Detection of Mycoplasma in Cell Cultures

© 2010 Nature Publishing Group http://www.nature.com/natureprotocols specialized culture conditions, can be missed. Consequently, the Consequently,the missed. be can conditions, culture specialized assay,this some ‘fastidious’ Mycoplasma, of species requirewhich agar is usually regarded as the ‘gold standard’ assay, but even using PCR nested or direct and ography,immunostaining autoradi ELISA, staining, fluorescent indirect or direct media, Table Many aremethods available for the Mycoplasmadetection of (see Mycoplasmaof Detection the cells. supported cultures such as human embryonic stem cell lines can contaminate by personnel can be responsible tures, contaminated reagents although such as or serum infection use an insensitive method have a high probabilitytive of beingtests. infected. Consequently, laboratorieslow levels that doof contaminationnot test for thatMycoplasmadifficult can only toor detectbe detectedin routine using cell highlylinesno apparent culturesensi effect work on cell growth. Consequently,tissueculture Mycoplasmasmedium without cancausing be obvious cloudiness and have unresponsive to antibiotics that target cell-wall synthesis. tissue culture media. The lack of a rigid cell wall makes Mycoplasmas Mycoplasma arginini found in frequently tissue culturemost arespecies The not. are species Mycoplasma most detect contamination. to fail can tests single why reason one is which species, 100 over are there and Mollicutes order the of members are They nisms. orga prokaryotic filamentous or round small, are Mycoplasmas to Introduction Mycoplasma in place. This protocol describes tests for detecting Mycoplasma. the presence of Mycoplasma and a regime of routine testing be put all cell stocks and all new cultures entering a laboratory are thetested resultsfor and conclusions from any experiment compromises almost all aspects of cell physiology, and consequently from 5 to 35% in published reports Mycoplasma contamination cellof cultures is widespread, ranging I tests should be an obligatory component of quality control in every tissue culture laboratory. and broth culture. of Mycoplasma. It is recommended that two techniques be used, selected from a cultures in a laboratory. It is essential that all new cell cultures entering a laboratory and all cell banks are tested for the presence size, Mycoplasmas can pass through filters used to prevent bacterial and fungal and contamination potentially spread to all the aspects of cell physiology, rendering experiments that are conducted with contaminated cells worthless. Because of their small Mycoplasma is a prokaryotic organism that is a frequent and occult contaminant of cell cultures. Published online 22 April 2010; doi:10.1038/nprot.2010.43 UK. Correspondence should be addressed to J.R.M. ([email protected]). 1 Lesley Young Detection of Mycoplasma in cell cultures can pass or be forced through filters (220 UK UK Stem Cell Bank, National Institute for Standards,Biological Hertfordshire, UK. NTRO The source of contamination is generally other infected cul infected other generally is contamination of source The concentrationTheMycoplasma of reach10 can Mycoplasmas deformability, and size small their to Owing 1 D ), including isolation on selective microbiological growth growth microbiological selective on isolation including ), UCT I ON 1 , Julia Sung T his his protocol describes these three tests for detecting Mycoplasma, which take from 1 d to 3–4 weeks, and such and Mycoplasma pneumoniae Acholeplasma Acholeplasma laidlawii Mycoplasma hyorhinis 1 , Glyn Stacey 1 . In addition, feeder cells used for 1 . The use of contaminated cells - nm pores) used to sterilize 1 & John R Masters 1 2,3 . Many cells support , is pathogenic, but Mycoplasma orale . It is essential that 1,2,4 8 cells per ml of of ml percells . 3 . Culture in in Culture . ,

