Advances in PCR Based Detection of Mycoplasmas Contaminating Cell Cultures

Home , Mollicutes, Mycoplasma hyorhinis, Mycoplasma orale

Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

Advances in PCR based Detection of Mycoplasmas Contaminating Cell Cultures

Georges Rawadi and Olivier Dussurget

Laboratoire des Mycoplasmes, D~partement de Bact&iologie et Mycologie, Institut Pasteur, 75724 Paris, CEDEX 15, France

M ycoplasmas (the trivial name for microorganisms belonging to the class Mollicutes) are the smallest free-living, self-replicating bacteria, having diame- ters of 300 to 800 nm. These pleomorph microorganisms have no cell walls. (1~ Be- cause of their small size and flexibility, mollicutes can pass through filters of 450 and 220 nm used commonly in cell culturing. ~,2) Mollicute contamination of primary and continuous eukaryotic cell lines rep- resents a major problem of economic and biological importance in basic research, diagnosis, and biotechnological production. This contamination problem is widespread. Surveys show that 5-87% of cell lines are contaminated. (3-6~ There are currently ~120 mollicute species, (~ but 5 species account for ~>95% of cell contaminations. (3'7-9~ The common contaminants are two bovine mollicutes, Mycoplasma arginini and Acholeplasma laidlawii; two human mol- FIGURE 1 Scanning electron microscopy of 3T6 cell line infected with M. fermentans. Arrows licutes, Mycoplasma orale and Myco- indicate the mycoplasmas adsorbed on the cell surface. plasma fermentans; and a porcine mollicute, Mycoplasma hyorhinis. (1~ Figure 1 shows a fibroblastic cell line contami- cleic acid and amino acid metabolism, ers or characteristics associated with nated with M. fermentans detected by and production of virus and biologic mollicutes, including DNA fluoro- scanning electron microscopy. products, such as cytokines and mono- chrome staining, DNA probes, enzyme- Although contamination originates clonal antibodies. ~3'7'9'12'~3~ Unlike bac- linked immunosorbent assay (ELISA), from laboratory personnel and commer- teria and fungi, moUicute contaminants immunofluorescence, electron micros- cial animal sera used in culture media, usually produce neither turbid growth copy, autoradiography, and biochemical the main source of contamination of nor cell damage. (6~ Moreover, most mol- assays. ~2'6'1~ Although efforts have fo- clean cultures is mollicute-infected cul- licutes are resistant to antibiotics com- cused on the improvement of these tech- tures.(2,7,11) monly used in long-term cell cul- niques, detection of mollicutes in cell Mollicutes are capable of altering vir- tures. (6'~2~ Periodic screening is therefore cultures remains a serious problem. Re- tually every property and parameter essential in controlling contamination cently, the application of PCR-based measured in cell cultures, depending on and maintaining mollicute-free cell methods of detection has attracted the contaminating species and on the lines. much attention because of their extreme type of cell infected, leading to unreli- Numerous methods for detecting sensitivity and specificity. Because the able experiments and unsafebiologicals, mollicute infection have been devel- pace of PCR technology advancement biopharmaceutical drugs, and virus vac- oped. Direct tests are based on microbi- is so rapid, detection methods have cines. It has been shown that mollicutes ological culture, and indirect tests are evolved quickly. The objective of this re- affect cell growth and morphology, nu- based on measurement of specific mark- view is to present the latest develop-

4:199-2089 by Cold Spring Harbor Laboratory Press ISSN 1054-9803/95 $5.00 PCR Methods ondApplications 199 Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press Review llll|ll

ments in the field of PCR-based detec- mollicute DNA and can generate mil- alignment studies of mollicute 16S rRNA tion of mollicutes contaminating ceil lions of DNA copies from the template sequences have revealed the existence of cultures. PCR-based methods are de- sequence, it makes the detection of mol- regions with highly conserved sequences scribed and compared with other molli- licutes easier, even in cell cultures with and regions with sequence variability at cute detection assays. low contamination. the genus and species levels, allowing the selection of genus- and species-specific primers and, thus, detection and Characteristics of Target Nucleic GENERAL PRINCIPLES OF PCR identification of mollicutes. However, Acids and Primers DETECTION most investigators have reported the The PCR technique is based on repeated Virtually all forms of double-stranded relative specificity of their primers, cycles of high-temperature template de- nucleic acids are suitable substrates for especially when used in one-step PCR naturation, oligonucleotide primer an- PCR. Mycoplasmic 16S rRNA sequences procedures. Some workers observed nealing, and thermostable polymerase- have been determined and provide the cross-reactions with walled prokaryotes mediated extension. (~4) The number of basis for a systematic phylogenetic anal- in genus-specific conditions (Table DNA molecules doubles after each cycle, ysis of mollicutes. ~ls) Typically, PCR tar- 1), C2~ or cross-reactions between mol- somewhat mimicking in vivo DNA rep- gets are chosen within the gene coding licutes in species-specific PCR condi- lication. Because PCR allows the specific for this evolutionarily conserved 16S tions. ~ Others used primers that did amplification of discrete fragments of rRNA (Tables 1 and 2). (16--22) Computer not cross-react with bacteria that is

TABLE 1 Primers used in Detection by PCR of Mycoplasma-contaminated Cell Cultures

Primer Site on 16S Undetected designation a Sequence 5' ---> 3' or 23S rRNA species Cross-reaction Reference

1-P1 GTGCCAGCAGCCGCGGTAATAC NRb none prokaryotes 20 2-P2 TCTACGCATTTCACCGCTACAC NRb 20 1-P3 CTTGTACACACCGCCCGTCACACCATG NRb none prokaryotes 20 2-P4 TACCTTGTTACGACTTCACCCCA NRb 20 1-P3 CTTGTACACACCGCCCGTCACACCATG NRb M. orale none 20 2-IP3 ATCGCTAGTCCTACCTTGGG NRb A. laidlawii 20 l-P3 CTTGTACACACCGCCCGTCACACCATG NRb A. laidlawii none 20 2-IP'3 GTCACCAGTCCTACCTTAGG NRb 20 1-MCGpF11 c ACACCAAGGGAG(CFF)TGGTAAT NRb none NR 23 2-R23-1R c CTCCTAGTGCCAAG(C/G) CAT(CFF)C NRa 23 3-R16-2 c GTG(C/G) GG(A/C)TGGATCACCTCCT NRb none NR 23 4-MCGpR21 c GCATCCACCA(A/T)A(AFF)AC(CFF)CTT NR~ 23 1-F1 ~ ACACCATGGGAG(CFF)TGGTAAT NRb none NR 24 2-R1 ~ CTTC(A/T)TCGACTT(CFF)CAGACCCAAGGCAT NRd 24 3-F2~ GTG(C/G) GG(A/C)TGGATCACCTCCT NRb none NR 24 4-R2 c GCATCCACCA(A/T)A(A/T)AC(CFF)CTT NRa 16 1-Myco 9 ~ (CFF)GCCTG(AJG)GTAGTA(CJT)(A/G) (TIC) (T/A) CGC NRb none NR 16 2-Myco 3 c GCGGTGTGTACAA(G/A)(A/C) CCCGA 16 3-Myco 8 ~ TGGTGCA(T/C) GGTTGTCGTCAG NRb none NR 16 4-Myco 5 ~ GAACGTATTCACCG(C/T)(A/G) (G/A) (CFF) (A/G)T(A/G) NRb 16 1-My 1 GCTGTGTGCCTAATACATGCAT 41-62 b'e none none 18 2-My 2 TGGTAGACAGTGAGACAATTGGAG 1013-1036 b'e 18 1-Molli 1 TACGGGAGGCAGCAGTA 343-359 b'f A. laidlawii Clostridia 21 2-Molli 2a TCAAGATAAAGTCATTTCCT 463-482 b'f 21 1-Molli 1 TACGGGAGGCAGCAGTA 343-359 b'f Mycoplasma none 21 species 2-Molli 2b TACCGTCAATITITAATITIT 451-471 b'f none 21 1-RNA5 AGAGTTTGATCCTGGCTCAGGA 10-31 f Gram-positive bacteria 2 19 2-RNA3 ACGAGCTGACGACAACCATGCAC 1068-1043 f none 19 1-GPO-3 GGGAGCAAACAGGATTAGATACCCT 774-798f prokaryotes NR 25 2-MGSO TGCACCATCTGTCACTCTGTTAACCTC 1029-1055 f 25 a(1-/2-) Primer pairs for one-step PCR or outer primers for nested PCR; (3-/4-) inner primers for nested PCR. b16s rRNA gene. CParentheses indicate nucleotide degeneration. (NR) Not reported. d23S rRNA gene. eUsing M. fermentans 16S rDNA as a reference. fRelative to Escherichia coli 16S rDNA nucleotide sequence. gLow G + C Gram-positive bacteria.

