Advances in PCR Based Detection of Mycoplasmas Contaminating Cell Cultures

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press Advances in PCR based Detection of Mycoplasmas Contaminating Cell Cultures Georges Rawadi and Olivier Dussurget Laboratoire des Mycoplasmes, D~partement de Bact&iologie et Mycologie, Institut Pasteur, 75724 Paris, CEDEX 15, France M ycoplasmas (the trivial name for microorganisms belonging to the class Mollicutes) are the smallest free-living, self-replicating bacteria, having diame- ters of 300 to 800 nm. These pleomorph microorganisms have no cell walls. (1~ Be- cause of their small size and flexibility, mollicutes can pass through filters of 450 and 220 nm used commonly in cell culturing. ~,2) Mollicute contamination of primary and continuous eukaryotic cell lines rep- resents a major problem of economic and biological importance in basic re- search, diagnosis, and biotechnological production. This contamination prob- lem is widespread. Surveys show that 5-87% of cell lines are contaminat- ed. (3-6~ There are currently ~120 molli- cute species, (~ but 5 species account for ~>95% of cell contaminations. (3'7-9~ The common contaminants are two bovine mollicutes, Mycoplasma arginini and Acholeplasma laidlawii; two human mol- FIGURE 1 Scanning electron microscopy of 3T6 cell line infected with M. fermentans. Arrows licutes, Mycoplasma orale and Myco- indicate the mycoplasmas adsorbed on the cell surface. plasma fermentans; and a porcine molli- cute, Mycoplasma hyorhinis. (1~ Figure 1 shows a fibroblastic cell line contami- cleic acid and amino acid metabolism, ers or characteristics associated with nated with M. fermentans detected by and production of virus and biologic mollicutes, including DNA fluoro- scanning electron microscopy. products, such as cytokines and mono- chrome staining, DNA probes, enzyme- Although contamination originates clonal antibodies. ~3'7'9'12'~3~ Unlike bac- linked immunosorbent assay (ELISA), from laboratory personnel and commer- teria and fungi, moUicute contaminants immunofluorescence, electron micros- cial animal sera used in culture media, usually produce neither turbid growth copy, autoradiography, and biochemical the main source of contamination of nor cell damage. (6~ Moreover, most mol- assays. ~2'6'1~ Although efforts have fo- clean cultures is mollicute-infected cul- licutes are resistant to antibiotics com- cused on the improvement of these tech- tures.(2,7,11) monly used in long-term cell cul- niques, detection of mollicutes in cell Mollicutes are capable of altering vir- tures. (6'~2~ Periodic screening is therefore cultures remains a serious problem. Re- tually every property and parameter essential in controlling contamination cently, the application of PCR-based measured in cell cultures, depending on and maintaining mollicute-free cell methods of detection has attracted the contaminating species and on the lines. much attention because of their extreme type of cell infected, leading to unreli- Numerous methods for detecting sensitivity and specificity. Because the able experiments and unsafebiologicals, mollicute infection have been devel- pace of PCR technology advancement biopharmaceutical drugs, and virus vac- oped. Direct tests are based on microbi- is so rapid, detection methods have cines. It has been shown that mollicutes ological culture, and indirect tests are evolved quickly. The objective of this re- affect cell growth and morphology, nu- based on measurement of specific mark- view is to present the latest develop- 4:199-2089 by Cold Spring Harbor Laboratory Press ISSN 1054-9803/95 $5.00 PCR Methods ondApplications 199 Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press Review llll|ll ments in the field of PCR-based detec- mollicute DNA and can generate mil- alignment studies of mollicute 16S rRNA tion of mollicutes contaminating ceil lions of DNA copies from the template sequences have revealed the existence of cultures. PCR-based methods are de- sequence, it makes the detection of mol- regions with highly conserved sequences scribed and compared with other molli- licutes easier, even in cell cultures with and regions with sequence variability at cute detection assays. low contamination. the genus and species levels, allowing the selection of genus- and species-spe- cific primers and, thus, detection and Characteristics of Target Nucleic GENERAL PRINCIPLES OF PCR identification of mollicutes. However, Acids and Primers DETECTION most investigators have reported the The PCR technique is based on repeated Virtually all forms of double-stranded relative specificity of their primers, cycles of high-temperature template de- nucleic acids are suitable substrates for especially when used in one-step PCR naturation, oligonucleotide primer an- PCR. Mycoplasmic 