2 Division of Surgery and Surgery Interventional of Division Science, University College London, London, 2 culture, indirect staining and a PCR recommendation is to use two assays from in isolation broth/agar Protocols and precautions for cell culture are available in the rel the in available are culture cell for precautions Protocolsand ifications will be needed to conform to the Europeansource Pharmacopoeia testing using this method. It should be compromisenoted thatthe sterilityminor of a mod laboratory, might it controlpositivemay a be of preferableuse the towhich outConsequently,in cases excludethem.to made being are efforts stringent which ment,in growth of live organisms and/or contaminated cells in the environ Mycoplasmatesting, provisionthepositivea of control entails the However,experiment.for every in mandatory is possible, where Mycoplasma. We recommend the use two of the of three options. of detection the for methods three describe we protocol, this In procedure of Overview and confirm any positive or negative results obtained by them. will wish to provide thorough training to its inexperiencedence neededpersonnel in optimization and interpretation of tests, a laboratorynation in the tissue culture laboratory, and the considerable experi minimum guidance. Given the importance of Mycoplasma protocolwith the implementsuccessfullycould student graduate contami fresh cultures from the cell bank and retesting all the cells. and disinfected and all partly used medium discarded before taking cleaned thoroughly be must incubators) and hoods (particularly closed be surfaces All should discarded. cultures living all work and immediately down culture cell laboratory, culture tissue routine the within found is contamination the If can successful. but be more) or months (3 process long a is Mycoplasma for line cell the new or Mycoplasma treated discarded with antibiotics. Antibiotic a treatment cells of be either in can cells the found quarantine, in is retained contamination the If managed? must always be included in assay.every (whichever is greater). Appropriate positive weeks and negative controls 2 for or subcultures three least at for antibiotics without the grown have must been cultures The organisms. reduce viable of number may freezing snap or storage as possible, whenever evant There are some basic principles for Mycoplasma detection. detection. Mycoplasma for principles basic some are There ( the Oneexpectations of a of be it should how found, is contamination Mycoplasma If A ) Nature Protocol Nature Agar and broth culture broth and Agar PCR -based -based method, indirect staining and an agar 6 . Cells for testing should be prepared fresh prepared be should testing for Cells . natureprotocols : the inclusion of a positive control,positive a of inclusion the : T his his organism can modify many NatureProtocol - based based technique

| VOL.5 NO.5VOL.5 is that a competent protocol 5 . | 2010 |

929

© 2010 Nature Publishing Group http://www.nature.com/natureprotocols • • For andbroth culture agar method For methods: cells all to tested be are inreference grown asdescribed REAGENTS M sensitivity of range a giving available, nested—are and plexed The method needs to be optimized under local conditions. method, the quality of the test sample and the specificity of primers. reliability of detection by PCR will depend on the sensitivity of the and A549 cell lines are also suitable test. under cells Vero3T6,used, MDCK but frequently most cells reporter the are the from medium culture using proliferation Mycoplasma of levels high support to known is that line reporter cence that mimic Mycoplasma. Therefore, it is essential to infect a DNA degraded from cells may give tofluores rise points of small or are DNA present contamination and organisms frombacterial micro few which in cases in difficult is Interpretation cultures. equivocal results and will only reliably detect heavily contaminated fluorescent oval areas. and on the culture dish. In contrast, cell nuclei will appear as large medium surrounding the in and seen, surface cell the on concentrated be can fluorescence of flecks or dots small DNA, contain stained with a fluorescent dye such as Hoechst 33258 or DAPI (4 cdrh/cfdocs/cfcfr/CFRSearch.cfm?fr=610.30). Mycoplasmas, 21 CFR 610.30, http://www.accessdata.fda.gov/scripts/which relate to vaccine production rather than cell culture (Test for (6th edition, 2007, section 2.6.7) and the guidelines of CBER/FDA, Immunostaining Autoradiography ELISA Nested PCR PCR Broth and agar culture 33258) with indicator cells (e.g., 3T3) Indirect DNA stain (e.g., Hoechst Direct DNA stain (e.g., Hoechst 33258) Method T 930 • For indirect staining diamidino a protocol Hoechst 33258(Sigma, cat. no. 861405) Alternatively, a known Mycoplasma (http://crs.edqm.eu) or specialist companies such as Mycoplasma Experience. as the European Directorate for the Quality Medicine of and Health Care tained from a Positive control—authenticated Mycoplasma reference strains can be ob Alternatively, plates agar andbroths produced canbe inthelaboratory Mycoplasma plates agar andbroths (Mycoplasma Experience or Difco). ATER lre ubr f ifrn st o piessnl, multi primers—single, of sets different of number large A ( Direct staining of cultures is not recommended, as it often gives ( b C B

le | ) ) VOL.5 NO.5VOL.5 Indirect staining 1 Direct PCR I ALS |

- Mycoplasma detection methods, their sensitivity, and advantages and disadvantages. 2 - bona fide phenylindole), which binds to DNA | 2010 : PCR can give false positives or false negatives. The

reference collection (see http://www.wfcc.info) such : Mycoplasmas can be detected in cell cultures |

natureprotocols

- contaminated cell line may be used. 3 . Sensitivity Moderate Moderate Moderate High High High High Low 7 . As Mycoplasmas A Rapid Rapid Rapid Rapid Rapid Sensitive contamination amplified Easy to interpret because Rapid, cheap dvantages 6. 8

