic DNA was subjected to one-directional sequencing at the Iowa State University DNA facility. The sequencing primer used was the Tn 4001 -specific primer (5’-CGAGGGATTCCGAGGACTG-3’), matching sequence located on the outward end of the tetM fragment inserted into pRIT-1. With this sequencing method, approximately 600 - 900 nucleotides of genomic DNA sequence was obtained. The sequence consisted of about 100 nucleotides of a universal flanking sequence (derived from the tetM fragment within IS 256L), plus unique sequence derived from each gene where Tn 4001 was inserted. The unique sequence of 1,340 individual clones was evaluated to determine the exact insertion site of Tn 4001 . The insertion site was determined by identifying the nucleotide that matched with the very first nucleotide of unique sequence obtained from genomic sequencing. Unique sequences were then matched to sequence from the genome of M. bovis PG45 which we arbitrarily annotated as described below.

Compilation of a mutant library of M. bovis We accessed the complete but un-annotated M. bovis PG45 genome (reported by The Institute for Genomic Research in 14 contigs, access date: August, 2007). To arbitrarily annotate the PG 45 genome, we grouped all contigs in the order reported, and identified all possible open reading frames (ORFs) present (DNAMAN sequence analysis software, Lynnon, Quebec). Each ORF was analyzed by comparisons with the recently annotated Mycoplasma agalactiae PG2 genome (NC_009497) since this species is phylogenetically similar to M. bovis (24). We then identified and assigned the putative function and arbitrary position numbers for each ORF of the PG45 genome. Using arbitrarily annotated M. bovis PG45 genome, we were able to locate 1,142 distinct Tn 4001 insertion sites from our library. We also found that strain PG45 and M23 had many identical ORFs, except for mismatching of a few nucleotides on certain ORFs. The mutant library was also used to define the essential gene complement of M. bovis by comparison with genome data from other mycoplasmas.

Stability of Tn 4001 in transformants To determine the stability of transposon mutants of M. bovis in broth culture, three mutants were selected and filter-cloned three times (0.65 µm pore membrane filters). The filter-cloned mutants were grown in Friis broth in the absence or presence of 2 µg/ml tetracycline for up to 15 passages. At passage number 1, 5, 10, and 15, the cultures were harvested and dilution-plated onto Friis agar with or without 2 µg/ml tetracycline. The percentage of tetracycline resistant colonies for each mutant at each passage level was determined.

Results Plasmid pRIT-1 and transformation of M. bovis strain M23 Plasmid pRIT-1 was able to transform M. bovis strain M23 with high transformation frequency. Initial attempts to transform this organism with pISM2062 using gentamicin selection resulted in detection of spontaneous mutants and pseudo-mutants, as reported in the earlier study with M. bovis PG45 (3). Unlike gentamicin, tetracycline was able to completely

42 inhibit the growth of M. bovis M23 at the concentration of 2 µg/ml tetracycline, without recovery of spontaneous mutants (at detection level limit of 3 x10 9). Using tetracycline selection, we tried to generate mutants using plasmid mini-Tn 4001 tet, constructed to prevent the subsequent transposition of integrated transposon into other sites of the mutant chromosome. However, mini-Tn4 001 tet was unable to create mutants of M. bovis M23, consistent with the earlier study using M. bovis PG45 (3). In contrast, and regardless of insertion direction of the tetM gene, pRIT-1 was able to confer tetracycline resistance in both E. coli and M. bovis M23 and demonstrated high transformation frequency in M. bovis M23. Overall transformation frequency ranged from 2 x 10-6 to 5 x10 -8 CFU/ g/ml (Figure 2), without occurrence of spontaneous mutants. The highest transformation frequency was observed when transformation was applied to M. bovis cells harvested at early logarithmic phase (8hr) of growth and with 500 ng plasmid DNA. Addition of more than 5 g of plasmid DNA to cells dropped the transformation frequency in all conditions tested (Figure 2). The presence of the tetM gene in transformants was confirmed by PCR analysis and one- directional genomic sequencing of mutants. In addition, filter-cloned mutants were found to maintain stable tetracycline resistance when grown in Friis broth without antibiotic pressure for up to 15 passages (Figure 3), indicating that instability of transposon insertion in transformed cells was not of significant concern with M. bovis strain 23.

Tn 4001 insertion site in mutants and genome characterization We identified a total of 663 ORFs on the un-annotated M. bovis PG45 genome, covering 89% of the genes reported in M. agalactiae PG2. Since M. bovis and M. agalactiae have been considered nearly identical species (24), the anticipated number of ORFs of M. bovis would likely be around 742. Of 1,340 mutants subjected by us to insert site sequencing, 1,142 revealed to have distinctly different insertion sites. The remaining 198 mutants did not yield usable insertion site sequence data. Subsequently, 807 out of the 1,142 distinct mutants were recognized as having insertions into assigned genes of M. bovis PG45, indicating that about 70% of the inserted transposons landed into functional gene regions. The remaining 335 mutants had inserts in 188 different intergenic regions. However, these 335 intergenic insert mutants should be re-analyzed after full annotation of the M. bovis PG45 genome is

43 available. Further analysis revealed that the 807 mutants had inserts in 324 putative genes, out of our arbitrarily annotated 663 genes. Since the mutants in this study were selected as colonies grown on modified Friis agar plates, these 324 genes that were disrupted by transposon insertion are not essential genes for M. bovis . On the opposite, the remaining 339 genes out of 663, where disruptions were not recovered after analysis of 1,142 transposition incidents, are most likely essential genes for M. bovis . In contrast, 382 genes were considered to be the essential gene complement for an independently living organism, on the basis of global mutagenesis of M. genitalium and M. pneumonia (7, 10, 13). The number of non- essential genes in M. bovis PG45 might then be 360 genes by subtraction of 382 from the anticipated 742 genes. In this library, 1,142 transposition events hit about 90.8% (342/360) of the expected non-essential genes of M. bovis PG45, implying that saturation coverage of non- essential genes of M. bovis was nearly complete. As shown in Supplementary Table 1, proteins of unknown function (hypothetical proteins) and transporters were heavily represented among the non-essential genes of M. bovis . Disruption of multiple types of transporters was permissive for growth of M. bovis in rich media. These transporters included oligopeptide transporters, sugar transporters, glycerol transporters, chromate transporter, spermidine/putrescine transporter, and uncharacterized transporters. Interestingly, 21 of the genes recognized as non-essential in our library were recognized as essential in other mycoplasma species (7, 8, 10, 13). These M. bovis genes are listed in Supplementary Table 2, and include genes related to metabolic pathways and some genes involved in critical biological functions. A listing of 339 genes that did not disrupted in M. bovis is included in Supplementary Table 3.

Discussion Our successful development of a large library of random transposon mutants resulted from achieving high efficiencies of transformation, in the range of those reported for M. arthritidis and M. pneumonia using pVIT-1 (5). As reported previously (Chopra-Dewastaly et al , 2005), a low concentration of plasmid DNA in the transformation reaction was required to obtain transformants. In addition, we observed that use of very early log M. bovis cells markedly improved transformation efficiency. Finally, the replacement of the gentamicin

44 resistance marker by the tetM tetracycline resistance marker eliminated the problem associated with the recovery of large numbers of spontaneous mutants (Chopra-Dewastaly et al , 2005). It should be noted that tetracycline resistance is very common among field isolates of M. bovis (Rosenbusch et al , 2007); thus, our new strategy can only be applied to a subset of strains that are highly susceptible to this antibiotic. Interestingly, attempts to transform M. bovis M23 with mini-Tn 4001 Tet (26), which was able to confer tetracycline resistance to M. gallisepticum , were unsuccessful, consistent with a previous report with M. bovis (3). Plasmid pRIT-1 construct carrying Tn 4001 functionality plus a tetM gene was developed using a strategy similar to that used for pIVT-1 construction (5). As in that report, pRIT-1 conferred tetracycline resistance in both E. coli and M. bovis strain M23 regardless of the insert direction of the tetM gene . Importantly, the mutants generated by pRIT-1 stably maintained phenotype in liquid medium for more than 15 passages in either presence or absence of antibiotic pressure, indicating that instability of transposon insertion in mutants was not occurring. A key factor in the establishment of global mutagenesis is to generate enough mutants to approach saturation of the entire genome of the recipient host. Sequencing of insertion sites in 1,340 mutants allowed us to cover about 90% of the predicted dispensable genes of M. bovis , which may be enough to invest this library of mutants in further studies. The conception of the minimal gene complement for independent replication of an organism has been derived by subtraction of non-essential genes from the entire gene repertoire found in a fully sequenced bacterial genome. Approaches to this concept have been made by either in silico comparative genomics (9) or global mutagenesis of a microorganism (17, 29, 30). In particular, M. genitalium is recognized as the self-replicating microorganism possessing the smallest genome, 580kb in size, and the minimal number of genes has been estimated by global mutagenesis of this microorganism (7). This minimal genome of 382 genes, deduced from the essential genes in M. genitalium is continually reduced in size with data from global mutagenesis in other mycoplasma species (6-8, 10, 13). A hypothetical organism with a minimal genome would likely be a parasite heavily dependent on its host for the supply of metabolites (18). In bacteria with small genomes like the mycoplasma, the majority of genes in the minimal set are predicted to be essential, yet may be dispensable in other species with

45 larger genomes because of functional redundancy (18). The minimal genome size required for cell survival has been estimated to be about 250 genes in Bacillus subtilis, using global mutagenesis (17). The availability of a global mutant library of M. bovis should now make possible studies on the biology and pathogenicity of this mycoplasma at the molecular level. In conclusion, we demonstrated the reliability of plasmid pRIT-1 to construct a transposon- based mutant library of M. bovis M23. After arbitrary annotation of the genome of M. bovis PG45, analysis of the M23 mutant library allowed the designation of 21 dispensable genes of M. bovis that have previously been classified as essential genes in other species of mycoplasma.

References 1. Burrack, L. S., and D. E. Higgins. 2007. Genomic approaches to understanding bacterial virulence. Current Opinion in Microbiology 10: 4-9.

2. Byrne, M. E., D. A. Rouch, and R. A. Skurray. 1989. Nucleotide sequence analysis of IS256 from the Staphylococcus aureus gentamicin-tobramycin-kanamycin- resistance transposon Tn 4001 . Gene 81: 361-367.

3. Chopra-Dewasthaly, R., M. Zimmermann, R. Rosengarten, and C. Citti. 2005. First steps towards the genetic manipulation of Mycoplasma agalactiae and Mycoplasma bovis using the transposon Tn 4001 mod. International Journal of Medical Microbiology 294: 447-453.

4. Coelho, P. S., A. Kumar, and M. Snyder. 2000. Genome-wide mutant collections: toolboxes for functional genomics. Current Opinion in Microbiology 3: 309-315.

5. Dybvig, K., C. T. French, and L. L. Voelker. 2000. Construction and use of derivatives of transposon Tn4001 that function in Mycoplasma pulmonis and Mycoplasma arthritidis . Journal of Bacteriology 182: 4343-4347.

6. Dybvig, K., C. Zuhua, P. Lao, D. S. Jordan, C. T. French, A.-H. T. Tu, and A. E. Loraine. 2008. Genome of Mycoplasma arthritidis . Infection and Immunity 76: 4000- 4008.

7. Fraser, C. M., J. D. Gocayne, O. White, M. D. Adams, R. A. Clayton, R. D. Fleischmann, C. J. Bult, A. R. Kerlavage, G. Sutton, J. M. Kelley, J. L. Fritchman, J. F. Weidman, K. V. Small, M. Sandusky, J. Fuhrmann, D. Nguyen, T. R. Utterback, D. M. Saudek, C. A. Phillips, J. M. Merrick, J. Tomb, B. A. Dougherty, K. F. Bott, P. C. Hu, T. S. Lucier, S. N. Peterson, H. O. Smith, C. A.

Hutchison, and J. C. Venter. 1995. The minimal gene complement of Mycoplasma genitalium . Science 270: 397-403.

8. French, C. T., P. Lao, A. E. Loraine, B. T. Matthews, H. Yu, and K. Dybvig. 2008. Large-scale transposon mutagenesis of Mycoplasma pulmonis . Molecular Microbiology 69: 67-76.

9. Gil, R., F. J. Silva, J. Pereto, and A. Moya. 2004. Determination of the core of a minimal bacterial gene set. Microbiology and Molecular Biology Reviews 68: 518- 537.

10. Glass, J. I., N. Assad-Garcia, N. Apperovich, S. Yooseph, M. R. Lewis, M. Maruf, C. A. Hutchison, H. O. Smith, and J. C. Venter. 2006. Essential genes of a minimal bacterium. Proceedings of the National Academy of Sciences of the United States of America 103: 425-430.

11. Hensel, M., and D. W. Holden. 1996. Molecular genetic approaches for the study of virulence in both pathogenic bacteria and fungi. Microbiology 142: 1049-1058.

12. Hudson, P., T. S. Gorton, L. Papazisi, K. Cecchini, S. Frasca, Jr., and S. J. Geary. 2006. Identification of a virulence-associated determinant, dihydrolipoamide dehydrogenase ( lpd ), in Mycoplasma gallisepticum through in vivo screening of transposon mutants. Infection and Immunity 74: 931-939.

13. Hutchison, C. A., S. N. Peterson, S. R. Gill, R. T. Cline, O. White, C. M. Fraser, H. O. Smith, and J. C. Venter. 1999. Global transposon mutagenesis and a minimal mycoplasma genome. Science 286: 21652169.

14. Janis, C., D. Bischof, G. Gourgues, J. Frey, A. Blanchard, and P. Sirand-Pugnet. 2008. Unmarked insertional mutagenesis in the bovine pathogen Mycoplasma mycoides subsp. mycoides SC: characterization of a lppQ mutant. Microbiology 154: 2427-2436.

15. Knudtson, K. L., and F. C. Minion. 1993. Construction of Tn 4001 lac derivatives to be used as promoter probe vectors in mycoplasmas. Gene 137: 217-222.

16. Knudtson, W. U., D. E. Reed, and G. Daniels. 1986. Identification of mycoplasmatales in pneumonic calf lungs. Veterinary Microbiology 11: 79-91.

17. Kobayashi, K., S. D. Ehrlich, A. Albertini, G. Amati, K. K. Andersen, M. Arnaud, K. Asai, S. Ashikaga, S. Aymerich, P. Bessieres, F. Boland, S. C. Brignell, S. Bron, K. Bunai, J. Chapuis, L. C. Christiansen, A. Danchin, M. DÃ©barbouillÃ©, E. Dervyn, E. Deuerling, K. Devine, S. K. Devine, O. Dreesen, J. Errington, S. Fillinger, S. J. Foster, Y. Fujita, A. Galizzi, R. Gardan, C. Eschevins, T. Fukushima, K. Haga, C. R. Harwood, M. Hecker, D. Hosoya, M. F. Hullo, H. Kakeshita, D. Karamata, Y. Kasahara, F. Kawamura, K. Koga, P.

Koski, R. Kuwana, D. Imamura, M. Ishimaru, S. Ishikawa, I. Ishio, D. Le Coq, A. Masson, C. MauÃ«l, R. Meima, R. P. Mellado, A. Moir, S. Moriya, E. Nagakawa, H. Nanamiya, S. Nakai, P. Nygaard, M. Ogura, T. Ohanan, M. O'Reilly, M. O'Rourke, Z. Pragai, H. M. Pooley, G. Rapoport, J. P. Rawlins, L. A. Rivas, C. Rivolta, A. Sadaie, Y. Sadaie, M. Sarvas, T. Sato, H. H. Saxild, E. Scanlan, W. Schumann, J. F. M. L. Seegers, J. Sekiguchi, A. Sekowska, S. J. SÃ©ror, M. Simon, P. Stragier, R. Studer, H. Takamatsu, T. Tanaka, M. Takeuchi, H. B. Thomaides, V. Vagner, J. M. van Dijl, K. Watabe, A. Wipat, H. Yamamoto, M. Yamamoto, Y. Yamamoto, K. Yamane, K. Yata, K. Yoshida, H. Yoshikawa, U. Zuber, and N. Ogasawara. 2003. Essential Bacillus subtilis genes. Proceedings of the National Academy of Sciences of the United States of America 100: 4678-4683.

18. Koonin, E. V., and A. R. Mushegian. 1996. Complete genome sequences of cellular life forms: glimpses of theoretical evolutionary genomics. Current Opinion in Genetics & Development 6: 757-762.

19. Mahairas, G. G., and F. C. Minion. 1989. Transformation of Mycoplasma pulmonis : demonstration of homologous recombination, introduction of cloned genes, and preliminary description of an integrating shuttle system. Journal of Bacteriology 171: 1775-1780.

20. Medini, D., D. Serruto, J. Parkhill, D. A. Relman, C. Donati, R. Moxon, S. Falkow, and R. Rappuoli. 2008. Microbiology in the post-genomic era. Nature Reviews Microbiology 6: 419-430.

21. Nicholas, R. A., and R. D. Ayling. 2003. Mycoplasma bovis : disease, diagnosis, and control. Research in Veterinary Science 74: 105-112.

22. Paine, K., and D. R. Flower. 202. Bacterial bioinformatics: pathogenesis and the genome. Journal of Molecular Microbiology and Biotechnology 4: 357-365.

23. Pallen, M. J., and B. W. Wren. 2007. Bacterial pathogenomics. Nature 449: 835- 842.

24. Pettersson, B., M. Uhlen, and K.-E. Johansson. 1996. Phylogeny of some Mycoplasmas from ruminants based on 16S rRNA sequences and definition of a new cluster within the hominis group. International Journal of Systematic Bacteriology 46: 1093-1098.

25. Pfutzner, H., and K. Sachse. 1996. Mycoplasma bovis is an agent of mastitis, pneumonia, arthritis and genital disorders in cattle. Revue Scientifique et Technique / Office International des Epizooties 15: 1477-1494.

26. Pour-El, I., C. Adams, and F. C. Minion. 2002. Construction of mini-Tn 4001 tet and its use in Mycoplasma gallisepticum . Plasmid 47: 129-137.

27. Rasberry, U., and R. F. Rosenbusch. 1995. Membrane-associated and cytosolic species-specific antigens of Mycoplasma bovis recognized by monoclonal antibodies. Hybridoma 14: 481-485.

28. Raskin, D. M., R. Seshadri, S. U. Pukatzki, and J. J. Mekalanos. 2006. Bacterial genomics and pathogen evolution. Cell 124: 703-714.

29. Song, J., K. Ko, J. Lee, J. Baek, W. Oh, H. Yoon, J. Jeong, and J. Chun. 2005. Identification of essential genes in Streptococcus pneumoniae by allelic replacement mutagenesis. Molecules and Cells 19: 365 - 374.

30. Thanassi, J., S. Hartman-Neumann, T. Dougherty, B. Dougherty, and M. Pucci. 2002. Identification of 113 conserved essential genes using a high-throughput gene disruption system in Streptococcus pneumoniae. Nucleic Acids Research 30: 3152 - 3162.

Figure 1. Construction of pRIT -1. pISM 2062 was linearized at the SmaI site in the IS256L arm of Tn 4001 and then ligated with 4.98 kb portion derived of HcII -digested pISM 1002. The resulting plasmid is pRIT -1 which confers tetracycline resistance.

Figure 2. Transformation frequency of pRIT -1 in Mycoplasma bovis strain M23 . M. bovis was cultured for designated times , harvested by centrifugation and transformed with ♦500 ng, ■1.0 g, ▲2.0 g or ●5.0 g of DNA, respectively . Cells that were harvested after 8-10 hours of culture and transformed with 500 ng or 1.0 g of DNA had the highest transformation frequency.

100

40 total number of colonies of number total 20

Percentage (%) of tetracycline-resistant of to the colonies tetracycline-resistant (%) Percentage 1 5 10 15

Passage number

Figure 3. Transformants retained inserts in absence of selective pressure. Mycoplasma bovis strain M23 was cultured in both selective and non-selective Friis broth and passed every 24 hours up to 15 passages. Passages 1 to 15 were plated on both ■selective and ▲non-selective Friis plates and total colonies counted. Three independent transformants were used and the results averaged. Error bars represent the S.E.M.

Supplementary table 1. List of genes of Mycoplasma bovis strain M23 disrupted by transposon mutagenesis.

