JOURNAL OF BACTERIOLOGY, Sept. 1991, p. 5808-5821 Vol. 173, No. 18 0021-9193/91/185808-14$02.00/0 Copyright C) 1991, American Society for Microbiology A Gam Protein Inhibits the Helicase and x-Stimulated Recombination Activities of Escherichia coli RecBCD Enzyme KENAN C. MURPHY Department of Molecular Genetics and Microbiology and Program of Molecular Medicine, University of Massachusetts, Worcester, Massachusetts 01605

Received 5 March 1991/Accepted 17 July 1991

The Gam protein was isolated from cells containing a Gam-producing plasmid. The purified Gam protein was found to bind to RecBCD without displacing any of its subunits. Gam was shown to inhibit all known enzymatic activities of RecBCD: ATP-dependent single- and double-stranded DNA exonucleases, ATP-indepen- dent single-stranded endonuclease, and the ATP-dependent helicase. When produced in vivo, Gam inhibited X-activated recombination in A red gam crosses but had little effect on the host's ability to act as a recipient in conjugational recombination. These experiments suggest that RecBCD possesses an additional "unknown" activity that is resistant to or induced by Gam. Additionally, the expression of Gam in recD mutants sensitizes the host to UV irradiation, indicating that Gam alters one or more of the in vivo activities of RecBC(D-).