16S rRNA sequences procedures. Some workers observed nealing, and thermostable polymerase- have been determined and provide the cross-reactions with walled prokaryotes mediated extension. (~4) The number of basis for a systematic phylogenetic anal- in genus-specific conditions (Table DNA molecules doubles after each cycle, ysis of mollicutes. ~ls) Typically, PCR tar- 1), C2~ or cross-reactions between mol- somewhat mimicking in vivo DNA rep- gets are chosen within the gene coding licutes in species-specific PCR condi- lication. Because PCR allows the specific for this evolutionarily conserved 16S tions. ~ Others used primers that did amplification of discrete fragments of rRNA (Tables 1 and 2). (16--22) Computer not cross-react with bacteria that is TABLE 1 Primers used in Detection by PCR of Mycoplasma-contaminated Cell Cultures Primer Site on 16S Undetected designation a Sequence 5' ---> 3' or 23S rRNA species Cross-reaction Reference 1-P1 GTGCCAGCAGCCGCGGTAATAC NR b none prokaryotes 20 2-P2 TCTACGCATTTCACCGCTACAC NRb 20 1-P3 CTTGTACACACCGCCCGTCACACCATG NRb none prokaryotes 20 2-P4 TACCTTGTTACGACTTCACCCCA NRb 20 1-P3 CTTGTACACACCGCCCGTCACACCATG NRb M. orale none 20 2-IP3 ATCGCTAGTCCTACCTTGGG NRb A. laidlawii 20 l-P3 CTTGTACACACCGCCCGTCACACCATG NRb A. laidlawii none 20 2-IP'3 GTCACCAGTCCTACCTTAGG NRb 20 1-MCGpF11 c ACACCAAGGGAG(CFF)TGGTAAT NR b none NR 23 2-R23-1R c CTCCTAGTGCCAAG(C/G) CAT(CFF)C NRa 23 3-R16-2 c GTG(C/G) GG(A/C)TGGATCACCTCCT NRb none NR 23 4-MCGpR21 c GCATCCACCA(A/T)A(AFF)AC(CFF)CTT NR~ 23 1-F1 ~ ACACCATGGGAG(CFF)TGGTAAT NRb none NR 24 2-R1 ~ CTTC(A/T)TCGACTT(CFF)CAGACCCAAGGCAT NRd 24 3-F2~ GTG(C/G) GG(A/C)TGGATCACCTCCT NRb none NR 24 4-R2 c GCATCCACCA(A/T)A(A/T)AC(CFF)CTT NRa 16 1-Myco 9 ~ (CFF)GCCTG(AJG)GTAGTA(CJT)(A/G) (TIC) (T/A) CGC NRb none NR 16 2-Myco 3 c GCGGTGTGTACAA(G/A)(A/C) CCCGA 16 3-Myco 8 ~ TGGTGCA(T/C) GGTTGTCGTCAG NRb none NR 16 4-Myco 5 ~ GAACGTATTCACCG(C/T)(A/G) (G/A) (CFF) (A/G)T(A/G) NRb 16 1-My 1 GCTGTGTGCCTAATACATGCAT 41-62 b'e none none 18 2-My 2 TGGTAGACAGTGAGACAATTGGAG 1013-1036 b'e 18 1-Molli 1 TACGGGAGGCAGCAGTA 343-359 b'f A. laidlawii Clostridia 21 2-Molli 2a TCAAGATAAAGTCATTTCCT 463-482 b'f 21 1-Molli 1 TACGGGAGGCAGCAGTA 343-359 b'f Mycoplasma none 21 species 2-Molli 2b TACCGTCAATITITAATITIT 451-471 b'f none 21 1-RNA5 AGAGTTTGATCCTGGCTCAGGA 10-31 f Gram-positive bacteria 2 19 2-RNA3 ACGAGCTGACGACAACCATGCAC 1068-1043 f none 19 1-GPO-3 GGGAGCAAACAGGATTAGATACCCT 774-798f prokaryotes NR 25 2-MGSO TGCACCATCTGTCACTCTGTTAACCTC 1029-1055 f 25 a(1-/2-) Primer pairs for one-step PCR or outer primers for nested PCR; (3-/4-) inner primers for nested PCR. b16s rRNA gene. CParentheses indicate nucleotide degeneration. (NR) Not reported. d23S rRNA gene. eUsing M. fermentans 16S rDNA as a reference. fRelative to Escherichia coli 16S rDNA nucleotide sequence. gLow G + C Gram-positive bacteria. 200 PCR Methods and Applications Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press TABLE 2 Species-specific Primers for Identification by PCR of Mycoplasma-contaminated Cell Culture Primer Site on Species designation Sequence 5' ~ 3' 16S rRNAa specificity Reference ARG2b TCAACCAGGTGTTCTTTCCC 460-440 M. arginini 19 ACH3b AGCCGGACTGAGGGTCTAC 277-296 A. laidlawii 19 FERb AAGAAGCGTTTCTTCGCTGG 203-222 M. fermentans 19 HYOb GAAAGGAGCTTCACAGCTTC 198-217 M. hyorhinis 19 ORAb GGAGCGTTTCGTCCGCTAAG 199-218 M. orale 19 PIRb GTCCGTTTGGACCGCTATAG 203-222 M. pirum 19 SALb GCTGCGTCAACAGTTCTCTG 849-830 M. salivarium 19 PNEU-GENb CCTGCAAGGGTTCGTTATTT 204-223 M. pneumoniae/ M. genitaliurn 19 moli2bc TACCGTCAATITFTAATITT 451-471 A. laidlawii 21 p1 c AAGGACCTGCAAGGGTTCGT NR M. pneumoniae 22 p2 c CTCTAGCCATTACCTGCTAA NR M. pneumoniae 22 p1 o TGAAAGGCGCTGTAAGGCGC NR M. hominis 22 p2 o GTCTGCAATCATTTCCTATTGCAAA NR M. hominis 22 p1 e GAAGCCTTTCTTCGCTGGAG NR M. fermentans 22 p2 e ACAAAATCATTTCCTATTCTGTC NR M. fermentans 22 p1 f AGCGTTTGCTTCACTTTGAA NR M. pulmonis 22 p2 f GGGCATTTCCTCCCTAAGCT NR M. pulmonis 22 RNA2b TTCTATAGCTTTGCCAAG NR M. pirum 26 Phyob TTCACAGCTTCACTTAAAA 207-225 M. hyorhinis 18 Pora b GCGTTTCGTCCGCTAAGA 202-219 M. orale 18 Pacho b AACACATVFAAAGATTTA 189-206 A. laidlawii 18 Psalb GGGCCTTTAAAGCTCCAC 200-217 M. salivarium 18 Pargb GCGAGGTTCTTTTGAACC 68-85 M. arginini 18 Pferb TTTCTTCGCTGGAGGAGCG 206-224 M. fermentans 18 aIUB E. coli 16S rRNA position. bUsed with a genus-specific primer to perform PCR. c-fPrimer pairs used together to perform PCR. (NR) Not reported. closely related to mollicutes phylogenet- mollicute DNA among the eukaryotic patible. ~31~ Several recent PCR-based ically, but did not amplify all mollicute gene material. Primer design is one of methods of diagnosing cell culture infec-
Recommended publications
  • The Role of Earthworm Gut-Associated Microorganisms in the Fate of Prions in Soil