Homolog in Mycoplasma ORF Putative function of ORF agalactiae PG2

MBO 5 DNA polymerase III, beta chain MAG_0020 MBO 6 esterase/lipase MAG_0030 MBO 7 NADH dependent flavin oxidoreductase MAG_0050 MBO 8 lipoate-protein ligase A, truncated product MAG_0060 MBO 9 lipoate-protein ligase A MAG_0070 MBO 10 hypothetical protein MAG_0080 MBO 11 glycine cleavage system H protein MAG_0090 MBO 12 hypothetical protein MAG_0100 MBO 13 hypothetical protein MAG_0110 MBO 16 ABC transporter, ATP-binding protein, P59 MAG_0140 MBO 17 sugar ABC transporter permease MAG_0150 MBO 21 hypothetical protein MAG_0190 MBO 22 hypothetical protein MAG_0200 MBO 23 hypothetical protein MAG_0250 MBO 26 hypothetical protein MAG_0280 MBO 27 ABC transporter ATP-binding protein MAG_0290 MBO 30 hypothetical protein MAG_0330 MBO 31 oligopeptide ABC transporter, ATP-binding protein (OppF) MAG_0340 MBO 32 oligopeptide ABC transporter, ATP-binding protein (OppD) MAG_0350 MBO 33 oligopeptide ABC transporter, permease protein(OppC) MAG_0360 MBO 34 oligopeptide ABC transporter, permease protein(OppB) MAG_0370 MBO 35 oligopeptide ABC transporter, substrate-binding protein (OppA) MAG_0380 MBO 36 hypothetical protein MAG_0390 MBO 38 tRNA/rRNA methyltransferase MAG_0410 MBO 39 hypothetical protein MAG_0420 MBO 42 hypothetical protein MAG_0450 MBO 45 hypothetical protein MAG_0480 MBO 46 hypothetical protein MAG_0490 MBO 47 glycerol-3-phosphate dehydrogenase MAG_0500

Supplementary table 1. (continued)

Homolog in Mycoplasma ORF Putative function of ORF agalactiae PG2

MBO 48 dimethyladenosine transferase MAG_0510 MBO 49 putative deoxyribonuclease (YabD) deoxyribonuclease (TatD) MAG_0520 MBO 54 EpsG MAG_0570 MBO 58 lipoate-protein ligase A MAG_0600 MBO 60 asparagine synthetase AsnA MAG_0640 MBO 67 proline iminopeptidase (Pip) MAG_0710 MBO 70 DNA-damage repair protein MucB MAG_0740 MBO 71 putative nicotinate-nucleotide adenylyltransferase MAG_0750 MBO 72 ribosomal large subunit pseudouridine synthaseB MAG_0760 MBO 73 lipoprotein MAG_0770 MBO 74 fructose-bisphosphate aldolase (Fba) MAG_0780 MBO 75 nuclease MAG_0790 MBO 78 hypothetical protein MAG_0820 MBO 79 hypothetical protein MAG_0830 MBO 80 hypothetical protein MAG_0840 MBO 84 hypothetical protein MAG_0880 MBO 88 hypothetical protein MAG_0920 MBO 94 hypothetical protein MAG_0980 MBO 95 hypothetical protein MAG_0990 MBO 96 hypothetical protein MAG_1000 MBO 97 oligopeptide ABC transporter, permease protein(OppB) MAG_1010 MBO 98 oligopeptide ABC transporter system, permease protein (OppC) MAG_1020 MBO 99 oligopeptide ABC transporter, ATP-binding protein (OppD) MAG_1030 MBO 100 oligopeptide ABC transporter, ATP-binding protein (OppF) MAG_1040 MBO 101 lipoprotein MAG_1050 MBO 103 hypothetical protein MAG_1070 MBO 104 hypothetical protein MAG_1080 MBO 105 hypothetical protein MAG_1100 MBO 107 hypothetical protein MAG_1120 MBO 108 hypothetical protein MAG_1140

Supplementary table 1. (continued)

Homolog in Mycoplasma ORF Putative function of ORF agalactiae PG2

MBO 112 XAA-Pro aminopeptidase MAG_1180 MBO 114 hypothetical protein MAG_1220 MBO 115 putative phosphoketolase MAG_1230 MBO 116 oligoendopeptidase F MAG_1240 MBO 119 spermidine/putrescine ABC transporter permease MAG_1270 MBO 122 hypothetical protein MAG_1300 MBO 123 thiamine biosynthesis protein thiI MAG_1310 MBO 124 hypothetical protein MAG_1320 MBO 125 hypothetical protein MAG_1330 MBO 126 hypothetical protein MAG_1340 MBO 127 hypothetical protein MAG_1360 MBO 128 valyl-tRNA synthetase MAG_1370 MBO 129 FolD bifunctional protein MAG_1380 MBO 130 phosphotransacetylase MAG_1390 MBO 131 acetate kinase MAG_1400 MBO 132 phosphopantetheine adenylyltransferase MAG_1410 MBO 133 GTPase EngB MAG_1420 MBO 134 hypothetical protein MAG_1430 MBO 135 pyruvate kinase MAG_1440 MBO 136 tRNA (uracil-5-)-methyltransferase Gid MAG_1470 MBO 140 hypothetical protein MAG_1520 MBO 141 Type III restriction-modification system: methylase MAG_1530 MBO 142 trigger factor MAG_1540 MBO 143 lipoprotein MAG_1560 MBO 144 hypothetical protein MAG_1570 MBO 145 hypothetical protein MAG_1580 MBO 146 hypothetical protein MAG_1590 MBO 147 hypothetical protein MAG_1600 MBO 148 hypothetical protein MAG_1610 MBO 149 hypothetical protein MAG_1620

Supplementary table 1. (continued)

Homolog in Mycoplasma ORF Putative function of ORF agalactiae PG2

MBO 150 integral membrane protein MAG_1640 MBO 153 lipoprotein MAG_5900 MBO 154 aminopeptidase MAG_5890 MBO 155 hypothetical protein MAG_5870 MBO 156 hypothetical protein MAG_5880 MBO 159 hypothetical protein MAG_5840 MBO 160 acetyltransferase MAG_5830 MBO 163 S-adenosylmethionine synthetase MAG_5800 MBO 166 lipoprotein MAG_5770 MBO 167 hypothetical protein MAG_5760 methylase protein of Type I restriction-modification system MBO 169 HsdM MAG_5730 methylase protein of Type I restriction-modification- MBO 170 modification system MAG_5650 MBO 171 Type I R/M system specificity subunit MAG_5640 MBO 173 hypothetical protein MAG_5700 MBO 174 hypothetical protein MAG_5710 MBO 177 hypothetical protein MAG_5620 MBO 180 heat shock protein GrpE (activation of DnaK) MAG_5580 MBO 181 large-conductance mechanosensitive channel MAG_5570 MBO 182 hypothetical protein MAG_5560 MBO 185 16S rRNA uridine-516 pseudouridylate synthase MAG_5530 MBO 186 aminopeptidase MAG_5520 MBO 188 recombinase A MAG_5500 MBO 189 hypothetical protein MAG_5480 MBO 210 hypothetical protein MAG_5280 MBO 222 hypothetical protein MAG_5150 MBO 224 deoxyribose-phosphate aldolase MAG_5130 MBO 225 thymidine phosphorylase (TDRPASE) MAG_5120 MBO 227 hypothetical protein MAG_5100 MBO 229 lipoprotein MAG_5080 MBO 230 ABC transporter permease protein MAG_5070

Supplementary table 1. (continued)

Homolog in Mycoplasma ORF Putative function of ORF agalactiae PG2

MBO 231 ABC transporter permease protein MAG_5060 MBO 232 ABC transporter ATP-binding protein MAG_5050 MBO 235 UvrABC system protein C MAG_5020 MBO 237 hypothetical protein MAG_5000 MBO 238 endonuclease IV MAG_4990 MBO 239 hypothetical protein MAG_4980 MBO 240 hexosephosphate transport protein MAG_4970 MBO 241 hypothetical protein MAG_4960 MBO 242 hypothetical protein MAG_4950 MBO 243 transmembrane protein MAG_4940 MBO 244 acetate kinase (acetokinase) MAG_4930 MBO 245 phosphate acetyltransferase(phosphotransacetylase) MAG_4920 MBO 246 hypothetical protein MAG_4910 MBO 247 L-lactate dehydrogenase (L-LDH) MAG_4900 MBO 250 hypothetical protein MAG_4860 MBO 255 GTP-binding protein LepA MAG_4810 MBO 256 hypothetical protein MAG_4790 MBO 261 lipoprotein MAG_4740 MBO 262 hypothetical protein MAG_4730 MBO 263 hypothetical protein MAG_4720 MBO 264 hypothetical protein MAG_4710 MBO 265 oligopeptide transport system permease protein(OppB) MAG_4700 MBO 272 hypothetical protein MAG_4640 MBO 273 hypothetical protein MAG_4630 MBO 274 hypothetical protein MAG_4620 MBO 275 ABC transporter, ATP-binding protein MAG_4610 MBO 276 ABC transporter, permease protein MAG_4600 MBO 277 cation-transporting P-type ATPase MAG_4590 MBO 279 30S ribosomal protein S9 MAG_4560 MBO 282 hypothetical protein MAG_2790

Supplementary table 1. (continued)

Homolog in Mycoplasma ORF Putative function of ORF agalactiae PG2

MBO 284 hypothetical protein MAG_2810 MBO 286 putative transmembrane protein MAG_2830 MBO 287 hypothetical protein MAG_2840 MBO 288 putative transmembrane protein MAG_2860 MBO 289 putative transmembrane protein MAG_2850 MBO 290 hypothetical protein MAG_2870 MBO 291 putative transmembrane protein MAG_2880 MBO 293 hypothetical protein MAG_2900 MBO 294 hypothetical protein MAG_2910 MBO 295 putative transmembrane protein MAG_2920 MBO 296 F0F1 ATP synthase subunit alpha MAG_2930 MBO 297 F0F1 ATP synthase subunit beta MAG_2940 MBO 298 lipoprotein MAG_2950 MBO 299 hypothetical protein MAG_2960 MBO 304 glycosyltransferase MAG_3010 MBO 307 hypothetical protein MAG_3040 MBO 310 Mg2+ transport protein (MGTE) MAG_3070 MBO 312 hypothetical protein MAG_3090 MBO 314 ABC transporter ATP-binding protein MAG_3110 MBO 315 hypothetical protein MAG_3120 MBO 316 peptide methionine sulfoxide reductase MAG_3130 MBO 318 foramidopyrimidine DNA glycosylase MAG_3150 MBO 319 glucose-6-phosphate isomerase MAG_3160 MBO 320 glucose-6-phosphate isomerase MAG_3170 MBO 321 30S ribosomal protein S1 MAG_3180 MBO 327 hypothetical protein MAG_3240 MBO 330 hypothetical protein MAG_5660 MBO 335 P30, lipoprotein MAG_3470 MBO 336 hypothetical protein MAG_3480 MBO 351 hypothetical protein MAG_3650

Supplementary table 1. (continued)

Homolog in Mycoplasma ORF Putative function of ORF agalactiae PG2

MBO 354 endopeptidase O MAG_3680 MBO 355 hypothetical protein MAG_3690 MBO 357 cell division protein ftsZ MAG_3710 MBO 358 hypothetical protein MAG_3720 MBO 363 hypothetical protein MAG_3770 MBO 364 excinuclease ABC subunit B MAG_3780 MBO 365 excinuclease ABC subunit A MAG_3790 MBO 367 hypothetical protein MAG_3810 MBO 371 hypothetical protein MAG_3860 MBO 372 hypothetical protein MAG_3360 MBO 373 hypothetical protein MAG_3870 MBO 374 hypothetical protein MAG_3880 MBO 375 hypothetical protein MAG_3890 MBO 376 hypothetical protein MAG_3900 MBO 378 hypothetical protein MAG_3920 MBO 379 hypothetical protein MAG_3930 MBO 380 hypothetical protein MAG_3940 MBO 381 hypothetical protein MAG_3950 MBO 382 lipoprotein MAG_1550 MBO 383 hypothetical protein MAG_3960 MBO 388 hypothetical protein MAG_4050 MBO 389 hypothetical protein MAG_4060 MBO 390 hypothetical protein MAG_0230 MBO 392 oxidoreductase, potentially truncated inN-terminal MAG_4120 MBO 393 hypothetical protein MAG_4130 MBO 394 hypothetical protein MAG_4140 MBO 398 purine nucleoside phosphorylase (inosinephosphorylase) MAG_4180 MBO 399 hypothetical protein MAG_4220 MBO 400 hypothetical protein MAG_4230 MBO 401 hypothetical protein MAG_4270

Supplementary table 1. (continued)

Homolog in Mycoplasma ORF Putative function of ORF agalactiae PG2

MBO 402 alcohol dehydrogenase MAG_4280 MBO 405 hypothetical protein MAG_4350 MBO 406 hydrolase MAG_4360 MBO 408 ABC transporter ATP-binding protein MAG_4380 MBO 410 putative glycerol-3-phosphate acyltransferase PlsX MAG_4400 MBO 411 hypothetical protein MAG_4410 MBO 412 hypothetical protein MAG_4420 MBO 413 hypothetical protein MAG_4430 MBO 416 hypothetical protein MAG_4460 MBO 418 glycerol facilitator factor MAG_4480 MBO 421 hypothetical protein MAG_4510 MBO 423 hypothetical protein MAG_4530 MBO 428 alcohol dehydrogenase MAG_2740 MBO 434 hypothetical protein MAG_2680 MBO 438 hypothetical protein MAG_2640 MBO 441 lipoprotein MAG_2610 MBO 443 30S ribosomal protein S2 MAG_2590 MBO 444 hypothetical protein MAG_2550 MBO 446 hypothetical protein MAG_2570 MBO 447 hypothetical protein MAG_2580 MBO 448 lipoprotein MAG_2540 MBO 450 lipoprotein MAG_2520 MBO 451 lipoprotein MAG_2510 MBO 452 hypothetical protein MAG_2500 MBO 453 hypothetical protein MAG_2490 MBO 454 DNA recombination protein MAG_2480 MBO 455 proton/glutamate symporter MAG_2470 MBO 456 NADH oxidase (NOXASE) MAG_2460 MBO 457 hypothetical protein MAG_2440 MBO 458 lipoprotein MAG_2430

Supplementary table 1. (continued)

Homolog in Mycoplasma ORF Putative function of ORF agalactiae PG2

MBO 459 P40, lipoprotein MAG_2410 MBO 461 hemolysin-related protein MAG_2390 MBO 465 lipoprotein MAG_2350 MBO 466 hypothetical protein MAG_2340 MBO 469 glycerol ABC transporter, ATP-binding component MAG_2310 MBO 473 hypothetical protein MAG_2270 MBO 474 tRNA pseudouridine synthase B MAG_2260 MBO 476 Holliday junction DNA helicase B MAG_2240 MBO 478 hypothetical protein MAG_2220 MBO 481 CTP synthetase MAG_2190 MBO 482 hypothetical protein MAG_2160 MBO 483 hypothetical protein MAG_2150 MBO 485 GTPase EngC MAG_2130 MBO 486 Serine/threonine-protein kinase MAG_2120 MBO 487 protein phosphatase MAG_2110 MBO 492 DNA methylase MAG_2070 MBO 499 lipoprotein MAG_2000 MBO 500 HIT-like protein (cell cycle regulation) MAG_1990 MBO 506 transketolase I MAG_1930 MBO 507 ribonuclease MAG_1920 MBO 508 hypothetical protein MAG_1910 MBO 509 ribose-phosphate pyrophosphokinase MAG_1870 MBO 515 hypothetical protein MAG_1810 MBO 517 DNA methylase MAG_1790 MBO 519 hypothetical protein MAG_1770 MBO 522 hypothetical protein MAG_1730 MBO 523 hypothetical protein MAG_1720 MBO 524 hypothetical protein MAG_1710 MBO 525 hypothetical protein MAG_1690 MBO 526 hypothetical protein MAG_1670

Supplementary table 1. (continued)

Homolog in Mycoplasma ORF Putative function of ORF agalactiae PG2

MBO 527 hypothetical protein MAG_1680 MBO 529 5'nucleotidase MAG_5910 MBO 534 ABC transporter ATP-binding protein MAG_5960 MBO 536 ABC transporter, ATP-binding protein MAG_5990 MBO 537 ABC transporter, ATP-binding protein MAG_6000 MBO 538 aminopeptidase MAG_6080 MBO 542 lipoprotein MAG_6130 MBO 545 lipoprotein MAG_6200 MBO 549 ClpB MAG_6240 MBO 553 methionyl-tRNA formyltransferase MAG_6280 MBO 554 hypothetical protein MAG_6290 MBO 556 transcriptional regulator MAG_6310 MBO 557 hypothetical protein MAG_6320 MBO 558 L-ribulose-5-phosphate 4-epimerase MAG_6330 MBO 559 L-xylulose 5-phosphate 3-epimerase MAG_6340 MBO 560 3-keto-L-gulonate-6-phosphate decarboxylase MAG_6350 MBO 561 Pentitol phosphotransferase enzyme II, acomponent MAG_6360 MBO 562 Pentitol phosphotransferase enzyme II, bcomponent MAG_6370 MBO 566 hypothetical protein MAG_6520 MBO 567 glycerol ABC transporter, permease component MAG_6530 MBO 568 glycerol transporter subunit B MAG_6540 MBO 569 hypothetical protein MAG_6560 MBO 570 hypothetical protein MAG_6570 MBO 573 NH(3)-dependent NAD(+) synthetase MAG_6600 MBO 576 putative RNA methyltransferase MAG_6630 MBO 582 hypothetical protein MAG_6690 MBO 583 ribonuclease H II MAG_6730 MBO 585 ribosomal large subunit pseudouridine synthaseD MAG_6750 MBO 586 chromate transporter MAG_6760 MBO 587 chromate transporter MAG_6770

Supplementary table 1. (continued)

Homolog in Mycoplasma ORF Putative function of ORF agalactiae PG2

MBO 588 tRNA (guanine-N(7))-methyltransferase MAG_6780 MBO 589 hypothetical protein MAG_6790 MBO 592 hypothetical protein MAG_6830 MBO 598 hypothetical protein MAG_6900 MBO 603 hypothetical protein MAG_6950 MBO 609 thymidine kinase MAG_7010 MBO 611 hypothetical protein MAG_7030 MBO 614 Variable surface protein K MBO 616 Variable surface protein B MBO 617 Variable surface protein G MBO 618 Variable surface protein N MBO 620 Variable surface protein H MBO 626 Variable surface protein O MBO 627 Variable surface protein I MBO 630 integrase-recombinase MAG_7110 MBO 631 hypothetical protein MAG_7120 MBO 632 hypothetical protein MAG_7140 MBO 642 cytidylate kinase (CK) MAG_7250 MBO 643 hypothetical protein MAG_7260 MBO 647 hypothetical protein MAG_7310 MBO 648 hypothetical protein MAG_7320 MBO 649 Acyl carrier protein MAG_7330 MBO 650 protoporphirogen oxidase HEMK MAG_7340 MBO 657 hypothetical protein MAG_7410

Supplementary table 2. Selected dispensable genes of Mycoplasma bovis strain M23 which has been classified previously as essential genes in other mycoplasma species. Mycoplasma species where the gene was found as essential Mutant name Putative function of disrupted genes M.bov M.gen M.pul M. arth

MBO 5 DNA polymerase III, beta chain - + + + putative nicotinate-nucleotide - + + + MBO 71 adenylyltransferase MBO 129 FolD bifunctional protein - + + + MBO 131 acetate kinase - + + + MBO 135 pyruvate kinase - + + + MBO 163 S-adenosylmethionine synthetase - + + + MBO 180 heat shock protein GrpE (activation of DnaK) - + + + MBO 224 deoxyribose-phosphate aldolase - + + + MBO 279 30S ribosomal protein S9 - + + + MBO 319 glucose-6-phosphate isomerase - + + + MBO 357 cell division protein ftsZ - + + + putative glycerol-3-phosphate acyltransferase - + + + MBO 410 PlsX MBO 443 30S ribosomal protein S2 - + + + MBO 456 NADH oxidase (NOXASE) - + + + MBO 486 Serine/threonine-protein kinase - + + + MBO 487 protein phosphatase - + + + MBO 509 ribose-phosphate pyrophosphokinase - + + + MBO 573 NH(3)-dependent NAD(+) synthetase - + + + MBO 642 cytidylate kinase (CK) - + + + MBO 649 Acyl carrier protein - + + + MBO 650 protoporphirogen oxidase HEMK - + + +

-: those that were found as non-essential genes in M. bovis +: those that have been classified previously as essential genes in other mycoplasma species

Supplementary table 3. List of genes of Mycoplasma bovis strain M23 where insertional mutation was not detected.