The primary route of general homologous recombination became prime candidates. This was further suggested by a in Escherichia coli proceeds through the RecBCD pathway. report (41) which showed that the RecBC enzyme (the The RecBCD enzyme (also known as ExoV) has five known species presumably present in recD mutants) retains residual activities: ATP-dependent double-stranded and single- unwinding and ssDNA endonuclease activities. recD mu- stranded DNA (dsDNA and ssDNA, respectively) exonu- tants contain no detectable ATP-dependent exonuclease yet cleases, an ATP-stimulated ssDNA endonuclease, an ATP- remain proficient at promoting conjugational recombination dependent unwinding activity, and a DNA-dependent (2), a phenotype reminiscent of Gam-containing hosts. One ATPase (for reviews, see references 14, 53, 58, and 62). The hypothesis suggested by these observations would have enzyme has also been shown to recognize and promote Gam simply displace the RecD subunit from RecBCD, nicking at X sites (5'GCTGGTGG3') while unwinding ds leaving behind an active RecBC species that could function DNA in vitro (42). At one time or another, one or more of properly in promoting recombination despite its loss of these activities have been implicated as the key function(s) exonuclease functions. This hypothesis was consistent with involved in the enzyme's ability to promote homologous the observed similarities between cells containing Gam- recombination (1-4, 10-12, 21, 27, 28, 32, 41, 50, 59). Some producing plasmids and recD mutants: both hosts are defi- of these studies involved the correlation of residual activities cient in the ATP-dependent exonucleases yet are proficient allow T4 of RecBCD enzyme isolated from mutants carrying recB, at conjugational and transductional recombination, mutants to grow, and the of X red recC, or recD with the cell's ability to carry out recombina- 2- phage support growth tion and repair. gam in recA hosts (2, 19, 31, 44). are differences The approach taken in this report is similar to those Despite these similarities, there distinct between Gam-containing hosts and recD mutants with re- described above: an examination of the residual biochemical and genetic activities of RecBCD after modification. How- gard to which activities of RecBC are retained and how the modification affects X recombination. This re- ever, the modification employed here is afforded not by x-stimulated port describes a RecBCD-Gam complex (complete with the mutation but by the A Gam protein, which has been reported D subunit) that is deficient in all of the known activities of to bind RecBCD and inhibit the exonuclease and ATPase RecBCD, including helicase and recognition. activities (25). The unwinding and X-recognizing capabilities X of RecBCD were not known at the time of earlier studies and thus were not tested. It has been a general assumption since MATERIALS AND METHODS those studies that a cell containing Gami was effectively a recBC null mutant. However, Hays et al. (22) and others (44) Bacteria and phage. E. coli W3110 lacIq L8 (8) was used showed that Gam-producing plasmids do not confer a recBC for propagation of plasmids. E. coli AB1157 (argE3 his4 phenotype on the host with regard to recombination follow- leuB6 proA2 thr-J ara-14 galK2 lac YI mtl-l xyl-5 thi-J ing conjugation, even though such hosts display other recBC rpsL31 tsx-33 supE44) and isogenic strains JC5519 (recB21 phenotypes such as UV sensitivity, the ability to plate T4 2- recC22), JC9239 (recF), and JC11451 (sbcB15) were obtained phage, inhibition of X recombination in a X-containing inter- from A. J. Clark. JC12123 (recJ::TnlO Tet) was obtained val, and decreased cell viability (19, 44). Thus, it seemed from S. Lovett. DPB267 (F- X- recD1901::TnlO) was ob- reasonable to assume that Gam did not inactivate all of tained from M. Marinus. KM353 was obtained by trans- RecBCD's activities. ducing AB1157 with a P1 stock grown on DPB267, selecting Which activity (or activities) of RecBCD might remain for Tetr, and then selecting for Tets by growth on fusaric acid intact in the presence of Gam? Since RecBCD nuclease and plates as described by Bochner et al. (6). The strain was ATPase activities have been shown to be inhibited by Gam scored as recD by virtue of its ability to plate T4 2- phage, in vitro (25), the helicase and/or X recognition capabilities UV resistance, and proficiency at cqnjugational recombina- 5808 VOL.V173, 1991 Gam INHIlBITION OF RecBCD HELICASE AND X ACTIVATION 5809 tion. (The T4 2- phage stock used was grown from a single TABLE 1. Gam purification round of infection in a Su- host and thus lacked the gene 2 Vol Total protein Total U Sp act protein in their phage heads necessary for successful infec- Fraction (ml) (mg) (10-4) (10-4 U/mg) tion of AB1157 [Su'] and its derivatives). A Tets version of JC12123 (KM354) was obtained by growth on fusaric acid Extract 157 1,020 8,300 8.1 plates. RDK1792 (recD1013) was obtained from R. Kolodner Ammonium sulfate 19 668 5,000 7.5 via L. Thomason. FS2152 (recD hflA) was obtained G-75 Sepharose 105 28.3 2,300 81.3 sup0 DE-52 cellulose 10 6.1 1,040 170 from F. Stahl. MV1955 (Hfr P03 metBi relAl spoTI 5.2 940 181 thr-35::Tn9) and CAG12079 (fuc-3072::TnlO) were obtained Hydroxylapatite 2.3 from M. Volkert. TP337 was derived by A. Fenton by transduction of MV1955 with a P1 stock grown on CAG12079 and selection for Tetr. A MMS556 (Rsus5 b1453 XD), A MMS558 (RsusS b1453 x76), and A JMC307 (Jsus6 collected by centrifugation and dissolved in 10 ml of buffer A b1453 cI857) were obtained from F. Stahl. (20 mM Tris HCl [pH 8.2], 0.1 mM EDTA, 10 mM mercap- Plasmids. Plasmids were constructed and propagated by toethanol, 100 mM KCl, 10% glycerol). standard techniques (34). pTP202 and pTP550 have been All of the following steps were performed at 4°C. The described previously (43, 51). pKM590 was constructed by ammonium sulfate precipitate fraction was placed on a G-75 placing the EcoRI fragment from pTP202, which contains the Sephadex column (105 by 5 cm), and 5-ml fractions were P1ac-gam fusion, into the EcoRI site of pTP550 (reading collected. Two peaks of RecBCD-inhibitory activity were clockwise in the conventional pBR322 map). A similar found. The first peak (A) eluted soon after the void volume plasmid, pKM574, contains Ptac in place of Plac. pCDK3 (15) and contained 2.1 x 106 U of ATP-dependent dsDNA was kindly supplied by S. Kushner. pKM587 was con- exonuclease inhibitory activity. The nature of peak A is structed by ligating the 19-kb BamHI (filled-in) RecBCD- discussed in Results; it was not further isolated. The second containing fragment from pCDK3 into the Scal site of peak (B), which eluted just ahead of the hen egg white pBR322. This manipulation allows tetracycline to be used lysozyme (added during the extraction procedure), con- for selection of the RecBCD-producing plasmid-containing tained 2.35 x 107 U of Gam. The Gam species in peak B was hosts during growth to high density. purified to homogeneity as described below and shown in Buffers, media, and chemicals. RecBCD buffer (RB) con- Table 1. tains 10 mM Tris HCl (pH 8.0), 10 mM MgCl2, 0.25 mM Peak B from the G-75 column (105 ml) was placed on a dithiothreitol (DTT), 0.5 mg of bovine serum albumin (BSA) DE-52 cellulose column (17 by 2.5 cm) and washed with per ml, and 10% (vol/vol) glycerol. Protein dilution buffer buffer A until the A280 was back to baseline. The column was (PDB) contains 10 mM potassium phosphate (pH 6.7), 1.0 then developed with a 0.1 to 0.4 M KCl gradient in buffer A mM DTT, 0.1 mM EDTA, 1 mg of BSA per ml, and 10%o (800 ml, total volume), and peak fractions containing glycerol. Resuspension buffer, Luria-Bertani (LB) medium, RecBCD dsDNA exonuclease inhibitory activity were col- and M9 medium have been described previously (34, 37). lected and combined (174 ml). The pooled fractions were DEAE-cellulose (DE-52) was purchased from Whatman. filtered through a Centriprep-30 Amicon filter. Ammonium Bio-Gel AO.5m, phosphocellulose, and polyacrylamide were sulfate (66 g) was slowly added to the filtrate (174 ml), and purchased from Bio-Rad. Hydroxylapatite was prepared as the solution was stirred overnight at 4°C. The precipitate was described previously (36). E. coli ssDNA-binding protein collected by centrifugation, suspended in 10 ml of buffer C (SSB) was purchased from U.S. Biochemical Corp. Isopro- (20 mM potassium phosphate [pH 6.8], 10 mM mercaptoeth- pyl-P-D-thiogalactopyranoside (IPTG) and BSA were pur- anol, 10% glycerol), dialyzed against buffer C, and placed on chased from Sigma. Ultrapure ammonium sulfate was pur- a 3-ml hydroxylapatite column. A small amount of A280- chased from Schwarz/Mann; all other chemicals were absorbing material eluted during a wash of the column with reagent grade. buffer C. Gam was eluted by washing the column with buffer Purification of Gam. Host cells (JC11451) containing the C made 50 mM in potassium phosphate. The resulting Gam-producing plasmid pKM574 were grown in 4 liters of fraction was concentrated to 2.3 ml with a Centricon-10 LB medium at 37°C. The cultures (500 ml in eight 2-liter Amicon concentrator. Glycerol (1.8 ml) and 0.1 M DTT (18 flasks) were shaken until they reached a density of 2 x 108 ,ul) were added to the concentrate, and fractions were stored cells per ml. IPTG was added to a final concentration of 0.5 at -800C. mM, and the cultures were aerated for an additional 2 h. The Purification of RecBCD. Hosts cells (JC11451) bearing the cells were collected by centrifugation, suspended in 35 ml of RecBCD-producing plasmid pKM587 were grown in 10 liters resuspension buffer, and frozen at -80°C. The extract was of LB medium supplemented with 12 ,ug of tetracycline per prepared as follows. To the frozen cell paste, an equal ml in a Fermentation Design fermentor. The culture was volume of 1-mg/ml hen egg white lysozyme in 0.125 M Tris allowed to proceed to saturation at 370C (5 to 6 h). The cells HCl (pH 7.5)-8.3% sucrose was added, and the solution was were concentrated by passage over Amicon filtration Duro- stirred at 4°C. After 5 min, EDTA and DTT were added to pore membranes with the Pellicon Cassette system to about final concentrations of 5 and 1 mM, respectively. After 25 500 ml. They were further concentrated by centrifugation, min of stirring, an equal volume of 1% Brij 58 in 50 mM Tris suspended in 100 ml of resuspension buffer, and frozen at HCl (pH 7.5)-l mM EDTA was added. After being stirred -80°C. Extraction was as described above for Gam except for an additional 30 min, the solution was centrifuged in a that the extract was sonicated for three 2-min bursts prior to 50.1 Ti Beckman rotor at 40,000 rpm for 1 h. Solid ammo- centrifugation. The use of tetracycline for plasmid selection nium sulfate (29.8 g) was slowly added to the extract (157 (and thus the ability to proceed to saturation) resulted in a ml), and the solution was stirred for 0.5 h at 4°C. The concentrated extract containing nearly a fourfold increase in supernatant was collected by centrifugation, and an addi- RecBCD activity (albeit a twofold decrease in specific activ- tional 29.8 g of ammonium sulfate was slowly added. After ity) compared with activity in similar extracts obtained from the solution was stirred for 1 h at 4°C, the precipitate was Ampr RecBCD-producing pCDK3. The RecBCD activity 5810 MURPHY J. BACTERIOL. assayed during purification was the ATP-dependent dsDNA TABLE 2. RecBCD purification exonuclease. Total Total Sp act The following steps were performed at 4°C. Ammonium Fraction no. and contents (vol) protein U (10-3 sulfate precipitation was performed as described above for (mg) (10-6) U/mg) Gam except that 94 g of ammonium sulfate was added for each extraction; the starting volume was 493 ml. The pre- I. Extract (493 ml) 25,630 19.5 0.76 Ammonium sulfate (150 ml) 15,600 11.7 0.75 cipitate from the second extraction was dissolved and dia- II. DEAE cellulose (270 ml) 969 8.1 8.5 lyzed overnight in buffer B (20 mM potassium phosphate [pH Ammonium sulfate (54 ml) 776 6.9 8.9 6.8], 1 mM EDTA, 1 mM DTT, 10% glycerol). After three III. Hydroxylapatite (55 ml) 236 3.5 14.8 changes of buffer, the sample (150 ml) was diluted with cold IV. Bio-Gel AO.5m (26 ml) 47 2.2 46.8 water to reduce the conductivity to that of buffer B and Va. Mono-Q (0.84 ml) (passed through 1.23 0.54 439 placed on a DEAE-cellulose column (5 by 10 cm). The two gradients; 0600 and 250-500 column was washed extensively first with buffer B and then mM KCI) with 0.15 M KCI in buffer B. RecBCD was eluted with 0.3 M Vb. Mono-Q (0.80 ml) (phosphocellulose 0.79 0.33 418 KCI in buffer B (fraction II). and heparin agarose) Ammonium sulfate (103 g) was added to fraction II (270 0.87 431 ml), and the solution was stirred for 90 min. The precipitate Total (1.64 ml) 2.02 was collected by centrifugation, suspended in buffer D (buffer B made 0.1 mM EDTA), and dialyzed overnight with four changes in buffer D. Cold water was added to reduce the conductivity to that of buffer D. The sample was then placed repeatedly in buffer B to bring the ammonium chloride on a hydroxylapatite column (1 by 25 cm), washed with concentration down below 10 mM and then was used di- buffer D, and eluted with buffer D made with 50 mM rectly in binding experiments with Gam. A summary of this potassium phosphate (fraction III). Fraction III (55 ml) was RecBCD isolation appears in Table 2. For one experiment, concentrated to 4 ml with an Amicon Centriprep-30 concen- the gel unwinding assay, RecBCD was prepared as described trator, placed over a Bio-Gel AO.5m column (2.5 by 65 cm), elsewhere (44). an eluted in buffer D. The RecBCD peak (fraction IV) eluted Enzyme and protein assays. The RecBCD dsDNA exonu- soon after the void volume. clease assay has been previously described (44). The ATP Fraction IV (26 ml) was concentrated to 1.0 ml with an concentrations used for dsDNA and ssDNA exonuclease Amicon Centriprep-30 concentrator. In two separate runs, assays were 0.2 and 1 mM, respectively. RecBCD was 0.5 ml of fraction IV was placed on a 5-ml Mono-Q fast generally diluted with PDB to bring the assay into the linear protein liquid chromatography (FPLC) column and eluted range (between 0.2 and 1.0 U of enzyme). One unit of with a 25-ml gradient of 0 to 600 mM KCl in buffer B. This RecBCD dsDNA exonuclease activity is the amount of and all subsequent FPLC steps were performed at room enzyme that catalyzes the ATP-dependent release of 1 nmol temperature. Sodium dodecyl sulfate (SDS)-polyacrylamide of nucleotides in 30 min. When these units are converted to gel electrophoresis (PAGE) of the Mono-Q fractions re- units previously reported (20-min assays), the final specific vealed that RecBCD eluted at between 400 and 430 mM KCl activity of RecBCD reported here is 2.87 x 105 U/mg, which with a persistent contaminant of about 85 kDa that ran agrees well with the highest reported specific activity for slightly ahead of the RecBCD complex. SDS-PAGE re- RecBCD (2). Unless otherwise noted, Gam activity was vealed that a complex containing predominantly RecB and measured by mixing various amounts of RecBCD and Gam RecC (no RecD) eluted at about 450 mM, though those in 50 ,ul of RB containing 0.8 mM ATP and incubating the fractions were not assayed for enzymatic activity. mixture for 10 min at 37°C. Prewarmed RB (150 p,l) contain- The two halves of RecBCD fraction V were treated ing 5 nmol of 32P-labeled P22 DNA (nucleotides) was then differently, though the final preparations gave similar spe- added to the mixture, and residual dsDNA exonuclease cific activities. One half of fraction V (1.5 ml) was concen- activity was measured as previously described (44). One unit trated fivefold with a Centriprep-30 Amicon concentrator of Gam activity is the amount of protein that inhibits 1 U of and suspended in buffer B repeatedly to lower the KCI RecBCD dsDNA exonuclease activity. N-terminal sequence concentration to below 10 mM. The sample was then con- analysis of purified Gam protein was performed at the centrated to 0.1 ml and placed back on the Mono-Q column University of Massachusetts Medical Center Protein Core in buffer B. The column was developed with a 25-ml gradient Facility. of 0.25 to 0.50 M KCI in buffer B. This gradient afforded a The molar ratio of Gam to RecBCD needed for 95% greater separation of the 85-kDa species from RecBCD, inactivation of any RecBCD activity depended on the spe- though a significant amount of overlap of the two peaks was cific activity of the RecBCD preparation used. Generally, still evident. Fractions containing predominantly RecBCD the amount of Gam needed for 95% inactivation decreased were concentrated to 0.42 ml, and an equal volume of buffer with decreasing RecBCD specific activity. Thus, no conclu- B made with glycerol was added; 0.1-ml fractions were sions can be reached on the actual stochiometry of Gam- stored at -80°C (fraction Va). The second half of fraction V RecBCD expected in vivo. was passed through a phosphocellulose column in buffer C SDS-PAGE was done in Tricine buffer as described by (pH 6.8). Both RecBCD and the 85-kDa species flowed Schagger and von Jagow (48). Protein concentrations during through the column. The sample was then applied to a purification were determined by the Bradford assay (7). heparin-agarose column (1 by 12 cm) and eluted with a Final protein concentrations were determined by A280, using 120-ml gradient of0 to 500 mM ammonium chloride in buffer the following molar extinction coefficients: for RecBCD, E = B. The separation of RecBCD from the 85-kDa species was 4.0 x 105 M-1 cm-1; for Gam, e = 1.13 x 104 M-1 cm-1. similar to the second Mono-Q step with fraction IVa; i.e., These values are based on the tyrosine and tryptophan the 85-kDa species ran slightly ahead of the RecBCD peak. contents of the proteins' predicted amino acid sequences as This sample (fraction Vb) was diluted and concentrated derived from DNA sequences (16-18). VOL.V173, 1991 Gam INHIBITION OF RecBCD HELICASE AND X ACTIVATION 5811