200 PCR Methods and Applications Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

TABLE 2 Species-specific Primers for Identification by PCR of Mycoplasma-contaminated Cell Culture

Primer Site on Species designation Sequence 5' ~ 3' 16S rRNAa specificity Reference ARG2b TCAACCAGGTGTTCTTTCCC 460-440 M. arginini 19 ACH3b AGCCGGACTGAGGGTCTAC 277-296 A. laidlawii 19 FERb AAGAAGCGTTTCTTCGCTGG 203-222 M. fermentans 19 HYOb GAAAGGAGCTTCACAGCTTC 198-217 M. hyorhinis 19 ORAb GGAGCGTTTCGTCCGCTAAG 199-218 M. orale 19 PIRb GTCCGTTTGGACCGCTATAG 203-222 M. pirum 19 SALb GCTGCGTCAACAGTTCTCTG 849-830 M. salivarium 19 PNEU-GENb CCTGCAAGGGTTCGTTATTT 204-223 M. pneumoniae/ M. genitaliurn 19 moli2bc TACCGTCAATITFTAATITT 451-471 A. laidlawii 21 p1 c AAGGACCTGCAAGGGTTCGT NR M. pneumoniae 22 p2c CTCTAGCCATTACCTGCTAA NR M. pneumoniae 22 p1 o TGAAAGGCGCTGTAAGGCGC NR M. hominis 22 p2 o GTCTGCAATCATTTCCTATTGCAAA NR M. hominis 22 p1 e GAAGCCTTTCTTCGCTGGAG NR M. fermentans 22 p2 e ACAAAATCATTTCCTATTCTGTC NR M. fermentans 22 p1 f AGCGTTTGCTTCACTTTGAA NR M. pulmonis 22 p2 f GGGCATTTCCTCCCTAAGCT NR M. pulmonis 22 RNA2b TTCTATAGCTTTGCCAAG NR M. pirum 26 Phyob TTCACAGCTTCACTTAAAA 207-225 M. hyorhinis 18 Pora b GCGTTTCGTCCGCTAAGA 202-219 M. orale 18 Pacho b AACACATVFAAAGATTTA 189-206 A. laidlawii 18 Psalb GGGCCTTTAAAGCTCCAC 200-217 M. salivarium 18 Pargb GCGAGGTTCTTTTGAACC 68-85 M. arginini 18 Pferb TTTCTTCGCTGGAGGAGCG 206-224 M. fermentans 18 aIUB E. coli 16S rRNA position. bUsed with a genus-specific primer to perform PCR. c-fPrimer pairs used together to perform PCR. (NR) Not reported.

closely related to mollicutes phylogenet- mollicute DNA among the eukaryotic patible. ~31~ Several recent PCR-based ically, but did not amplify all mollicute gene material. Primer design is one of methods of diagnosing cell culture infec- species, especially A. laidlawii (Table the most important factors affecting the tion by mollicutes detected both molli- 1). ~2~ The initial divergence of molli- quality of PCR. Primer selection criteria, cutes and bacteria that are closely related cutes from their clostridial ancestors has like the adjustment of PCR conditions, phylogenetically to mollicutes. ~ been shown to involve the Acholeplasma such as temperature, duration of PCR Nevertheless, when compared with branch. 05) steps, and composition of the reaction more specific methods that fail to am- A commercial mollicute detection mixture, may improve the reaction sen- plify several mollicute species, ~26) these method uses specific primers to detect sitivity and specificity considerably. An recent methods seem more convenient heterogeneity within the mollicute tRNA alignment study of specific nucleotide for the purpose of detecting cell line gene cluster. ~28~ Another original ap- sequences showing mollicute genus- and contaminants. This is because the cross- proach has been developed by Harasawa species-specific regions (see above) is a reacting bacteria, such as Clostridium in- and co-workers. ~23'29~ They showed that useful tool when selecting a primer pair nocuum and Clostridium ramosum, are amplification of the 16S-23S spacer re- and predicting its specificity properties. never found as cell culture contami- gion in rRNA operons of mollicutes, us- In contrast, a trial-and-error approach by nants. Furthermore, in the field of rou- ing primers for the flanking 16S and 23S new combinations of primers derived tine detection of cell culture contami- structural genes, is a highly specific ap- from slightly different positions of the nants, false-negative results must be proach leading to the identification of original target gene sequences is neces- avoided more than false-positive results contaminant mollicutes, especially sary to improve the sensitivity properties because of cross-reactions with bacteria when followed by restriction analysis of a primers pair, because so far there is that diagnose a nonmollicute but a (Table 1). (24) no means of predicting such sensitiv- prokaryotic infection of cell lines. Thus, ity. (30) when setting up PCR, one should give Setting Up Amplification The efficacy of PCR is measured by its priority to one of the three parameters specificity, efficiency, and fidelity. The mentioned above and optimize the PCR Sufficient sensitivity and specificity of ideal PCR with high specificity, effi- according to the application (detection PCR are prerequisites for its use in the ciency, and fidelity is difficult to set up and/or identification of contaminants). diagnosis of mollicute infection of cell because the conditions for maximizing Each of the three parameters is influ- lines, for detecting small amounts of these parameters are sometimes incom- enced by the components of the PCR.