Homolog in Mycoplasma ORF Putative function of ORF agalactiae PG2

MBO 1 hypothetical protein MAG_1880 MBO 2 hypothetical protein MAG_3980 MBO 3 lipoprotein MAG_3970 MBO 4 chromosomal replication initiation protein MAG_0010 MBO 14 P48, lipoprotein MAG_0120 MBO 15 hypothetical protein MAG_0130 MBO 18 sugar ABC transporter permease protein MAG_0160 MBO 19 deoxyguanosine kinase MAG_0170 MBO 20 deoxyguanosine kinase MAG_0180 MBO 24 hypothetical protein MAG_0260 MBO 25 HAD superfamily hydrolase MAG_0270 MBO 28 hypothetical protein MAG_0300 MBO 29 hypothetical protein MAG_0320 MBO 37 cysteinyl-tRNA synthetase MAG_0400 MBO 40 50S ribosomal protein L33 MAG_0430 MBO 41 transcription antitermination protein NusG MAG_0440 MBO 43 uridylate kinase MAG_0460 MBO 44 ribosome recycling factor (ribosome releasing factor) MAG_0470 MBO 50 tRNA modification GTPase TrmE MAG_0530 MBO 51 hypothetical protein MAG_0540 MBO 52 glyceraldehyde 3-phosphate dehydrogenase (GAPDH) MAG_0550 MBO 53 seryl-tRNA synthetase MAG_0560 MBO 55 50S ribosomal protein L34 MAG_7500 MBO 56 ribonuclease P protein component MAG_0580 putative inner membrane protein translocase component MBO 57 YidC MAG_0590 MBO 59 esterase/lipase MAG_0610 MBO 61 DNA polymerase III PolC MAG_0650 MBO 62 recombination factor protein RarA MAG_0660 MBO 63 phenylalanyl-tRNA synthetase subunit alpha MAG_0670

Supplementary table 3. (continued)

Homolog in Mycoplasma ORF Putative function of ORF agalactiae PG2

MBO 64 Uracil-DNA glycosylase (Ung) MAG_0680 MBO 65 phenylalanyl-tRNA synthetase beta chain (PheT) MAG_0690 MBO 66 serine hydroxymethyltransferase MAG_0700 MBO 68 nitrogen fixation protein NifS MAG_0720 MBO 69 nitrogen fixation protein NifU MAG_0730 MBO 76 50S ribosomal protein L11 MAG_0800 MBO 77 50S ribosomal protein L1 MAG_0810 MBO 81 tRNA/rRNA methyltransferase MAG_0850 MBO 82 rRNA methylase MAG_0860 MBO 83 ribosomal biogenesis GTPase MAG_0870 MBO 85 HPr kinase/phosphorylase MAG_0890 MBO 86 prolipoprotein diacylglyceryl transferase MAG_0900 MBO 87 thioredoxin reductase MAG_0910 MBO 89 pyruvate dehydrogenase E1 component, alpha subunit MAG_0930 MBO 90 pyruvate dehydrogenase E1 component, beta subunit MAG_0940 dihydrolipoamide acetyltransferase component of pyruvate MBO 91 dehydrogenase MAG_0950 dihydrolipoamide dehydrogenase (E3 component of MBO 92 pyruvate complex) MAG_0960 MBO 93 50S ribosomal protein L28 MAG_0970 MBO 102 hypothetical protein MAG_1060 MBO 106 ribose-5-phosphate isomerase B MAG_1110 MBO 109 hypothetical protein MAG_1150 MBO 110 cytidine deaminase (cytidine aminohydrolase) MAG_1160 MBO 111 GTP-binding protein Era MAG_1170 MBO 113 prolyl-tRNA synthetase MAG_1190 MBO 117 spermidine/putrescine ABC transporter ATP-binding protein MAG_1250 MBO 118 spermidine/putrescine ABC transporter permease MAG_1260 MBO 120 hypothetical protein MAG_1280 MBO 121 50S ribosomal protein L32 MAG_1290 MBO 137 hypothetical protein MAG_1480 MBO 138 D-lactate dehydrogenase MAG_1490

Supplementary table 3. (continued)

Homolog in Mycoplasma ORF Putative function of ORF agalactiae PG2

MBO 139 esterase/lipase MAG_1500 MBO 151 DNA polymerase I MAG_1650 MBO 152 putative prophage protein (ps3) MAG_6440 MBO 157 phosphoglycerate kinase MAG_5860 MBO 158 nicotinate phosphoribosyltransferase MAG_5850 MBO 161 Signal recognition particle protein MAG_5820 MBO 162 hypothetical protein MAG_5810 MBO 164 hypothetical protein MAG_5790 MBO 165 glutamyl-tRNA synthetase MAG_5780 MBO 168 5-formyltetrahydrofolate cyclo-ligase MAG_5750 MBO 172 restriction modification system specificity subunit HsdS MAG_5720 MBO 175 Phage family integrase MAG_5690 MBO 176 DNA gyrase subunit A MAG_5630 MBO 178 30S ribosomal protein S4 MAG_5610 MBO 179 heat-inducible transcription repressor MAG_5590 MBO 183 50S ribosomal protein L21 MAG_5550 MBO 184 50S ribosomal protein L27 MAG_5540 MBO 187 hypothetical protein MAG_5510 MBO 190 hypothetical protein MAG_5490 MBO 191 30S ribosomal protein S10 MAG_5470 MBO 192 50S ribosomal protein L3 MAG_5460 MBO 193 50S ribosomal protein L4 MAG_5450 MBO 194 50S ribosomal protein L23 MAG_5440 MBO 195 50S ribosomal protein L2 MAG_5430 MBO 196 30S ribosomal protein S19 MAG_5420 MBO 197 50S ribosomal protein L22 MAG_5410 MBO 198 30S ribosomal protein S3 MAG_5400 MBO 199 50S ribosomal protein L16 MAG_5390 MBO 200 30S ribosomal protein S17 MAG_5380 MBO 201 50S ribosomal protein L14 MAG_5370

Supplementary table 3. (continued)

Homolog in Mycoplasma ORF Putative function of ORF agalactiae PG2

MBO 202 50S ribosomal protein L24 MAG_5360 MBO 203 50S ribosomal protein L5 MAG_5350 MBO 204 30S ribosomal protein S14 MAG_5340 MBO 205 30S ribosomal protein S8 MAG_5330 MBO 206 50S ribosomal protein L6 MAG_5320 MBO 207 50S ribosomal protein L18 MAG_5310 MBO 208 30S ribosomal protein S5 MAG_5300 MBO 209 50S ribosomal protein L15 MAG_5290 MBO 211 preprotein translocase subunit SecY MAG_5260 MBO 212 adenylate kinase MAG_5250 MBO 213 methionine aminopeptidase MAG_5240 MBO 214 translation initiation factor IF-1 MAG_5230 MBO 215 30S ribosomal protein S13 MAG_5220 MBO 216 30S ribosomal protein S11 MAG_5210 MBO 217 DNA-directed RNA polymerase subunit alpha MAG_5200 MBO 218 50S ribosomal protein L17 MAG_5190 MBO 219 cobalt transporter ATP-binding subunit MAG_5180 MBO 220 ABC transporter permease protein MAG_5160 MBO 221 cobalt transporter ATP-binding subunit MAG_5170 MBO 223 triosephosphate isomerase MAG_5140 MBO 226 purine nucleoside phosphorylase (inosinephosphorylase) MAG_5110 MBO 228 GTPase ObgE MAG_5090 MBO 233 hypothetical protein MAG_5040 MBO 234 P80, lipoprotein MAG_5030 MBO 236 thioredoxin (TRX) MAG_5010 MBO 248 malate permease MAG_4890 MBO 249 arginyl-tRNA synthetase MAG_4880 MBO 251 hypothetical protein MAG_4840 MBO 252 hypothetical protein MAG_4850 MBO 253 NADPH flavin oxidoreductase MAG_4830

Supplementary table 3. (continued)

Homolog in Mycoplasma ORF Putative function of ORF agalactiae PG2

MBO 254 hypothetical protein MAG_4820 MBO 257 ATP-binding protein MAG_4780 MBO 258 50S ribosomal protein L20 MAG_4770 MBO 259 50S ribosomal protein L35 MAG_4760 MBO 260 translation initiation factor IF-3 MAG_4750 MBO 266 phosphocarrier protein HPr(histidine-containing protein) MAG_4690 MBO 267 Acyl carrier protein phosphodiesterase MAG_4680 MBO 268 transcription termination factor (NusB) MAG_4670 MBO 269 hypothetical protein MAG_4660 MBO 270 phosphomannomutase MAG_4650 MBO 271 UTP-glucose-1-phosphate uridyltransferase MAG_4580 MBO 278 hypothetical protein MAG_4570 MBO 280 50S ribosomal protein L13 MAG_4550 MBO 281 hypothetical protein MAG_4540 MBO 285 DNA ligase MAG_2820 MBO 292 hypothetical protein MAG_2890 MBO 300 hypothetical protein MAG_2970 MBO 301 hypothetical protein MAG_2980 MBO 302 ATP-dependent helicase MAG_2990 MBO 303 hypothetical protein MAG_3000 MBO 305 asparaginyl-tRNA synthetase MAG_3020 MBO 306 hypothetical protein MAG_3030 MBO 308 hypothetical protein MAG_3050 MBO 309 hypothetical protein MAG_3060 MBO 311 elongation factor P MAG_3080 MBO 313 ABC transporter ATP-binding protein MAG_3100 MBO 317 hypothetical protein MAG_3140 MBO 322 phosphopyruvate hydratase MAG_3190 MBO 323 elongation factor Tu MAG_3200 MBO 324 hypothetical protein MAG_3210

Supplementary table 3. (continued)

Homolog in Mycoplasma ORF Putative function of ORF agalactiae PG2

MBO 325 hypothetical protein MAG_3220 MBO 326 O-sialoglycoprotein endopeptidase MAG_3230 MBO 328 hypothetical protein MAG_3320 MBO 329 hypothetical protein MAG_3250 MBO 331 hypothetical protein MAG_5670 MBO 332 tryptophanyl-tRNA synthetase MAG_3430 MBO 333 threonyl-tRNA synthetase MAG_3440 MBO 334 hypothetical protein MAG_3450 MBO 337 hypothetical protein MAG_3490 MBO 338 F0F1 ATP synthase subunit A MAG_3500 MBO 339 ATP synthase C chain MAG_3510 MBO 340 ATP synthase B chain MAG_3520 MBO 341 ATP synthase delta subunit MAG_3530 MBO 342 F0F1 ATP synthase subunit alpha MAG_3540 MBO 343 F0F1 ATP synthase subunit gamma MAG_3550 MBO 344 F0F1 ATP synthase subunit beta MAG_3560 MBO 345 ATP synthase epsilon chain MAG_3570 MBO 346 hypothetical protein MAG_3580 MBO 347 hypothetical protein MAG_3610 MBO 348 hypothetical protein MAG_3620 MBO 349 heat shock ATP-dependent protease MAG_3630 MBO 350 leucyl-tRNA synthetase (leucine-tRNA ligase) MAG_3640 MBO 352 Uracil phosphoribosyltransferase MAG_3660 MBO 353 single-strand binding protein(helix-destabilizing protein) MAG_3670 MBO 356 glycine cleavage system H protein MAG_3700 MBO 359 S-adenosyl-methyltransferase MAG_3730 MBO 360 cell division protein MraZ MAG_3740 MBO 361 potassium uptake protein KtrA MAG_3750 MBO 362 potassium uptake protein KtrB MAG_3760 MBO 366 hypothetical protein MAG_3800

Supplementary table 3. (continued)

Homolog in Mycoplasma ORF Putative function of ORF agalactiae PG2

MBO 368 translation-associated GTPase MAG_3820 MBO 369 hypoxanthine-guanine phosphoribosyltransferase(HGPRT) MAG_3840 MBO 370 transcription elongation factor greA MAG_3850 MBO 377 hypothetical protein MAG_3910 MBO 384 hypothetical protein MAG_3990 MBO 385 hypothetical protein MAG_4000 MBO 386 hypothetical protein MAG_4020 MBO 387 hypothetical protein MAG_4040 MBO 391 lipoprotein MAG_4320 MBO 395 putative Holliday junction resolvase MAG_4150 MBO 396 alanyl-tRNA synthetase MAG_4160 tRNA (5-methylaminomethyl-2-thiouridylate)- MBO 397 methyltransferase MAG_4170 MBO 403 lipoprotein MAG_4330 MBO 404 alcohol dehydrogenase MAG_4340 MBO 407 ABC transporter permease protein MAG_4370 MBO 409 ribonuclease III (RNase III) MAG_4390 MBO 414 hypothetical protein MAG_4440 MBO 415 hypothetical protein MAG_4450 MBO 417 glycerol kinase MAG_4470 MBO 419 aspartyl-tRNA synthetase (AspRS) MAG_4490 MBO 420 histidyl-tRNA synthetase (HisRS) MAG_4500 MBO 422 hypothetical protein MAG_4520 MBO 424 30S ribosomal protein S18 MAG_2780 MBO 425 single-stranded DNA-binding protein MAG_2770 MBO 426 30S ribosomal protein S6 MAG_2760 MBO 427 DNA topoisomerase I MAG_2750 MBO 429 preprotein translocase subunit SecA MAG_2730 MBO 430 hypothetical protein MAG_2720 MBO 431 alkylphosphonate ABC transporter permease MAG_2710 MBO 432 ABC transporter, ATP-binding protein MAG_2700

Supplementary table 3. (continued)

Homolog in Mycoplasma ORF Putative function of ORF agalactiae PG2

MBO 433 alkylphosphonate ABC transporter substrate-binding protein MAG_2690 MBO 435 glycyl-tRNA synthetase MAG_2670 MBO 436 DNA primase MAG_2660 MBO 437 RNA polymerase sigma factor MAG_2650 MBO 439 NADH oxidase (NOXASE) MAG_2630 MBO 440 hypothetical protein MAG_2620 MBO 442 elongation factor Ts (EF-Ts) MAG_2600 MBO 445 hypothetical protein MAG_2560 MBO 449 hypothetical protein MAG_2530 MBO 460 lipoprotein MAG_2400 MBO 462 replicative DNA helicase MAG_2380 MBO 463 50S ribosomal protein L9 MAG_2370 MBO 464 hypothetical protein MAG_2360 MBO 467 glycerol ABC transporter, permease component MAG_2330 MBO 468 glycerol ABC transporter, permease component MAG_2320 MBO 470 esterase/lipase MAG_2300 MBO 471 30S ribosomal protein S15 MAG_2290 MBO 472 hypothetical protein MAG_2280 MBO 475 protein-export membrane protein MAG_2250 MBO 477 Holliday junction DNA helicase motor protein MAG_2230 MBO 479 lipoprotein signal peptidase (SPase II) MAG_2210 MBO 480 isoleucyl-tRNA synthetase MAG_2200 MBO 484 ribulose-phosphate 3-epimerase MAG_2140 MBO 488 guanylate kinase MAG_2100 MBO 490 hypothetical protein MAG_2090 MBO 491 ribonuclease R MAG_2080 MBO 493 methionyl-tRNA synthetase MAG_2060 MBO 494 hypothetical protein MAG_2050 MBO 495 cell division protein FtsY MAG_2040 MBO 496 hypothetical protein MAG_2030

Supplementary table 3. (continued)

Homolog in Mycoplasma ORF Putative function of ORF agalactiae PG2

MBO 497 Thiol peroxidase MAG_2020 MBO 498 50S ribosomal protein L33 MAG_2010 MBO 501 lipoprotein MAG_1980 MBO 502 hypothetical protein MAG_1970 MBO 503 hypothetical protein MAG_1960 MBO 504 30S ribosomal protein S20 MAG_1950 MBO 505 inorganic pyrophosphatase MAG_1940 MBO 510 methyltransferase GidB (glucose inhibiteddivision protein B) MAG_1860 MBO 511 ribonuclease HII (RNase HII) MAG_1850 MBO 512 hypothetical protein MAG_1840 MBO 513 DNA topoisomerase IV subunit A MAG_1830 MBO 514 topoisomerase IV subunit B MAG_1820 MBO 516 formylmethionine deformylase MAG_1800 MBO 518 hypothetical protein MAG_1780 MBO 520 hypothetical protein MAG_1750 tRNA uridine 5-carboxymethylaminomethyl modification MBO 521 enzyme MAG_1740 MBO 528 DNA polymerase III DnaE MAG_1660 MBO 530 elongation factor G MAG_5920 MBO 531 30S ribosomal protein S7 MAG_5930 MBO 532 30S ribosomal protein S12 MAG_5940 MBO 533 hypothetical protein MAG_5950 MBO 535 hypothetical protein MAG_6150 MBO 539 hypothetical protein MAG_6100 MBO 540 DNA-directed RNA polymerase subunit beta' MAG_6110 MBO 541 DNA-directed RNA polymerase subunit beta MAG_6120 MBO 543 50S ribosomal protein L7/L12 MAG_6180 MBO 544 50S ribosomal protein L10 MAG_6190 MBO 546 lysyl-tRNA synthetase MAG_6210 MBO 547 hypothetical protein MAG_6220 MBO 548 hypothetical protein MAG_6230

Supplementary table 3. (continued)

Homolog in Mycoplasma ORF Putative function of ORF agalactiae PG2

MBO 550 30S ribosomal protein S16 MAG_6250 MBO 551 tRNA (guanine-N(1)-)-methyltransferase MAG_6260 MBO 552 50S ribosomal protein L19 MAG_6270 MBO 555 phosphoenolpyruvate-protein phosphotransferase MAG_6300 MBO 563 ascorbate-specific PTS system enzyme IIC MAG_6380 MBO 564 hypothetical protein MAG_6390 MBO 565 hypothetical protein MAG_6400 MBO 571 hypothetical protein MAG_6580 MBO 572 hypothetical protein MAG_6590 MBO 574 ICEF-IA ORF9 ortholog MAG_6610 MBO 575 esterase/lipase MAG_6620 MBO 577 putative DNA helicase MAG_6640 MBO 578 hypothetical protein MAG_6650 MBO 579 hypothetical protein MAG_6660 MBO 580 hypothetical protein MAG_6670 MBO 581 modification methylase MAG_6680 MBO 584 hypothetical protein MAG_6740 MBO 590 hypothetical protein MAG_6800 MBO 591 hypothetical protein MAG_6810 MBO 593 DNA polymerase III subunit delta' MAG_6840 MBO 594 thymidylate kinase MAG_6850 MBO 595 recombination protein RecR MAG_6860 MBO 596 DNA polymerase III subunit gamma and tau MAG_6870 MBO 597 phosphoglyceromutase MAG_6890 MBO 599 hypothetical protein MAG_6910 MBO 600 hypothetical protein MAG_6920 CDP-diacylglycerol-glycerol-3-phosphate3- MBO 601 phosphatidyltransferase MAG_6930 MBO 602 phosphatidate cytidylyltransferase MAG_6940 MBO 604 adenine phosphoribosyltransferase MAG_6960 MBO 605 translation initiation factor IF-2 MAG_6970

Supplementary table 3. (continued)

Homolog in Mycoplasma ORF Putative function of ORF agalactiae PG2

MBO 606 hypothetical protein MAG_6980 MBO 607 transcription elongation factor NusA MAG_6990 MBO 608 hypothetical protein MAG_7000 MBO 610 aminopeptidase (leucine aminopeptidase) MAG_7020 MBO 612 Open reading frame 5 MBO 613 Variable surface protein L MBO 615 Variable surface protein M MBO 619 Variable surface protein A MBO 621 Open reading frame 4 MBO 622 Open reading frame 3 MBO 623 Variable surface frame J MBO 624 Open reading frame 2 MBO 625 Variable surface protein F MBO 628 Variable surface protein E MBO 629 site-specific tyrosine recombinase MBO 633 aspartyl/glutamyl-tRNA amidotransferase subunit B MAG_7160 MBO 634 amidase MAG_7170 MBO 635 hypothetical protein MAG_7180 MBO 636 ribosomal large subunit pseudouridine synthaseC MAG_7190 MBO 637 segregation and condensation protein B MAG_7200 MBO 638 segregation and condensation protein A MAG_7210 MBO 639 1-acyl-SN-glycerol-3-phosphate acyltransferase MAG_7220 Holo-[acyl-carrier protein] synthase MBO 640 MAG_7230 MBO 641 GTP-binding protein EngA MAG_7240 MBO 644 heat shock protein DNAJ (activation of DNAK) MAG_7280 MBO 645 ribosome-binding factor A MAG_7290 MBO 646 tyrosyl-tRNA synthetase 1 MAG_7300 MBO 651 peptide chain release factor 1 MAG_7350 MBO 652 hypothetical protein MAG_7360 MAG_7360 MBO 653 DNA gyrase subunit B MAG_7370

Supplementary table 3. (continued)

Homolog in Mycoplasma ORF Putative function of ORF agalactiae PG2

MBO 654 thioredoxin MAG_7380 MBO 655 SsrA-binding protein MAG_7390 MBO 656 hypothetical protein MAG_7400 MBO 658 cation-transporting P-ATPase MAG_7420 MBO 659 ABC transporter ATP-binding protein MAG_7430 MBO 660 ABC transporter permease protein MAG_7440 MBO 661 cell division protein ftsH-like protein MAG_7450 MBO 662 hypothetical protein MAG_7460 MBO 663 peptidyl-tRNA hydrolase MAG_7470 MBO 664 exodeoxyribonuclease V alpha chain MAG_7480

CHAPTER 3. CHARACTERIZATION OF AN ATP-BINDING CASSETTE TRANSPORT SYSTEM RESPONSIBLE FOR NUCLEOSIDE UPTAKE IN MYCOPLASMA BOVIS STRAIN M23

Abstract Mycoplasma bovis transposon mutants defective in the components of a putative thymidine transport system were isolated and utilized to characterize the molecular mechanism of thymidine transport in M. bovis . Genetic analysis revealed that the transporter belongs to a family of classical ABC transport systems and is composed of a substrate binding protein ( uptB ), an ATP-binding cytoplasmic domain ( uptA ), and integral membrane permease proteins ( uptC and uptD ). Inactivation of each gene of the transporter resulted in loss of thymidine uptake, indicating that all components were absolutely required for the transport function. The loss of thymidine uptake in these mutants was recovered once the intact uptBACD gene cluster was introduced into the mutants. The entry of 3H-thymidine into

M. bovis mediated by UptBACD was a high-affinity dependent process, with K m of 0.96 ±

0.7 nM, and V max of 244 ± 6.76 nM under the test conditions. Depletion of ATP in mycoplasma reduced the level of 3H-thymidine uptake, indicating that the transport system was energy-dependent. 3H-thymidine uptake was nearly abolished in the presence of 40-fold excess of unlabeled thymidine and reduced in the presence of nucleosides, except deoxycytidine. However, nucleobases and pentoses did not affect of 3H-thymidine uptake. Thus, the UptBACD transporter of M. bovis possesses specific and high-affinity nucleoside transport activity. The activity is likely critical for replication of M. bovis in the host.