Formation of RecBCD-Gam complex. RecBCD (87 jig) and 37°C, 2 p.l of 1Ox loading buffer (25% glycerol, 0.25% Gam (53 ,ug) were run separately in a Superose-12 FPLC tracking dye) was added, and the samples were run on a column in buffer B made 0.1 M KCl. The RecBCD and Gam 0.75% agarose gel to detect the disappearance of M13 peaks were collected and concentrated to 0.19 and 0.29 ml, ssDNA. At the same time, the rest of the preincubation respectively. Portions of these samples were mixed at a samples were diluted 300-fold with PDB, and the residual Gam/RecBCD molar ratio of 10:1, incubated at 37°C for 20 ATP-dependent dsDNA exonuclease activity was measured min, and concentrated to 0.15 ml with a Centricon-30 Ami- as described above. con concentrator. Part of this mixture (100 ,u1) was then UV sensitivity measurements. Overnight cultures of cells placed over a Superose-12 FPLC column (24 ml) and eluted containing pTP550 or pKM590 were grown with aeration at in buffer B made 0.1 M KCl. The elution profile was 37°C in 5 ml of LB medium containing tetracycline (15 determined by A280 and compared with profiles of RecBCD p.g/ml). Fresh cultures (5 ml) were started by making 1:500 and Gam run alone. Peaks of RecBCD and RecBCD-Gam dilutions in LB medium containing tetracycline (15 p.g/ml). complex were run side by side in SDS-PAGE to verify the At cell densities of 1 x 107 to 3 x 107/ml, IPTG was added to presence of Gam. The polyacrylamide gel was stained with a final concentration of 1 mM. The cultures were grown with Coomassie blue and scanned with a Quick-Scan R&D den- aeration to a density of 2 x 108 cells per ml, collected by sitometer. centrifugation, suspended in an equal volume of M9, and Unwinding assays. RecBCD helicase was measured by two placed on ice. Cells were diluted in M9 medium, spread on procedures. In the gel shift assay, RecBCD (0.4 nM) with LB medium plates containing 0.5 mM IPTG, and exposed to and without a preincubation period with Gam was mixed UV light (254 nm) at a dose of 18 J/m2. Plates were kept in with a 346-bp HindIII-BamHI 32P-labeled fragment from the dark at 37°C overnight; unirradiated plates were used to pBR322 (0.16 nM DNA ends) in the following buffer: 5 mM determine cell titers. Percent survival rates are reported as MOPS (morpholinepropanesulfonic acid; pH 7.0), 1 mM the means of three experiments with standard deviations MgCl2, 1 mM CaCl2, 100 mM NaCl, 1 mM DTT, and 0.5 mg (unless otherwise noted). In a random sampling of 240 of BSA per ml. RecBCD exonuclease activities are unde- colonies, all were found to retain their resistance to tetracy- tectable in this buffer. The reaction was started by the cline. Some experiments were performed with LB medium addition of 1 mM ATP. After 5 min at 37°C, the mixture (20 plates containing both IPTG and tetracycline; this did not ,u1) was electrophoresed on a 5% polyacrylamide gel in affect survival rates compared with those on plates without Tris-borate-EDTA (TBE) buffer to separate dsDNA from tetracycline. ssDNA. In the second unwinding assay, ssDNA generated Conjugational recombination. Recombination following by RecBCD helicase was detected by the change in fluores- bacterial conjugation was measured as described previously cence of SSB after it bound to ssDNA, as described by (45) except that TP337 instead of MV1955 was used as the Roman and Kowalczykowski (46). The unwinding reaction donor. TP337 is Tetr by virtue of a TnJO insertion and thus is mixture contained 1 p.g of P22 phage DNA (3 nmol of not inhibited by tetracycline when mixed with the recipient nucleotides), 1 mM ATP, and 0.42 p.M SSB in 1 ml of cultures. Wild-type and mutant strains of E. coli bearing unwinding buffer (25 mM Tris-acetate [pH 7.5], 1 mM pTP550 (control plasmid) or pKM590 (Gam producer) were magnesium acetate, 1 mM DTT). The phage DNA was used as recipients. The donor strain was grown overnight at digested with EcoRV to increase the number of double- 37°C without shaking in LB medium containing 25 p.g of stranded ends (1.28 nM DNA ends in the final mixture). chloramphenicol per ml. Recipient strains were grown over- These reactions did not contain an ATP regeneration system night at 37°C with aeration in LB medium containing strep- as described previously (46). RecBCD (0.44 ,uM) was incu- tomycin (100 p.g/ml) and tetracycline (15 p.g/ml). Fresh bated alone or with various amounts of Gam in the presence cultures were started with 1:200 dilutions into the same of 1 mM ATP in RB. After 15 min at 37°C, aliquots of the medium used for overnight growth. At about 107 recipient mixture were removed, diluted in RB, and assayed for both cell per ml, IPTG was added to a final concentration of 1 dsDNA exonuclease and helicase activities. The helicase mM. Titers of recipient cells were determined on LB me- assay was started by adding RecBCD (or RecBCD plus dium plates containing 100 p.g of streptomycin per ml, and Gam) to the unwinding mixture (1 ml in a 5-ml cuvette) at a the titer of the donor strain was determined on LB medium final concentration of 1.4 nM; the reaction took place at plates containing 25 p.g of chloramphenicol per ml. The room temperature (21°C), and the mixture was stirred con- mating mixtures contained 200 p.1 of recipient cells (at 2 x stantly. The change in fluorescence of SSB was recorded on 108/ml) and either 50 or 100 p.1 of the donor strain (at 0.5 x a SPEX Fluorolog-2 spectrofluorometer interfaced with a 108 to 1.0 x 108 cells per ml). The mixtures were kept at 370C SPEX DM3000F computer. Excitation and emission wave- without shaking. After 45 min, they were diluted with M9 lengths were 290 and 340 nm, respectively. Assays were medium, disrupted by vortexing, and plated on LB medium typically carried out for 5 min, though under the conditions plates containing both chloramphenicol and streptomycin to described here, the reactions for uninhibited RecBCD were determine the titer of exconjugants. Control mixtures lack- complete in about 30 s. The uninhibited rate of unwinding in ing either donors or recipients exhibited no growth on the these measurements was 40 p.mol of bp s-' per p.mol of Rec selective medium. Each recipient strain was tested at least BCD. Fluorescence readings (counts per minute at 1-s twice; representative data from one experiment are shown in intervals) for each assay were transferred from DOS to Table 4. Macintosh format and analyzed by using Kaleidagraph (ver- Phage crosses. X activity was measured in wild-type and sion 2.0.2). mutant hosts containing either pTP550 or pKM590 as de- Endonuclease assay. Tubes containing 10 pmol of RecBCD scribed by Stahl and Stahl (55). Phage crosses were per- with various amounts of Gam were preincubated in 20 p.l of formed essentially as described previously (44). Cells were RB. After 15 min at 37°C, 2 p.1 of each sample was mixed grown overnight in LB medium containing 0.4% maltose and with 18 p.l of endonuclease buffer (40 mM Tris HCl [pH 7.0], 12 p.g of tetracycline per ml. Fresh cultures (5 ml) were 50 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, 1 mM DTT) started in the same medium supplemented with 10 mM containing 0.14 ,ug of M13 circular ssDNA. After 30 min at MgCl2. At 108 cells per ml, phage were added to 0.5-ml 5812 MURPHY J. BACTERIOL.