′ ,6 -

and • • • plasmas such as DNA or bacterial genera with close phylogenetic relation to myco the within region Mycoplasma pirum urealyticum hominis arthritidis Mycoplasma detects also protocol this addition, In Pharmacopoeia. European and cultures cell phylogenetic in relationships, based on contaminants the guidelines provided as in the occurrence of frequency citri of mollicutes. These include include These mollicutes. of attempting to detect a broad Mycoplasmarange of species. • • • For PCR • • • gallisepticum Mycoplasma fermentans Mycoplasma a known Mycoplasmaa known species. Standard Mycoplasma standard organism—a preparation of result, i.e., on thePCRgel. aclear band visible e.g., Acholeplasma laidlawii, which must produce apositive contaminated cell lineor astandard Mycoplasma organism, Positive control sample—asamplefrom aMycoplasma- on thePCRgel. visible medium, which must produce anegative result, i.e., noband Negative sterile water control or growth sample—asampleof U1511) Deoxynucleotide (dNTP)mix(10mM)(Promega, triphosphate cat. no. manufacturer’s date. expiration kit; Qiagen,polymerase cat. no. 203605) HotStar expiration date. kit; Qiagen, cat. no. 203605) 10× CoralLoad PCR buffer (supplied in HotStar Vectashield solution mounting (Vector laboratories, cat. no. H-1000) Reporter cell line(e.g., Vero) Reporter culture medium growth The following direct PCR protocol allows detection of a range range a of detection allows protocol PCR direct following The The following The controlsfollowing should be used for the PCR method:

, species representing an optimal selection in terms of of terms in selection optimal an representing species , specificity

,  Taq Mycoplasma penetrans

CRITCAL Plus DNA (supplied inHotStar polymerase , Mycoplasma bovis Mycoplasma 9,10 at at low level Can be difficult to interpret if contamination is at low level Can be difficult to interpret if contamination is Limited range of species detected to give false positives More sensitive than direct PCR, but more likely Requires optimization Slow and may require expert interpretation Indirect and thus more time-consuming Can be difficult to interpret Disadvantages Clostridium . Most primers use highly conserved sequences, conserved highly use primers Most . Store at 16S rRNA 16S . The primers used are derived from a conserved , ,  M. hyorhinis M. , − yolsa genitalium Mycoplasma

CR Mycoplasma synoviae Mycoplasma 20 °C until manufacturer’s20 °Cuntil date. expiration , gene I Lactobacillus Acholeplasma laidlawii Acholeplasma T , I Mycoplasma salivarium ,

CAL Mycoplasma hyopneumoniae Mycoplasma 1 1 Store at and do not detect eukaryotic eukaryotic detect not do and 

CRITCAL , M. orale M. Taq

and −

20 °C until manufacturer’s Plus DNA polymerase Store at Streptococcus , and and Taq M. pneumoniae M. , Plus DNA , Mycoplasma Mycoplasma , Spiroplasma Spiroplasma − M. arginini M. Ureaplasma 20 °C until 20 °Cuntil

. and and

, ,

(B) (B) Indirect staining ( 1| PROCEDURE • • For and agar broth culture method EQUIPMENT • • • • • direct PCR) For of gelelectrophoresis agarose (part • • • • •

small aliquots.small Primers are stable for several years at small aliquots.small Primers are stable for several years at Sterile plastic pipettes,Sterile plastic 1or 2ml 37 °C/5%CO DNA100-bp ladder (Promega, cat. no. G2101) cat. no. S33102) SYBR Safe DNA gelstain10,000×concentrate inDMSO(Invitrogen, UltraPure sterile water (Media Services, NIBSC) water, acetic (Media acid) adjusted glacial to Services, pH8.3with NIBSC) 10× TBE(162gTris UltraPure agarose—electrophoresis (Invitrogen, grade cat. no. 15510–027) Experience) Standard Mycoplasma organism, e.g., DNeasy andtissuekit(Qiagen, blood cat. no. 69504) DNase-free water (Qiagen, cat. no. 129114) freeze–thaw cycles. (10 GPO-3(5 Sense primer freeze–thaw cycles. (10 Antisense MGSO(5 primer A (iii) (iii) Subculture from broths toagarplatesat3–5d, and at14d. Incubate asabove. (iv) Incubate ina5%CO (iv)