Introduction Mollicutes are bacteria that are characterized as the smallest and simplest prokaryotes capable of autonomous self-replication (29, 31). Because of their small genome capacity, Mollicutes have limited synthetic potential for biological substances essential for survival, including amino acids, vitamins, fatty acids, and nucleotide precursors (29). They require rich nutrients for growth in artificial medium, such as animal sera, and yeast extract (16). In particular, nucleotide precursors are among the nutrients that are essential building blocks for

77 the synthesis of genetic materials in all living organisms, including Mollicutes . However, most Mollicutes are unable to synthesize de novo purine and pyrimidine bases, and subsequently must acquire such molecules from the environment (7, 30). In Mollicutes , the requirement of nucleobases for nucleotide synthesis has been reported in several species of mycoplasma (14, 18-20, 34, 39). Incorporation of all nucleosides has been demonstrated in various species of mycoplasma, including Mycoplasma putrefaciens , Mycoplasma gallisepticum , Mycoplasma pneumonia , and Acholeplasma laidlawii (5, 14). In addition, rapid uptake of (deoxy)ribonucleoside-5-monophosphate was demonstrated in M. mycoides subsp. mycoides by substrate uptake analysis (20, 21). These results supported the potential existence of transport systems involved in nucleoside uptake in Mollicutes . Recent knowledge gleaned from advances in complete genome sequencing of several Mollicutes indicate that about 10 % of the open reading frames in genomes of Mollicutes are devoted to encoding for membrane-associated transport systems, with the number of transport systems in the range of 55 to 103 per genome (24, 32, 41). Nucleotide precursors might be imported via one of these transport systems because Mollicutes are defective in biosynthetic pathways for nucleotides (26). In addition to uptake systems, multiple proteins that potentially participate in a salvage pathway for utilization of nucleotide precursors have been identified in Mollicutes (20, 37). These results strongly suggest that active transport systems capable of transporting nucleotide precursors must exist in Mollicutes , and the incorporated substrates then can be utilized by the salvage pathways. Despite multiple circumstantial evidence, no such transport system responsible for the uptake of nucleotide precursors has been characterized in Mollicutes . ABC transport systems are members of a protein family that is ubiquitously found in living organisms. They are composed of three main components including a substrate-binding protein, an ATP-binding domain, and integral transmembrane permeases. These transporter systems are involved in various biological functions in bacteria, as either importers or exporters. In Gram-positive bacteria, one of the major roles of ABC transport systems is to import nutrient substrates from the environment. This should be a vital function in Mollicutes since they need to uptake many nutrients for their survival. In Streptococcus mutans, an ABC transport system has recently been characterized as a nucleoside transport system (38). Interestingly, several sets of conserved ABC transport

78 systems have been identified in the genomes of Mollicutes , although their biological functions have not been characterized. In this study, we have identified mutants defective in transporting thymidine in the bovine M. bovis strain M23. Genetic analysis revealed that the mutants were disrupted in the genes encoding a putative sugar ABC transport system in M. bovis . We report that M. bovis possesses a substrate-binding protein-dependent ABC transport system responsible for nucleoside uptake. In addition, all components of the transport system are absolutely required for its biological function.

Materials and Methods Bacteria, mycoplasma, and growth conditions M. bovis M23 was used as a parent strain for transposon mutant construction and as a wild-type for all assays. This is a pathogenic strain of M. bovis isolated from a case of bovine pneumonia (28). All mycoplasma strains used are listed in Table 1. Primer sequences used are listed in Table 2. All mycoplasma strains were maintained in modified Friis broth supplemented with 20% fetal bovine serum (10), and chloramphenicol (25 µg/ml) or tetracycline (4 µg/ml) was added to this medium as required. Escherichia coli DH5 α was used for plasmid manipulation and propagation, and was maintained in Luria-Bertani (LB) broth or plates. For E. coli , ampicillin (50 µg/ml), chloramphenicol (25 µg/ml), or tetracycline (5 µg/ml) was added to the medium as required.

Chemicals Adenine, guanine, cytosine, uracil, thymine, adenosine, guanosine, uridine, cytidine, deoxyadenosine, deoxyguanosine, thymidine, deoxycytidine, deoxyuridine, ribose, deoxyribose, arabinose, xylose, valinomycin, sodium orthovandate, dicylohexylcarbondiimide (DCC), and 5-bromo-2’-deoxyuridine were purchased from Sigma-Aldrich (St. Louis, MO). Gemcitabine was purchased from ChemieTek (Indianapolis, IN). 3H-methyl -thymidine (86 Ci/mM) was obtained from GE HealthCare (Piscataway, NJ).

Plasmid construction and random mutation All genetic manipulation procedures were performed by standard molecular techniques (35). The transposon-based plasmid pRIT-1 carrying modified Tn4001 functionality and tetracycline resistance was constructed and used for the generation of isogenic mutants (Lee and Rosenbusch, unpublished data). Briefly, plasmid pISM 2062 (9) was digested with SmaI and ligated with 4.98 kb HicII fragment derived from plasmid pISM 1002 carrying Tn 916 (12), resulting in pRIT-1. For complementation assays, plasmids were constructed as follows. The promoter region of the tetM gene conferring tetracycline resistance was amplified by PCR on template DNA of pISM1002 using a primer set (TpF, TpR) and ligated to SalI-BamHI-digested pUC19, resulting in pRIC-1. The chloramphenicol acetyltransferase ( cat ) gene conferring chloramphenicol resistance was amplified by PCR on template DNA of pBR328 (ATCC 37517) using a primer set (CmF, CmR) and inserted into MfeI/SmaI-digested plasmid pRI-1, resulting in pRIC-2. The cat gene under control of the tetM promoter was amplified by PCR on template DNA of pRIC-2 using a primer set (catF, catR) and inserted into SmaI-digested pISM 2062, resulting in pRIC-3. Then, the entire gene region encoding the transporter system was amplified by PCR on template DNA of M. bovis M23 using a primer set (ABC-F, ABC-R), SmaI-digested, and ligated to SmaI-digested pRIC-3, resulted in pRIC-ABC. Plasmid pRIC-ABC carries both the entire region of the uptBACD encoding ABC transporter and the cat gene within the modified Tn 4001 . Mycoplasma transformation was performed as described previously (27). Isogenic mutants were selected on Friis plates with 2 µg/ml tetracycline, whereas the complemented strains were selected on Friis plates with 25 µg/ml chloramphenicol. The selected mutants were filter-cloned and stored at -70˚C until used.

Mutant selection A mutant (MBOTn 2627) that was defective in thymidine uptake was obtained from a library of transposon mutants (Lee and Rosenbusch, unpublished data) after screening with a thymidine uptake assay. The mutant completely lost its ability to incorporate thymidine, when compared to the wild type strain M23 of M. bovis . To identify the gene responsible for this functional loss, the transposon insertion site in the mutant was evaluated by one-

80 directional genomic sequencing using a primer (5’-CGAGGGATTCCGAGGACTG-3’) positioned outwards on the IS256L sequence of Tn 4001 . The disrupted gene in MBOTn 2627 was identified as the ATP-binding domain protein of a putative sugar ABC transporter, located in an arbitrary annotation of the genome of M. bovis strain PG45 (Lee and Rosenbusch, unpublished data). Genomic analysis of flanking genes and their putative translation products revealed that the gene was a component of a putative ABC transporter system composed of four functional genes, consisting of a substrate binding protein, an ATP- binding domain protein, and two different integral transmembrane domain proteins. Three additional mutants, MBO 3754, MBO 2927, and MBO 3178, with disruptions in each one of the other 3 genes of the transporter were also found in the library.

Nucleotide sequence of the ABC transporter of M. bovis M23 To determine the nucleotide sequence of the ABC transporter of M. bovis M23, total genomic DNA was extracted and subjected to Iowa State University DNA facility. The entire nucleotide sequence of the ABC transporter was obtained by a “primer walk” strategy on M23 genomic DNA.

Thymidine uptake assay Thymidine uptake was determined by a rapid filtration method (21), modified as follows. Cells growing exponentially in Friis medium (16 hours at 37 °C) were diluted 1:10 into pre-warmed medium and further incubated for 4 hrs. Cells were harvested by centrifugation (8,000x g, 4˚C, 10 min), washed twice in assay buffer (Ringer’s solution, pH 7.6)(17) by centrifugation (13,000x g, 4˚C, 3 min), and adjusted to an optical density of 0.1 at 3 600 nm in assay buffer. For kinetic studies with the wild-type M23, H-thymidine substrate as required, was added in a volume of 100 µl to a 2 ml microcentrifuge tube containing 900 µl of cell suspension, so that final concentrations of thymidine ranged from 0 to 500 nM. To determine an adequate reaction time, 50 µl samples were taken at various time points (0 to 30 min) from the reaction tubes and vacuum-filtered through pre-wetted filter membranes (0.22 µm-pore size). The membranes were immediately washed 6 times with 1 ml of washing buffer (100 µM unlabeled thymidine in assay buffer). After drying at 65˚C for 3 hr, the

81 radioactivity remaining on the filter was measured with a liquid scintillation counter. The thymidine uptake was determined in nM/mg of cell protein (Lowry Protein Assay, Pierce). Thymidine uptake in four transporter mutants and the corresponding complemented strains were similarly measured. For substrate competition assays, various unlabelled substrates and 3H-thymidine were simultaneously added to the 900 µl of cell suspension, adjusting to either a 40 fold excess of substrates to thymidine at 10 nM. At designated time points, 50 µl samples were taken and processed as described above. All assays were performed in duplicate on three independent mycoplasma culture stocks. Apparent K m and K max values were determined by fitting the data to the Michaelis-Menten equation (Prism, GraphPad, CA).

Energy inhibitors and uptake assay To test whether the ability of thymidine uptake is energy-dependent, sodium orthovanadate, valinomycin, and dicylohexylcarbodiimide (DCC) were added to mycoplasma cells in assay buffer at a final concentration of 1 mM, 10 µM, and 10 µM, respectively. The cells were pretreated with the chemicals at 37˚C for 15 min, then, subjected to thymidine uptake assay.

Results 3H-Thymidine is taken up by a high-affinity transporter 3 H-thymidine uptake in the M23 wild type strain occurred with K m of 0.96 ± 0.7 nM and V max of 244 ± 6.76 nM/mg protein (Figure 1A), within the range characteristic of a high- affinity transporter system. The time course of uptake of 3H-thymidine into M. bovis in the presence of 10 nM 3H-thymidine is shown in Figure 1B. The uptake of 3H-thymidine was nearly linear up to 1 min, at which point an almost maximum level of 3H-thymidine uptake occurred. Therefore, uptake inhibition assays were performed at 30 sec of incubation time. In contrast to the wild type, all transporter mutants (MBOTn 3754, MBOTn 2627, MBOTn 2927, and MBOTn 3178) had almost completely lost their ability to transport 3H-thymidine (Figure 4). We expected that the substrate binding protein mutant (MBOTn 3754) might partially lose its capability of 3H-thymidine uptake. However, 3H-thymidine uptake by the mutant was completely abolished, suggesting that the substrate binding protein is an integral

82 component of the transporter. Thus, each of the four proteins is indispensable for the biological function of the thymidine transporter in M. bovis .

Identification of M. bovis genes encoding a thymidine transporter Thymidine uptake in M. bovis was mediated by an ABC transporter encoding the uptBACD genes. This transporter possesses structural features characteristic of ABC transporters abundant in both eukaryotes and prokaryotes. The complete nucleotide sequence of the ABC transporter of M. bovis strain M23 is shown in Figure 2, whereas the schematic diagram of the genes encoding the thymidine transporter is shown in Figure 3. The uptB gene (substrate binding protein) is separated by 200 bp from a uptA CD gene cluster (ATP-binding protein and permeases) and is transcribed in an opposite direction from the three genes. Gene uptA , uptC , and uptD are overlapping each other by 14 bp, and 1 bp, respectively, and are transcribed in the same direction. Tight organization of the uptACD genes strongly suggests that they are processed by transcriptional coupling, causing a polar effect on the genes. Interestingly, a small open reading frame (ORF) is present between the uptB and uptA genes. This ORF may be a regulator-related protein but this function has not been characterized. The product of the uptB gene, a 467 amino acid protein, exhibits an exporter signal peptide in the first 23 amino acid residues and is followed by a basic membrane lipoprotein (bmp) motif from amino acid residues 64 to 431. The uptA gene encodes a cytoplasmic protein of 533 amino acids, sharing a highly conserved motif with other ATP-binding proteins of ABC transporter systems (1). These include a Walker A motif at residue 20, a Walker B at residue 433, and a C-loop at residue 425. The uptC and uptD genes encode integral membrane proteins of 669 and 324 amino acids, respectively, which likely form the permease structure. Homology searches with the individual genes identified matching genes in several species of mycoplasma, indicating that they are most likely conserved genes possessing a common biological function among mycoplasma species.

Substrate specificity To test the effect of various substrates on thymidine uptake, substrate uptake inhibition assays were performed (Figure 5). Since thymidine is composed of nucleobase

83 thymine and deoxyribose, both nucleobases and pentoses were first tested. They did not affect the uptake of thymidine in M. bovis . With (deoxy) nucleosides, 40-fold excess of unlabeled thymidine completely abolished the ability of 3H-thymidine uptake, and other nucleosides, except deoxycytidine, also significantly inhibited thymidine uptake. On the contrary, 3H-thymidine uptake was slightly increased in the presence of deoxycytidine and similar results were obtained by addition of cytidine. To test whether the inhibitory effect of thymidine analogs on the ability of 3H-thymidine uptake is different from that of unlabelled thymidine, bromodeoxyuridine or gemcitabine were tested in the substrate competition assay. Bromodeoxyuridine had a significant inhibitory effect on 3H-thymidine uptake whereas gemcitabine had no effect in the assay (Figure 5). This indicated that structural modifications on the ribose-moiety (gemcitabine data) may not be critical in substrate recognition by the substrate binding protein, so long as the nucleobase-ribose structure is presented.

Complementation test Complemented strains were generated by introducing plasmid pRIC-ABC carrying the entire uptBACD region and the cat gene into each transporter mutant and by selection on Friis plates (with 25 µg/ml chloramphenicol). The recovery of thymidine uptake in complemented strains was determined by thymidine uptake assay (Figure 7). The thymidine uptake in complemented strains fully recovered to the level of the wild type M23, indicating that loss of thymidine uptake was indeed as a consequence of disruption of each gene composing the transporter.

Thymidine uptake was energy dependent.

Thymidine uptake was not affected by DCC (Fig 7), a F 0 F1-ATPase inhibitor, indicating that the thymidine transporter may not be linked to F 0 F1-ATPase activity. However, the P-type ATPase inhibitor, sodium orthovanadate, inhibited about 50% of the thymidine uptake. Because P-type ATPases are in general linked to ion transporters, this observation should be further studied. Valinomycin, a K + ionophore, greatly inhibited the level of thymidine uptake (Figure 8). This may be a result of direct bacteriostatic effect or disruption of membrane potential of mycoplasma cells. Thus, the diminished uptake of thymidine in chemical-treated cells may reflect a decreased energy-generating capacity.

Discussion In this study we characterize a substrate-binding ATP-dependent ABC transport system, UptBACD, required for nucleoside uptake in M. bovis . Indeed, Mollicutes must acquire nucleotide precursors and this function is absolutely essential for survival from exogenous sources due to lack of de novo synthetic pathways for such molecules (16). The need for a nucleotide transport systems has long been proposed (11, 20) and related genomic sequences reported in recently sequenced Mollicutes genomes (23). However, such transport systems have not been full y characterized in Mollicutes to date. Studies have reported that nucleotide precursors presented in medium were incorporated into several Mollicutes and eventually their nucleic acids (14, 18-20, 34, 39). In addition, uptake of nucleoside monophosphates into M. mycoides subsp. mycoides has been demonstrated by substrate uptake assay (21). In these reports, the existence of a transport system responsible for the uptake of nucleotide precursors was proposed but not confirmed. In preliminary genome studies performed in M. bovis with a subtract hybridization library, gene uptB was defined as a putative lipoprotein named p48 in M. bovis strain PG45 (33), whereas gene uptA was named p59 in M. bovis PG45 and identified as a putative sugar ABC transporter ATP- binding protein. Partial sequences of uptA and uptB of M. bovis PG45 are available (GeneBank, DQ354911). The entire nucleotide sequence of the nucleoside uptake system of M. bovis M23 was determined in the present study. This is the first report of a fully characterized active ABC transport system that is responsible for nucleoside uptake in Mollicutes . The absolute requirement for a substrate binding protein in certain ABC transport systems has been demonstrated in a ribose transport system in enterobacteria (3, 22). Therefore, it was suggested that a substrate binding protein must make contact with the domains of permease proteins presented on the periplasmic membrane to form a tertiary conformational structure (2, 22). Substrate capture specificity was driven by the substrate binding protein, and the binding resulted in triggering of substrate uptake by the permease proteins (2). In substrate competition analyses to determine the substrate-specificity of UptBACD of M. bovis , nucleobases and pentoses did not affect thymidine uptake, indicating that these molecules may not play a significant role by themselves in the substrate binding

85 process. The rate of thymidine uptake was completely abolished in the presence of 40-fold excess of the homologous nucleoside thymidine, as is typical of substrate uptake by an ABC transport system. However, various nucleosides also significantly inhibited thymidine uptake, indicating that UptBACD may not have strict substrate-specificity. In contrast, thymidine uptake in E. coli was highly sensitive to excess of the homologous nucleoside but relatively insensitive to other nucleosides (15). In Lactobacillus lactis , nucleotides can be transported by two different transporters that possess affinity to specific nucleotides (13). Unlike these examples, it has been proposed that transport systems in Mollicutes may function with multiple substrates to compensate for their small genome capacities (36). Interestingly, the increased level of thymidine uptake in the presence of excess deoxycytidine may occur as a result of its activating effect on thymidine kinase, a key enzyme in deoxythymidine synthesis (8). All mutants defective in transporting thymidine were able to grow in modified Friis medium, containing highly rich nutrient sources, including nucleobases, nucleosides, nucleotides, oligonucleotides, RNA, and DNA. This indicated that the uptBACD genes are not essential for survival of M. bovis . Thus, there may be alternative routes that enable M. bovis to uptake other thymine-related nucleotide precursors that can be eventually converted into dTTP by a salvage pathway in the absence of thymidine. The nucleotide dTTP, essential for DNA synthesis, can be formed by two different routes. First, dTMP can be synthesized from dUMP via the action of thymidylate synthase and subsequently converted to dTDP and dTTP by both thymidylate kinase and dTDP kinase. Second, dTMP can be converted from thymidine by thymidine kinase. However, thymidylate synthase has not been identified in M. bovis or the genetically related M. agalactiae (25), suggesting that M. bovis must uptake exogenous nucleotide precursors to generate dTTP. In this case, the existence of a transporter capable of transporting such molecules is inevitable. Interestingly, in M. mycoides subsp. mycoides , the thymidine-related transporter has been experimentally substantiated (40). In that report, the selected mutant was unable to incorporate 3H-thymidine, whereas the wild type was able to rapidly uptake it but lost its ability in the presence of unlabelled thymidine. In addition, the mutant was able to utilize thymine for DNA synthesis but grew slowly

86 compared to the wild type. This indicates that a thymidine-transporter can be compensated by other potential routes for the uptake of thymine-related nucleotide precursors. Our thymidine transport studies revealed that M. bovis mutants disrupted in each component gene of UptBACD completely lost their thymidine uptake ability, indicating that all of the individual components of UptBACD are required for a functional transport system. In addition, the impaired thymidine uptake ability in these mutants was recovered by introducing intact uptBACD genes, confirming that UptBACD requires all four components. Recently, a new class of nucleoside transporter has been characterized in Streptococcus mutans (38). Unlike other nucleoside transporters, this transporter belongs to a carbohydrate uptake subfamily of active ABC transporters, but is involved in ribonucleotide transport. The gene organization of the RnsBACD of S. mutans is very similar to that observed by us in M. bovis . In addition, RnsBACD could not transport ribose or nucleobases, in concert with our observations on the UptBACD transporter of M. bovis . The biological activity of an uptBACD mutant of M. bovis could potentially be impaired as a consequence of disruption of an important transporter that is directly related to bacterial replication. A mutant defective in the pyrimidine salvage pathway of Toxoplasma gondii had attenuated pathogenicity under in vivo challenge (6). For Salmonella typhimurium , a mutant requiring nucleotides was unable to grow in vivo (4). These results indicated that disruption of a metabolic pathway of microorganisms critical for their survival could affect the in vivo survival of the microorganism. Thus, the UptBACD transport system is likely to be needed in M. bovis when it colonizes nucleoside-poor environments in the host.