TCGACGC1TATAA GATAT TTACTG AACTGAGATCMGC&AAGCATUCACTMCCCCCCCTGC I I I TCCTMTCAG CCCGGCATTTCGCGGGCGATATTnTCACAGCTATTTCCA@AGTTCAGCCAMCGCIiATTACATTCAGGATCGTCTTGAGGC m n a y y i q d r I e a t t FIG. 1. Start of gamL and gamS DNA sequences. A portion of the X gam sequence present in pKM574 and pKM590 and containing the potential start sites of gamL and gamS (underlined), the gamS ribosome-binding site (outlined), and the predicted N-terminal amino acid sequence of the GamS protein is shown. N-terminal protein sequencing of the GamS protein (isolated as described in Materials and Methods) revealed two N termini (arrows). portions of the cultures at a multiplicity of 5 for each phage. summarized in Fig. 1. The data (not shown) suggest that two After 10 min, 0.1-ml portions of the infected cell cultures species of Gam are present in about equal amounts: one has were removed and treated with a drop of chloroform, and an N terminus of tyrosine (residue 4 of GamS), and the other titers on KM353 (recD) were determined to measure the has an N terminus of isoleucine (residue 6 of GamS). A total percentage of unabsorbed phage. The rest of the culture was of 12 N-terminal residues were identified. Assuming that no then diluted fivefold with 1.6 ml of fresh, warm medium and degradation has occurred from the C-termini, the two spe- rolled for 2 h at 37°C. A few drops of chloroform were added cies of GamS differ only by two residues and would not be to induce lysis in all of the crosses. Titers of phage lysates expected to resolve from each other on SDS-polyacrylamide were determined on FS2152 (recD su- hflA) for recombinant gels. progeny phage and on KM353 (recD su+) for total progeny Previous reports (25) of Gam isolated from a A lysogen phage. The hflA allele was used to easily distinguish turbid described a Gam species of 16 kDa, which is consistent with from clear plaques, as A MMS558 may be phenotypically cIII the protein encoded by the longer open reading frame as a result of the b1453 deletion. Plaques on FS2152 (ca. 200 (GamL), though the authors did not report the N-terminal per plate) were scored as either turbid or clear (ca. 5% were sequence of that protein. It is not known with certainty if the too small to score); X activity was calculated by the equation Gam species isolated from the lysogen differs in size from given in the legend to Fig. 9 (as defined by Stahl and Stahl the plasmid-encoded Gam described here. [55]). Gam inhibits RecBCD unwinding activity. The GamS pro- tein species described above (hereafter called Gam) was RESULTS tested for its ability to inhibit RecBCD nuclease functions as previously reported (25). It was similar to Gam protein Purification of Gam. The purification of the Gam protein isolated previously with respect to inhibiting both the was done as described in Materials and Methods. The gam dsDNA and ssDNA exonuclease activities (Fig. 3) and the gene sequence within pKM574 contains two potential start ssDNA endonuclease activity (see below). The plasmid- sites encoding proteins of 16.1 and 11.4 kDa (GamL and derived Gam protein was also proficient at inhibiting GamS, respectively; see reference 19; Fig. 1). SDS-poly- RecBCD ATPase activity (data not shown). acrylamide gels of cells containing pKM574 showed evi- Two different assays were utilized to show that Gam dence that both the longer and shorter versions of Gam were inhibits RecBCD helicase activity. In the first assay, a short produced; the shorter species was present in greater labeled fragment of pBR322 dsDNA (346 bp) was incubated amounts (data not shown). It is not known if the shorter species was generated by processing of the larger species or whether both are translated separately. However, given the near-consensus Shine-Dalgarno ribosome-binding site prior to the start of gamS, the two start sites are probably independent. Two peaks of RecBCD ATP-dependent dsDNA exonucle- ase inhibitory activity were found in extracts of host con- taining pKM574 after exclusion chromatography (see Mate- rials and Methods). Most of the in activity appeared peak B, .._ a late peak in the chromatogram, which is consistent with a greater amount of the smaller, GamS protein seen in the SDS-PAGE described above; purification of this species is shown in Table 1. An estimate of the molecular weight of the purified GamS protein based on its mobility on SDS-poly- acrylamide gels is 11 kDa (Fig. 2). 1 2 3 4 5 6 7 8 9 Peak A, which eluted before peak B, also contained FIG. 2. SDS-PAGE of GamS purification. The percentage of RecBCD-inhibitory activity. Unlike peak B, peak A was not total sample placed on the SDS-polyacrylamide gel is in parenthe- inactivated by being heated to 70°C for 15 min. However, it ses. Lane 1, JC11451/pKM574 extract (0.005%); lane 2, ammonium was also not inactivated by DNase, did not precipitate with sulfate extract (0.005%); lane 3, G-75 Sepharose fraction (0.01%); polyethylenimine, and required a preincubation period with lane 4, DE-52 cellulose fraction (0.01%); lane 5, hydroxylapatite RecBCD fraction (0.025%); lane 6, standards (phosphorylase b, 94 kDa; BSA, to inactivate it, a requirement of Gam activity (25). 67 kDa; ovalbumin, 43 kDa; carbonic anhydrase, 30 kDa; soybean It is possible that the species responsible for this activity is trypsin inhibitor, 20.1 kDa; and a-lactalbumin, 14.4 kD); lanes 7, 8, GamL, the species encoded by the larger of the two open and 9, respectively, 3, 6, and 12 ,ug of purified GamS protein. The reading frames, but this has not yet been investigated. higher-molecular-weight band seen in lane 9 is probably a GamS Results from N-terminal sequence analysis of GamS are dimer (GamS behaves as a dimer during purification). VOL. 173, 1991 X Gam INHIBITION OF RecBCD HELICASE AND X ACTIVATION 5813