    The Role of Earthworm Gut-Associated Microorganisms in the Fate of Prions in Soil

    THE ROLE OF EARTHWORM GUT-ASSOCIATED MICROORGANISMS IN THE FATE OF PRIONS IN SOIL Von der Fakultät für Lebenswissenschaften der Technischen Universität Carolo-Wilhelmina zu Braunschweig zur Erlangung des Grades eines Doktors der Naturwissenschaften (Dr. rer. nat.) genehmigte D i s s e r t a t i o n von Taras Jur’evič Nechitaylo aus Krasnodar, Russland 2 Acknowledgement I would like to thank Prof. Dr. Kenneth N. Timmis for his guidance in the work and help. I thank Peter N. Golyshin for patience and strong support on this way. Many thanks to my other colleagues, which also taught me and made the life in the lab and studies easy: Manuel Ferrer, Alex Neef, Angelika Arnscheidt, Olga Golyshina, Tanja Chernikova, Christoph Gertler, Agnes Waliczek, Britta Scheithauer, Julia Sabirova, Oleg Kotsurbenko, and other wonderful labmates. I am also grateful to Michail Yakimov and Vitor Martins dos Santos for useful discussions and suggestions. I am very obliged to my family: my parents and my brother, my parents on low and of course to my wife, which made all of their best to support me. 3 Summary.....................................................………………………………………………... 5 1. Introduction...........................................................................................................……... 7 Prion diseases: early hypotheses...………...………………..........…......…......……….. 7 The basics of the prion concept………………………………………………….……... 8 Putative prion dissemination pathways………………………………………….……... 10 Earthworms: a putative factor of the dissemination of TSE infectivity in soil?.………. 11 Objectives of the study…………………………………………………………………. 16 2. Materials and Methods.............................…......................................................……….. 17 2.1 Sampling and general experimental design..................................................………. 17 2.2 Fluorescence in situ Hybridization (FISH)………..……………………….………. 18 2.2.1 FISH with soil, intestine, and casts samples…………………………….……... 18 Isolation of cells from environmental samples…………………………….……….
  • Species Determination – What's in My Sample?