PCR Methods and Applications 201 Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press Review lllllll

Apart from template and primer design cially if PCR products and contaminat- cultivation of cells to be assayed in the (see above), numerous other compo- ing DNA fragment are short in length. diagnostic laboratory. Therefore, in the nents are very important for optimizing Others have eliminated DNA contamina- case of specific culture media (e.g., insect PCR: reaction mixture [i.e., standard tion by the use of photochemical (isop- cell cultures), the latter must also be pro- buffer for DNA polymerases, pH, con- soralen) and enzymatic (uracil N-glyco- vided. The handling of samples could be centration of Mg2+, gelatin, Triton sylase) methods effective on PCR problematic and increases the risk of X-100, spermidine, tetramethylammo- amplicons of >100 bp. (3s'4s-47) Walder bacterial and fungal contamination, be- nium chloride (TMAC), dimethylsulfox- and co-workers prevented cross-contam- cause cells must be cultivated without ide (DMSO), glycerol, formamide, min- ination associated with PCR by the use of antibiotics (see below). PCR requires eral oil], PCR cycles (number of steps, primers that contain a 3'-terminal ribose only a small amount of DNA, so I ml of duration of steps, number of cycles, tem- residue. (48) No sterilization protocol is cell cultures can serve to perform several peratures, ramp times), DNA poly- likely to be 100% efficient; therefore, PCR assays, van Kuppeveld et al. (2s) dem- merases (e.g., Taq, Vent, Pfu, Tth), dNTP, good laboratory practices are highly rec- onstrated that a PCR assay for the detec- phase of PCR, and so forth. Alternate ommended. tion of mycoplasmas contaminating cell PCR procedures have also been used to Inhibition of the amplification reac- cultures can be performed on lyoph- optimize parameters. To enhance sensi- tion because of the presence of trace ilized materials. Thus, sample storage tivity, reverse transription-PCR (RT- contaminants in samples has been de- and transport to reference laboratories PCR), which consists of reverse tran- scribed previously as a source of false- are simplified. In addition, cell cultures scription of high copy number rRNA to negative results, (45) which is another ob- can be stored frozen for a long time cDNA that is subsequently amplified, (2z) stacle to the diagnostic use of PCR. To without altering the amplification effi- and nested PCR, which consists of a dou- demonstrate that the reaction is work- ciency. Similar amplification results ble-step PCR using internal primers to ing, one can apply multiplex amplifica- were obtained with fresh samples and amplify the first-step PCR prod- tion where an additional primer set, spe- those stored at -20~ for 11/2 years (G. uct O6'2~ have been applied. A three- cific for a host gene or for a control Rawadi and O. Dussurget, unpubl.). As primer PCR approach (32) has been ap- plasmid, is added. One limitation is that PCR can be achieved with frozen and plied for mollicute detection to enhance the two distinct PCRs possess different lyophilized materials, this offers a means specificity. (z7) Numerous reviews and efficiencies. Moreover, there is no con- for a retrospective analysis. books have been published on the set- trol for the omission of the primers am- At present, before submitting cell cul- ting up of PCR, describing general prin- plifying the target DNA. Another com- tures for mycoplasma diagnosis by con- ciples that can be applied to mollicute monly used approach is the addition of a ventional methods, cultivating cells in detection.(31'33--39) control template engineered by deletion antibiotic-free culture media for at least or insertion that produces a shorter or 2 weeks is required. (s~ This measure longer fragment than the authentic DNA may not be obligatory for mycoplasma Problems and Troubleshooting fragment using the same primer set. This diagnosis by PCR. Streptomycin, an an- Because PCR can generate 106 DNA cop- approach is not a true positive control tibiotic widely used in cell culture me- ies from a template sequence, false pos- because one can omit the sample DNA dia, is known to bind to DNA and can be itivity attributable to contaminating nu- being tested. Low-stringency PCR is a re- expected to interfere with Taq poly- cleic acids from a previous PCR reaction cent method that provides an internal merase. However, we did not observe (carryover), exogenous DNA, or other control for negative results. (49) When any differences in amplification effi- cellular material is a problem in diagnos- the primer set is used under low-strin- ciency when PCR is performed on cells tic application. To avoid PCR product gency conditions, this technique leads to cultivated with or without antibiotics (G. (amplicons) carryover, one can take spe- amplification of the specific DNA se- Rawadi, unpubl.). Nevertheless, cell cul- cific precautions, including (1) preali- quence (e.g., mollicutes), if present, and tures treated with mycoplasma removal quoting reagents, using positive dis- of nonspecific eukaryotic DNA found in agent, (MRA, ICN) should be passaged in placement-dedicated pipettes or tips the sample. However, at low concentra- culture media free of this antibiotic prior with cotton plugs, (2) physically separat- tions of specific template, the problem to PCR assay, as cell cultures treated with ing the reaction preparation from the in distinguishing the specific band from MRA have been observed to inhibit am- area of reaction product analysis, (3) us- low-stringency products arises and the plification (D. Roulland-Dussoix, pers. ing autoclaved solutions, (4) changing presence of numerous bands may com- comm.). gloves, (5) avoiding splashes, (6) premix- plicate the readout. The use of PCR-based methods for ing reagents, adding DNA last, and (7) mycoplasma detection in cell cultures will facilitate sample handling consider- choosing positive and negative controls TRANSPORT AND STORAGE OF carefully. (4~ Multiple negative controls ably and reduce transport cost and in- SAMPLES are necessary to monitor and reveal con- convenience. tamination. Numerous "sterilization" Diagnosis of mollicutes contaminating methods have been described. Several cell cultures is usually performed in spe- investigators have used nucleases, UV cialized and reference laboratories. Thus, SAMPLE PREPARATION light, (41,42) or ~/-irradiation (43) to inacti- applicant laboratories have to transport vate contaminants in solution (or on their cell cultures under adequate condi- Pre-PCR preparation influences subse- surfaces in the case of UV), (44) but all of tions to be tested. Conventional myco- quent PCR analysis significantly. Al- these protocols have limitations, espe- plasma detection methods require the though PCR-based methods for myco-