1.54 I I

. ~~~~~GanffRecBCD (M) C). -s--80- dsDNA E 60 ssDNA CD 1.3 60 __1.2 >0 4 0 0 20 o 1.1.10~~~~~~~~~~~~~1X \ 0.2 no Gain

0 0 1 2 3 4 5 6 0 40 80 1 20 160 200 Gam/RecBCD (M) seconds FIG. 3. Inhibition of RecBCD dsDNA and ssDNA exonucleases. FIG. 5. Gam inhibits RecBCD helicase: fluorescence assay. The RecBCD (2.3 pmol) was incubated with increasing amounts of Gam spectroscopic profiles of the change in fluorescence of SSB after in 20 ,ul ofRB. The mixture was incubated for 15 min at 37°C, diluted binding of unwound dsDNA generated by RecBCD are shown. to 700 tl with PDB, and left at room temperature for 10 min. A 1O-,l DNA (1.22 nM DNA ends), SSB (0.42 mM), and ATP (1 mM) were portion of the dilution (1 U of RecBCD) was measured for residual mixed in 1 ml of unwinding buffer (see Materials and Methods) in a RecBCD exonuclease activities. The assay mixture (206 ,ul of RB) 5-ml cuvette; zero time denotes the start of the fluorescence time contained 5 nmol of P22 DNA and either 0.2 or 1.0 mM ATP (for the scan. At 30 s, RecBCD (alone or preincubated with various amounts dsDNA and ssDNA exonuclease assays, respectively). ssDNA was of Gam) was added to the mixture at a final concentration of 1.4 nM generated by boiling dsDNA for 2 min and then incubating it for 10 to start the reaction. The shutter to the fluorospectrometer was mm on ice. closed for roughly 10 s during addition of enzyme, indicated by the drop in counts per minute. The change in fluorescence was moni- tored for 5 min (only 200 s are shown here). These reactions were carried out at 21°C. Under these conditions, uninhibited RecBCD in the presence of RecBCD under conditions which suppress unwound dsDNA at a rate of 40 ,umol of bp s'- per ,umol of the RecBCD nuclease functions (see Materials and Meth- RecBCD. The numbers associated with each profile represent the ods). After a 5-min incubation, the sample was run on a molar ratios of Gam/RecBCD during the preincubation period. polyacrylamide gel; the ssDNA generated by RecBCD heli- case was resolved from the dsDNA substrate by virtue of its lower mobility. The ability of Gam to inhibit this unwinding preincubated with RecBCD prior to the addition of the activity is seen in Fig. 4. RecBCD is able to completely dsDNA was found to inhibit the generation of ssDNA (lanes unwind the dsDNA substrate within 5 min (lane 8). Gam 3 to 7). Electron micrographs of RecBCD incubated with dsDNA suggest that RecBCD rewinds the unwound dsDNA as it travels along the DNA (59). The unwinding assay described above does not rule out the possibility that Gam increases the rate of rewinding relative to unwinding, leaving behind an intact dsDNA substrate. In such a scenario, RecBCD- Gam would move through dsDNA with no net unwinding. To address this question, a second unwinding assay used SSB to trap the ssDNA generated by RecBCD helicase. The rate and extent of unwinding was then monitored by the decrease in the intrinsic fluorescence of SSB upon binding to ssDNA (46). Gam inhibits RecBCD helicase activity as measured by this assay. Various amounts of Gam were preincubated with RecBCD as described in Materials and Methods. After the preincubation period, one sample of the mixture was used to measure helicase activity and a second sample was used to measure the remaining dsDNA exonuclease. Figure 5 shows that Gam inhibition is maximal when the relative ratio of Gam (monomer) to RecBCD reaches 2. However, as de- scribed in Materials and Methods, the Gam/RecBCD molar 1 2 3 4 6 7 8 ratio needed to achieve 95% inhibition varied with the FIG. 4. Gam inhibits RecBCD helicase: gel assay. RecBCD was specific activity of the RecBCD preparation used rather than preincubated with or without Gam, mixed with a 32P-labeled 346-bp with the activity being measured. Therefore, no conclusion HindIII-BamHI fragment from pBR322, and run on a 5% polyacryl- on the stoichiometry of Gam-RecBCD needed for maximum amide gel in TBE buffer as described in Materials and Methods. Lane 1, position of dsDNA; lane 2, position of ssDNA (generated by helicase inhibition can be made with certainty. boiling dsDNA); lanes 3 to 8, samples containing RecBCD (0.4 nM) In Fig. 6, the residual helicase and dsDNA exonuclease with the following concentrations of Gam added during a preincuba- activities of RecBCD are plotted as a function of the molar tion period: 0.14 nM, lane 3; 0.69 nM, lane 4; 2.1 nM, lane 5; 4.1 nM, ratio of Gam/RecBCD. The two activities are inhibited lane 6; 16.5 nM, lane 7; none, lane 8. largely in parallel and to the same extent. 5814 MURPHY J. BACTERIOL.

A. 1.40 A.1 2 3 4 5 B. 1 2 3 4 5 6 7 ° 1.35 +.~ *...~~~. - 1.30

* Gamb cBCD 2.0 A A E 1.25 A *G.Gm cBCD-1.0 0o AA A - ~~~~~~~Xa E | u2 1.20 A* GamecBCD.0.5 + 3 AA c o GafvrRSCD = 0.2 + 1.15 0o + NoGan 1.10 0) I i I f 25 30I 35 40 45 50 55 60I 6' seconds 100 c-0V) 80 B. 100 60 .= 80 Q|*exonuclease activity S ^\ E :o-|helicase activity 2 60 : 40 =~a,°EE 0 o M 20