    Species Determination – What's in My Sample?

    Species determination – what’s in my sample? What is my sample? • When might you not know what your sample is? • One species • You have a malaria sample but don’t know which species • Misidentification or no identification from culture/MALDI-TOF • Metagenomic samples • Contamination Taxonomic Classifiers • Compare sequence reads against a database and determine the species • BLAST works for a single sequence, too slow for a whole run • Classifiers use database indexing and k-mer searching • Similar accuracy to BLAST but much much faster Wood and Salzberg Genome Biology 2014, 15:R46 Page 3 of 12 http://genomebiology.com/2014/15/3/R46 Kraken taxonomic classifier Figure 1 The Kraken sequence classification algorithm. To classify a sequence, each k-mer in the sequence is mapped to the lowest common ancestor (LCA) of the genomes that contain that k-mer in a database. The taxa associated with the sequence’s k-mers, as well as the taxa’s ancestors, form a pruned subtree of the general taxonomy tree, which is used for classification. In the classification tree, each node has a 15 weight equal to the number of k-mersWood in the and sequence Salzberg associatedGenome with the Biology node’s taxon. 2014 Each root-to-leaf:R46 (RTL) path in the classification tree is scored by adding all weights in the path, and the maximal RTL path in the classification tree is the classification path (nodes highlighted in yellow). The leaf of this classification path (the orange, leftmost leaf in the classification tree) is the classification used for the query sequence.
  • The Mysterious Orphans of Mycoplasmataceae

    The Mysterious Orphans of Mycoplasmataceae

    The mysterious orphans of Mycoplasmataceae Tatiana V. Tatarinova1,2*, Inna Lysnyansky3, Yuri V. Nikolsky4,5,6, and Alexander Bolshoy7* 1 Children’s Hospital Los Angeles, Keck School of Medicine, University of Southern California, Los Angeles, 90027, California, USA 2 Spatial Science Institute, University of Southern California, Los Angeles, 90089, California, USA 3 Mycoplasma Unit, Division of Avian and Aquatic Diseases, Kimron Veterinary Institute, POB 12, Beit Dagan, 50250, Israel 4 School of Systems Biology, George Mason University, 10900 University Blvd, MSN 5B3, Manassas, VA 20110, USA 5 Biomedical Cluster, Skolkovo Foundation, 4 Lugovaya str., Skolkovo Innovation Centre, Mozhajskij region, Moscow, 143026, Russian Federation 6 Vavilov Institute of General Genetics, Moscow, Russian Federation 7 Department of Evolutionary and Environmental Biology and Institute of Evolution, University of Haifa, Israel 1,2 [email protected] 3 [email protected] 4-6 [email protected] 7 [email protected] 1 Abstract Background: The length of a protein sequence is largely determined by its function, i.e. each functional group is associated with an optimal size. However, comparative genomics revealed that proteins’ length may be affected by additional factors. In 2002 it was shown that in bacterium Escherichia coli and the archaeon Archaeoglobus fulgidus, protein sequences with no homologs are, on average, shorter than those with homologs [1]. Most experts now agree that the length distributions are distinctly different between protein sequences with and without homologs in bacterial and archaeal genomes. In this study, we examine this postulate by a comprehensive analysis of all annotated prokaryotic genomes and focusing on certain exceptions.
  • MIB–MIP Is a Mycoplasma System That Captures and Cleaves Immunoglobulin G

