NIST Standards for Genetic Testing: Technologies Past, Present, and Future • Present – Applied Genetics Group to Consolidate Forensic DNA John M

December 1, 2008 NIST Standards for Genetic Testing

Presentation Overview

•Past – Extensive experience with developing forensic DNA reference materials and genotyping assays and NIST Standards for Genetic Testing: technologies Past, Present, and Future • Present – Applied Genetics Group to consolidate forensic DNA John M. Butler, Ph.D. with clinical genetics and agricultural biotech efforts National Institute of Standards and Technology – Work with genetic genealogy Biochemical Science Division/Applied Genetics Group • Future SACGHS – Planned genetic testing standards December 1, 2008

Congress Passed the DNA Identification Act of 1994 (Public Law 103 322) Checks and Controls on Forensic DNA Results Formalized the FBI's authority to establish a national DNA index for law enforcement purposes. Community FBI DNA Advisory Board’s Quality Assurance Standards (also interlaboratory studies) FBI’s DNA Advisory Board Laboratory ASCLD/LAB Audits and Accreditation Quality Assurance Standards Analyst Proficiency Tests & Continuing Education for Forensic DNA Testing Laboratories (October 1, 1998) Method/Instrument Validation of Analytical Performance (with aid of traceable reference materials) STANDARD 9.5 Protocol Standard Operating Procedure is followed The laboratory shall check its Data Sets Allelic ladders, positive and negative amplification DNA procedures annually or controls, and reagent blanks are used whenever substantial changes are made to the protocol(s) Individual Sample Internal size standard present in every sample against an appropriate and Interpretation of Second review by qualified analyst/supervisor available NIST standard reference Result material or standard traceable to Court Presentation Defense attorneys and experts with power of a NIST standard. of Evidence discovery requests

The Tools of DNA Typing and SRM Needs 2003: NIST SRM 2391b Driven primarily by commercial kit loci… • RFLP Testing (Late 1980’s) SRM 2390

– Radioactive Based Technology no – Chemiluminescent Based longer used

• PCR-Based Testing (Mid 1990’s) 2222 autosomalautosomal STRsSTRs –Dot-Blot SRM 2391..a..b characterizedcharacterized acrossacross –VNTR Growth area 1212 DNADNA samplessamples – STR (Fluorescent markers used today) • DNA Sequencing (Late 1990’s) SRM 2392, 2392-I Consumption of SRM 2391b has slowed because we – Mitochondrial DNA have encouraged labs to create NIST-traceable materials or only use portions of the SRM’s 12 components each • Y-Chromosome Testing (early 2000’s) SRM 2395 time when the annual calibrations are performed (i.e., to Growth area stretch out the use of one unit of SRM 2391b)

http://www.cstl.nist.gov/biotech 1 December 1, 2008 NIST Standards for Genetic Testing

Steps Involved Steps in Forensic DNA Analysis Short Tandem Repeat (STR) Markers Usually 1-2 day process (a minimum of ~5 hours) Collection Slot Blot 1 ng PCR primers anneal to unique sequences Specimen Storage 0.3 ng bracketing the variable STR repeat region PCR Product Size (bp) No DNA 0.5 ng 0.5 ng The overall PCR product size is measured Extraction 0.7 ng 1 ng Fluorescent PCR product size generated Blood Stain Buccal swab Allelic Ladder 1 ng dye Quantitation Sample Collection DNA DNA & Storage Forward DNA template Extraction Quantitation PCR primer containing STR marker Multiplex PCR

Biology Reverse STR Typing PCR primer If a match occurs, comparison of DNA profile to population allele Multiplex PCR Amplification Sample Interpretation frequencies to generate a case GATA GATA GATA GATA #1 report with probability of a random of Results DNA separation and sizing STR repeat region Genetics match to an unrelated individual

Database TCCCAAGCTCTTCCTCTTCCCTAGATCAATACAGACAGA Storage & Searching DNA AGACAGGTGGATAGATAGATAGATAGATAGATAGATA Sample #2 Database STR Typing GATAGATAGATAGATATCATTGAAAGACAAAACAGAGA Calculation of Search TGGATGATAGATACATGCTTACAGATGCACAC

Match Probability Technology Male: 13,14-15,16-12,13-10,13-15,16 = 11 GATA repeats (“11” is all that is reported) Interpretation of Results

Position of Forensic STR Markers Fluorescent dye-labeled Short Tandem Repeat (STR) Typing on Human Chromosomes primer STR Repeat Region 3′ TPOX 13 Core U.S. STR Loci 5′ 123456 (Maternal) D3S1358 3′ 5′ 12345678 (Paternal) TH01 1997 D8S1179 GATA D5S818 forward primer reverse primer VWA hybridization region hybridization region FGA D7S820 CSF1PO