0 2 4 6 8 10) Gam/RecBCD (M) Gam/ RecBCD (M) FIG. 6. Inhibition of RecBCD exonuclease and helicase. (A) The FIG. 7. Inhibition of RecBCD endonuclease. RecBCD and Gam were mixed in various molar ratios during a preincubation period. curves in Fig. 5 were redrawn to show the first 30 s following the start of the reaction (i.e., data from 30 to 60 s). From the slopes of Aliquots were then removed, mixed with 0.14 ,ug of M13 circular these curves, initial rates of unwinding were determined. (Insert: ssDNA, and incubated at 37°C as described in Materials and molar ratio of Gam to RecBCD during the preincubation period prior Methods. The samples were run in 0.75% agarose to detect the to the addition of enzyme to the unwinding reaction.) For clarity, the disappearance of M13 ssDNA. (A) This gel serves as a standard: lane no RecBCD lane 1 of which is curves for the Gam/RecBCD ratios of 5 and 10 are not included. (B) 1, added; 2, pmol RecBCD, The percent helicase activity remaining (relative to that of uninhib- enough to promote at least two nicks in the circular ssDNA ited enzyme) for each sample of inhibited enzyme is compared with substrate; lanes 3 to 5, serial twofold dilutions of the amount of the percent dsDNA exonuclease remaining. RecBCD used in lane 2, representing 50, 75, and 87.5% inhibition, respectively. (B) Top, all reactions contained 1 pmol of RecBCD. Lane 1, no Gam; lanes 2 to 7, reactions contained Gam/RecBCD molar ratios of 0.25, 0.5, 1, 3, 7.5, and 15, respectively. Bottom, Gam inhibits RecBCD ATP-independent endonuclease ac- inhibition of dsDNA exonuclease for each preincubation sample tivity. The lysogen-derived Gam protein has been shown to used in the ssDNA endonuclease assay. Each point in the graph inhibit the endonuclease activity of RecBCD (25). To show represents the same Gam/RecBCD molar ratio found in the samples that the plasmid-encoded Gam protein does the same, the run in lanes 2 to 7 of the gel shown above. digestion of M13 circular ssDNA by RecBCD was used to measure the inhibition of RecBCD endonuclease by Gam. Gam and RecBCD were mixed in various molar ratios: one activity, and placing the mixture over a Superose-12 FPLC portion at each ratio was used to measure residual dsDNA column. Figure 8 shows the elution profiles of RecBCD, exonuclease, and a second portion was used to measure Gam, and RecBCD-Gam along with the analysis of the residual ssDNA endonuclease. ATP was included only in the RecBCD-containing peaks by SDS-PAGE. The following dsDNA exonuclease assay; therefore, in the endonuclease observations are noted. (i) Gam forms a tight complex with assay, the exonuclease fractions are effectively shut off. M13 circular ssDNA was incubated with various amounts of RecBCD for 30 min (Fig. 7A). One picomole of RecBCD effectively induces at least two nicks in the circular substrate by virtue of the disappearance of both circular and linear DD DNA species (Fig. 7A, lane 2). Samples run in lanes 3 to 5 contained three twofold dilutions of 1 pmol of RecBCD to mimic inhibition of 50, 75, and 87.5% of the activity shown in 3::. lane 2. Using panel A as a standard, one can see that inhibition of RecBCD endonuclease by Gam (panel B, top) closely matches the Gam-induced inhibition of RecBCD .... i ~ :,1 dsDNA exonuclease (panel B, bottom). For example, at a Gam/RecBCD molar ratio of 7.5:1, about 90% of both activities are inhibited (compare Fig. 7B, lane 6 [with Fig. 7A, lane 5, as a standard] with the graph shown in the lower FIG. 8. RecBCD-Gam complex formation. (A) Elution profiles half of panel B). Thus, the ssDNA endonuclease activity of of RecBCD (87 ,ug) and Gam (54 ,ug) run separately in a Superose-12 RecBCD is inhibited by Gam to roughly the same extent as FPLC column. The peaks shown were concentrated as described in the Materials and Methods and then mixed to give a molar ratio of Gam exonuclease and helicase activities. to RecBCD of 10:1. (B) Elution profile obtained when RecBCD and RecD is not displaced from RecBCD by Gam. A direct test Gam were mixed prior to elution through Superose-12. Arrow, of whether RecD is displaced from RecBCD by Gam was elution peak of BSA (67 kDa). SDS-PAGE on right: lane 1, left peak made by mixing Gam with RecBCD at a 10:1 molar ratio, of elution profile shown in panel A; lane 2, left peak of elution profile which resulted in 97% inhibition of dsDNA exonuclease shown in panel B; lane 3, purified Gam. VOL.V173, 1991 Gam INHIBITION OF RecBCD HELICASE AND X ACTIVATION 5815