    MIB–MIP Is a Mycoplasma System That Captures and Cleaves Immunoglobulin G

    MIB–MIP is a mycoplasma system that captures and cleaves immunoglobulin G Yonathan Arfia,b,1, Laetitia Minderc,d, Carmelo Di Primoe,f,g, Aline Le Royh,i,j, Christine Ebelh,i,j, Laurent Coquetk, Stephane Claveroll, Sanjay Vasheem, Joerg Joresn,o, Alain Blancharda,b, and Pascal Sirand-Pugneta,b aINRA (Institut National de la Recherche Agronomique), UMR 1332 Biologie du Fruit et Pathologie, F-33882 Villenave d’Ornon, France; bUniversity of Bordeaux, UMR 1332 Biologie du Fruit et Pathologie, F-33882 Villenave d’Ornon, France; cInstitut Européen de Chimie et Biologie, UMS 3033, University of Bordeaux, 33607 Pessac, France; dInstitut Bergonié, SIRIC BRIO, 33076 Bordeaux, France; eINSERM U1212, ARN Regulation Naturelle et Artificielle, 33607 Pessac, France; fCNRS UMR 5320, ARN Regulation Naturelle et Artificielle, 33607 Pessac, France; gInstitut Européen de Chimie et Biologie, University of Bordeaux, 33607 Pessac, France; hInstitut de Biologie Structurale, University of Grenoble Alpes, F-38044 Grenoble, France; iCNRS, Institut de Biologie Structurale, F-38044 Grenoble, France; jCEA, Institut de Biologie Structurale, F-38044 Grenoble, France; kCNRS UMR 6270, Plateforme PISSARO, Institute for Research and Innovation in Biomedicine - Normandie Rouen, Normandie Université, F-76821 Mont-Saint-Aignan, France; lProteome Platform, Functional Genomic Center of Bordeaux, University of Bordeaux, F-33076 Bordeaux Cedex, France; mJ. Craig Venter Institute, Rockville, MD 20850; nInternational Livestock Research Institute, 00100 Nairobi, Kenya; and oInstitute of Veterinary Bacteriology, University of Bern, CH-3001 Bern, Switzerland Edited by Roy Curtiss III, University of Florida, Gainesville, FL, and approved March 30, 2016 (received for review January 12, 2016) Mycoplasmas are “minimal” bacteria able to infect humans, wildlife, introduced into naive herds (8).
  • Mycoplasma Agalactiae MEMBRANE PROTEOME

    Mycoplasma Agalactiae MEMBRANE PROTEOME

    UNIVERSITÀ DEGLI STUDI DI SASSARI SCUOLA DI DOTTORATO IN SCIENZE BIOMOLECOLARI E BIOTECNOLOGICHE INDIRIZZO MICROBIOLOGIA MOLECOLARE E CLINICA XXIII Ciclo CHARACTERIZATION OF Mycoplasma agalactiae MEMBRANE PROTEOME Direttore: Prof. Bruno Masala Tutor: Dr. Alberto Alberti Tesi di dottorato della Dott.ssa Carla Cacciotto ANNO ACCADEMICO 2009-2010 TABLE OF CONTENTS 1. Abstract 2. Introduction 2.1 Mycoplasmas: taxonomy and main biological features 2.2 Metabolism 2.3 In vitro cultivation 2.4 Mycoplasma lipoproteins 2.5 Invasivity and pathogenicity 2.6 Diagnosis of mycoplasmosis 2.7 Mycoplasma agalactiae and Contagious Agalactia 3. Research objectives 4. Materials and methods 4.1 Media and buffers 4.2 Bacterial strains and culture conditions 4.3 Total DNA extraction and PCR 4.4 Total proteins extraction 4.5 Triton X-114 fractionation 4.6 SDS-PAGE 4.7 Western immunoblotting 4.8 2-D PAGE 4.9 2D DIGE 4.10 Spot picking and in situ tryptic digestion 4.11 GeLC-MS/MS 4.12 MALDI-MS 4.13 LC-MS/MS 4.14 Data analysis Dott.ssa Carla Cacciotto, Characterization of Mycoplasma agalactiae membrane proteome. Tesi di Dottorato in Scienze Biomolecolari e Biotecnologiche, Università degli Studi di Sassari. 5. Results 5.1 Species identification 5.2 Extraction of bacterial proteins and isolation of liposoluble proteins 5.3 2-D PAGE/MS of M. agalactiae PG2T liposoluble proteins 5.4 2D DIGE of liposoluble proteins among the type strain and two field isolates of M. agalactiae 5.5 GeLC-MS/MS of M. agalactiae PG2T liposoluble proteins 5.6 Data analysis and classification 6. Discussion 7.
  • Genomic Islands in Mycoplasmas