(size in bp) 8 STR loci overlap between U.S. and Europe AMEL 75….80….100….120….140….160….180….200….220….240.…260….. 1000 Sex-typing RFUs 500 D13S317 D16S539 D18S51 D21S11 AMEL 6 DNA Separation and Detection 139bp 8 147bp

PCR Product Size (bp) PATERNITY TESTING TH01 TPOX D7 CSF D13 D16 D19 D3 D21 D2 D8 VWA D18 Allelic Family Inheritance of STR Alleles (D13S317) AMEL D5 FGA Ladder PCR product size (bp) DNA Size (bp)

D8S1179 D21S11 D7S820 CSF1PO 11 14 6FAM™ Father (blue)

TH01 D2S1338 D3S1358 D13S317 D16S539 12 14 VIC™ Sample Child #1 (green)

TPOX 8 VWA 14 NED™ D19S433 D18S51 Child #2 (yellow) Measurement (genotype determination) is performed by comparing allele size (relative to an internal size standard) to a commercially AMEL D5S818 11 12 provided STR kit allelic ladderFGA with calibrated repeat numbers (sized Child #3 PET™ (red)according to the same internal size standard)

8 12 An internal size GS500 LIZ size standard (not shown above) is run with Mother LIZ™ standard (orange) each sample and external standard to correlate sizes.

http://www.cstl.nist.gov/biotech 2 December 1, 2008 NIST Standards for Genetic Testing

Different Genetic Tests Can Give Different Results Based on PCR Primer Positions SRM 2391b Genomic 8 with D16S539

PCR Primers in Different Positions Heterozygous alleles Identifiler are well balanced All allele calls with MiniFiler for around the STR repeat region 68 CSF1PO, D7S820, D13S317, D18S51, D21S11, FGA, and D16S539 (with the exception noted below) match previously certified values. Imbalance in allele peak heights 6 8 MiniFiler * PowerPlex 16 Mutations in the DNA Sequence Allele (impact PCR primer annealing) 8 dropout* “Null” Allele * Slight imbalance from Allele Dropout with allele 11

Allele 6 amplicon has “dropped out” *Due to primer binding site mutation

An Abbreviated Organizational Chart Current Areas of NIST Effort with Forensic DNA • Standards http://www.cstl.nist.gov/biotech/strbase/ NIST/CSTL – Standard Reference Materials – Standard Information Resources (STRBase website) – Interlaboratory Studies Analytical Chemistry Biochemical Science • Technology Division (839) Division (831) – Research programs in SNPs, miniSTRs, Y-STRs, mtDNA, qPCR – Assay and software development • Training Materials Applied Genetics – Review articles and workshops on STRs, CE, validation (1 of 6 Groups) – PowerPoint and pdf files available for download Responsibilities for Forensic DNA Testing and Clinical and Agricultural Diagnostics (GMOs)

NIST Applied Genetics Group Group Mission Statement Applied Group Leader Formally organized October 2008 Applied Genetics Genetics

Advancing technology and traceability through quality genetic measurements to John Marcia Margaret Pete aid work in Butler Holden Kline Vallone • forensic DNA testing, • clinical genetics, • agricultural biotechnology, and • DNA biometrics.

Amy Ross Becky Jan Decker Haynes Hill Redman

http://www.cstl.nist.gov/biotech 3 December 1, 2008 NIST Standards for Genetic Testing

Group Expertise and Funding Sources Standard Reference Materials (SRMs) Applied http://www.nist.gov/srm Genetics Group Expertise Traceable standards to ensure accurate and • Reference Material Characterization comparable measurements between laboratories • Standard Information Resource Development SRM 2391b – autosomal STRs • Rapid Multiplex PCR Assay Construction SRM 2392 &-I – mtDNA sequencing • Short Tandem Repeat (STR) Genotyping SRM 2395 – Y-STRs SRM 2372 – DNA quantitation • Single Nucleotide Polymorphism (SNP) Genotyping SRM 2394 – mtDNA heteroplasmy • DNA Sequencing SRM 2399 – Fragile X • Training Materials and Workshops (validation info) Lab 1 Lab 2 Calibration with SRMs Current Funding Sources enables confidence in • National Institute of Justice (Forensic DNA) comparisons of results between laboratories • NIST (SRM development and production) Standards Reference Material We are looking to strengthen our portfolio Helps meet ISO 17025 needs in clinical genetics and agricultural biotech for traceability to a national metrology institute