TABLE 3. UV sensitivity of hosts containing Gam-producing TABLE 4. Recombination in Hfr crosses plasmids Host Relevant genotype Plasmid Function Recombination Host Relevant genotype Plasmid Function % Survival' AB1157 Wild type pTP550 None 5.5 (+2.6) AB1157 Wild type pTP550 None 1.0 pKM590 Gam 0.62 (+0.08) pKM590 Gam 0.83 JC5519 recBC pTP550 None 0.51 (0.32) JC5519 recBC pTP550 None 0.017 pKM590 Gam 0.51 (+0.24) pKM590 Gam 0.014 KM353 recD pTP550 None 7.2 (±3.2) KM353 recD pTP550 None 0.026 pKM590 Gam 0.58 (±0.32) pKM590 Gam 0.0048 JC9239 recF pTP550 None 0.84b None 0.67 pKM590 Gam 0.15 JC9239 recF pTP550 None 1.6 JC8111 recBC recFc pTP550 None <0.0005b pKM590 Gam 0.86 pKM590 Gam <0.0005 KM354 recJ pTP550 None 0.95 KM354 recJ pTP550 None 22.4 (±18.6) pKM590 Gam 0.12 pKM590 Gam 0.0046 (±0.0029) a of 1.0 = 9 exconjugants per 1,000 donors. KM355 recD recJd None 0.047 (±0.037) Wild-type frequency a At 18 J/m2. Values are averages ofthree independent experiments done on different days; standard deviations are given in parentheses. b Done only once. rather than to any other target in the cell (for instance, the c This strain is also sbcB15. sbcC gene product [26]). Moreover, the mechanism of sen- d Despite the absence of plasmid, this strain is Tetr by virtue of a TnIO insertion in recD. sitization involves the inhibition of some activity of RecBCD that does not depend on the D subunit. Two other strains were tested in the experiment shown in Table 3 to determine the role of RecF pathway genes in RecBCD; the presence of Gam in the complex was verified Gam+ hosts. E. coli recF strains were found to be UV by SDS-PAGE (Fig. 8, lanes 1 and 2). (ii) Excess Gam is sensitive, as previously reported (23). UV sensitization of chromatographically separated from the RecBCD-Gam com- the recF strain by the presence of a Gam-producing plasmid plex. (iii) No evidence of free RecD protein was observed in (pKM574) compared with that of a control plasmid (pTP550) the elution profile. The position at which a protein species of was about sixfold, which is close to that exhibited in 67 kDa would be expected to elute is shown by the arrow in wild-type cells but not nearly as high as the sensitivity Fig. 8B. (iv) Densitometry tracing (not shown) of the poly- exhibited by recBC recF double mutants (Table 3; 23). (The acrylamide gel shown in Fig. 8 revealed that the relative recBC recF strain is also sbcB. Deactivation of exonuclease molar amounts of RecB, RecC, and RecD (roughly 1:1:1) in I does not restore UV resistance to recBC recF double lanes 1 and 2 were identical, indicating that RecD is not mutants as it does for recBC mutants [23, 66]. This rules out underrepresented in the RecBCD-Gam complex. When the an interaction between Gam and exonuclease I to account Gam protein was included in the densitometry scan, the for the relative UV resistance of recF Gam+ hosts compared molar ratio of Gam to RecBCD was 2:1, which is consistent with that of recBC recF double mutants.) These observa- with the view that Gam binds to RecBCD as a dimer. tions are in agreement with results reported by Friedman and The isolated RecBCD-Gam complex possessed 30% of the Hays (19). Of 30 colonies surviving from this experiment, all native dsDNA exonuclease specific activity, which agrees retained their gam+ phenotype by virtue of their sensitivity well with the 25 to 30% activity remaining when Gam was to T4 2- phage. One interpretation of these results is that mixed directly with RecBCD at a molar ratio of 2:1. This some activity of RecBCD is left intact (or tuned on) after assay (not shown) was performed at the same time, using Gam is bound. This is significant in light of the results shown RecBCD with the same specific activity as that used to form above which indicate that the Gam species isolated from the complex with Gam. The lack of complete inhibition by pKM574-containing hosts inhibits all the known activities of Gam in both cases suggests that the activity of the Gam RecBCD. Gam increased the sensitivity of a recJ strain by 3 preparation is only about 70% (i.e., 30% of the bound Gam orders of magnitude (Table 3). Such a high sensitivity was fails to inhibit). Had there been significant dissociation of also noted in a recD recJ double mutant by Lovett et al. (31) RecBCD and Gam during elution through the Superose-12 and reflects the need for the exonucleolytic activity of either column, one would have expected a lower molar ratio RecBCD or RecJ for successful repair of UV-induced dam- (Gam/RecBCD) in the isolated complex and, as a result, a age. It is noteworthy, though, that Gam+ recJ hosts were 1 higher specific activity compared with that of Gam and order of magnitude more sensitive than recD recJ double RecBCD mixed directly at a molar ratio of 2:1. This is not mutants, again suggesting that some activity of RecBCD what was found, suggesting little if any dissociation of Gam other than the exonuclease plays a role in recovery from UV from RecBCD during chromatography. damage. UV sensitivity of Gam+ hosts. Hosts containing Gam- Conjugational recombination in Gam+ hosts. Conjuga- producing plasmids (hereafter called Gam+ hosts) and con- tional recombination experiments were performed to assess trol vectors were grown in LB medium, induced with IPTG, Gam's ability to inhibit the recombination proficiency of plated on LB medium-IPTG plates, and irradiated as de- RecBCD in a variety of host backgrounds. As reported scribed in Materials and Methods. In these experiments, previously (22, 45), Gam had little effect on the ability of Gam increased wild-type cell sensitivity to UV damage wild-type cells to act as recipients in Hfr crosses (Table 4). 10-fold (to about the sensitivity level of a recBC host). As To rule out the possibility that Gam might turn down shown in Table 3, recD mutants were sensitized to the same RecBCD-promoted recombination yet at the same time turn extent; Gam did not increase the UV sensitivity of a recBC up another pathway (e.g., RecF), Hfr crosses were per- mutant. These results suggest that Gam-mediated sensitiza- formed with a Gam+ recBC host. The presence of Gam had tion of cells to UV results from binding of Gam to RecBCD no effect on restoring the recombination deficiency of recBC 5816 MURPHY J. BACTERIOL. host (Table 4), which agrees with earlier results (45). Thus, Cross 1 while some RecF pathway components are involved (see below), the recombination seen in the Gam+host is depen- XD dent on the presence of RecB and/or RecC. b1453 cl+ Rsus5 Also shown in Table 4 are the results of an experiment to determine if Gam-producing plasmids inhibit the recombina- tion proficiency of recD mutants. This experiment produced Jsus6 b1453 c1857 the surprising results that the control plasmid (Gam-) inhib- ited recombination to almost the same extent as the mutation in recBC. (pBR322 had the same effect [data not shown]). This observation is not limited to the recD strain constructed for these studies. Strain RDK1792 (recD) also exhibited this Cross 2 conjugational recombination defect in the presence of plas- mids (data not shown). An explanation of this phenomenon X76 is more fully discussed below. Nonetheless, it is noteworthy that the presence of a Gam-producing plasmid inhibited b1453 I cli. Rsus5 recombination fivefold over that of the control plasmid, suggesting again that Gam alters one or more activities of the Jsus6 b1453 c1857 RecBC(D-) species. The role of RecF pathway genes in conjugational recom- FIG. 9. X activity determination. Diagrams are of phages used to bination within Gam+ hosts was investigated. Table 4 shows determine X activity as described in the text (and by Stahl and Stahl that recF has a small (twofold) to negligible effect on the [55]). The bl453 deletion removes X's red and int recombination recombination frequency. This is similar to the threefold systems; therefore, these phage recombine via the RecBCD path- effect seen previously (45). The effect of recJ is more way. X activity = [(turbid plaques,/clear plaques,) x (clear plaques2/ turbid plaques2)]112. This value is equal to unity if X is inactive; substantial, however, as it lowers the recombination fre- subscripts denote recombinant progeny in the crosses diagrammed. quency about 10-fold but not quite to the level seen in recBC hosts. This 10-fold effect is also observed when recJ is present in recD mutants (31). Thus, one or more of the components of the RecF pathway are involved in the recom- DISCUSSION bination seen in Gam+ hosts. Clearly, however, this does The lambda Gam protein inhibits all the known biochem- not imply that the RecF pathway is working alone in Gam+ ical activities of RecBCD. This report demonstrates that this hosts (as in sbcB mutants), since recB and recC are also inhibition includes RecBCD's helicase activity. Addition- required. ally, Gam inhibits X activity to the level observed in recBC Gam inhibits X activity. Previous studies have shown that hosts. Thus, one should clearly expect a Gam+ host to be X activity is reduced in X red gam+ crosses (relative to A red phenotypically a recBC null mutant. This is, in fact, true for gam) when the phages recombine via the RecBCD pathway many recBC phenotypes: support of T4 2- growth, ability to (55). Additionally, plasmid-borne Gam has been shown to plate A red gam in recA hosts, lack of P1 and P2 phage inhibit recombination in a X-containing interval of A red gam growth, production of linear plasmid multimers in sbcB phage but not in a different interval devoid of X (44). Here, a backgrounds, increased presence of inviable cells in culture, direct measurement of X activity in Gam+ hosts was per- increased UV sensitivity, and, as shown here, lack of ability formed, as diagrammed in Fig. 9. Crosses 1 and 2 are to mediate x-stimulated lambda recombination (13, 19, 44). identical except for the positions of the X sites. In cross 1, However, in other tests, Gam+ strains differ from recBC stimulation of recombination in the interval to the left of XD strains: recBC recF strains are extremely UV sensitive, would generate a greater number of turbid R+ J+ recombi- while Gam+ recF strains are only moderately sensitive nant progeny phage. In cross 2, the position of X would (19; this report), and Gam+ strains, unlike recBC strains, increase the relative number of clear R+ J+ progeny phage. are proficient at conjugational and Pl-mediated recombina- Thus, X activity can be measured by using the ratio of tion (22, 45; this report). It has been shown here that clear/turbid plaques in these crosses, as described in the these anomalies cannot be explained by the persistence of legend of Fig. 9 and by Stahl and Stahl (55). The results are RecBCD's helicase or X recognition activities in Gam+ shown in Table 5. The wild-type strain exhibited X activity, hosts. while a recD mutant did not, as expected. The same crosses One of the simplest explanations for these anomalies is performed in a wild-type Gam+ host showed inhibition of X that Gam+ hosts retain some residual RecBCD activity; activity to the extent seen in recBC and recD hosts. How- indeed, Gam never completely inhibits RecBCD activity in ever, while the numbers of recombinants produced in the vitro. This explanation seems unsatisfactory. It implies that recD host were down slightly (3-fold) relative to that of the a small fraction of RecBCD activity can perform nearly the wild-type host, the levels of recombinants were down 50-fold same amount of conjugational recombination as wild-type in wild-type Gam+ and recBC hosts. This result provides the levels of enzyme. Furthermore, no ATP-dependent exonu- major distinction between recD and Gam+ cells. Both are X clease activity is detectable in Gam+ host extracts even inactive but for different reasons. Thaler et al. (63) suggest when RecBCD is overproduced by a plasmid (data not that loss of RecD turns RecBC into an active "recombi- shown). Since, as shown here, the nuclease and helicase nase." Thus, recD mutants are suggested to possess a activities of RecBCD are inhibited by Gam to the same RecBC(D-) species that is always activated and therefore extent, it is likely that none of these activities persists in the cannot be activated by X. The data in Table 5 suggest that presence of Gam in vivo. Finally, one should consider the in Gam either prevents RecBCD from getting to X or, if it does vivo molar ratios. Depending on the specific activity of get there, from recognizing or cutting X. RecBCD used, Gam/RecBCD molar ratios of 2 to 8 in vitro VOL. 173, 1991 X Gam INHIBITION OF RecBCD HELICASE AND X ACTIVATION 5817