    Genomic Islands in Mycoplasmas

    G C A T T A C G G C A T genes Review Genomic Islands in Mycoplasmas Christine Citti * , Eric Baranowski * , Emilie Dordet-Frisoni, Marion Faucher and Laurent-Xavier Nouvel Interactions Hôtes-Agents Pathogènes (IHAP), Université de Toulouse, INRAE, ENVT, 31300 Toulouse, France; [email protected] (E.D.-F.); [email protected] (M.F.); [email protected] (L.-X.N.) * Correspondence: [email protected] (C.C.); [email protected] (E.B.) Received: 30 June 2020; Accepted: 20 July 2020; Published: 22 July 2020 Abstract: Bacteria of the Mycoplasma genus are characterized by the lack of a cell-wall, the use of UGA as tryptophan codon instead of a universal stop, and their simplified metabolic pathways. Most of these features are due to the small-size and limited-content of their genomes (580–1840 Kbp; 482–2050 CDS). Yet, the Mycoplasma genus encompasses over 200 species living in close contact with a wide range of animal hosts and man. These include pathogens, pathobionts, or commensals that have retained the full capacity to synthesize DNA, RNA, and all proteins required to sustain a parasitic life-style, with most being able to grow under laboratory conditions without host cells. Over the last 10 years, comparative genome analyses of multiple species and strains unveiled some of the dynamics of mycoplasma genomes. This review summarizes our current knowledge of genomic islands (GIs) found in mycoplasmas, with a focus on pathogenicity islands, integrative and conjugative elements (ICEs), and prophages. Here, we discuss how GIs contribute to the dynamics of mycoplasma genomes and how they participate in the evolution of these minimal organisms.
  • Molecular Detection of Urogenital Mollicutes in Patients with Invasive Malignant Prostate Tumor Osama Mohammed Saed Abdul-Wahab1, Mishari H

    Molecular Detection of Urogenital Mollicutes in Patients with Invasive Malignant Prostate Tumor Osama Mohammed Saed Abdul-Wahab1, Mishari H

    Abdul-Wahab et al. Infectious Agents and Cancer (2021) 16:6 https://doi.org/10.1186/s13027-021-00344-9 RESEARCH ARTICLE Open Access Molecular detection of urogenital mollicutes in patients with invasive malignant prostate tumor Osama Mohammed Saed Abdul-Wahab1, Mishari H. Al-Shyarba2, Boutheina Ben Abdelmoumen Mardassi3, Nessrine Sassi3, Majed Saad Shaya Al Fayi4, Hassan Otifi5, Abdullah Hassan Al Murea6, Béhija Mlik3 and Elhem Yacoub3* Abstract Background: The etiology of prostate cancer (PCa) is multiple and complex. Among the causes recently cited are chronic infections engendered by microorganisms that often go unnoticed. A typical illustration of such a case is infection due to mollicutes bacteria. Generally known by their lurking nature, urogenital mollicutes are the most incriminated in PCa. This study was thus carried out in an attempt to establish the presence of these mollicutes by PCR in biopsies of confirmed PCa patients and to evaluate their prevalence. Methods: A total of 105 Formalin-Fixed Paraffin-Embedded prostate tissues collected from 50 patients suffering from PCa and 55 with benign prostate hyperplasia were subjected to PCR amplification targeting species-specific genes of 5 urogenital mollicutes species, Mycoplasma genitalium, M. hominis, M. fermentans, Ureaplasma parvum, and U. urealyticum. PCR products were then sequenced to confirm species identification. Results significance was statistically assessed using Chi-square and Odds ratio tests. Results: PCR amplification showed no positive results for M. genitalium, M. hominis, and M. fermentans in all tested patients. Strikingly, Ureaplasma spp. were detected among 30% (15/50) of PCa patients. Nucleotide sequencing further confirmed the identified ureaplasma species, which were distributed as follows: 7 individuals with only U.
  • The Phylogenetic Composition and Structure of Soil Microbial Communities Shifts in Response to Elevated Carbon Dioxide

    The Phylogenetic Composition and Structure of Soil Microbial Communities Shifts in Response to Elevated Carbon Dioxide