References 1. Davidson, A. L., and J. Chen. 2004. ATP-binding cassette transporters in bacteria. Annual Review of Biochemistry 73: 241-268.

2. Davidson, A. L., E. Dassa, C. Orelle, and J. Chen. 2008. Structure, function, and evolution of bacterial ATP-binding cassette systems. Microbiology and Molecular Biology Reviews 72: 317-364.

3. Eym, Y., Y. Park, and C. Park. 1996. Genetically probing the regions of ribose- binding protein involved in permease interaction. Molecular Microbiology 21: 695- 702.

4. Fields, P. I., R. V. Swanson, C. Haidaris, and F. Heffron. 1986. Mutants of Salmonella typhimurium that cannot survive within the macrophage are avirulent. Proceedings of the National Academy of Sciences of the United States of America 83: 5189-5193.

5. Finch, L. R., and A. Mitchell. 1992. Sources of nucleotides, p. 211-230. In J. Maniloff, R. N. McElhaney, L. R. Finch, and J. B. Baseman (ed.), Mycoplasmas; Molecular biology and pathogenesis. American Society for Microbiology, Washington DC.

6. Fox, B. A., and D. J. Bzik. 2002. De novo pyrimidine biosynthesis is required for virulence of Toxoplasma gondii . Nature 415: 926-929.

7. Himmelreich, R., H. Hilbert, H. Plagens, E. Pirkl, B. C. Li, and R. Herrmann. 1996. Complete sequence analysis of the genome of the bacterium Mycoplasma pneumoniae . Nucleic Acid Research 24: 4420-4449.

8. Iwatsuki, N., and R. Okazaki. 1967. Mechanism of regulation of deoxythymidine kinase of Escherichia coli : I. Effect of regulatory deoxynucleotides on the state of aggregation of the enzyme. Journal of Molecular Biology 29: 139-154.

9. Knudtson, K. L., and F. C. Minion. 1993. Construction of Tn 4001 lac derivatives to be used as promoter probe vectors in mycoplasmas. Gene 137: 217-222.

10. Knudtson, W. U., D. E. Reed, and G. Daniels. 1986. Identification of mycoplasmatales in pneumonic calf lungs. Veterinary Microbiology 11: 79-91.

11. Lee, D. H., R. J. Miles, and A. E. Beezer. 1986. Isolation and microcalorimetric characterisation of glucose-negative and pyruvate-negative mutants of Mycoplasma mycoides subsp. mycoides . FEMS Microbiology Letters 34: 283-286.

12. Mahairas, G. G., and F. C. Minion. 1989. Transformation of Mycoplasma pulmonis : demonstration of homologous recombination, introduction of cloned genes, and preliminary description of an integrating shuttle system. Journal of Bacteriology 171: 1775-1780.

13. Martinussen, J., S. L. L. Wadskov-Hansen, and K. Hammer. 2003. Two nucleoside uptake systems in Lactococcus lactis : competition between purine nucleosides and cytidine allows for modulation of intracellular nucleotide pools. Journal of Bacteriology 185: 1503-1508.

14. Mcivor, R. S., and G. E. Kenny. 1978. Differences in incorporation of nucleic acid bases and nucleosides by various Mycoplasma and Acholeplasma species. Journal of Bacteriology 135: 483-489.

15. McKeown, M., M. Kahn, and P. Hanawalt. 1976. Thymidine uptake and utilization in Escherichia coli : a new gene controlling nucleoside transport. Journal of Bacteriology 126: 814-822.

16. Miles, R. J. 1992. Cell nutrient and growth, p. 23-40. In J. Maniloff, R. N. McElhaney, L. R. Finch, and J. B. Baseman (ed.), Mycoplasmas: molecular biology and pathogenesis. American Society for Microbiology, Washington.

17. Miles, R. J., and C. Agbanyim. 1998. Determination of substrate utilization rates by Mycoplasmas, p. 95-103. In R. J. Miles and R. A. J. Nicholas (ed.), Methods in Molecular Biology, vol. 104. Humana Press Inc., Totowa, NJ.

18. Miles, R. J., A. E. Beezer, and D. H. Lee. 1986. Growth of Mycoplasma mycoides subspecies mycoides on media containing various sugars and amino sugars: an ampoule microcalorimetric study. Microbios 45: 7-19.

19. Mitchell, A., I. L. Sin, and L. R. Finch. 1978. Enzymes of purine metabolism in Mycoplasma mycoides subsp. mycoides . Journal of Bacteriology 134: 706-712.

20. Neale, G., A. Mitchell, and L. R. Finch. 1983. Enzymes of pyrimidine deoxyribonucleoside metabolism in Mycoplasma mycoides subsp. mycoides . Journal of Bacteriology 156: 1001-1005.

21. Neale, G. A. M., A. Mitchell, and L. R. Finch. 1984. Uptake and utilization of deoxynucleoside 5'-monophosphates by Mycoplasma mycoides subsp. mycoides . Journal of Bacteriology 158: 943-947.

22. Park, Y., J. Cho, T. Ahn, and C. Park. 1999. Molecular interactions in ribose transport: the binding protein module symmetrically associates with the homodimeric membrane transporter. The EMBO Journal 18: 4149-4156.

23. Paulsen, I. T., L. Nguyen, M. K. Sliwinski, R. Rabus, and M. H. Saier Jr. 2000. Microbial genome analyses: comparative transport capabilities in eighteen prokaryotes. Journal of Molecular Biology 301: 75-100.

24. Paulsen, I. T., M. K. Sliwinski, and M. H. Saier. 1998. Microbial genome analyses: global comparision of transport capabilities based on phylogenies, bioenergetics and substrate specificities. Journal of Molecular Biology 277: 573-592.

25. Pettersson, B., M. Uhlen, and K.-E. Johansson. 1996. Phylogeny of some Mycoplasmas from ruminants based on 16S rRNA sequences and definition of a new cluster within the hominis group. International Journal of Systematic Bacteriology 46: 1093-1098.

26. Pollack, J. D. 2002. The necessity of combining genomic and enzymatic data to infer metabolism function and pathway in the smallest bacteria: amino acid, purine and pyrimidine metabolism in Mollicutes . Frontiers in Bioscience 7: d1762-1781.

27. Pour-El, I., C. Adams, and F. C. Minion. 2002. Construction of mini-Tn 4001 tet and its use in Mycoplasma gallisepticum . Plasmid 47: 129-137.

28. Rasberry, U., and R. F. Rosenbusch. 1995. Membrane-associated and cytosolic species-specific antigens of Mycoplasma bovis recognized by monoclonal antibodies. Hybridoma 14: 481-485.

29. Razin, S. 1992. Mycoplasma taxonomy and ecology, p. 3-22. In J. Maniloff, R. N. McElhaney, L. R. Finch, and J. Baseman (ed.), Mycoplasmas: molecular biology and pathogenesis. American Society for Microbiology, Washington.

30. Razin, S. 1978. The mycoplasmas. Microbiological Reviews 42: 414-470.

31. Razin, S. 1969. Structure and function in Mycoplasma. Annual Review of Microbiology 23: 317-356.

32. Ren, Q., and I. T. Paulsen. 2007. Large-scale comparative genomic analyses of cytoplasmic membrane transport systems in prokaryotes. Journal of Molecular Microbiology and Biotechnology 12: 165-179.

33. Robino, P., A. Alberti, M. Pittau, B. Chessa, M. Miciletta, P. Nebbia, D. L. Grand, and S. Rosati. 2005. Genetic and antigenic characterization of the surface lipoprotein P48 of Mycoplasma bovis . Veterinary Microbiology 109: 201-209.

34. Rodwell, A. W. 1960. Nutrition and metabolism of Mycoplasma mycoides var. mycoides . Annals of the New York Academy of Sciences 79: 499-507.

35. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning. A laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press.

36. Saurin, W., and E. Dassa. 1996. In the search of Mycoplasma genitalium lost substrate-binding proteins: sequence divergence could be the result of a broader substrate specificity. Molecular Microbiology 22: 389-390.

37. Tham, T. N., S. Ferris, R. Kovacic, L. Montagnier, and A. Blanchard. 1993. Identification of Mycoplasma pirum genes involved in the salvage pathway for nucleosides. Journal of Bacteriology 175: 5281-5285.

38. Webb, A. J., and A. H. Hosie. 2006. A member of the second carbohydrate uptake subfamily of ATP-binding cassette transporters is responsible for ribonucleoside uptake in Streptococcus mutans . Journal of Bacteriology 188: 8005-8012.

39. Williams, M. V., and J. D. Pollack. 1985. Pyrimidine deoxyribonucleotide metabolism in Acholeplasma laidlawii B-PG9. Journal of Bacteriology 161: 1029- 1033.

40. Youil, R., and L. R. Finch. 1988. Isolation and characterization of Mycoplasma mycoides subsp. mycoides mutants deficient in nucleoside monophosphate transport. Journal of Bacteriology 170: 5922-5924.

41. Zhao, Y., H. Wang, R. W. Hammond, R. Jomantiene, Q. Liu, S. Lin, B. A. Roe, and R. E. Davis. 2004. Predicted ATP-binding cassette systems in the phytopathogenic mollicute Spiroplasma kunkeli . Molecular Genetics and Genomics 271: 325-338.

Figure 1. Kinetics of thymidine uptake in Mycoplasma bovis strain M23 (wild type). Thymidine uptake ability was measured for 10 min at the substrate concentrations indicated. The insert graph presents the time course of thymidine uptake at 10 nM of substrate. Uptake values at each concentration were the means ± S.D. from three independent culture s. Values were corrected by subtracting the amount of radioactivity detected at zero time point and fitted to the Michaelis -Menten equation.

1 TATTAAAATT ATATAGTGTC CAAAATTGGG AATTTTTTAA TGTATAATAC AAATCATGGA 61 AAATAGATTG ATAGAAAATC AAAAAAGTAG TCAAAATGAA TTCAACAGAT TCAATAGAGC 121 CACATCAGTA GTAAGCAGAA AAAATGCTTT TCTAGGTGCT TCAGTTGGTT GATTTTCATA 181 TTCTACATTT GTCGCATTTA TTAGCGCTAT TGTAATGCTT GTATTTTTTA GCCATGCACT 241 AGTATTTATG AAGCAAAACA TCTTTTTAGC ACTAGGGCTT TCGTTCTTGT TAATAATATT 301 TATTTTTGTT GAATTTATTG TAGGCCCAAG AATGAGCTTT TGGACGCAGC TTGTCATAAT 361 AACATTAAGC ATGGTTCTGT TTGGAATTGT TGTACTATCA TTTGCAATTG TTGAATTATT 421 AGAAACGTTT GCTAAAGGTG CACAAAATAT AAACTTACCT CTTGCTCAAA CTTTTGGTGT 481 CATAATTGCC CCAATTGTTA TTATGGCTAT TATGGCAATA TTAGCCTACT TTGATTTGAT 541 TAAAATTAAA ATAGCATATG CATTAACAAT ATTTATATTC ATAAGTTTTT TATTTATTTG 601 AATAATAAGC TCTTTCATTT TTAGCTCATG ACTTTATTCA TTAATTCCTG CATTTGGCTT 661 TGCTTTAATG GTTTGTTATA TGGCTATTGA TTGATGACTA ATTAGCAGAT ACAACAAAGC 721 ATTTAATGCT ACAGTAAGTA ATGAAGCAAC TAAAAAAGAA TTTATGAAGT TAACAATATA 781 TTTTGGCTTC AAATTAGCAT ACGACTACTT ATGAGCTTTA ATTTACTTAG TAAAACTTAT 841 TAGATTAGCT AAAAACTAGA ACAAAAAACC AGGACACGAT TAAATGTCTT GGTTTTTAAT 901 TTTAGTAGCC TATTTTTGTG TTTCTTTAGC CAATCAGTTA ATCATTTTCC CAAATTGGTC 961 AGCAGGTTGG TCTGGTCATT TTGTACCTAA AGCTTTTTTA GCTTCTTCCA ATTGACCTGA 1021 TAAAGTTTTT TGAATTTCCG CTTTTTTACT TTCGTAGTAT TTAGTAGCTT CTTCCAATGC 1081 TTTATTAGCA ATCTCATCAT TCTTTGAGTC TAATAATCCT GAAGTTGCAA CACCTACATA 1141 TTTGCTTGCT TCATTTTCAC CATAACCAAA TACTTTAGCC TCACCATTTT TTTTACCAAT 1201 TTCAAAGCCT GGTTGAAGCG ATAGACTATT TTCACCTTGA GAGTATAAGT CAGCTAAAAC 1261 GTTATAAACA GCTTGACCAA TTAATTTCAT AACTGATGTA AATATTCTAT GACCCTTTAA 1321 TGCATTCTTT TGGTCAGCGT CAACACCAAT AATGAATTTG TTTTTATCGC CTAACTTCTT 1381 AATTTCTTTA GCTGTGTCAG AAGATAATGA TCCTGCAACT GGATATGAAG CTGTGGCCTT 1441 AATTACTGAG TTAATAGCAG CAACTGCAAC GGGTTCACCA GAAGTAAATG ATGTTTTTAA 1501 TTCAATTGTG TTATTTAATG ATTTAGTCTT AGCTTCTGGG TGTTCTTTAT TTCAGTCAAT 1561 AATACCTTGG AATGTACCAG CTATAAAGTC AGAAACTGCT GGTCAAGGAA TACCACCGAA 1621 GGCACCTATT GTACGTTTTT CAGGATTATC CTTGTAAATT TTTGAGAAGT AGTCAGCAAG

Figure 2. Nucleoside sequence of ABC transporter involved in thymidine uptake in Mycoplasma bovis strain M23. Substrate binding protein gene ( uptB ): 910-2316 (complementary), Hypothetical protein gene: 2443-2895 (complementary), ATP-binding domain gene ( uptA ): 3004-4608, intergral membrane permease gene ( uptC ): 4577-6589, integral membrane permease gene ( uptD ): 6589-7566.

1681 AGCACGACCA GCAATATATG CAGCTTGTTT AGTGTCAAAT ATTACAGGAA TTAAGCGTCC 1741 TTGACCAATT TTGTCAACAA ATGCTTTTGC TGCAGGTTCG CCAGTGCTTG CATCTTGTTG 1801 GATATCAAAG TCAACAGTAA TAAAGACAAT ATTATTATCT TTAATCTTTT TAATGTATTC 1861 TGGTTCTAAA CCATAAAGCG CTGCTTTGTG AGTAAATCCA CAAAGAACAA TGTATCTAAA 1921 ACTACTATCA ATAGCGTTTT TGTATGAAGA TGCTAATTCA CCCTTTTTAG GTTCGTAAAC 1981 TTTATTTCTT AAGTTTTTAT TACCACTAAC TTGCGCCTTA TCTAATCCAA GTTCATATGA 2041 AATTTTATGA ACTGCTTCTC AACCAGATTG ATTGAATGAT TCATCATGCA CAGATCCTTC 2101 ATCAGTTATA AATGCTGCCC TTGGTGCATT ATCAACGGTT AAACCATCTC TTAGTTTTAA 2161 TCCTTTACGA GACACGATGT GTGAAAGTGT TGTAACAGTT TTCACTCCAT CAACTTCAGT 2221 TTCTTTAAAG TATTTATCAC CACATGAAGC AGCAACCAAT GGCACTGATA GAACAGGAGC 2281 GGCTCCTAAA AATAGATAGA ATTTGTTTTT TTTCATATTG ATCCCTAATT CAAATATATT 2341 AAGTTCTAAT GAATCAAAAT TTATCAAAAT TTCAATATAG TTTAGAACTA ACAATATTAT 2401 ATTAAATTTA ATATTACTAA TAGCAGTGTG AAAAAGCCAA ATTTATTGCT GAAAAAACAA 2461 AGTCGTTTCT ATCGTTTTTC TTTCATTTTG GGAAATTTTA GTTTTACCTT TATTTAAAAT 2521 ATTAAAAACC AAAGCCCCTA TAAATAAGTT AAATTTGATT GACAAGTTTC CTTGACGGTG 2581 CTCATTTCAC AATTTTTCTC CGTCTTTCTT TTTTAATAAG AAATTTGTTC ATTTGCTTAA 2641 CTTTAAAAGT GACAAAAAAG GGTTAATTAT AAGAATTAAA GATAAAAAAC TCAATGATGC 2701 TATTACGGTG AAAGCAATAA ATTGAGCTTT TTGTCTAAAG TAGACAATCG CTAACAATGT 2761 CATAAAAAAC ATTAAGATAG ATACAAAACC TAAAAAAAGA ACTACTATTA ACTTAAATTT 2821 TCTGTCCTCA TCATATGAAG CAATTTTTTC TAGTTTTTTA GCTTCAATAT TCATAATCAT 2881 TATATTTTTA CTCATAAGCT ACCTTCAATG TTCTGAATTT CATATTCACA AGTTAATATA 2941 GCCTAATTTA TATATAATTA AAGCATATTT ACTTAATATA TTTTATACAA GAAAGGGGGT 3001 TTTATGGAAC ACAATTATGC CGTTGAATTT GAGCATGTGA CTAAGGATTT TGTTGGTATA 3061 AGGGCTAATG ATGACGTGAC TTTTAAAGTT AAAAAAGGAA CAATTCATGC ACTTATTGGC 3121 GAAAATGGAG CTGGGAAAAG TACTCTAACT TCAATTTTGT TTGGTTTGTA TGAACCAACT 3181 GAAGGGTCTG TCAAAATTAA TGGTAAATCA GTTATTGTTA AAAACCCAAA TCAAGCTAAT 3241 GAAATTGGAA TAGGTATGGT TCACCAACAC TTTAAATTGG TTGCTGCCTA TACTAATTTA 3301 CAAAATGTGA TTATGGGTTC AGAGTTCACA TATCAACACT CTTTAGGAAC TTTAGATCTT 3361 AAGTTAGCTA AAGCCAAGAT TAAAAGTATC CAAGAGCTTT ATGATTTACA CTTTAGTTTA 3421 AACCAAAAAA CATCTAAAGC AACAGTTGCG ACTCAGCAAA AAGTTGAGAT TATGAAGATG 3481 CTTTATCGCG ATGCTGAAAT CTTAATTTTT GACGAACCTA CTGCTGTTTT AACCGACCAA 3541 GAAATCCAAG GTTTGCTAAA AACAATGCAA GTATTCAAGG AAAATGGCAA AACAATTATC 3601 TTTATTTCCC ATAAACTCAA TGAAGTTAAA CAGGTAGCTG ACGAAGCAAC TGTTTTAAGA 3661 AAAGGAAAGG TAATTGGAAC ATATGATGTA TCCAAAACCT CTATTCCACA GTTAGCTGAG