(ii) (ii) ) ) (v) (i) Grow testcellsfor atleastthree passages orfor 2weeks(whichever isgreater) inantibiotic-free medium. (i) Grow cellsfor atleastthree subcultures orfor 2weeks(whichever isgreater) inantibiotic-free medium. µ µ A Carry outtwoof the following three options. M) (Integrated DNA Technologies) M) (Integrated DNA Technologies) gar gar and broth culture method the reporter cells. phase of growth at the time of testing; hence, it may be more convenient to plate the reporter cells at a later time point. Vero cellsper2.5cm (e.g., ’24-wellplate’)toproduce anexponentially growing culture ontopof the coverslipafter7d(e.g., 10–20,000 seed enough reporter cellsinantibiotic-free medium withasterileglasscoverslip inthe baseof the culture vessel batch of broths/agar platesinuse.  at 37°Cfor 28dinanatmosphere enriched with5% CO 2 weeks)into avial containing 1.5-mlMycoplasma broth, and onto the surface of aMycoplasma agarplate. Incubate have atypical ‘fried-egg’ appearance asin incubation, then discard the broths and agarplates. Culture testcellsfor 7doruntil peakconcentration/density isachieved inanantibiotic-free medium. Simultaneously, Add 1-mlmedium from the testcellstothe medium of Observe the agarplatesunder amicroscope eachweek,noting the presence of any Mycoplasma colonies (some species Inoculate 0.1–0.2mlof antibiotic-free cellsuspension (fresh samplewhere possible, otherwise store at4°Cfor upto Remove the medium with apipette(ifvacuumaspi disseminate infection). equipment is difficult tosterilizeand the process can cytocentrifuge and staining (not recommended as the which canbetestedifdesired byspinning down ina of the plastic. Most willbediscarded inthe medium, oplasmas willbeonthe cell surface oronthe surface possible withallrinsing steps asthe majority of Myc  aspirating bleachthrough the tubing afteruse). should then beprevented bycareful disinfection by rator isused, cross-contamination through the tubing

CR CRITCAL STEP CRITCAL STEP I 2 incubator dedicated for Mycoplasma tests T I CAL +

STEP 27.5 g boric acid acid 27.5gboric ′ - GGGAGCAAACAGGATTAGATACCCT

● ′ -TGCACCATCTGTCACTCTGTTAACCTC-3 Clearer results are obtained if the reporter cells are healthy and subconfluent, i.e., in the exponential Incorporate Mycoplasma-positive controls ineach testtoensure thatMycoplasma grows onthe It isimportant tobeasgentle as

T IMI 2 2 atmosphere for 3d. ).

N Acholeplasma laidlawii G results are obtained within 10 d +   9.3gEDTA in1liter UltraPure

CRITCAL CRITCAL

●

T IMI

− − Store at Store at 20 °C. Avoid multiple 20 °C. Avoid multiple N G results are obtained within 3–4 weeks (Mycoplasma Fig. − − 20 °Cin 20 °Cin -3 1 ′

), , butthisisnot alwaysthe case).Record the results after28dof

′ - - ), 2 .

• • • • • • • PCR) For of gelelectrophoresis agarose (part • • • • For PCR • • • • For indirect staining • • • morphology (courtesy of NIBSC-HPA). Figure 1 13 mm-diameter roundcoverslips glass autoclaved thatcanbe used canbe ml PCR tubes or0.2-ml PCRtubes 96-wellPCRplate Camera UV transilluminator Electrophoresis tank preparationGel tank Microwave Conical flask Weighing balance Microcen Thermocycler Class IIla in aluminum foil packages) Sterile microscope coverslips to fit test incubationcultures (typically Incubation culture vessels, e.g., 24- well culture plates Epiflu Inverted Petri dishes Microb 1.5-m l Eppendorf tubes l Eppendorf orescence-power microscope high objective with (e.g., ×63) iological safety cabinet, safety iological class II

| microscope ×10phase objectives with or astereomicroscope Typical Mycoplasma colony, having the classic ‘fried-egg’ trifuge capable of 22,000 capable of trifuge minar flow cabinet natureprotocols g