202 PCR Methods and Applications Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

plasma detection have been described at be sterilized by UV irradiation (see Prob- where laboratories are not accustomed length, few investigators deal with lems and Troubleshooting above). r to the handling of radioactive products, prePCR sample preparation. A large Southern blot analysis can be performed number of methods for the isolation of with biotinylated probes. highly purified nucleic acids are suitable MYCOPLASMA DETECTION AND The 16S-23S spacer region in rRNA for use in PCR and mainly for PCR de- IDENTIFICATION BY PCR-BASED operons has also been used as an ampli- tection of mycoplasmas. However, the METHODS fication target for mycoplasma detec- traditional DNA extraction methods are tion. ~z9~ This nested PCR approach has Mycoplasma detection not adapted to the processing of a large been shown to be suitable for myco- number of samples. Blanchard et al. (26) showed that it was plasma detection in cell cultures. ~z3'24~ Protocols described as quick and easy possible to utilize 16S rRNA genes to de- The reported one-step PCR-based for the isolation of DNA suitable for tect mollicutes by PCR amplification. methods involve primer sets that anneal use in PCR have been applied success- The method described by these investi- to almost all mollicutes. As discussed fully for prePCR sample prepara- gators is not appropriate for the detec- previously, Acholeplasma species is prob- tion. (18'19'26'27) These simplified meth- tion of mollicutes contaminating cell lematic for mollicute primer design. To ods involve the use of proteinase K in the cultures because strains currently iso- achieve reliable detection of myco- PCR buffer to release DNA from cells. lated from cell cultures are not amplified plasma in cell cultures, this species Proteinase K has the advantage of being (e.g., M. hyorhinis). Thus, they focused should be amplified. Two primer sets for relatively heat stable in the mid-temper- their efforts on the development of PCR PCR, one for the specific detection of Ac- ature range (50--60~ yet is thermally protocols used specifically for myco- holeplasma and a second for the detec- inactivated easily at 95~ The use of plasma detection in cell cultures. tion of the other mollicutes species, have ionic detergent, such as SDS, in the lysis Several PCR methods based on 16S been described. ~zl~ However, suitable buffer must be avoided because it is not rDNA amplification have been de- primers have been shown to allow Ac- compatible with Taq polymerase at any scribed. These methods involve one- or holeplasma as well as Mycoplasma species useful level. Nonionic detergent (e.g., two-step nested PCRs. Spaepen et al. r176 amplification in the same PCR run. In an NP-40, Laurenth-12, Tween 20) at 0.5% is and Hopert et al. r described distinct attempt to develop protocols to amplify compatible with Taq polymerase activ- nested PCR protocols. The method de- mollicutes-contaminating cell cultures, ity. ~sl~ Diethylpyrocarbonate (DEPC) veloped by Spaepen et al. consists of the including Acholeplasma, care should be prevents the degradation of DNA and amplification of bacterial 16S rDNA in taken to avoid cross-reactivity with other RNA by nucleases and can be added to the first round of PCR. Nested PCR was bacterial DNA. Although the method de- lysis buffer to improve the pre-PCR sam- then performed with mollicute-specific scribed by Deng et al. ~ss~ amplifies sev- ple preparation protocol. However, primers to detect this contamination. A. eral mollicute species (including Achole- DEPC was reported render to PCR inef- laidlawii, a common contaminant of cell plasma), it also surprisingly amplifies fective. (33~ The pre-PCR protocols also cultures, was not amplified correctly by DNA from plant tissue. Moreover, the can be improved by adding glass powder this method. The detection of bacterial latter techniques have been shown to to cell lysates, as described by Yamada et contamination of cell cultures is not cross-react with Clostridia. ~zl,ss~ Proto- al. (s2~ Glass powder specifically binds problematic in that it can be spotted vi- cols for specific amplification of molli- nucleic acid molecules and can be sepa- sually. However, culture media are usu- cutes commonly found in cell cultures rated from the lysate by centrifugation. ally supplemented with antibiotics; thus, (including Acholeplasma) and additional DNA or RNA can then be recovered by they may be contaminated with DNA Mycoplasma species rarely isolated (e.g., heating at 55~ from eradicated or dormant bacteria. M. bovis, M. pirum, and M. hominis) have The mere boiling of samples was also Given the high sensitivity of PCR, such been described. (18,19,22) van Kuppeveld used to release DNA from mollicutes an approach may lead to a false-positive et al. (22) reported primers that were ca- prior to PCR amplification. (21~ However, diagnosis. Moreover, it is well docu- pable of amplifing members of Ure- it has been shown that prolonged heat- mented that the use of nested PCR in- aplasma and Spiroplasma species as well. ing of DNA reduces the efficiency of its creases the risk of nonspecific amplifica- Using similar protocols, we did not ob- amplification. Therefore, we believe that tion. The second nested PCR protocol serve cross-reactivity with any of a series the proteinase K protocol is more appli- was shown to be apparently mollicute- of Gram-negative or Gram-positive bac- cable. specific in both PCR steps. ~ Similar re- teria, including Clostridia, even at 106 A point that should be considered in sults (positive or negative diagnosis) bacteria/ml. (18) These methods ~ the pre-PCR sample preparation step is were obtained in first- and second-round were validated by diagnosis of a large that extreme care must be taken to avoid PCR. Nevertheless, the second PCR run number of cell cultures and were capable false-positive results. False positives can was shown to increase the sensitivity of of detecting all of the contaminating result from sample-to-sample contami- detection in a serial dilution assay of in- mollicutes when compared to conven- nation. A more serious source of con- fected samples. Southern blotting of PCR tional methods. tamination is the carryover of DNA from products and hybridization with a spe- previous amplifications of the same tar- cific radiolabeled internal probe is more Mycoplasma Identification get. Thus, procedures to minimize the suitable to improve the sensitivity of my- risk of false-positives results should be coplasma diagnosis. In this way, such Identification of mollicute species con- followed strictly. ~s3~ In addition, re- sensitivity could be increased up to 10- taminating cell cultures can also be agents used for sample preparation can fold. ~s'22'27~ Furthermore, in cases achieved by PCR amplification using

PCR Methods and Applications 203 Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press Review llll|ll