Figure 2. (continued)

3721 GCTATGGTTG GACAAAAGGT TGTTGAAACA AAAAACACAG CATTTTTTGA AGGTTACGAT 3781 AAATCTGAAT TTATTTCATT TAACAATGTT TCTACAAAGA AAAGCAGAGA CTCTGTTTCA 3841 CTGAAAAACG TTTCGTTTAA AGTGCGCCCT GGAGAAATTT TAGCAATCGC TGGAGTTGAA 3901 GGAAACGGAC AAGAAACACT AGAATATGTT TTAGCTGGAT TATTAAAACC TATTCATGGT 3961 GAAATAAAAG TTAAAAACTT TGATTACGAT CCAAATAATC CAAAGTCTGT TCAAGAATTC 4021 AACATTACAC ACTGGAGTGT TGATAAGAAA AACAGATTTG CAAAAATTAA TATTGTGCCA 4081 GGCGACAGAC ACAAGCATGG ATTAGTTTTG GACTTTAGTA TTAGAGACAA TTCAATACTA 4141 AGACTAATAA ATGATAAATA CTATGCCCCA CTTGGCTTCA TTAAAGCCAA TAAAAAAGAA 4201 GAATTGTTCC AAAGTATTGT CACAAATTTT GATGTTAGAG GAACAAACCA CGGAAACTCT 4261 TTAGCCAGAT CGCTTTCTGG TGGTAACCAA CAAAAAGCGA TTGTCGGTAG AGAAATGACC 4321 ACAGAGCACA ATCTGCTTGT AATAGTTCAA CCAACCAGAG GGCTTGATGT CGGCGCTATT 4381 GATTTAATTC ATAAAAAAAT TCTTTTAGAA AAACAAGCGG GTAAGGCTAT ATTGCTAATT 4441 TCATATGAGT TAGATGAAAT TCTAGCATTA GCAGACACAA TTGCTGTTAT TAATGACGGA 4501 AGAATTTTAG ATCTTAAACC TGCTTCACAG TTTAGTAGAA CTGAAATAGG TTTATTGATG 4561 GCCGCATCAA ACAAAGATGA AGAATTGAAA GGAGAAGGCG ATGAATAGTA CTGCTGAAAA 4621 AACAACAAAC CCTGTTCTTT CATTCTTCAA AAACTTCTGA AGCAAAGTCA AAAAAGGCGT 4681 TAATGCCGAT AGCGCAGTAT CAACTAGAAG AAAAGCCTAT AACTCTATTT GATCGGTTGT 4741 TTTTGGTATA TTCGTATCTA GCGTTGTGCT TTTACTATTT TTCCAAACCA ACCCTTTTGA 4801 GTTTTTTACG CAAGTTGTTA AAGCAACAAC AAATAAAGGA AACATAGACT GAGTATATAT 4861 ATTTATTATT TACTCATTAG CATCTATAGG TGTCGGATTC TCTTTTAAAA CAGGGCTATT 4921 CAACATTGGG GTAGCTGGAC AAATGTCACT ATCAGGTGTT ATTTGTTTTG CGCTTATCAA 4981 TAAAAGCAAT GTAATTGATG CTACTGGAGT TATAAAAAGC CAAGGCTTAG TATTTGCAAT 5041 AATGCTTTTA TCTATTGTAA TAGGATTTTT ATATGCTGCA ATAGCAGGAT TATGTAAAGC 5101 GTTTTTTAAT ATACACGAAG TTGTTTCTAC AATTTTGCTC AACTGAGTTG CTGTTTATAT 5161 CGGAAGCTTT ATATTTGGAT CAAAATCGCC ATTTAATAAT GATTTTGTGT TCGCTAATAG 5221 TCCAACCGGA TCAGCAACAA TAACTATAAC TGGTGGACTT TTTGATAAAG ATTCATTTTG 5281 AATATTAGGA ATAGTTTTAG TTGCATTTGT TGCGCTAACA CTATATATGA TCTTTGCATT 5341 TACATCATTG GGATACAAAA TCAAAATGAA TGGACTAAAC AAGGACGCTA GTTCATATGC 5401 AGGCGTTAAT CAAAAGTTAA CAACAGTTTT ATCATTGGGC TTTTCTGGGG CACTCGCCGG 5461 GCTAGCTGGT TTCATACATT TTGTTTATAA AGCCAAACAA TATGATGTTG TTGCTCTTTC 5521 CAGTCCACTA CCACTAGGAT TTGACACTAT AGCCATATCT TTAATAGGAA TTAACTCCCC 5581 AATAGGAATA CTTTTCTCAT CGGTTTTCTA CACAATGCTA GAGTTTTCTA GAATTGAGTT 5641 AATTGGTTAT TACTCAACTA GTGGCGTTAA AGAGGGAGGA ATTGACTTAG TTGTTGGTGT 5701 TATTATTTTC ACATCAGCAC TAGCTGTTAT GTTCACTAAT TTTAAACCTA TTCGCAAGTT

Figure 2. (continued)

5761 TAGGATGTGG ATAGCATTGC TGACCCAAAA AGTATATAAA GGTCACTATG CAACATATAA 5821 AGAAAAAGTA AAAACAGTTA AGGAAAATAC CAAAAAATTA CTTGATGAAG CGAAATTAGT 5881 TTACCAAAAG AACAAACCAA AATACAATGA AATTAAATCT AAAATAAAGG CTCTTGAAAA 5941 TGAAGTGTTA ATCAAGGTTA AACTGGGAAC TGATAAAAAA TCACAAACCA AACTTTCAAA 6001 TCATGACATT GAAAAGATTT TCCAAGCACT AGCAAAACAA AAATCTGTTC TTAATCAAGA 6061 GTTGGCTACA TATGGCTATT TTGATAAAAA AGATATTAAA AACCTTAAAA ATGTTAAGTT 6121 AACACAACTT AAAGTTGAAC TTAACAAAAT TCAAGAAGAC TTATTAGATA ACTATCTACT 6181 AATTGAATCA AGACTAATCT TTTTAAGAGA AACATATGAC CAAAAGCACT ATAAAATAGT 6241 GAAAGAACAT AATTTAGATC AATTTAAAAA CGAGCTATTT TATCTTTATG AAGATAAAAA 6301 ACAAATGATT AAAAATCATA AGTTAGAACT CAAAAAAGCA AAATCTGAAT CAAATAATGA 6361 ATTAGTTGCA AAATTAACAT CTGAATTAAA CAAGCTAAAT GAAGAATTAG CAAAGATTAA 6421 ATCGGATTAT GCAATTTATA GAAAAGACAT ATTAGCTTCA TACAAAGGAA TTGAAACAGT 6481 CGACAATTCA AACAGCGAAA ATCCAATCAA GACAATAAAT CAAGATCTAT TTTTTGCATA 6541 TAAAGAAAAA GTTAAACTAA TAGAAAGCTT CGCGACAGGA GGTGAATAAT GGAAAATATA 6601 GCGTTTATAA CTAATGAAAC ATTATTTTTC GCTTGCGTCC TTGGCCTAGC TGCTATTGCT 6661 GGAATATTTG CTGAAAGATC AGGAACTGTA AATATTGCAA TTGAAGGTAC TATGTCAATG 6721 GGGGCCTTAG GATATTGCAT TATTTCAGCG CTTTTAACTA GTGGTGGAAG AATAACAGGA 6781 GCAAATATTG ATGCACCGGG TATAGAGATT ATTTCATTAA TCTTTGCTGC TCTATTTGGT 6841 TCATTATTCT CATTATTGCT AGGTTTATCA ACAATAAAAT TAAAAGCTGA GCACACAATA 6901 ACAGGGGTTG CATTAAACCT TTTATCTGTA GGTATTTGTG CTGCTATTAT GAATCCTTCA 6961 CTTTTAGGTA ATGCACAAAA GCAAATTGAT CACACTGTGC GTGAACTTGC ATTAAGCACA 7021 AATTATAATG AATTTGGAAA CATTTTAAGT TTTAAACTAT TCCTTTTAAT ATCAGTTGTA 7081 GTTATTTCAT GATTTGCTTT AAACAAAACA AAATGAGGGC TTCGTTTCAA AGCTGTTGGC 7141 GAGAACCCAC AAGCTGTTGA CGTAGCCGGA ATAAATGTTT ATAAATACAA ATGAATGGGC 7201 ATTGTTATTT CAGGTTGTAT AGCCGGAATG GCTGGTGGTG TGTTTGCTCA AAAACTACCA 7261 TTTTCTGGAC AAACTAACGG ATTTGGTTTC CTTGCATTAG CTATTATGAT AATGTCTCAC 7321 TGAAATGTAT TAATTGTTCC AGTTTGTGCC TTATTCTTTG GTTTCTTCCA ACAAATAGGT 7381 GCATGACTAC TTGGCGTAGA ATTTGCTAAT ATTGTATCGA CTGAAACTAA TGATAGAGTT 7441 CAAAAAATTG GAGAACTAAT TAAAGCAATT CCATATGTCT TAACGCTTAT CTCGATTATG 7501 GCATTTAGTA AACTGTCTCC TGGCCCTGCA GCTTCAGGTA TAAACTATGA TAAGTCCAAG 7561 AGATAAGTAA CAAAATATTA TCAGCCTAGC TTTTTGCTAG CTGATTTTAT TTATTGCTTT 7621 TAAGCCTGTA AAACAGGCAA TAAGCCCACA TTCTGATAAC AAGACAACAT AGTTTTCTTT

Figure 2. (continued)

Figure 3. G enetic map of the ( uptBACD ) region encod ing the thymidine transporter of Mycoplasma bovis . Transcriptional direction of genes is represented by large arrows, with gene name on top and the number of amino acid residues at the bottom. Vertical arrows indicat e the transposon insertion sites on each gene and the name of the transposon mutants is indicated in boxes. uptB : substrate binding protein, NK : not known gene, uptA : ATP-binding domain, uptC and uptD : transmembrane permease proteins.

Figure 4. Inability of thymidine uptake in the transporter mutants of Mycoplasma bovis . 3H-thymidine uptake was measured at 10 nM thymidine and 37°C for 5 min. The data represents mean ± S.D. from three independent cultures. M23: wild type, MBOTn 3754: substrate-binding protein mutant, MBOTn 2627: ATP-binding domain mutant, MBOTn 2927: transmembrane permease mutant, MBOTn 3178: transmembrane permease mutant.

adenine cytosine thymine uracil adenosine cytidine uridine deoxyadenosine deoxycytidine deoxyguanosine thymidine deoxyuridine arabinose deoxyribose ribose xylose no substance

0 50 100 150 200 Thymidine uptake (%)

Figure 5. Inhibition of thymidine uptake by various substrates in Mycoplasma bovis . Uptake of 3H-thymidine was determined using 10 nM 3H-thymidine in the presence of 40-fold excess of the indicated substrate at 37°C for 30 sec. Values are means ± S.D. from three independent mycoplasma cultures.

Figure 6. Effect of thymidine analogs on thymidine uptake in Mycoplasma bovis . (A) chemical structure of thymidine analogs: (1) bromodeoxyuridine, (2) gemcitabine (GT). (B) Inhibitory effects of thymidine analogs and thymidine (dTR) on 3H-thymine uptake.

100

Figure 7. Recovery of thymidine uptake in transporter mutants by complementation of the impaired genes. The uptake rates were determined at 10 nM thymidine and 37°C for 1 min and shown as mean ± S.D. from three independent cultures. Complementation was accomplished using plasmid pRIC-3.

101

Figure 8. Effect of energy inhibitors on thymidine uptake in Mycoplasma bovis . 3H-thymidine uptake was measured with 10 nM 3H-thymidine at 37˚C for 5 min in the cells that were pre-treated with chemicals for 15 min at 37˚C. Values are means ± S.D. from three independent cultures. DCC:dicylohexylcarbodiimide, SOV: sodium orthovanadate, VMC: valinomycin .

102

Table 1: Bacteria, mycoplasma strains, and plasmids. Bacterial strains Sources or Descriptions and plasmids references

Mycoplasma M23 Field isolated parent strain (30) MBO 2627 Transposon mutant disrupted in ATP-binding domain gene This study MBO 2927 Transposon mutant disrupted in permease C protein This study MBO 3178 Transposon mutant disrupted in permease D protein This study MBO 3754 Transposon mutant disrupted in substrate-binding protein This study C-MBO 2627 Complemented MBO 2627 carrying pRIC-ABC that contains This study the entire uptBACD gene region and chloramphenicol resistance gene C-MBO 2927 Complemented MBO 2927 carrying pRIC-ABC This study C-MBO 3178 Complemented MBO 3178 carrying pRIC-ABC This study C-MBO 3754 Complemented MBO 3754 carrying pRIC-ABC This study

Plasmids This study pRIT-1 pISM2062 carrying 4.9 kb HcII fragment containing Lee and Rosenbusch tetracycline resistance gene ( tetM ) derived from pISM1002 (unpublished data) pRIC-1 pUC19 carrying tetM promoter region at SalI/BamHI This study pRIC-2 pUC19 carrying chloramphenicol acetyltranferase ( cat ) gene This study under control of tetM promoter pRIC-3 pISM2062 carrying the cat gene under control of tetM This study promoter at (EcoRV)SmaI pRIC-ABC pRIC-3 carrying the entire uptBACD gene region at This study SmaI/SmaI pISM1002 Source of tetracycline resistance ( tetM ) gene (13) pISM2062 Parent plasmid for constructs, carrying modified Tn 4001 (10) pUC19 Parent strain for plasmid construction pBR328 Source of cat gene ATCC

103

Table 2. Primers used in this study.

Name Nucleotide sequences (5’ 3’) Sources

TpF TCAGTCGAC GAATAACAAATATTGGTACATTATTACAGCT This study

TpR TCAGGATCCCAATTG TTCCTCCATTCAAAAG This study

CmF TCACAATTG ATGGAGAAAAAAATCACTGGATATACCA This study

CmR TCACCCGGG TTAAGGGCACCAATAAC This study catF GCATCAGATATC GAATAACAAATATTGGTACATTATTACAGC This study catR GCATCACCCGGG TTAAGGGCACCAATAACTGC This study

ABC-F CTGCTACCCGGG AACTAGAACAAAAAACCAGGACACGAT This study

ABC-R TCACTGCCCGGG TTCCGCTTATTCCTATTAACATAGACTTACTCC This study

104

CHAPTER 4. IDENTIFICATION OF MYCOPLASMA BOVIS GENES REQUIRED FOR RESPIRATORY TRACT PERSISTENCE AND SYSTEMIC INFECTION IN CALVES USING SIGNATURE-TAGGED MUTAGENESIS

Abstract Invasive disease and chronicity are hallmarks of Mycoplasma bovis infections . This study was carried out to better understand the genetic basis of M. bovis disease and the genes required for establishment of systemic infection and lower respiratory tract persistence in calves. We analyzed 50 mutants selected from a Tn 4001 random insertion library of the pathogenic M. bovis strain M23. A modified signature-tagged mutagenesis assay in calves was developed to screen the selected mutants. The mutants were grouped into 5 mutant pools consisting of 10 - 15 mutants per group, and 10 7 colony forming units of each mutant were inoculated intratracheally. At 7 days post-infection, tissue samples from the calves were analyzed by PCR assays specific for each mutant. We identified three mutants which could not be recovered from the tracheo-bronchial lymph node of infected calves. The defective genes identified in these non-invasive mutants were a polyamine transporter permease gene (potC ), an uncharacterized ABC transporter permease gene, and oppF , an oligopeptide ABC transporter ATP-binding protein gene. These last two mutants were also unable to persist on the tracheal mucosa. In addition, a mutant defective in trigger factor ( tig ) was only recovered from the tracheo-bronchial lymph node of a few calves, and mutants with defective lipoate- protein ligase ( lpo ) and peptide methyltransferase ( hemk ) exhibited limited persistence on tracheal mucosa. The signature-tagged mutagenesis assay in cattle allowed the identification of multiple genes associated with in vivo survival and virulence of M. bovis .

Introduction Mycoplasma bovis is a major etiological agent causing calf pneumonia, mastitis, arthritis, and other conditions (23, 27). After it was first isolated in 1961 in the USA (9), M. bovis infections have been shown to occur worldwide (23). The infections cause costly diseases leading to substantial economic losses to the cattle industry due to mortality, reduction of milk production in dairy cow, loss of weight gain and carcass value in beef (23,

105

27). Furthermore, once M. bovis infection enters a herd, it is very difficult to eliminate it from the affected herd. As with other mycoplasmas, chemotherapy generally provides limited clinical benefit and does not clear the infection. Since resistance to antimicrobials is well documented (14), there have been many efforts to develop vaccines against M. bovis infection, also with limited success (23-25). No virulence determinants have been identified in M. bovis , in part due to a lack of genetic tools useful for this mycoplasma. A recent report (5) indicated that M. bovis PG45 could be transformed with the Tn 4001 -containing plasmid pISM 2062 (16). We have constructed a random insertion library from the pathogenic M. bovis strain M23 using plasmid pRIT-1 (Lee and Rosenbusch, 2009, pers. comm.). In addition, signature-tagged mutagenesis (STM) screening has being widely used to determine putative virulence factors in many pathogens (3, 33). Recently, STM screening was successfully used to identify a virulence factor in Mycoplasma gallisepticum using a chicken respiratory infection model (12). Here, we report the establishment of a STM screening assay and its use to identify M. bovis genes required for establishment of systemic infection and tracheal mucosa persistence in cattle.

Materials and Methods Mutant library and mutant pools Strain M23 of M. bovis is a pathogenic strain isolated from a case of bovine pneumonia (30). A random mutant library of M. bovis strain M23 was constructed (Lee and Rosenbusch, pers. comm.). For STM screening in calves, we selected 50 candidate virulence gene mutants out of the 3,155 random mutants from the library, selecting only from among mutants having transposon insertions that were likely to functionally disrupt the gene under study (7). Mutants to be tested were those where the disrupted gene of interest was possibly associated with virulence, invasion, or in vivo survival of an organism, based on reported studies on animal mycoplasmas or gram-positive bacteria. Mutants were characterized according to gene function by sequence homology with genes from a preliminary genome annotation (Lee and Rosenbusch, pers. comm.). They could be classified into 14 functional categories as follows: translation (2), transcription (1), replication, recombination and repair (4), cell cycle control (1), membrane biogenesis (2), posttranslational modification, protein

106 turnover, and chaperones (5), energy production and conversion (2), carbohydrate transport and metabolism (8), amino acid transport and metabolism (6), nucleotide transport and metabolism (2), coenzyme transport and metabolism (2), inorganic ion transport and metabolism (4), other functions (7), and non-assigned (8). Thus, the mutants tested represented many categories of biological functions. The list of selected mutants is reported in Table 1. To prepare mutant pools, individual mutants were grown to mid-logarithmic phase in Friis broth supplemented with 20% fetal bovine serum (17). Aliquots were snap- frozen on dry ice and stored at -70˚C. The viable bacterial concentration within each frozen stock was determined as colony forming units (CFU) per ml by titration on Friis agar plates. Mutant pools were prepared from frozen aliquots of each individual mutant resuspended in a total pool of 100 ml of phosphate-buffered saline (PBS), pH 7.4, supplemented with 1% horse serum, so that the pool contained the same concentration of each included mutant.