| VOL.5 NO.5VOL.5 protocol | 2010

931

932

( (xvii) Run18 (xiii) (viii) (viii) (xiii) Placea15-,20-or30-well combinto the gel mix, depending onthe number of samplesfor testing. (xvi) Pour enough 1×TBEinto the tanktocoverthe gel. (xiv) Allowthe gel toset. This takes about30min. protocol C (xii) Add 10 (xii) Remove excess fluid. (vii) Placethe tubesorplateinathermal cycler. (vii) Fixthe cellsinanice-cold mixture of acetic acid and methanol (freshly prepared 1:3ratio) for atleast5min. (xv) Once the gel hasset,carefully remove the comb and placethe gel inthe electrophoresis tank. (iii) (xi) (xi) (iv) (ix) (vi) Mixthe contents of the tubesand taporcentrifuge toremove airbubbles. (vi) Rinse the cellswithmedium orPBS. (ix) Add 50ng ml ) ) (ii) Add 8.25 (x) Weigh out2gof agarose and add toaconical flaskcontaining 100ml of 1×TBE. (v) (x) Remove stainand rinse gently withdistilledwaterthree times. (i)

| PCR VOL.5 NO.5VOL.5 fresh tube, avoiding the pelletedcells. Thissupernatant isusedasthe templateinPCR. 10 minand hold at4°Cuntil the plateisremoved. basis. of the importance of the barrier filter must be given to trainees and persons using UV microscopy on an occasional Consequently, if a microscope lacking safety features to prevent eye exposure is used, full training and explanation !  identity represented byeachcoverslip.  completely dissolved. determine whether the agarose mixisdissolved. Ifnot, repeat the microwave procedure until the agarose is sterile water. nuclease-free watertoeachreaction. drop (being careful not tocreate bubbles). For the inhibition-control reaction, add 1 Examine cultures using UVepifluorescence witha330/380-nm excitation filter and a440-nmbarrier filter. Place conical flaskinto amicrowave todissolvethe agarose. Microwave onfullpower for 1min,and then check to Collect 1mlof supernatant from adherent cellsorgrowing insuspension inanEppendorf tube. Add adrop of mountant, placeone edge of acoverslipclosetothe drop and, using aneedle, gently loweronto the Add 1 Run the samplesat95°Cfor 5min;40cyclesat94°Cfor 0.5min,55°Cfor 0.5minand 72°Cfor 1min;72 °Cfor Agarose gel electrophoresis: prepare 500mlof 1×TBEbyadding 50mlof 10×TBEto450-mlUltraPure Discard the fixative, wash gently withdistilledwaterand dry eachcoverslip,taking care to keep control of sample Centrifuge testsamplesat200 well. Add 39.75 ? ? ? ? Total premix solution HotStar dNTP mix (10 mM each) GPO-3 primer (10 MGSO primer (10 10× CoralLoad PCR buffer PCR mastermix

CAUTION

TROUBLESHOOT ING TROUBLESHOOTING TROUBLESHOOTING TROUBLESHOOTING ● PAUSE POINT CRITCAL STEP

T IMI µ Taq µ µ l of supernatant tothe appropriate tubeorwell.To adjustthe final reaction volume to50 | 2010 l SYBR SafeDNAgel stain to the agarose mixand pour the gel mixinto the gel preparation tank. l of allPCR-amplified sampleson2%agarose gel at100V for 1h. Include a100-bp DNAladder. µ N plus DNA polymerase UV light is hazardous, and can cause burning of the eyes and may permanently damage sight. l of premix solution (seebelow)toeachtubeorwell. G results are obtained within 4–5 h

− | 1

of Hoechst 33258indistilledwaterfor 10minatroom temperature. natureprotocols µ µ Coverslipscanbestored at room temperature atthispoint ifnecessary. µ M) M) Wear glovesthroughout the protocol. l of nuclease-free watertoeachreaction toadjust the final reaction volume to50 g for 1minatroom temperature topelletcellulardebris. Transfer the supernatant toa ( For onereaction  l)

8.25 0.25 1 1 1 5 µ l of supernatant and 1 ( For tenreactions  l) 82.5 10 10 10 50 2.5 µ l of Mycoplasma-positive control toeachtubeor µ l, add 40.75

µ l.