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by University of Minnesota Digital Conservancy The ISME Journal (2012) 6, 259–272 & 2012 International Society for Microbial Ecology All rights reserved 1751-7362/12 www.nature.com/ismej ORIGINAL ARTICLE The phylogenetic composition and structure of soil microbial communities shifts in response to elevated carbon dioxide Zhili He1, Yvette Piceno2, Ye Deng1, Meiying Xu1,3, Zhenmei Lu1,4, Todd DeSantis2, Gary Andersen2, Sarah E Hobbie5, Peter B Reich6 and Jizhong Zhou1,2 1Institute for Environmental Genomics, Department of Botany and Microbiology, University of Oklahoma, Norman, OK, USA; 2Ecology Department, Earth Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA, USA; 3Guangdong Provincial Key Laboratory of Microbial Culture Collection and Application, Guangdong Institute of Microbiology, Guangzhou, China; 4College of Life Sciences, Zhejiang University, Hangzhou, China; 5Department of Ecology, Evolution, and Behavior, St Paul, MN, USA and 6Department of Forest Resources, University of Minnesota, St Paul, MN, USA One of the major factors associated with global change is the ever-increasing concentration of atmospheric CO2. Although the stimulating effects of elevated CO2 (eCO2) on plant growth and primary productivity have been established, its impacts on the diversity and function of soil microbial communities are poorly understood. In this study, phylogenetic microarrays (PhyloChip) were used to comprehensively survey the richness, composition and structure of soil microbial communities in a grassland experiment subjected to two CO2 conditions (ambient, 368 p.p.m., versus elevated, 560 p.p.m.) for 10 years. The richness based on the detected number of operational taxonomic units (OTUs) significantly decreased under eCO2.
  • ( 12 ) United States Patent

    ( 12 ) United States Patent

    US009956282B2 (12 ) United States Patent ( 10 ) Patent No. : US 9 ,956 , 282 B2 Cook et al. (45 ) Date of Patent: May 1 , 2018 ( 54 ) BACTERIAL COMPOSITIONS AND (58 ) Field of Classification Search METHODS OF USE THEREOF FOR None TREATMENT OF IMMUNE SYSTEM See application file for complete search history . DISORDERS ( 56 ) References Cited (71 ) Applicant : Seres Therapeutics , Inc. , Cambridge , U . S . PATENT DOCUMENTS MA (US ) 3 ,009 , 864 A 11 / 1961 Gordon - Aldterton et al . 3 , 228 , 838 A 1 / 1966 Rinfret (72 ) Inventors : David N . Cook , Brooklyn , NY (US ) ; 3 ,608 ,030 A 11/ 1971 Grant David Arthur Berry , Brookline, MA 4 ,077 , 227 A 3 / 1978 Larson 4 ,205 , 132 A 5 / 1980 Sandine (US ) ; Geoffrey von Maltzahn , Boston , 4 ,655 , 047 A 4 / 1987 Temple MA (US ) ; Matthew R . Henn , 4 ,689 ,226 A 8 / 1987 Nurmi Somerville , MA (US ) ; Han Zhang , 4 ,839 , 281 A 6 / 1989 Gorbach et al. Oakton , VA (US ); Brian Goodman , 5 , 196 , 205 A 3 / 1993 Borody 5 , 425 , 951 A 6 / 1995 Goodrich Boston , MA (US ) 5 ,436 , 002 A 7 / 1995 Payne 5 ,443 , 826 A 8 / 1995 Borody ( 73 ) Assignee : Seres Therapeutics , Inc. , Cambridge , 5 ,599 ,795 A 2 / 1997 McCann 5 . 648 , 206 A 7 / 1997 Goodrich MA (US ) 5 , 951 , 977 A 9 / 1999 Nisbet et al. 5 , 965 , 128 A 10 / 1999 Doyle et al. ( * ) Notice : Subject to any disclaimer , the term of this 6 ,589 , 771 B1 7 /2003 Marshall patent is extended or adjusted under 35 6 , 645 , 530 B1 . 11 /2003 Borody U .
  • Metabolic Network Percolation Quantifies Biosynthetic Capabilities

    Metabolic Network Percolation Quantifies Biosynthetic Capabilities

    RESEARCH ARTICLE Metabolic network percolation quantifies biosynthetic capabilities across the human oral microbiome David B Bernstein1,2, Floyd E Dewhirst3,4, Daniel Segre` 1,2,5,6,7* 1Department of Biomedical Engineering, Boston University, Boston, United States; 2Biological Design Center, Boston University, Boston, United States; 3The Forsyth Institute, Cambridge, United States; 4Harvard School of Dental Medicine, Boston, United States; 5Bioinformatics Program, Boston University, Boston, United States; 6Department of Biology, Boston University, Boston, United States; 7Department of Physics, Boston University, Boston, United States Abstract The biosynthetic capabilities of microbes underlie their growth and interactions, playing a prominent role in microbial community structure. For large, diverse microbial communities, prediction of these capabilities is limited by uncertainty about metabolic functions and environmental conditions. To address this challenge, we propose a probabilistic method, inspired by percolation theory, to computationally quantify how robustly a genome-derived metabolic network produces a given set of metabolites under an ensemble of variable environments. We used this method to compile an atlas of predicted biosynthetic capabilities for 97 metabolites across 456 human oral microbes. This atlas captures taxonomically-related trends in biomass composition, and makes it possible to estimate inter-microbial metabolic distances that correlate with microbial co-occurrences. We also found a distinct cluster of fastidious/uncultivated taxa, including several Saccharibacteria (TM7) species, characterized by their abundant metabolic deficiencies. By embracing uncertainty, our approach can be broadly applied to understanding metabolic interactions in complex microbial ecosystems. *For correspondence: DOI: https://doi.org/10.7554/eLife.39733.001 [email protected] Competing interests: The authors declare that no Introduction competing interests exist.
  • A Phylogenetic Analysis of the Mycoplasmas: Basis for Their Lc Assification W