species-specific primers. (18'19'22'26) Sam- comparing published 16S rDNA genes al- sure repeatability and reproducibility. ples that appear to be infected with lows the identification of the contami- However, two significant problems that mollicutes, using genus-specific PCR am- nated species. The standard sequencing have arisen from the wide use of PCR plification, can be submitted to a spe- technique is time consuming; therefore, technology should be considered: (1) the cies-specific PCR to identify the con- semiautomated systems using biotiny- presence of polymerase inhibitors in taminant. The identification may be lated primers and solid-phase sequenc- some cell cultures, and (2) DNA carry- performed by combining a genus-spe- ing of PCR products have been de- over contamination. This leads to false- cific primer and a species-specific scribed (sT) and shown to be useful for negative or false-positive diagnosis, re- primer. Therefore, PCR amplifications mycoplasmic 16S rDNA sequencing. (sS) spectively. Since the inception of PCR, should be conducted on each contami- The association of mollicute genus-spe- users pointed out the occurrence of car- nated sample using available species-specific PCR amplification and sequencing ryover contamination owing to the cific primers. should prove to be a valuable technol- abundance of DNA generated by PCR Typical contaminating species (i.e., ogy for discriminating all mycoplasma amplification. Cautions that should be M. hyorhinis, M. orale, M. fermentans, M. contaminations. taken to prevent this problem are well salivarium, M. arginini, and A. laidlawii) Analysis of restriction fragment documented and have been discussed cause 98% of infection. This should be length polymorphism (RFLP) of the 16S above. considered when performing PCR to rDNA amplified segments was used to The real nature of the polymerase in- identify these cultures, in that species- identify mollicute species. (s4) Restriction hibitors found in some cell cultures is specific primers of these contaminants enzyme digestion time can be reduced not well known. This problem has been systematically have to be used first. PCR considerably, up to minutes, by utilizing reported in mycoplasma PCR-based as- identification results of contaminated a microwave oven. (sg) RFLP analysis of say. (19) The presence of such inhibitors mollicutes displayed this same preva- the 16S-23S intergenic amplified frag- in tested samples could be detected by lence (Table 3). (18,19.25) In rare cases, ment was also developed for species using multiplex amplification. A low when mycoplasma contamination is de- identification. (23'24). However, RFLP pro- stringency (LS)-PCR-derived method tected by mollicute-specific PCR meth- files are established mainly from type has been developed in our laboratory ods, species-specific PCR failed to iden- strains, and variation of these profiles that involves decreasing the primer an- tify the contaminating mycoplasmas may occur between strains within the nealing temperature by 3~ (i.e., from (2%; see Table 3). (18'19) However, in same species. Thus, interpretation of 55~ to 52~ In case of contaminated these cases, employing species-specific RFLP results should be confirmed by cell cultures, primer pairs match specifi- primers for mycoplasma rarely found in other identification methods. cally to mycoplasmic 16S rDNA yielding cell cultures (e.g., M. pirum, M. bovis, and the expected size fragment exclusively, M. horninis) did not resolve the identifi- whereas in mycoplasma-free samples, PCR Controls cation, van Kuppeveld et al. (2s) detected mismatched priming throughout eu- only 1 M. pirurn isolate among 67 con- All reports are consistent with the fact karyotic DNA results in nonspecific am- taminated cell cultures (Table 3). that PCR is the most sensitive, specific, plification (Fig. 2). This was tested in Amplicons from mollicute genus-spe- and reliable method for mycoplasma de- >100 cell cultures and was found to pro- cific PCR amplification can be cloned tection. This technique could be sub- vide a reliable and simple method to ver- easily using the TA cloning system, (s6) jected to automation, thus allowing the ify negative diagnosis. and the variable 16S rDNA region can analysis of a large number of samples also be sequenced. Sequence analysis by under the same conditions, which en- COMPARISON OF PCR WITH CONVENTIONAL METHODS FOR THE TABLE 3 Prevalence of Mycoplasma-contaminated Cell Cultures Determined by DETECTION OF MYCOPLASMAS PCR-based Diagnosis The first isolation of mycoplasma from a Ref. 18 Ref. 19 Ref. 43 contaminated cell culture goes back to Total number of cell cultures tested 114 372 104 1956. (60) The development of in vitro Percentage of contaminated cell culture as a tool for basic research cell cultures 31 23 64 highlighted the problem of contamination with mollicutes. In the years that Species identification M. arginini 57% 11.6% 32.8% followed, numerous direct or indirect M. hyorhinis 17% 51.2% 37.3% methods for the detection of mycoplas- M. fermentans 0 11.6% 7% mas in cell cultures have been devel- M. orale 23% 15.1% 17.9% oped. A. laidlawii 0 1.2% 2.9% Direct methods consist primarily of M. pirum 0 0 1.5% microbiological cultivation procedures Mixed contamination a 0 7% 0 with specific media. Although this Unidentified speciesb 3% 2% 0 method is considered to be the most sen- aCell cultures contaminated by more than one mycoplasma species. sitive and specific, cultivation for t>10- bMycoplasma contamination detected by mollicute-specific PCR, but not identified by species- 14 days is necessary to obtain results. specific PCR. Moreover, some Mycoplasma species

204 PCR Methods and Applications Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

methods involve microscopy observa- hyorhinis, M. orale, M. arginini, and A. tion (e.g., fluorochrome DNA staining, laidlawii). The ELISA technique is more electron microscopy), ELISA, biochemi- appropriate for mycoplasma identifica- cal assays [e.g., adenosine phosphorylase tion than for mycoplasma detection. (AdoP) activity], and molecular biologi- This short inventory of conventional cal tests (e.g., DNA-DNA hybridization and commonly used assays for the detec- and PCR-based assays described in this tion of mycoplasma infection in cell cul- review). Some methods based on the tures shows that there is no standard modulation of thymidine incorporation method. At least two or three techniques by proliferating cells have been de- should be conducted on the same sam- scribed for the detection of mycoplasma ple to obtain a reliable diagnosis. Molec- infection. (61'62) These techniques are ular biological tests, that is, DNA-DNA rarely used in diagnostic laboratories be- hybridization and PCR amplification, cause the proliferation of cells may be surpass all of these conventional meth- stimulated or inhibited by several com- ods in reliability and sensitivity. DNA- ponents that might be present in the su- DNA hybridization is based on either 16S pernatants of cell cultures. Thus, the rRNA or 23S rRNA gene hybridiza- observed effects are not necessarily cor- tion. (66'67) These methods are quite rapid related to mycoplasma infection. but have been shown to cross-react with DNA fluorochrome staining is used gram-positive bacteria, especially the widely for mycoplasma detection in cell H900 probe, yielding nonspecific hy- cultures. (63) This technique, as well as bridization. (66) The detection limit of the the AdoP activity-based assay, requires hybridization assay is 103-104 organ- the use of a permanent indicator cell line isms; thus, it is not suitable for monitor- free of mollicutes (e.g., Swiss albino ing eradication of mycoplasma contam- mouse embryo fibroblast-3T6 cell line, ination or for the detection of the onset Vero cell line). Indicator cells are cul- of contamination. Moreover, this tech- tured with 100- to 200-1~1 of the speci- nique requires the use of a radioactive mens to be tested under adequate condi- element that may be problematic for tions, and stained with fluorochrome safety and regulatory reasons. (e.g., Hoechst 33258). Mollicutes are de- In our hands, no false-negative or FIGURE 2 Mycoplasma detection in cell cul- tected under epifluorescence micros- false-positive results were observed using ture by LS-PCR-derived technique. Cell cul- copy as extranuclear fluorescent bodies. PCR-based methods. Similar observa- tures were diagnosed for mycoplasma con- AdoP activity assay is based on the ob- tions were made by the vast majority of tamination as described previously, (18) except servation of cell toxicity induced by the reports dealing with the PCR detection that annealing temperature was shifted from degradation of 6-methylpurine deoxyri- of mycoplasmas when compared with 55~ to 52~ (A) Ten microliters of amplified boside (6-MPDR) to 6-methylpurine ri- classic methods, including DNA-DNA product was analyzed by 1.5% agarose gel bose. (64) Samples (100-200 i~1) are added hybridization. (16'1s'19'21'22) A PCR assay electrophoresis. Amplified products were detected under UV fluorescence after ethidium with 6-MPDR to indicator cell culture, is more specific than other assays when bromide staining. (Lane 1) Rat basophilic leu- and incubated under adequate con- the primers used are chosen purpose- kemia (RBL)-contaminated cell line; (lane 2) ditions for 48-72 hr; cells are then fully. This assay does not require the cul- RBL mycoplasma-free cell line; (lane 3) Chi- observed using classic microscopy for tivation of mollicutes; thus, it can over- nese hamster ovary (CHO) mycoplasma-free cell toxicity. Both of these methods come the problem of uncultivatable cell line; (lane 4) U937 mycoplasma-free cell give false-positive or false-negative re- strains. The sensitivity of PCR-based line; (lane 5) no DNA; (lane M) molecular suits.(3,18) methods was shown to be as little as a weight marker (pBR328-BglI, Hinfl). Only in- Electron microscopy (i.e., scanning single organism per milliliter(2z) or 1 or- fected cell cultures yielded a specific band at and transmission electron microscopy), ganism/103 cells in mock-infected cul- the expected size (1000 bp, arrow), whereas in mycoplasma-free cell cultures nonspecific a traditional technology, needs specific tures. (is) The sensitivity of the PCR diag- fragments were generated. (B) The specificity equipment and a trained staff. Although nosis could be increased 10-fold by of the amplification was tested by Southern these techniques have been applied for analyzing the amplified materials by blot analysis of the same samples with a radi- the detection of mollicutes, (6s) they can Southern blot. Usually, cells are heavily olabeled internal probe as described previ- hardly be used as routine tests. Thus, infected at the level of -100 organisms/ ously. (18) their use is focused on mycoplasma basic ml of cell culture. (13) Nevertheless, the research. sensitivity of the PCR assay also allows ELISAs are easy to perform but have the detection of early contamination been also shown to produce false-nega- and the monitoring of MRA treatment of (i.e., M. hyorhinis) cannot be cultivated tive results. ~ This is because of part infected cultures. In addition, this high and consequently remain undetected by to the relatively weak sensitivity of this sensitivity provides a means for detect- these methods. Until now, these proce- technique. Moreover, commercially ing mollicutes in commercial animal dures are regarded as the standard for the available ELISA detection kits mainly ad- sera, a serious source of contamina- validation of new techniques. Indirect dress certain mollicute species (i.e., M. tion. (27) Altogether, PCR is superior to