µ l of

© 2010 Nature Publishing Group http://www.nature.com/natureprotocols Step ANTICPATE D RESULTS surrounding the cells. Ifthe results are equivocal,the testshould berepeated. samples, spotsorflecks of bright bluestainwillbeseenathigh magnification scattered over the cells and on the plastic seen in An example of aMycoplasma colony thatgrows by the agarand broth culture method from acontaminated culture canbe C(v) Box 1 C(ii) C(viii) C(xvii) C(viii) C(ii) and C(v) C(viii) T Troubleshooting advice canbefound in ? Step 1(C), PCR: results are obtainedand 30 min to stain and inspect cells). within 4–5 h (~30–60 min for Step 1(B), Indirect staining: theresults are obtained within 10 d (15 PCRmin to plate cells, 5 min to transfersetup, medium to reporter line 2.5 h for PCR end ofand incubation after 28 d. Colonies are1 visible after 3–5 d hunless the contamination for is at a low level). agarose gel electrophoresis). 5–10 min to check plates and subculture at 3–5 d and at the 14-d time points; and finally another 5–10 min to check at the Step 1(A), Agar and broth culture method: results are obtained within 3–4 weeks (5–10 min to set up each plate or broth; ● (xviii) Runthe gel at100Vfor 60min. a (xix) Take and store animage of the gel exposed toUVlight (using aUVtransilluminator).

In cellsexamined byindirect staining, the nuclei of cellswillstainblue. Ifthere isMycoplasma contamination inthese TROUBLESHOOTING b T le IMI 2 N Figure | G

Troubleshooting table for PCR. 1 . the inhibition control reaction Absence of amplification in a 270 bp band Negative control shows multiple bands in the gel Presence of non-specific positive control lane Absence of a 270 bp band in Problem T able

Error in set up Incorrect annealing temperature Error in set up tances in the supernatant Presence of inhibitory subs Aerosol contamination Pipettes contaminated negative control reactions culture medium used in the Contaminated reagents, water or Contamination Priming starting during set up Annealing temperature is too low Error in gel analysis/loading Error in cycling P ossible reason

natureprotocols volumes all reagents are added in correct Repeat the experiment. Ensure that temperature Use recommended annealing reaction added to each inhibition control Ensure that the positive control is from test samples by DNA extraction Remove the inhibitory substances template carefully. Use filter tips Pipette and expel reagents and for each reaction Ensure that a fresh pipette tip is used Use filter tips and clean pipettes. templates in negative controls water and culture medium used as Prepare fresh premix solution, bands Check negative control reaction for hot-start Set up reaction on ice or use a gradient in 2 °C increments temperature. Run a temperature Use recommended annealing correct wells in the gel Ensure that samples are loaded in the the program used is correct actual block temperature. Check that display in the thermal cycler is the Ensure that the temperature on Solution Taq DNA polymerase

| VOL.5 NO.5VOL.5 protocol | 2010

933 © 2010 Nature Publishing Group http://www.nature.com/natureprotocols 1. reprintsandpermissions/. Reprints and permissions information is available online at http://npg.nature.com/ Published online at http://www.natureprotocols.com/. interests. CO draft documents. J.R.M. wrote the drafts and is the corresponding author. protocol and additional references and introductory scientific text and reviewed protocol; both contributed to the drafts. G.S. provided the indirect staining AUT (http://www.ukstemcellbank.org.uk). Protection Agency) for primary cell cultures and human stem cell lines National Institute for Biological Standards and Control (part of the UK Health have been used routinely in the Division of Cell Biology and Imaging at the A control reaction), repeat the PCRasdescribed in culture medium for PCRtesting. line isthen incubated for afewdays tocultivateand supporthigh levelsof Mycoplasma proliferation, prior toharvesting of reporter cellline (such asVero cellmonolayer) known tobenegative for the presence of Mycoplasma. The inoculated cell seen bygel electrophoresis isfaint) the suspectedcontamination canbeamplifiedbyinoculation of test material onto a and the inhibition control givepositiveresults. Ifthe results obtained using PCRare equivocal(i.e., the band of 270bp region ( whereas the negative controls should show no bands inthis and the inhibition control should bothshow a270-bpband, those of the positivecontrol reaction. The positivecontrol presence and sizeof the PCRproduct from testsampleswith sample D; and lane 14, positive control. inhibition control for test sample C; lane 12, inhibition control for test for test sample A; lane 10, inhibition control for test sample B; lane 11, D; lane 8, inhibition control for negative control; lane 9, inhibition control sample A; lane 4, test sample B; lane 5, test sample C; lane 6, test sample lanes 1, 7 and 13, 100-bp DNA ladder; lane 2, negative control; lane 3, test Figure 2 934 2. protocol cknowle Box 1 (5) (6) Proceed toPROCEDUREStep 1C(ii). (4) Carefully decant the supernatant. Resuspend the pellet(which may not bevisible)in100 (3) Centrifuge supernatant at22,000 (2) Transfer the supernatant toafresh Eppendorf tube, avoiding any cellpellet. pellet celldebris. (1) Centrifuge the supernatant from adherent orsuspension cellsinanEppendorf tubeat200 INHIBIT M For testsamplesthatare inhibitorytothe PCRreaction (indicated bythe absence of the 270-bpband inthe inhibition The results using PCRare interpreted bycomparing the