    A Phylogenetic Analysis of the Mycoplasmas: Basis for Their Lc Assification W

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by DigitalCommons@University of Nebraska University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Public Health Resources Public Health Resources 9-1989 A Phylogenetic Analysis of the Mycoplasmas: Basis for Their lC assification W. G. Weisburg University of Illinois J. G. Tully National Institute of Allergy and Infectious Diseases D. L. Rose National Institute of Allergy and Infectious Diseases J. P. Petzel Iowa State University H. Oyaizu University of Illinois See next page for additional authors Follow this and additional works at: https://digitalcommons.unl.edu/publichealthresources Weisburg, W. G.; Tully, J. G.; Rose, D. L.; Petzel, J. P.; Oyaizu, H.; Yang, D.; Mandelco, L.; Sechrest, J.; Lawrence, T. G.; Van Etten, James L.; Maniloff, J.; and Woese, C. R., "A Phylogenetic Analysis of the Mycoplasmas: Basis for Their lC assification" (1989). Public Health Resources. 310. https://digitalcommons.unl.edu/publichealthresources/310 This Article is brought to you for free and open access by the Public Health Resources at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Public Health Resources by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Authors W. G. Weisburg, J. G. Tully, D. L. Rose, J. P. Petzel, H. Oyaizu, D. Yang, L. Mandelco, J. Sechrest, T. G. Lawrence, James L. Van Etten, J. Maniloff, and C. R. Woese This article is available at DigitalCommons@University of Nebraska - Lincoln: https://digitalcommons.unl.edu/ publichealthresources/310 JOURNAL OF BACTERIOLOGY, Dec. 1989, p. 6455-6467 Vol. 171, No.
  • Characterization of the Bacterial Communities of the Tonsil of the Soft Palate of Swine

    Characterization of the Bacterial Communities of the Tonsil of the Soft Palate of Swine

    Characterization of the Bacterial Communities of the Tonsil of the Soft Palate of Swine by Shaun Kernaghan A Thesis Presented to The University of Guelph In partial fulfilment of requirements for the degree of Master of Science in Pathobiology Guelph, Ontario, Canada © Shaun Kernaghan, December, 2013 ABSTRACT CHARACTERIZATION OF THE BACTERIAL COMMUNITIES OF THE TONSIL OF THE SOFT PALATE OF SWINE Shaun Kernaghan Advisor: University of Guelph, 2013 Professor Janet I. MacInnes Terminal restriction fragment length polymorphism (T-RFLP) analysis and pyrosequencing were used to characterize the microbiota of the tonsil of the soft palate of 126 unfit and 18 healthy pigs. The T-RFLP analysis method was first optimized for the study of the pig tonsil microbiota and the data compared with culture-based identification of common pig pathogens. Putative identifications of the members of the microbiota revealed that the phyla Firmicutes, Proteobacteria and Bacteroidetes were the most prevalent. A comparison of the T-RFLP analysis results grouped into clusters to clinical conditions revealed paleness, abscess, PRRS virus, and Mycoplasma hyopneumoniae to be significantly associated with cluster membership. T-RFLP analysis was also used to select representative tonsil samples for pyrosequencing. These studies confirmed Actinobacteria, Bacteroidetes, Firmicutes, Fusobacteria, and Proteobacteria to be the core phyla of the microbiota of the tonsil of the soft palate of pigs. Acknowledgements I would like to thank my advisor Janet MacInnes for her support and endless patience during this project. I would like to thank my committee, Patrick Boerlin and Emma Allen-Vercoe, for their insights and support, as well as Zvoninir Poljak for his help through this project.