PCR Methods and Applications 205 Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

most classical methods developed for tamination in cell cultures have been cell cultures in the Netherlands. Antonie the detection of mycoplasmas in cell cul- published recently. (16-19'21'49) From in- Leeuwenhoek. J. Microbiol. 53: 107-118. tures and should prove to be the tech- dividual studies reviewed, it can be con- 6. Uphoff, C.C., S. Brauer, D. Grunicke, S.M. nique of the future. cluded that PCR provides a rapid, sensi- Gignac, R.A.F. Mac Leod, H. Quentmeier, K. Steube, M. T/immler, M. Voges, B. tive, and reliable method for detecting Wagner, and H.G. Drexler. 1992. Sensitiv- and identifying mollicutes in cell cul- CONCLUSION ity and specificity of five different myco- tures. Although there is no standard for plasma detection assays. Leukemia Mollicute-infected cultures are them- the detection of mollicute contamina- 6: 335-341. selves the major source of infection of tion of cell cultures, projects to establish 7. Arai, S., R. Harasawa, T. Ohno, M. Takeu- cell cultures. Guidelines have been pub- standard methods and protocols are cur- chi, K. Hikizi, N. Kobayashi, I. Lee, K. lished that form the basis of an efficient rently in development. Arai and co- Kato, H. Takahashi, I. Okamoto, and T. quality control program for the preven- workers have already presented a 3- year Furudera. 1994. Comparative studies to tion of mollicute infection of cell cul- study for evaluating methods, especially detect mycoplasma contamination in tures, (13~ including acquisition of cell PCR, to detect mollicute contamination bioindustrial materials, for validating standard method. Int. Organ. Mycoplas- lines from reputable cell collections, re- in industrial biological materials. (7~ mol. Lett. 3: 48-49. ception in the laboratory and quarantine Standardization in PCR procedures is 8. McGarrity, G.J., H. Kotani, and D. Carson. until sterility is attained and mollicute needed to ensure reliable results and to 1986. Comparative studies to determine tests have been performed (as for media avoid variation in results among differ- the efficiency of 6 methylpurine deoxyri- components, especially serum), periodic ent laboratories, which is crucial when boside to detect cell culture mycoplas- mollicute detection assays (at least quar- PCR is used as a diagnostic tool. (7~ The mas. In Vitro Cell. Dev. Biol. 22: 301-304. terly), preservation of the mollicute-free International Research Program on 9. McGarrity, G.J., H. Kotani, and G.H. But- cell culture in liquid nitrogen, use of an- Comparative Mycoplasmology (IRPCM) ler. 1992. Mycoplasmas and tissue culture tibiotic-free media to prevent undetec- is also currently performing an interna- cells. In Mycoplasmas. Molecular biology ted infections, especially in stock cul- tional multicenter collaborative trial to and pathogenesis (ed. J. Maniloff, R.N. McElhaney, L.R. Finch, and J.B. Base- tures, and disinfection of working evaluate PCR-based diagnosis of molli- man), pp. 445-454. American Society for surfaces. Attempts to eliminate mollicute infection of cell cultures. This trial Microbiology, Washington, D.C. cutes from contaminated cells should be will provide useful data to assess the re- 10. Barile, M.F. and S. Rottem. 1993. Myco- considered only as a last resort. It is often liability of PCR and to develop PCR stan- plasmas in cell cultures. In Rapid diagnosis better to destroy the infected culture by dards, leading to large-scale validation of of mycoplasmas (ed. I. Kahane, and A. autoclaving and replacing it with a mol- this powerful technology applied to the Adoni), pp. 155-193. Plenum Press, New licute-free stock culture. However, when diagnosis of cell culture infection. York. the infected cell culture is irreplaceable, 11. Somerson, N.L. and B.C. Cole. 1979. The the following procedures can be used to mycoplasma flora of human and nonhu- ACKNOWLEDGMENTS eliminate mollicutes: (7'1~ treatment man primates. In The mycoplasmas (ed. J. G. Tully, and R. F. Whitcomb), vol. 2, pp. with anti-mollicute antisera, passage We thank Dr. R. Harasawa and Dr. D. 191-216. Academic Press, New York. through mice, exposure to murine mac- Roulland-Dussoix for their critical read- 12. Gabridge, M.G. and D. J.Lundin. 1989. ing of this manuscript. We acknowledge rophages, treatment of cells with 5-bro- Cell culture user's guide to mycoplasma de- mouracil or merocyanine 540 and Ho- Dr. D. Lecaque for helpful electron mi- tection and control. Bionique Laboratories, echst 33258 followed by exposure to croscopy assistance. New York. light, (68,69) prolonged heat treatment, 13. McGarrity, G.J. and H. Kotani. 1985. Cell culture mycoplasmas. In The mycoplasmas and selective killing with antibiotics [ty- REFERENCES losin, spectinomycin, tiamulin, minocy- (ed. S. Razin, and M. Barile), vol. 4, pp. clin, gentamycin, neomycin, kanamy- 1. Tully, J.G. 1992. Mollicutes. In Encyclope- 353-390. Academic Press, New York. cin, novobiocin, thialine, quinolones, dia of microbiology (ed. J. Lederberg), vol. 14. Saiki, R.K., D.H. Gelfand, S. Stoffel, S.J. 3, pp. 181-191. Academic Press, New Scharf, R. Higuchi, G.T. Horn, K.B. Mullis, MRA (ICN), BM-Cyclin (Boerhinger York. and H.A. Erlich. 1988. Primer-directed en- Mannhiem), etc.], or mycoplasmacidal 2. Hay, R.J., M.L. Macy, and T.R. Chen. 1989. zymatic amplification of DNA with ther- drugs. Antibiotic treatment is the most Mycoplasma infection of cultured cells. mostable DNA polymerase. Science. common method, but it is time consum- Nature 339: 487-488. 239: 487-491. ing and its efficiency is variable depend- 3. B61ske, G. 1988. Survey of mycoplasma 15. Weisburg, W.G., J.G. Tully, D.L. Rose, J.P. ing on the resistance of the cell line to infections in cell cultures and a compari- Petzel, H. Oyaizu, D. Yang, L. Mandelco, J. toxicity and on the sensitivity of the con- son of detection methods. Zentralbl. Bak- Sechrest, T.G. Lawrence, J. van Etten, J. tainment to antibiotics. It has been teriol. Mikrobiol. Hyg. 269: 331-340. Maniloff, and C.R. Woese. 1989. A phylo- shown that some mollicutes possess in- 4. Pawar, V., J. Luczak, M.S. Cox, J. Dubose, genetic analysis of the mycoplasma: Basis tracellular parasitism properties (e.g., M. and J.W. HarbeU. 1994. Trends in the in- for their classification. J. Bacteriol. cidence and distribution of mycoplasma 171: 6455-6467. fermentans) and are therefore able to re- contamination detected in cell lines and 16. Hopert, A., C.C. Uphoff, M. Wirth, H. sist antibiotic treatments. None of these their products. Int. Organ. Mycoplasmol. Hauser, and H.G. Drexler. 1993. Specific- methods can be regarded as standard Lett. 3: 77. ity and sensitivity of polymerase chain re- and no irrefutable assay has been devel- 5. Polak-Vogelzang, A.A.,J. Brugman, and R. action (PCR) in comparison with other oped yet. Reijgers. 1987. Comparison of two meth- methods for the detection of mycoplas- Numerous comparative studies of ods for detection of Mollicutes (Myco- mas contamination in cell lines. J. Immu- methods for detecting mollicute con- plasmatales and Acholeplasmatales) in nol. Methods 164: 91-100.