Mutant screening in calves Calves and calf inoculation: All animal experiments were conducted following protocols approved by the Institutional Animal Care and Use Committee. Six-month old Holstein calves confirmed mycoplasma-free by microbiological culture of nasal swabs and ELISA serology were purchased and housed in an animal isolation unit at Iowa State University. The calves were acclimatized for two weeks prior to initiation of the study. For mycoplasma inoculation, calves were sedated and a trochar was introduced into the trachea through a skin incision. A tracheal catheter was then inserted and advanced to the tracheal bifurcation. The mutant pool (100 ml) was slowly inoculated via the tracheal catheter. After inoculation, calves were observed daily and rectal temperature recorded. Signature tagged mutagenesis screening in calves: To optimize STM in vivo assay conditions in calves, pools of 15 pseudo-mutants were prepared. Each pseudo-mutant had Tn 4001 inserted at intergenic regions (between two functional genes). A frozen aliquot of each pseudo-mutant was pooled into a final volume of 100 ml PBS with 1 % horse serum, adjusting the viable mycoplasma number to 10 5, 10 7, or 10 8 CFU of each mutant, respectively. The pseudo-mutant pools were kept on ice and used to inoculate calves within 30 minutes of preparation. To prepare an input DNA pool, 100 µl of each mutant was

107 inoculated into 10 ml of Friis medium and incubated for 24hr. Genomic DNA was extracted from the mutant pool culture, and designated “input DNA”. Nasal swabs from both nares of each calf were taken daily. At necropsy, nasal swabs, uncoagulated blood, tonsils, tracheal swabs obtained from the lower third of the tracheal mucosa, and the tracheo-bronchial lymph node (TBLN) were taken. The TBLN was selected because of its prominent role in collecting lymph from most of the lung parenchyma in ruminants (2). Screening by STM with candidate mutants was performed as described for pseudo- mutants, with 10 - 15 individual mutants per pool, and 10 7 CFU of each mutant in the inoculum pool. Input DNA pools were prepared for each mutant pool as described above. The selected 50 mutants were assigned to 5 mutant pools that were used for STM screening using 2 calves per pool. Several candidate mutants were assigned to more than one pool, and were tested in more than one pair of calves. The criteria used for defining whether recovery of a mutant was impaired from a given site were that the loss was observed to occur in all of the calves tested. Partial loss of recovery was assigned to results where more than half of the calves tested did not yield the mutant at the site. Recovery scores from nasal mucosa or tonsil were not considered reliable, since recovery of the wild type strain M23 was variable from these sites in calves inoculated at the tracheal bifurcation (Rosenbusch, pers. comm.)

Mutant identification Sample processing: Swab samples were collected into dry sterile tubes and kept on ice for processing. Paired nasal swabs were soaked in 2 ml sterile PBS on ice for 30 minutes, the swabs removed, and the PBS wash used to inoculate Friis broth. Eight tracheal mucosa swabs from each calf were soaked in 8 ml of sterile PBS and processed as above. Tissue samples (tonsil, TBLN) were weighed, 1 gm of tissue homogenized in 10 ml of sterile PBS using glass tissue grinders, and the suspension centrifuged (200x g for 3 minutes at room temperature) to retrieve the supernate. Each processed sample was inoculated 1:10 (v/v) in 100 ml Friis broth supplemented with 67 µg/ml cefoperazone and 100 µg/ml bacitracin (Sigma, St. Louis, MO) as inhibitors of bacterial contamination. After 24 hr of incubation at 37˚C, the broth cultures were filtered through membrane filters (0.85 µm in diameter) and

108 centrifuged (15,000x g at 4 ˚C for 20 minutes). The pellets were resuspended in 50 ml of fresh Friis broth with inhibitors and further incubated at 37˚C for 24 hr. Mycoplasma cells were harvested by centrifugation (15,000x g at 4 ˚C for 20 minutes). Total genomic DNA, designated “output DNA”, was extracted from pellets of enriched broth samples (Blood DNA Extraction Midi-Kit, Qiagen, Valencia, CA) and subjected to PCR analysis to identify individual mutants within the “output DNA”. Mutant identification by PCR analysis: Presence of an individual mutant within “input DNA” or “output DNA” was determined by PCR using a mutant-specific primer which recognized sequence from the gene or a flanking gene, and a universal primer (U256) recognizing an outward sequence on IS256 L of Tn 4001 . Each mutant-specific PCR reaction resulted in a single PCR product of characteristic size, whether it was run on mutant DNA or pool DNA. Mutants that yielded amplicons that did not conform to this criterion were not used in these pools. The amplicon size for each mutant was in the range from 220 bp to 1100 bp and the primers used are listed in Table 2.

Results Optimization of STM assay In a calf inoculated with a pseudo-mutant pool at 10 8 CFU per mutant, blood samples were culture-positive up to day 5 post-infection, confirming that M. bovis strain M23 was able to cause bacteremia following intratracheal inoculation. However, the calves inoculated with pseudo-mutant pools at 10 7 and 10 5 CFU per mutant showed intermittent culture- positive blood samples, and these results were not used for analysis of mutants. All 15 pseudo-mutants were recovered from tonsil, tracheal swab, and TBLN samples in the calves inoculated with pseudo-mutant pools of 10 8 CFU and 10 7 CFU per mutant while several pseudo-mutants were not recovered in these body locations from the calf receiving the pseudo-mutant pool at 10 5 CFU per mutant. The results were used to configure all STM screens, using pools of 15 mutants or less and 10 7 CFU per mutant. The selected 50 mutants were assigned to 5 pool groups where each group contained 10 - 15 mutants with 107 CFU per mutant.

109

Mutant recovery patterns Three distinct patterns of recovery were observed with the mutants. Mutants that behaved like the wild type (pattern A) were recovered from all calves in all samples, and principally from tracheal mucosa, and TBLN. Most mutants (42 out of 50) were categorized in this pattern. The second pattern (pattern B) included mutant MBOTn 627 that was recovered from tracheal mucosa but not from the TBLN sample. The functional defect did not impair mucosal colonization but did impair translocation to other tissues. The third pattern (pattern C) included mutants which were not recovered from either tracheal mucosa or TBLN, represented by mutants MBOTn 1283 and MBOTn 1290. The mutants were unable to colonize on the tracheal mucosa and thus were not available for translocation to the TBLN. Some mutants were observed to have only partially lost potential for tracheal mucosa colonization or translocation to the TBLN. Mutant isolation from blood or nasal swab samples was infrequent during the 7 days after inoculation, and occurred only with strains with recovery pattern A (data not shown). A summary of recovery results is presented in Table 3. Translocation to the TBLN and tracheal mucosa colonization were reliable indicators of M. bovis pathogenicity, and required separate colonization factors. Tissue and swab samples yielded representative amounts of genomic DNA of each recoverable mutant when processed by PCR (Figure 1).

Identification of disrupted genes and their schematic features Disruption of 3 genes resulted in recovery patterns distinct from the wild type. The spermidine/putrescine ABC transporter permease gene ( potC ) disruption in MBOTn 627 was associated with translocation to the TBLN. An uncharacterized ABC transporter permease protein gene disrupted in MBOTn 1283, and an oligopeptide ABC transporter ATP-binding protein gene ( oppF ) disrupted in MBOTn 1290 were important in tracheal mucosa colonization. In M. bovis , potC belongs to a spermidine/putrescine ABC transporter that consists of an ATP-binding domain ( potA ), two permeases ( potB and potC ), and a substrate binding domain ( potD ). The genes overlap by 14, 5, and 11 nucleotides respectively in potABCD (Figure 1C), indicating that the genes are likely under control of a single promoter. Insertion of the transposon into potC is likely to also affect the potD gene function

110 due to polarity of the gene cluster, and consequently impair the biological function of the polyamine transporter. In mutant MBOTn 1283, the identified gene is part of a gene cluster identified as a characteristic ABC transporter (Figure 1A). The gene cluster consists of conserved predicted lipoproteins, an ATP-binding domain, and two integral transmembrane proteins. In particular, the last three genes overlap by 16 and 59 nucleotides respectively, indicating that the genes are likely to be under the control of a single promoter. The transposon was inserted into the first integral transmembrane gene, suggesting that one or both transmembrane genes are inactivated due to the polarity of the gene cluster. The biological function of this ABC transporter has not been characterized. In mutant MBOTn 1290, the oppF gene was interrupted by transposon insertion, and this gene is part of an oligopeptide ABC transporter that includes a hypothetical protein (a putative substrate binding domain oppA ), two permease proteins ( oppB and oppC ), and two ATP-binding domains ( oppD and oppF ). Disruption of the oppF gene results in inactivation of one ATP- binding domain and the loss of energy abolishes the functionality of the transporter. While not eliminating recovery from the TBLN, a mutant (MBOTn 230) defective in the tig trigger factor gene was only recovered from this site in 1 out of 4 calves tested. Similarly, a mutant (MBOTn 1240) defective in the lpo gene for lipoate protein ligase, and a mutant (MBOTn 363) defective in the hemk gene for peptide methyltransferase were both recovered from the tracheal mucosa of only 2 out of 6 calves tested.

Discussion Although M. bovis causes a variety of diseases in beef and dairy cattle, the molecular pathogenesis of these diseases is unknown. It has been reported that M. bovis is able to infect internal organs and tissues, such as liver, kidney, lung, joints, and mammary glands as a consequence of either invasion across airway and alveolar epithelium or lymphatic drainage from alveoli (1, 15, 32, 37). To establish systemic infection, M. bovis may need to survive and replicate in the infected host in various environments and have the ability to confront scarcity of nutrients and components of the host’s immune defenses. Microbial pathogens have multiple biological properties that enable them to attach, colonize, invade at specific entry sites, and replicate in the environment of the infected host

111

(11). Thus it is highly desirable to use in vivo assays in the natural host to determine the genes responsible for such complicated infection processes (18). In particular, STM has often been used to identify mutants unable to survive specific conditions in the infected host, and has led to the identification of genes critical for establishment of bacterial diseases (3, 21, 22, 33). Since STM relies on the ability of the pathogen to survive and replicate as a mixed population in the infected host, several parameters must be optimized to obtain reproducible outcomes in a particular host. The parameters include the complexity of mutant pool, inoculum dose, administration route, duration of infection, and choice of animal host. The parameters must be optimized empirically because they are obviously interrelated to each other (18, 26). The ability of microorganisms to survive in vivo is a result of complex interplay between the host environment and the microorganism (18). A constant supply of a nutrient utilized by a gene that is required for in vivo survival may be a critical factor in the ability of a pathogen to establish disease. Many nutrients are obtained from exogenous sources by mycoplasmas due to their limited synthesis pathways. Thus, the ability to incorporate molecules through membrane-associated transport systems appears to be a critical factor for in vivo survival of M. bovis . In our study, two transporters (oligopeptide transporter oppABCDF and an uncharacterized transporter) were required for colonization on the tracheal mucosa. In Mycoplasma mycoides subsp. mycoides , a glycerol transporter ( gtsABC ) has been defined as a virulence factor associated with hydrogen peroxide production and induction of cytotoxicity (10, 28, 38, 39). The mRNA expression of oppD (ATP binding protein of oligopeptide transporter) of Mycoplasma hyopneumoniae was slightly up-regulated during in vivo infection (20) and under iron-depletion conditions (19). An oppA mutant of Streptococcus Group A was reported to be attenuated in mortality and tissue damage in a mouse model (40). The oligopeptide ABC transporter was required for growth and survival of Streptococcus agalactiae in a rat model, and was correlated to lack of amino acid biosynthetic capabilities in this organism (13, 34). We show here that another transporter ( potABCD ) is required for translocation of M. bovis to the TBLN. The mRNA transcription of potA was up-regulated in M. hyopneumoniae during in vivo infection (20), and mRNA of potB was up-regulated under iron-limiting

112 growth of the mycoplasma (19). In Streptococcus pneumoniae , both potA and potD genes were identified as virulence-associated genes by STM in a mouse model (29, 35, 41). The polyamines transported by Pot transporters (spermidine and putrescine) have multi-factorial biological functions in living organisms, including stress responses which may be more important than their metabolic role (31, 36). The tig gene defect resulted in partial loss of translocation of the mutant to the TBLN. The gene product is a ribosome-associated chaperone that has been shown to be involved in persistence of Listeria monocytogenes in lymphoid tissues and in stress tolerance (4). Disruption of the peptide methyltransferase HemK resulted in partial loss of tracheal mucosa colonization of mutant M. bovis . A similar gene disruption was shown to eliminate protection against phagocytosis in Yersinia pseudotuberculosis (8), and prevent systemic infection in Streptococcus pneumoniae (6), although in both reports the effect was ascribed to polar effect on a nearby gene. Peptide methyltransferase plays a critical role in translation termination by methylation of terminator peptides. A lipoate protein ligase ( lpo ) disruption mutant of Mycoplasma gallisepticum was shown to have lost tracheal mucosa colonization ability and resulted in lowered tracheal lesion scores in chickens (12). Similarly, the lpo gene may be involved in tracheal mucosa colonization in M. bovis . In summary, this study demonstrated that our STM technique is applicable to identify M. bovis genes required for survival of the mycoplasma in its natural host. Up to 2 genes were shown to be required for translocation to a regional lymph node, and up to 4 genes were shown as required for tracheal mucosa colonization.

References 1. Adegboye, D. S., P. G. Halbur, D. L. Cavanaugh, R. E. Werdin, C. C. L. Chase, D. W. Miskimins, and R. F. Rosenbusch. 1995. Immunohistological and pathological study of Mycoplasma bovis -associated lung abscesses in calves. Journal of Veterinary Diagnostic Investigation 7: 333-337.

2. Albertine, K. H., J. P. Wiener-Kronish, P. J. Roos, and N. C. Staub. 1982. Structure, blood supply, and lymphatic vessels of the sheep's visceral pleura. American Journal of Anatomy 165: 277-294.

3. Autret, N., and A. Charbit. 2005. Lessons from signature-tagged mutagenesis on the infectious mechanisms of pathogenic bacteria. FEMS Microbiology Reviews 29: 703-717.

113

4. Bigot, A., E. Botton, I. Dubail, and A. Charbit. 2006. A homolog of Bacillus subtilis trigger factor in Listeria monocytogenes is involved in stress tolerance and bacterial virulence. Applied and Environmental Microbiology 72: 6623-6631.

5. Chopra-Dewasthaly, R., M. Zimmermann, R. Rosengarten, and C. Citti. 2005. First steps towards the genetic manipulation of Mycoplasma agalactiae and Mycoplasma bovis using the transposon Tn 4001 mod. International Journal of Medical Microbiology 294: 447-453.

6. Fernebro, J., C. Blomberg, E. Morfeldt, H. Wolf-Watz, S. Normark, and B. Normark. 2008. The influence of in vitro fitness defects on pneumococcal ability to colonize and to cause invasive disease. BMC Microbiology 8: 65.

8. Garbom, S., M. Olofsson, A.-C. Bjornfot, M. K. Srivastava, V. L. Robinson, P. C. F. Oyston, R. W. Titball, and H. Wolf-Watz. 2007. Phenotypic characterization of a virulence-associated protein, VagH, of Yersinia pseudotuberculosis reveals a tight link between VagH and the type III secretion system. Microbiology 153: 1464- 1473.

9. Hale, H. H., C. F. Helmboldt, W. N. Plastridge, and E. F. Stula. 1962. Bovine mastitis caused by Mycoplasma species. Cornell Veterinarian 52: 582-591.

10. Hames, C., S. Halbedel, M. Hoppert, J. Frey, and J. Stulke. 2009. Glycerol metabolism is important for cytotoxicity of Mycoplasma pneumoniae . Journal of Bacteriology 191: 747-753.

11. Handfield, M., and R. C. Levesque. 1999. Strategies for isolation of in vivo expressed genes from bacteria. FEMS Microbiology Reviews 23: 69-91.

13. Jones, A. L., K. M. Knoll, and C. E. Rubens. 2000. Identification of Streptococcus agalactiae virulence genes in the neonatal rat sepsis model using signature-tagged mutagenesis. Molecular Microbiology 37: 1444-1455.

114

14. Kauf, A. C. W., R. F. Rosenbusch, M. J. Paape, and D. D. Bannerman. 2007. Innate immune response to intramammary Mycoplasma bovis infection. Journal of Dairy Science 90: 3336-3348.

15. Khodakaram-Tafti, A., and A. Lopez. 2004. Immunohistopathological findings in the lungs of calves naturally infected with Mycoplasma bovis . Journal of Veterinary Medicine A 51: 10-14.

16. Knudtson, K. L., and F. C. Minion. 1993. Construction of Tn 4001 lac derivatives to be used as promoter probe vectors in mycoplasmas. Gene 137: 217-222.

17. Knudtson, W. U., D. E. Reed, and G. Daniels. 1986. Identification of mycoplasmatales in pneumonic calf lungs. Veterinary Microbiology 11: 79-91.

18. Lipsitch, M., and E. R. Moxon. 1997. Virulence and transmissibility of pathogens: what is the relationship? Trends in Microbiology 5: 31-37.

19. Madsen, M. L., D. Nettleton, E. L. Thacker, and F. C. Minion. 2006. Transcriptional profiling of Mycoplasma hyopneumoniae during iron depletion using microarrays. Microbiology 152: 937-944.

20. Madsen, M. L., S. Puttamreddy, E. L. Thacker, M. D. Carruthers, and F. C. Minion. 2008. Transcriptome changes in Mycoplasma hyopneumoniae during infection. Infection and Immunity 76: 658-663.

21. Mazurkiewicz, P., C. M. Tang, C. Boone, and D. W. Holden. 2006. Signature- tagged mutagensis: barcoding mutants for genome-wide screens. Nature Reviews Genetics 7: 929-939.

22. Mecsas, J. 2002. Use of signature-tagged mutagenesis in pathogenesis studies. Current Opinion in Microbiology 5: 33-37.

23. Nicholas, R. A., and R. D. Ayling. 2003. Mycoplasma bovis : disease, diagnosis, and control. Research in Veterinary Science 74: 105-112.

24. Nicholas, R. A. J., R. D. Ayling, and L. McAuliffe. 2009. Vaccines for mycoplasma diseases in animals and man. Journal of Comparative Pathology 140: 85-96.

25. Nicholas, R. A. J., R. D. Ayling, and L. P. Stipkovits. 2002. An experimental vaccine for calf pneumonia caused by Mycoplasma bovis: clinical, cultural, serological and pathological findings. Vaccine 20: 3569-3575.

26. Perry, R. D. 1999. Signature-tagged mutagenesis and the hunt for virulence factor. Trends in Microbiology 7: 385-388.

115

27. Pfutzner, H., and K. Sachse. 1996. Mycoplasma bovis is an agent of mastitis, pneumonia, arthritis and genital disorders in cattle. Revue Scientifique et Technique / Office International des Epizooties 15: 1477-1494.

28. Pilo, P., E. M. Vilei, E. Peterhans, L. Bonvin-Klotz, M. H. Stoffel, D. Dobbelaere, and J. Frey. 2005. A metabolic enzyme as a primary virulence factor of Mycoplasma mycoides subsp. mycoides small colony. Journal of Bacteriology 187: 6824-6831.

29. Polissi, A., A. Pontiggia, G. Feger, M. Altieri, H. Mottl, L. Ferrari, and D. Simon. 1998. Large-scale identification of virulence genes from Streptococcus pneumoniae . Infection and Immunity 66: 5620-5629.

30. Rasberry, U., and R. F. Rosenbusch. 1995. Membrane-associated and cytosolic species-specific antigens of Mycoplasma bovis recognized by monoclonal antibodies. Hybridoma 14: 481-485.

31. Rhee, H. J., E. J. Kim, and J. K. Lee. 2007. Physiological polyamines: simple primordial stress molecules. Journal of Cellular and Molecular Medicine 11: 685-703.

32. Rodriguez, F., D. G. Bryson, H. J. Ball, and F. Forster. 1996. Pathological and immunohistochemical studies of natural and experimental Mycoplasma bovis pneumonia in calves. Journal of Comparative Pathology 115: 151-162.

33. Saenz, H. L., and C. Dehio. 2005. Signature-tagged mutagenesis: technical advances in a negative selection method for virulence gene identification. Current Opinion in Microbiology 8: 612-619.

34. Samen, U., B. Gottschalk, B. J. Eikmanns, and D. J. Reinscheid. 2004. Relevance of peptide uptake systems to the physiology and virulence of Streptococcus agalactiae . Journal of Bacteriology 186: 1398-1408.

35. Shah, P., D. G. Romero, and E. Swiatlo. 2008. Role of polyamine transport in Streptococcus pneumoniae response to physiological stress and murine septicemia. Microbial Pathogenesis 45: 167-172.

36. Shah, P., and E. Swiatlo. 2008. A multifaceted role for polyamines in bacterial pathogens. Molecular Microbiology 68: 4-16.

37. Thomas, L. H., C. J. Howard, K. R. Parsons, and H. S. Anger. 1987. Growth of Mycoplasma bovis in organ cultures of bovine foetal trachea and comparison with Mycoplasma dispar . Veterinary Microbiology 13: 189-200.

38. Vilei, E. M., E.-M. Abdo, J. Nicolet, A. Botelho, R. Goncalves, and J. Frey. 2000. Genomic and antigenic differences between the European and African/Australian clusters of Mycoplasma mycoides subsp. mycoides SC. Microbiology 146: 477-486.