PET mycoplasmas. Nature Hay, R.J., Macy, M.L. & Chen, T.R. Mycoplasma infection of cultured cells. cultured of infection MycoplasmaT.R. Chen, & Macy,M.L. Hay,R.J., Rottem, S. & Naot, Y. Subversion and exploitation of host cells by cells host of exploitation and SubversionY. Naot, & S. Rottem, | OR VOL.5 NO.5VOL.5 Extract DNAusing acommercially availableDNAextraction kitsuch asthe DNeasy bloodand tissuekit(Qiagen), orequivalent. The extracted DNAisusedasthe templateinthe PCR. I

CONTR | G G FI Fig. Typical gel photo from direct PCR. Numbering from left to right,

dgm 339 NANC | IB ents , 487–488 (1989). 487–488 , 2 FURTHER PROCEDURET UT ). Atestisonlyacceptedasvalid ifthe negative controls givenegative results and boththe positivecontrol ORY T Trends Microbiol. Trends | I 2010 I

AL ONS The protocols for agar and broth culture and PCR I NTERESTS J.S. J.S. provided the PCR and L.Y. the agar culture | natureprotocols O THEPCRREACTION

6 The authors declare no competing financial , 436–440 (1998). 436–440 , g for 15min.

Box 1 O BEUSED WHEREPCRTESTSAMPLESARE

11. 4. 8. 9. 5. 6. 7. 3. 10. 2606–2615 (1992). 2606–2615 amplification. rRNA 16S by mycoplasmas F.J.M.Kuppeveld, van (2004). reaction. chain polymerase by cultures Anim. lines. cell continuous in infections mycoplasma Methods Immunol. J. methods.detection various of Comparison I. lines. cell leukemia human stain. 33258 Hoechst fluorescent by Protoc. Nat. Cancer J. Br. Biol. Mol. Methods contaminations.mycoplasma of Detection Drexler,H.G. & C.C. Uphoff, Jersey,2005). New Hoboken, Sons, Uphoff, C.C., Gignac, S.M. & Drexler, H.G. Mycoplasma contamination in contaminationMycoplasma Drexler,H.G. & S.M. Gignac, C.C., Uphoff, Uphoff, C.C. & Drexler, H.G. Comparative PCR analysis for detection of detection for analysis PCR Comparative Drexler,H.G. & C.C. Uphoff, research. cancer in lines cell of use the for guidelines UKCCCR UKCCCR. Masters, J.R. & Stacey, G.N. Changing medium and passaging cell lines. cell passaging and medium Changing G.N. Stacey, & J.R. Masters, Chen, T.R.Chen, Freshney,R.I. Uphoff, C.C. & Drexler, H.G. Detecting Mycoplasma contamination in cell in contaminationMycoplasma Detecting Drexler,H.G. & C.C. Uphoff,

38 , 79–85 (2002). 79–85 , In situ In

2 82 , 2276–2284 (2007). 2276–2284 , Culture of Animal Cells Animal of Culture , 1495–1509 (2000). 1495–1509 , detection of mycoplasma contamination in cell cultures cell in contaminationmycoplasma of detection

290

149 et al. et , 13–23 (2005). 13–23 , g µ for 1minatroom temperature to l of PBS. , 43–53 (1992). 43–53 , Genus- and species-specific of identification species-specific and Genus- 5th edn. 307–320 (John Wiley & Wiley (John 307–320 edn. 5th Exp. Cell Res. Cell Exp. Methods Mol. Med. Mol. Methods Appl. Environ. Microbiol. Environ. Appl. In Vitro Cell Dev. Biol. Dev. Cell Vitro In

104 , 255–262 (1977). 255–262 ,

88 , 319–326 ,