206 PCR Methods and Applications Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

17. Penn, L., K. Leung, C. McDowell, and P. 23S spacer region in rRNA operons of my- on amplicon length and sequence com- Quinn. 1994. Evaluation of the poly- coplasmas by the polymerase chain position. J. Clin. Microbiol. 31: 2361- merase chain reaction for the detection of reaction. System. Appl. Microbiol. 15: 181- 2365. mycoplasma contamination of tissue cul- 186. 47. Persing, D.H. 1991. Polymerase chain re- ture cells. Int. Organ. Mycoplasmol. Lett. 30. He, Q., M. Marjam~iki, H. Soini, J. Mert- action: Trenches to benches. J. Clin. Mi- 3: 778--79. sola, and M. K. Viljanen. 1994. Primers are crobiol. 29: 1281-1295. 18. Rawadi, G., D. Lecaque, D. Pirot, and S. decisive for sensitivity of PCR. BioTech- 48. Walder, R.Y., J.R. Hayes, and J.A. Walder. Roman-Roman. 1993. Detection and niques 17: 82-87. 1993. Use of PCR primers containing a 3'- identification of mycoplasma contamina- 31. Cha, R.S. and W.G. Thilly. 1993. Specific- terminal ribose residue to prevent cross- tion in cell cultures by polymerase chain ity, efficiency, and fidelity of PCR. PCR contamination of amplified sequences. reaction. Methods Mol. Cell. Biol. 4: 147- Methods Applic. 3: $18-$29. Nucleic Acids Res. 21: 4339-4343. 156. 32. Kai, M., S. Kamiya, S. Sawamura, T. Ya- 49. Damas de Caballero, O.L.S., E.D. Neto, 19. Roulland-Dussoix, D., A. Henry, and B. mamoto, and A. Ozawa. 1991. Simplified M.C. Koury, A.J. Romanha, and A.J.G. Lemercier. 1994. Detection of mycoplas- method for confirmation of PCR prod- Simpson. 1994. Low-stringency PCR pro- mas in cell cultures by PCR: A one year ucts. Nucleic Acids Res. 16: 4562. vides an internal control for negative re- study. J. Microbiol. Methods 19: 127-134. 33. Coen, D.M. 1992. The polymerase chain sults in PCR-based diagnosis. PCR Methods 20. Spaepen, M., A.F. Angulo, P. Marynen, reaction. In: Current protocols in molecular Applic. 3: 305-307. and J.P. Cassiman. 1992. Detection of bac- biology (ed. F.M. Ausubel, R. Brent, R.E. 50. McGarrity, G.J., J. Sarama, and V. Vana- terial and mycoplasmal contamination in Kingston, D.D. Moore, J.G. Seidman, J.A. man. 1979. Factors influencing microbio- cell cultures by polymerase chain reac- Smith and K. Strhul), vol. 2, pp. 15.0.3- logical detection of mycoplasmas in cell tion. FEMS Microbiol. Lett. 99: 89-94. 15.1.7. Greene Publishing Associates/ culture. In vitro 15: 73-81. 21. Teyssou, R., F. Poutiers, C. Saillard, O. Wiley & Son, New York. 51. Gelfand, H.H. 1989. Taq polymerase. In Grau, F. Laigret, J.M. Bov~, and C. B~b~ar. 34. Dieffenbach, C.W., T.M.J. Lowe, and G.S. PCR technology: principles and applications 1993. Detection of mollicute contamina- Dveksler. 1993. General concepts for PCR for DNA amplification (ed. H.A. Eldrich), tion in cell cultures by 16S rDNA ampli- primer design. PCR Methods Applic. 3: pp. 17-22. Stockton Press, New York. fication. Mol. Cell. Probes 7: 209-216. $30-$37. 52. Yamada, O., T. Matsumoto, M. Nakash- 22. van Kuppeveld, F.J.M., J.T.M. van der 35. Erlich, H.A., D. Gelfand, and J.J. Sninsky. ima, S. Hagari, T. Kamahora, H. Ueyama, Logt, A.F. Angulo, M.J. van Zoest, W.G.V. 1991. Recent advances in the polymerase Y. Kishi, H. Uemura, and T. Kurimura. Quint, H.G.M. Niesters, J.M.D. Galama, chain reaction. Science 252: 1643-1651. 1990. A new method for extracting DNA and W.J.G. Melchers. 1992. Genus- and 36. Innis, M.A., D.H. Gelfand, J.J. Sninsky, or RNA for PCR. J. ViroL Methods 27: 203- species-specific identification of myco- and T.J. White. 1990. PCR protocols. Aca- 210. plasmas by 16S rDNA amplification. Appl. demic Press, San Diego, CA. 53. Kwok, S. 1990. Procedures to minimize Environ. Microbiol. 58: 2606-2615. 37. Oste, C. 1988. Polymerase chain reaction. PCR-product carry-over. In: PCR protocols: 23. Harasawa, R., H. Mizusawa, K. Nozawa, T. BioTechniques 6: 162-167. A guide to methods and applications (ed. Nakagawa, K. Asada, and I. Kato. 1993. 38. White, B.A. 1993. PCR protocols. Current M.A. Innis, D.H. Gelfand, J.J. Sninsky, and Detection and tentative identification of methods and applications. In Methods in T.J. White), pp. 142-145. Academic Press, dominant mycoplasma species in cell cul- molecular biology, vol.15. Humana Press, San Diego, CA. tures by restriction analysis of the 16S-23S Totowa, NJ. 54. Sarkar, G. and S. Sommer. 1990. More rRNA intergenic spacer regions. Res. Mi- 39. Wolcott, M.J. 1992. Advances in nucleic light on PCR contamination. Nature crobiol. 144: 489-493. acid-based detection methods. Clin. Mi- 347:340-341 24. Harasawa, R., H. Mizusawa, K. Nozawa, T. crobiol. Rev. 5: 370-386. 55. Deng, S., C. Hiruki, J.A. Robertson, and Nakagawa, K. Asada, and I. Kato. 1994. 40. Kwok, S. and R. Higuchi. 1989. Avoiding G.W. Stemke. 1992. Detection by PCR and Detection and identification of dominant false positives with PCR. Nature differentiation by restriction fragment mycoplasma species in cell cultures by re- 339: 237-238. length polymorphism of Acholeplasma, striction analysis of the 16S-23S rRNA in- 41. Ou, C.Y., J.L. Moore, and G. Schochet- Spiroplasma, Mycoplasma and Ureaplasma. tergenic spacer regions. Int. Organ. Myco- man. 1991. Use of UV irradiation to re- PCR Methods Applic. 1: 202-204. plasmol. Lett. 3: 68-69. duce false positivity in polymerase chain 56. Kovalic, D., J-H. Kwok, and B. Weisblum. 25. van Kuppeveld, F.J.M., K.E. Johansson, reaction. BioTechniques 10: 442-445. 1991. General method for direct cloning J.M.D. Galama, J. Kissing, G. B61ske, 42. Sarkar, G. and S. Sommer. 1990. Shedding of DNA fragments generated by PCR. Nu- J.T.M. van der Logt, and W.J.G. Melchers. light on PCR contamination. Nature cleic Acids Res. 19: 4650. 1994. Detection of mycoplasma contami- 343: 27. 57. Wahlberg, J., A. Holmberg, S. Berg, T. nation in cell cultures by a mycoplasma 43. Deragon, J.M., D. Sinnett, G. Mitchell, M. Hultman, and M. Uhl~n. 1992. Auto- group-specific PCR. Appl. Environ. Micro- Potier, and D. Labuda. 1990. Use of ~/ ir- mated magnetic preparation of DNA tem- biol. 60: 149-152. radiation to eliminate DNA contamina- plates for solid phase sequencing. Electro- 26. Blanchard, A., M. Gautier, and V. Mayau. tion for PCR. Nucleic Acids Res. 18: 6149. phoresis 13: 547-551. 1990. Detection and identification of my- 44. Cone, R.W. and M.R. Fairfax. 1993. Proto- 58. Petterson, B., K.E. Johansson, and M. coplasmas by amplification of rDNA. col for ultraviolet irradiation of surfaces Uhl6n. 1993. Direct automated solid FEMS Microbiol. Lett. 81: 37-42. to reduce PCR contamination. PCR Meth- phase sequencing in an in vitro amplified 27. Dussurget, O. and D. Roulland-Dussoix. ods Applic. 3: $15-$17. segment of 16S rDNA from bacteria. In 1994. Rapid, sensitive PCR-based detec- 45. Clewley, J.P. 1989. The polymerase chain Proceedings of the Sixth European Congress tion of mycoplasmas in simulated sam- reaction, a review of the practical limita- on Biotechnology (ed. L. Alberghina, L. ples of animal sera. Appl. Environ. Micro- tions for human immunodeficiencies vi- Frontali, and P. Sensi), pp. 359-362. biol. 60: 953-959. rus diagnosis. J. Virol. Methods 25: 179- Elsevier, Amsterdam, The Netherlands. 28. McKenzie, D. 1992. PCR-mediated detec- 188. 59. Jhingan, A.K. 1992. Microwave restriction tion of mycoplasma. Strategies 5: 65. 46. Espy, M.J., T.F. Smith, and D.H. Persing. enzyme digestion of DNA. Methods Mol. 29. Uemori, T., K. Asada, I. Kato, and R. Ha- 1993. Dependence of polymerase chain Cell Biol. 3: 270-274. rasawa. 1992. Amplification of the 16S- reaction product inactivation protocols 60. Robinson, L.B., R.H. Wichelhausen, and