Slide from Marc Salit, Multiplexed Biomolecular Science Group NIST DNA Reference Materials External RNA Control Consortium Applied Date of release or certificate revision (r) Genetics Forensic Applications • STR PCR DNA Profiling (SRM 2391b) – 1995, r2008 • Industry-initiated, NIST-hosted, stakeholder • Model for future work in this area coupled – sets up our work to be well-coupled to – 1999, 2003 • Mitochondrial DNA Sequencing (SRM 2392-I, 2392) – Janet Warrington, VP Clinical Genomics at stakeholder needs • Human Y-Chromosome DNA Profiling (SRM 2395) – 2003, r2008 Affymetrix – keeps us relevant and tied in – all major microarray technology developers – lets us develop SRMs that are stable and – 1992, r2001, • RFLP DNA Profiling (SRM 2390) now obsolete – other gene expression assay developers generic • collaborative study • probe content on commercial array platforms Clinical Applications • Use reference material approach to transfer • Fragile X Human DNA Triplet Repeat (SRM 2399) – 2004, r 2007 accuracy of NIST measurements and ensure • Huntington's Disease CAG Repeats (SRM 2393) – in process harmony amongst users – Long-term useful for gene expression, not tied Spike‐ins to microarray measurement approach • Novel aspects Platform Testing – Certification of sequence • Human DNA Quantitation (SRM 2372) - 2007 • developing new metrological framework for certifying sequence as property, consistent • Heteroplasmic mtDNA Mutation Detection (SRM 2394) - 2004 with ISO/REMCO definition of CRM • DNA Sequence Library for External RNA Controls (SRM 2374) • focus on confidence in sequence – SRM to be template; work with SDO to develop documentary standard for CRM production A few others are in early stages of development • CRMs to be commercially available

Slide from Marc Salit, Multiplexed Biomolecular Science Group Slide from Marc Salit, Multiplexed Biomolecular Science Group RNA Control Set NIST SRM 2374 – DNA Sequence Library enable objective performance measures for microarray gene expression for External RNA Controls

Analytical performance • NIST developing reference • Preparing SRM wrt signal level and ratio material of 96 control – cloned sequence library into sequences common vector Receiver‐Operating – SRM will be plasmid DNA with • suitable for use in accurate preparation of RNA controls Characteristic Curves control sequences as inserts – Prepared 400 units – sequence is certified property 4x • 96 tubes in each 2.5x – sequencing at NIST and multiple partner labs • Certifying ~100,000 bases – Sanger sequencing complete at 1.5x – sequencing with Sanger and next-gen “UHTS” approach(es) CBI, NIST • Developed sequence library – alternate sequencing approaches underway from submission by ERCC – quality measures developed to members & synthesis permit estimation of sequence Approach developed in conjunction with – evaluated performance of RNA reliability Pine and Thompson, FDA controls on variety of platforms • based on de novo assembly at –results of simulation shown – – selected 96 well performing alternate sites sequences • integration of data from multiple labs

http://www.cstl.nist.gov/biotech 4 December 1, 2008 NIST Standards for Genetic Testing

(now available) Two Different Nomenclatures Used by DNA Ancestry Fragile X (SRM 2399) Testing Companies for Y-chromosome Marker DYS442 (revised certificate in 2007) Applied TATTCCATTG TATC TATC TGTC TGTC TGTC Genetics • Disease: Fragile X involves the expansion of a trinucleotide (A) Gel image of SRM 2399 components (CGG) repeat and is the most common inherited cause of TATC TATC TATC TATC TATC TATC TATC A B C D E F G H I intellectual impairment and the most common known genetic TATC TATC TATC TATC TATC ACAGTTTCTT cause of autism that affects 1 in 4000 males and 1 in 6000 females of all races and ethnic groups. Normal (29-31 CGG repeats), Premutation (55-200 CGG repeats), Full Mutation Gusmão et al. (2006) (more than 200 CGG repeats), and Intermediate or Gray Zone [TATC]2 [TGTC]3 [TATC]12 ISFG recommended Alleles (40 - 60 repeats) [1]. Component G showing two NIST supports the (A) nomenclature fragments • SRM 2399 Components: Nine PCR products (labeled “A” to “I”) Assigned repeat values and possessing between 20 and 118 CGG repeats (along with Normal A = 20 220 bp of flanking region sequence) were initially released in TATTCCATTGTATCTATCTGTCTGTCTGTC TATC B = 30 Gray Zone (B) C = 41 Dec. 2004; revisions were made to the certificate in June 2007; TATC TATC TATC TATC TATC TATC TATC D = 51 component G was found to have two alleles present that were E = 60

Premutation assigned to contain 88/89 and 93 CGG repeats. TATC TATC TATC TATC ACAGTTTCTT F = 73 G = 88/89, 93 H = 96 • Customer Feedback Requested: We will consider adding Iida et al. (2001) I = 118 components with larger number of repeats if there is interest. [TATC]12 Currently no full mutation [1] Sherman, S. (2002). "Epidemiology". Chapter 3 in Fragile X Syndrome, Diagnosis Treatment and Research. Butler et al. (2008) Addressing Y-STR allele nomenclature. Journal of Genetic Genealogy 4(2): 125-148 components available Ed. Hagerman, R. J. & Hagerman, P.J. (3rd Edition). Johns Hopkins University Press: Baltimore.