116

39. Vilei, E. M., and J. Frey. 2001. Genetic and biochemical characterization of glycerol uptake in Mycoplasma mycoides subsp. mycoides SC: Its impact on H 2O2 production and virulence. Clinical and Diagnostic Laboratory Immunology 8: 85-92.

40. Wang, C.-H., C.-Y. Lin, Y.-H. Luo, P.-J. Tsai, Y.-S. Lin, M. T. Lin, W.-J. Chuang, C.-C. Liu, and J.-J. Wu. 2005. Effects of oligopeptide permease in group A streptococcal infection. Infection and Immunity 73: 2881-2890.

41. Ware, D., Y. Jiang, W. Lin, and E. Swiatlo. 2006. Involvement of potD in Streptococcus pneumoniae polyamine transport and pathogenesis. Infection and Immunity 74: 352-361.

117

Table 1. Tn 4001 mutants of Mycoplasma bovis tested in cattle. Transposon M. agalactiae CDS length Mutant Hypothesized function insertion site homolog (nucleotides) (nucleotides) MBOTn 99 Hypothetical protein MAG 6950 654 59 MBOTn 113 Foramidopyrimidine DNA MAG 3150 837 396 MBOTn 126 Hypothetical protein MAG 5870 896 555 MBOTn 136 Trigger factor MAG6310 864 790 MBOTn 151 RecA MAG 5500 990 762 MBOTn 169 UvrABC system protein A MAG 3790 2829 780 Peptide methionine sulfoxide MBOTn 191 reductase MAG 3130 927 613 MBOTn 216 Variable surface protein O - 756 92 MBOTn 230 Trigger factor Tig MAG 1540 1503 591 MBOTn 245 Conserved hypothetical protein - 1725 77 Large-conductance mechanosensitive MBOTn 255 channel MAG 5570 420 45 MBOTn 286 HIT-like protein (cell cycle regulation) MAG 1990 384 64 MBOTn 293 Aminopeptidase MAG 5520 1359 841 Oliogopeptide ABC transporter, MBOTn 307 substrate-binding protein(OppA) MAG 0380 2952 794 MBOTn 359 Cell division protein FtsZ MAG 3710 1139 11 NADH dependent flavin MBOTn 362 exidoreductase MAG 4830 1182 500 MBOTn 363 Peptide methyltransferase (Hemk) MAG 7340 720 36 MBOTn 395 ClpB MAG 6240 2166 86 MBOTn 420 Chaperone protein DnaK MAG 7280 1815 133 MBOTn 461 Endopetidase O MAG 3680 1944 1018 MBOTn 516 NADH oxidase MAG 2460 1347 167 MBOTn 525 Thymidine phosphorylase MAG 5120 1293 132 MBOTn 526 Phosphate acetytransferase MAG 1390 972 465 Hypothetical protein, predicted MBOTn 568 lipoprotein - 1263 951 MBOTn 585 tRNA/rRNA methyltransferase MAG 0410 699 147 MBOTn 592 ABC transporter, permease protein MAG4600 1860 494 MBOTn 593 DNA-damage repair protein MucB MAG 0740 1245 10

118

Table 1.(continued) Transposon M. agalactiae CDS length Mutant Hypothesized function insertion site homolog (nucleotides) (nucleotides) Spermidine/putrescine ABC MBOTn 627 transporter permease PotC MAG 1270 891 6 MBOTn 671 Sugar ABC transporter permease MAG 0150 2010 582 MBOTn 691 Hemolysin-related protein MAG 2390 1290 MBOTn 719 Hypothetical protein MAG 0880 387 84 MBOTn 740 Mg2+ transporter protein (Mgte) MAG 3070 1458 833 Oligopeptide ABC transporter, MBOTn 817 permease protein (OppB) MAG 1010 1119 689 MBOTn 827 Chromate transport protein MAG 6760 666 324 ABC transporter, ATP-binding protein MBOTn 863 P59 MAG 0140 1602 22 Oligopetide ABC transporter, MBOTn 916 permease protein (OppB) MAG 0370 1083 713 MBOTn 930 Pyruvate kinase MAG 1440 1434 162 MBOTn 962 Hypothetical protein MAG 0330 429 37 Pseudogene of glycerol transporter MBOTn 990 subunit A MAG 6560 1221 574 MBOTn 1008 Proline iminopeptidase (Pip) MAG 0710 900 447 MBOTn 1014 Hypothetical protein MAG 0420 582 134 MBOTn 1126 Hypothetical protein MAG 2500 2085 1242 MBOTn 1156 Glycerol facilitator factor MAG 4480 789 250 Glycerol ABC transporter, ATP- MBOTn 1159 binding component MAG 2310 1216 1170 MBOTn 1221 Hypothetical protein MAG3650 726 620 MBOTn 1240 Lipoate-protein ligase LpoA MAG 0070 972 563 MBOTn 1273 Thiamine biosynthesis protein Thil MAG 1310 1134 517 MBOTn 1283 ABC transporter, permease protein MAG 5060 1065 391 Oliogopetidase ABC transporter, ATP- MBOTn 1290 binding protein (OppF) MAG 1040 2400 549 MBOTn 2452 P48, predicted protein MAG 0120 1404

119

Table 2. Oligonucleotides used in this study to identify mutants.

Mutant name Name of primer Nucleotide sequence (5’ 3’)

U 256 (universal) CGAGGGATTCCGAGGACTG MBOTn 99 Tp 99 CCAAGGTCCCCAGGTCT MBOTn 113 Tp 113 AGGCAAATTTGCTCGCATGTGA MBOTn 126 Tp 126 GCAAGCCTGCTATGTGCGTTAATAC MBOTn 136 Tp 136 TGCTTTGGAACAACTCATGCAGAC MBOTn 151 Tp 151 GCCTTCATAAGCATATCAAGCG MBOTn 169 Tp 169 CCTCCACTAAGAGTTTCGGCATTC MBOTn 191 Tp 191 CTATGACATTTCAGCTGATGGTGCATC MBOTn 216 Tp 216 GCATCTGTATCTTCGTCGACTTCGTC MBOTn 230 Tp 230 GATAATATGTAAAGTTCTGTGCGCGGAAAC MBOTn 245 Tp 245 CGATTATGTTCTCCCGTTGGGATAG MBOTn 255 Tp 255 GCAACCACTGCAACTGGAG MBOTn 286 Tp 286 CATATATAAATCAAATTGTGCCAGTAGGCA MBOTn 293 Tp 293 TGTGTTAGAATACAATGGAAACCCTGATTC MBOTn 307 Tp 307 CACAACATTTGATAGTGATGAAGGTTCACTAGC MBOTn 359 Tp 359 CATTCTTTTCCAACCTTAGGATCACCA MBOTn 362 Tp 362 TAGGTGAGGATGATGGCGTTG MBOTn 363 Tp 363 TGTTCTACCGTTGAACTACACTCCTAC MBOTn 395 Tp 395 GATCCGAAATCTATTGGATGAGGTCAG MBOTn 420 Tp 420 AGCCGCTAAAAGCGGAAGGAA MBOTn 461 Tp 461 ACTCGTCATTAGTTGAGTTTTCTCCTAGTG MBOTn 516 Tp 516 CGGCATCTTCTAAACGGGTTAGAG MBOTn 525 Tp 525 CCTGCCGATTGGTCTAGACAT MBOTn 526 Tp 526 CGTTCGCATATACCAGTGCCTAG MBOTn 568 Tp 568 ACTGTTATCCTACTGGTGAGTGATCA MBOTn 585 Tp 585 CAGTTGAAGTTACATCAGTCGATCTGTC MBOTn 592 Tp 592 TGATATGGTCTGTTAATAAAGTGAGCAGCA MBOTn 593 Tp 593 GACTTAATTAACTGTCTAGGTCACTAG MBOTn 627 Tp 627 TCTCATGACTTAGGTAACGGACCA MBOTn 671 Tp 671 GGTAGAGAAATGACCACAGAGCAC MBOTn 691 Tp 691 GCATATACTAGTCTAAGTCCAGGCAGGA

120

Table 2. (continued)

Mutant name Name of primer Nucleotide sequence (5’ 3’)

MBOTn 719 Tp 719 GACAAAATCAATAGTGGCGGCTCAAC MBOTn 740 Tp 740 GATATAAATAGTGCTACTGATGTGCCA MBOTn 817 Tp 817 CATCTCTTTCTAGACCATATACAGGAACAGAC MBOTn 827 Tp 827 TACAATCAGTAATGCTACACCTGGTGT MBOTn 863 Tp 863 CAGCAACCAATGGCACTGATAG MBOTn 916 Tp 916 TCACTCTTTGTAAGCAAGCGGTCA MBOTn 930 Tp 930 GCTCTAGTAGGATGCGGA MBOTn 962 Tp 962 CAATTCAGTTGCCGGCAC MBOTn 990 Tp 990 GAAGTATATAAACAGTACATTGCGAGCGGA MBOTn 1008 Tp 1008 GACCAGGTGCTGGTTGCA MBOTn 1014 Tp 1014 CTGTGCATAAGTATTAAATGCCTCTG MBOTn 1126 Tp 1126 TAAATATCCTTAATAAAATTCGTCTAGCAG MBOTn 1156 Tp 1156 ATGGCTGGCTTAGCTACTGGATAC MBOTn 1159 Tp 1159 GCAAGATGCTTTAAAGCTTAGCGATTC MBOTn 1221 Tp 1221 TGGCTCATCACATCTTCAGCATC MBOTn 1240 Tp 1240 GAAGATCCATCAATCACTGGCGATG MBOTn 1273 Tp 1273 GGTATCACTAGTTATAGCCCGGTT MBOTn 1283 Tp 1283 TGACTTTGTAACTCCTCAGCCTGT MBOTn 1290 Tp 1290 CTAAACTGCGCTTCTTTTCG MBOTn 2452 Tp 2452 CCACTAACTTGCGCCTTATC

121

Table 3. Mutant recovery data from STM assays in calf model. Mutants are grouped by functional category.

Number of positive calves Mutants and Putative function of ORF /total number of calves Functional category Tonsil Trachea TBLN

Translation MBOTn 113 Foramidopyrimidine DNA 2/2 2/2 2/2 MBOTn 363 Peptide methyltransferase (Hemk) 5/6 2/6 2/6 MBOTn 585 tRNA/rRNA methyltransferase 2/2 2/2 2/2

Replication, recombination, and repair MBOTn 151 Recombinase A protein 1/2 2/2 2/2 MBOTn 169 Excinuclease ABC subunit A 2/2 2/2 2/2 MBOTn 593 DNA-damage repair protein MucB 2/2 2/2 2/2

Posttranslational modification and protein turnover MBOTn 191 Peptide methionine sulfoxide reductase 2/2 2/2 2/2 MBOTn 230 Trigger factor 2/4 4/4 1/4 MBOTn 395 ATP-dependent Clp protease subunit B 1/2 2/2 2/2 MBOTn 420 Chaperone protein dnaK 1/2 2/2 2/2 MBOTn 461 Endopetidase O 1/2 2/2 2/2 MBOTn 293 Aminopeptidase 5/6 6/6 6/6

Membrane biogenesis MBOTn 255 Large-conductance mechanosensitive channel 2/2 2/2 2/2

Carbohydrate transport and metabolism MBOTn 990 Glycerol transporter subunit A (pseudogene) 2/2 2/2 2/2 MBOTn 1156 Glycerol facilitator factor 1/2 2/2 2/2 Glycerol ABC transporter, ATP-binding MBOTn 1159 2/2 2/2 2/2 component

General function MBOTn 286 HIT-like protein (cell cycle regulation) 2/2 2/2 2/2 MBOTn 516 NADH oxidase 1/2 2/2 2/2

122

Table 3. (continued)

Number of positive calves Mutants and Putative function of ORF /total number of calves Functional category Tonsil Trachea TBLN MBOTn 691 Hemolysin-related protein 2/2 2/2 2/2 MBOTn 930 Pyruvate kinase 0/2 2/2 2/2 MBOTn 1008 Proline iminopeptidase (Pip) 2/2 2/2 2/2

Energy production and conversion MBOTn 362 NADH dependent flavin exidoreductase 2/2 2/2 2/2 MBOTn 526 Phosphate acetyltransferase 2/2 2/2 2/2

Cell cycle control, mitosis MBOTn 359 Cell division protein FtsZ 2/2 2/2 2/2

Coenzyme transport and metabolism MBOTn 1240 Lipoate-protein ligase LpoA 2/6 2/6 3/6 MBOTn 1273 Thiamine biosynthesis protein Thil 2/2 2/2 2/2

Transcription MBOTn 136 Transcription regulator 2/2 2/2 2/2

Cell surface structure and membrane proteins MBOTn 216 Variable surface protein O 2/2 2/2 2/2 MBOTn 2452 P48, predicted protein 1/2 2/2 2/2

Inorganic ion transport and metabolism MBOTn 740 Magnesium (Mg2+) transporter protein 2/2 2/2 2/2 MBOTn 827 Chromate transport protein 2/2 2/2 2/2

Substrate binding proteins/Transporters Oliogopeptide ABC transporter, substrate-binding MBOTn 307 1/2 2/2 2/2 protein (oppA) MBOTn 592 ABC transporter, permease protein 3/6 6/6 4/6 Spermidine/putrescine ABC transporter permease MBOTn 627 1/4 2/4 0/4 potC MBOTn 671 Putative sugar ABC transporter permease protein 1/2 2/2 2/2

123

Table 3. (continued)

Number of positive calves Mutants and Putative function of ORF /total number of calves Functional category Tonsil Trachea TBLN Oligopeptide ABC transporter, permease protein MBOTn 817 4/8 6/8 4/8 (oppB) MBOTn 863 ABC transporter, ATP-binding protein P59 1/2 2/2 2/2 Oligopetide ABC transporter, permease protein MBOTn 916 2/2 2/2 2/2 (oppB) MBOTn 1283 ABC transporter, permease protein 0/2 0/2 0/2 Oliogopetide transporter, ATP-binding protein MBOTn 1290 0/2 0/2 0/2 (oppF)

Nucleotide transport and metabolism MBOTn 525 Thymidine phosphorylase 2/4 3/4 3/4

Genes of unknown function MBOTn 99 Hypothetical protein 1/2 1/2 1/2 MBOTn 126 Hypothetical protein 2/2 2/2 2/2 MBOTn 245 Conserved hypothetical protein (lipoprotein) 2/2 2/2 2/2 MBOTn 568 Hypothetical protein, predicted lipoprotein 2/2 2/2 2/2 MBOTn 719 Hypothetical protein 2/2 2/2 2/2 MBOTn 962 Hypothetical protein 2/2 2/2 2/2 MBOTn 1014 Hypothetical protein 0/2 2/2 2/2 MBOTn 1126 Hypothetical protein 0/2 2/2 2/2 MBOTn 1221 Hypothetical protein 2/2 2/2 2/2

124

Figure 1. PCR analysis of signature -tagged mutagenesis screen ing . (A) Profile of PCR amplicons of input DNA for mutant pool 1. (B) Output PCR profile obtained from the tracheo-brochial lymph node sample collected from a calf inoculated with mutant pool 1. M: DNA molecular weight marker, Lanes 1 – 9: individual mutant amplicons. Lanes 5 ( potC ) and 9 (ABC transporter ATP -binding domain) identified mutants that could not be recovered from the TBLN sample of the calf.

125

A PM PM ATP HP HP

(981) (1065) (2102) (1182) (2184)

B potA potB potC potD

(990)(891) (834) (1899)

C HP oppBoppC oppD oppF

(2907) (1119) (1266) (1086) (2400)

Figure 2. Schematic features of three transporters. (A) uncharacterized ABC transporter, (B) polyamine transporter, (C) oligopeptide transporter. The arrows indicate the direction of individual genes belonging to transporters. Transposon insertion sites are indicated by a black arrowhead. The shaded arrows represented the genes disrupted by the insertion of the transposon. Gene names are shown on the genes and the sizes of genes are indicated in parenthesis under the gene. PM : ABC transporter permease, ATP : ABC transporter ATP-binding domain protein, HP : hypothetical protein, potA : polyamine transporter A, potB : polyamine transporter B, potC : polyamine transporter C, potD ; polyamine transporter D, oppB : oligopeptide transporter B, oppC : oligopeptide transporter C, oppD : oligopeptide transporter D, and oppF: oligopetide transporter F.

126

CHAPTER 5. GENERAL CONCLUSIONS AND SUMMARY

Mycoplasma bovis is a significant bacterial pathogen that causes a variety of diseases in cattle. Even so, studies on this pathogen have been limited and focused on diagnostics and treatment of the diseases. The unavailability of molecular tools to genetically manipulate this pathogen has limited the opportunity to investigate this pathogen at the genetic level, such as by comparing isogenic mutants, or determining its virulence genes. In this study, we arbitrarily annotated the genome of M. bovis strain PG45. Then, we developed genetic tools useful for this pathogen and used them to establish a global random mutant library. The mutant library was used to determine which genes are essential or dispensable in M. bovis , with comparison to data on global mutagenesis of other mycoplasma species. These studies provided valuable information about the genome and the physiology of M. bovis . From the mutant library, we defined an ABC transport system responsible for the uptake of nucleosides as nucleotide precursors. This finding is the first report that mycoplasmas are able to uptake exogenous nucleotide precursors via an active and genetically defined ABC transporter. We deduce that this transporter must be a part of important biological functions of M. bovis , particularly during colonization of its specific host, the bovine. Considering the pathogenicity of this mycoplasma, we established a modified signature-tagged mutagenesis (STM) in vivo persistence assay and applied it to define genes responsible for either establishment of systemic infection or colonization on the respiratory tract of the host. To our knowledge, this is the first application of STM to a large animal species. We identified three genes disrupted in non-invasive mutants, a putrescine/spermidine ABC transporter permease gene ( potC ), an uncharacterized ABC transporter permease gene, and an oligopeptide ABC transporter ATP-binding domain ( oppF ). The last two mutants were also unable to persist on the tracheal mucosa of cattle, an additional phenotype that could be studied with our STM assay. Taken together, our studies greatly expanded the understanding of the basic physiology and pathogenicity of M. bovis .

127

Recommendations for future research As an extension of our research, we visualize two different approaches for further studies to better understand M. bovis at the genetic level. The first direction would be to focus on the basic physiology of this pathogen. The discovery of the thymidine transporter confirms the existence of an entry route of some exogenous nucleotide precursors. However, the genes encoding the nucleoside transporter turned out to be non-essential genes, allowing the mutants to grow in the highly enriched modified Friis medium where other forms of nucleotide precursors exist. The ability of transporter mutants to grow in modified Friis medium strongly suggests that there are other active transport systems able to uptake other forms of nucleotide precursors. Further studies to define other transporters that participate in the uptake of other forms of nucleotide precursors would provide an opportunity to complete a study of entry routes for nucleotide precursors, and eventually define the salvage pathways for nucleotide synthesis in mycoplasma. No defined virulence factors have been identified in M. bovis even though severe disease and mortality can be produced by it in cattle of all ages. In general, clinical signs of most mycoplasma infections are considered to appear as a consequence of multifactorial processes and interactions between the mycoplasma and the host environment, except for some mycoplasmas where active virulence factors have been defined. In the case of M. bovis , colonization at an entry site, invasion into deep tissues, and systemic infection must be crucial steps to establish diseases in the infected host. In this study, we identified three genes responsible for the ability to colonize the respiratory tract and/or establish systemic infection. The genes identified in these mutants were associated with components encoding substrate- dependent ABC transport systems rather than the direct production of classical virulence determinants. Uptake of specific substrates required for metabolic pathways could be critical for survival because mycoplasmas possess limited synthetic capabilities for many essential molecules and must acquire them from exogenous sources. Thus, substrates that are utilized by the genes identified in our studies are most likely to have important biological roles for the mycoplasma in dealing with the in vivo environment in the infected host. Further characterization of the biological roles of these substrates in M. bovis will open new avenues to understand the pathogenicity of M. bovis and other similar mycoplasmas.

128

ACKNOWLEDGEMENTS

I dedicate this dissertation to those who have long supported and encouraged me to complete this degree

I would like to thank Dr. Ricardo F. Rosenbusch, my mentor, for his guidance, support, encouragement, and most importantly patience throughout the course of my study. Furthermore, I do deeply appreciate him for giving me the opportunity to continue a long journey to pursue my dream.

I also sincerely thank to Drs. Bryan Bellaire, Walter Hsu, Brett Sponseller, and Michael Wannemuehler for both their contributions and critics to my research.