PCR Methods and Applications 207 Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

B. Roizman. 1956. Contamination of human cell cultures by pleuropneumonia- like organisms. Science. 124: 1147-1148. 61. Alzani, R., R. Rossi, E. Cozzi, D. Trizio, and F. Marcucci. 1992. Detection of mycoplasma contamination through modulation (stimulation or inhibition) of thymidine incorporation by stimulated mouse spleen cells. J. Immunol. Methods 152: 35-42. 62. Sinigaglia, K., F. Scheidegger, D. Tal- madge, and G. Garotte. 1985. A sensitive and quantitative microassay for the detection of mycoplasma contamination: Inhi- bition of IL-2 dependent cell line pro- lifiration. ]. Immunol. Methods 76: 85-92. 63. Chen, T.R. 1978. In situ detection of mycoplasma contamination in cell cultures by fluorescent Hoechst 33258 stain. Exp. Cell. Res. 104: 255-262. 64. McGarrity, G.J. and D.A. Carson. 1982. Adenosine phosphorylase-mediated nu- cleoside toxicity. Exp. Cell. Res. 139: 199- 205. 65. Phillips, D.M. 1978. Detection of mycoplasma contamination of cell cultures by electron microscopy. In Mycoplasma infection of cell cultures (ed. G.J. McGarrity, D.G. Murphy, and W.W. Nichols), pp. 105-118. Plenum Press, New York. 66. Johanssen, K.E., I. Johanssen, and U.B. G6bel. 1990. Evaluation of different hybridization procedures for the detection of mycoplasma contamination in cell cultures. Mol. Cell. Probes 4: 33-42. 67. Johanssen, K.E. 1993. Detection and identification of mycoplasma with diagnostic DNA probes complementary to ribosomal RNA. In Rapid diagnosis of mycoplasma (ed. I. Kahane and A. Adoni), pp. 139-154. Ple- num Press, New York. 68. Marcus, M., U. Lavi, I. Nattenberg, S. Rot- tern, and O. Markovitz. 1980. Selective killing of mycoplasmas from contaminated mammalian cells in cell culture. Nature 285:659 69. Tarshis, M., A. Katzenel, and S. Rottem. 1993. Use of Merocyanine 540 and Ho- echst 33258 for the selective killing of contaminating mycoplasmas in cell cultures. J. Immunol. Methods 168: 245-252. 70. Bockstahler, L.E. 1994. Overview of international PCR standardization efforts. PCR Methods Applic. 3: 236-267.

208 PCR Methods and Applications Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press

Advances in PCR-based detection of mycoplasmas contaminating cell cultures.

G Rawadi and O Dussurget

Genome Res. 1995 4: 199-208

References This article cites 56 articles, 10 of which can be accessed free at: http://genome.cshlp.org/content/4/4/199.full.html#ref-list-1

License

Email Alerting Receive free email alerts when new articles cite this article - sign up in the box at the Service top right corner of the article or click here.

To subscribe to Genome Research go to: https://genome.cshlp.org/subscriptions