(in process) Huntington’s Disease (SRM 2393) Clinical Guidelines (completion planned for 2009) Applied for Huntington’s Disease Genetics • Disease: Huntington disease is a neurodegenerative disease of midlife onset that produces choreic movements and cognitive decline, often accompanied by Normal Mutable Normal HD Alleles HD Alleles 35 repeats psychiatric changes that affects approximately 1 in 140.16 bp 45 repeats 10,000 individuals. Inheritance is autosomal dominant Intermediate alleles Reduced penetrance Full penetrance 169.98 bp with clinical manifestations associated with expansion of Stutter products Stutter products ≤ 26 27 – 35 36 – 39 ≥ 40 a polymorphic trinucleotide (CAG) repeat. CAG CAG CAG CAG repeats repeats repeats repeats • Plan for Standards: Supply DNA fragments that are Repeat Classification Disease count status larger than the currently published genotyping primers with components to have repeat numbers representing <27 Normal Unaffected Recommended HD sizing accuracy: “normal” to “Juvenile onset” stages. ± 1 repeat for alleles ≤ 43 27–35 Intermediate Unaffected ± 2 repeat for alleles between 44 -50 • Potential Users: Clinical diagnostic laboratories wanting ± 3 repeat for alleles between 51 -75 36–39 Variable +/- to ensure the accuracy and comparability of their testing Penetrance Affected ± 4 repeat for alleles > 75 results to other testing laboratories and those wishing to >39 Full Affected Penetrance validate their CAG repeat sizing methods. >60 Juvenile Affected American College of Medical Genetics: Standards and Guidelines for Clinical Genetics Laboratories onset 2006 Edition : Technical Standards and Guidelines for Huntington’s Disease AMERICAN COLLEGE OF MEDICAL GENETICSStandards and Guidelines for Clinical Genetics Laboratories 2006 Edition Technical Standards and Guidelines for Huntington Disease:

(in development) (in development) Cytomegalovirus (CMV) Reference Material Agricultural Biotechnology (completion planned for 2010) Biotech Crop Quantification (grain/food) Applied Applied Genetics • Disease: CMV causes life-threatening infections in Genetics • Background: Shipments of US grain/food are tested for the type and immunocompromised patients and in congenital transmission to infants, quantity of biotech crop material to comply with regulatory policies of though commonly found and usually latent in the general population importing countries. Multiple testing methods often give different results. • Standard needs: Calibration and quality control of quantitative real-time NIST is working with biotech crop developer companies to provide a PCR assays of blood and other body fluids quantitative real-time PCR method that would be applicable to • Customers: Producers of secondary standards or clinical laboratory numerous biotech crop events. using in-house assays for CMV detection • Strategy: Detection and quantification of the 35S promoter sequence • Current Plans: from the Cauliflower mosaic virus. – Materials: Pure viral DNA from Towne Strain in the form of a bacterial – The 35S promoter is a strong and consistent promoter sequence artificial chromosome (Towne ΔUL147) containing all of the viral genome and has been used in genetic constructs to guarantee expression of except for region US1-15 and UL147; viral DNA to be provided in a buffer for the transgene in numerous genetically engineered crop plants (e.g. dilution into a user’s matrix of choice maize, soy, cotton and canola species) – Certification: the mass fraction of DNA based on SI traceable phosphorus measurements – The method will be validated for as many crop events carrying the – Additional Information: 35S promoter as possible • Copy number from DNA mass fraction and digital PCR • Customers: Biotech crop testing laboratories around the world. Broad • DNA sequence of genes that are targets for Q-PCR adoption by world wide testing laboratories would contribute to • Restriction digest and microarray validation of BAC international harmonization • Testing of various published PCR assays • Homogeneity and stability

http://www.cstl.nist.gov/biotech 5 December 1, 2008 NIST Standards for Genetic Testing

Some Issues Faced When Developing STRBase: a Community Resource for Reference Materials Forensic DNA Applications of STRs… • Initial selection of material (SRM components) was for a specific purpose usually and may not address every need in the future (a new locus may not exhibit a diverse set of alleles)

• The forensic community uses commercial STR typing kits – and only wants a confirmation of the allele calls against an allelic ladder – should we fully sequence every sample?

• Some genetic loci will not be able to have every allele sequenced (e.g., due to locus duplication)

• There are lots of loci that could be “certified” – how do we decide which ones to include in future certificate updates? A similar standard information resource could be developed for clinical diagnostics or agricultural biotech crop applications

Thank You for Your Attention… Applied Genetics

Contact Information [email protected] 301-975-4049

http://www.cstl.nist.gov/biotech 6