TABLE 5. X activity test (A Rsus5 xD x A Jsus6)

Relevant Plasmid Avg burst size' of: X activity Avg % recombinationb for: Hostgenotype (function) Cross 1 Cross 2 (SD) Cross 1 Cross 2 AB1157 Wild type pTP550 (none) 112 66 6.92 (±0.54) 12.1 9.2 KM353 recD pTP550 (none) 105 100 1.23 (±0.07) 4.8 2.2 AB1157 Wild type pKM590 (Gam) 131 114 1.49 (±0.12) 0.22 0.15 JC5519 recBC pTP550 (none) 116 108 1.19 (±0.19) 0.29 0.22 a Phage produced per infected cell. b Percent recombination = (titer on recD su/titer on recD su+) x 2. The crosses were performed three times; the average values given are 10%lo.

inhibit all enzymatic activities by 95%. In the in vivo of Gam on RecBCD-mediated X recombination in replica- experiments described here, Gam was being produced by a tion-blocked crosses. However, it is noteworthy that the multicopy plasmid under the control of Pla, within a host in crosses in both Gam+ and recBC hosts shown in Table 5 which the levels of RecBCD were calculated to be in the displayed identical decreases in the rate of recombination vicinity of 10 molecules per cell (59). Estimates from SDS- relative to that of wild type, a result that is consistent with a PAGE of Gam+ extracts (together with observations on the RecBCD-Gam species that is devoid of x-activated recom- relative strengths of P,a. and Ptac) suggest that Gam repre- binational proficiency. sents 0.2% of the total cellular protein in the experiments Interaction of Gam with the sbcC gene product. Mutations described in this paper. If so, the Gam/RecBCD molar ratio in sbcC allow X containing long palindromic DNA to repli- in vivo would be greater than 250. cate efficiently in E. coli (9). It is thought that the sbcC gene It was previously thought that the partial recBC pheno- product. is detrimental to some X replication intermediate types of Gam+ hosts were due to the production of GamS, that forms as a result of the presence of the palindrome. a smaller version of the supposed phage-encoded Gam Kulkarni and Stahl (26) have shown that these phage also protein (13, 19) which was thought to be incapable of grow in a wild-type strain containing a Gam-producing inactivating all of RecBCD's activities. This is not the case, plasmid. One interpretation of this observation is that the since the GamS species was purified in this study and shown sbcC gene product is a second target for Gam, which is to inhibit all the activities of RecBCD. The Gam-producing consistent with the DNA sequence identity between the plasmid pKM574 produces both GamL and GamS, though recBC genes and sbcC region open reading frames (39). GamS is the predominant species. Further comparisons of Could the recombinational proficiency of Gam+ cells be the the plasmid-derived GamS protein and the Gam protein result of Gam's inactivation of the sbcC gene product(s)? isolated from an induced lysogen will be needed to firmly The answer is probably not. Lloyd and Buckman showed identify the Gam species produced following X infections. that recB sbcC strains are not more proficient at conjuga- Gam's inhibition of X activity. Stahl and Stahl found tional recombination than recB strains (29). Furthermore, reduced but significant X activity (2.5) in X red gam+ crosses Hfr-mediated recombination and UV sensitivity are unaf- (55) compared with the lack of X activity in Gam-producing fected by the presence of Gam in recBC cells (45; this plasmid-containing hosts in this study. (In the former case, report). These observations suggest that, at least in the Gam was supplied by suppression of the gam210 amber absence of RecBCD, Gam's modification of the sbcC gene allele.) Lack of full suppression of RecBCD X activity in the product(s) (or any other potential target) is not responsible X red gam+ crosses could be due to a number of causes: for preserving the recombinational proficiency of Gam+ inadequate amber suppression efficiency, production of a hosts. This discussion does not rule out a role for inactiva- modified Gam protein (due to amber substitution), different tion of the sbcC gene product(s) in promoting recombination levels of Gam during the lytic program, or an alternate start in wild-type Gam+ strains (though it cannot be solely site for translation during infection. The most likely expla- responsible, since recombination is still dependent on nation for greater inhibition of X activity in Gam+ cells is the recBC). higher levels of Gam protein attainable in vivo when the Another possibility for the recombinational proficiency of protein is produced by a plasmid. It is not known if the small Gam+ hosts is that Gam mimics a recBC sbcB sbcC host by amount of X activity (1.49) found in Gam+ hosts is signifi- interfering with exonuclease I, the sbcB gene product, in cant. Measurements of X activity in Gam+ hosts in which addition to its interactions with RecBCD and the sbcC gene RecBCD is overproduced and in vitro X cutting assays are in product. In such a scenario, the RecF pathway would be progress to address this question. activated. However, two observations argue against such a Table 5 shows that Gam inhibits RecBCD's ability to possibility: (i) in vitro biochemical studies have shown that respond to X. A different interpretation of this observation is Gam does not inhibit exonuclease I (64; unpublished obser- suggested by lambda biology. Two pathways for generation vations), and (ii) conjugational recombination in the Gam+ of concatemeric phage DNA (the precursor to packaging) are host is unaffected by recF mutations (45; this report). recombination between monomeric circles and rolling-circle An unknown activity of RecBCD? A fourth explanation for replication (67). In wild-type (Gam-) hosts, in which rolling- the partial recBC phenotypes in Gam+ hosts described circle replication is not allowed, the recombinant pool is above is the presence of an unknown activity of RecBCD enriched for those phage that have undergone a recombina- that is refractory to inhibition by Gam. Amundsen et al. (1) tion event. This is not true for Gam+ strains, in which the describe a mutation in recB (recB2153) that retains all five rolling-circle mode of replication proceeds uninhibited. activities of RecBCD yet leaves the cell recombinationally Thus, the Gam+ host might be expected to exhibit a lower deficient, leading the authors to suggest that the mutation rate of X red recombination than wild-type strains exhibit. inactivates an unknown function of RecBCD. One could The best way to address this question is to examine the effect argue that Gam does the opposite: it leaves this unknown 5818 MURPHY J. BACTERIOL.

function intact while inactivating all the other known activ- large linear multimers by virtue of the rolling-circle mode of ities. replication and can effectively compete with plasmid multi- The nature of this unknown activity is purely speculative. mers for RecBC(D-) enzyme. Possibilities include the following. (i) An inherent activity of RecBCD's role in UV damage repair. What activities of RecBCD may have escaped detection because of our lack of RecBCD are involved in repair of damage due to UV? The knowledge of the appropriate substrates. Such substrates UV resistance of recD strains suggests that RecBCD exonu- might include specialized Holliday-type recombination inter- clease is expendable for RecBC-promoted repair as long as mediates (14, 61). (ii) RecBCD may exist in vivo as part of a RecJ exonuclease (30) is available. If both RecBCD and more highly ordered structure (akin to DNA polymerase III RecJ exonucleases are missing, UV sensitivity increases holoenzyme) which contains an activity by virtue of the dramatically (31; this report). One possibility for the extreme mere presence of RecBCD regardless of whether the sensitivity of recD recJ mutants it that one or the other of RecBCD is active or inhibited by Gam. Interestingly, a these exonucleases is necessary for full induction of the SOS complex of RecBC(D?) and DNA polymerase I has been response (and, thus, the SOS-inducible uvrABC excision reported to be partially purified from E. coli (49), and a repair pathway). RecBCD exonuclease is known not to be recB-dependent DNA-polymerizing activity has been identi- necessary for induction of the SOS response after UV fied by Syvaoja (57). It may be this (or a similar) activity irradiation (35) but may become necessary in the absence of which remains intact in Gam+ hosts and accounts for the RecJ exonuclease. Alternatively, the exonuclease functions wild-type levels of conjugational recombination seen in the may be interchangeable and play a direct role in postrepli- presence of Gam. Genetic analyses have also linked cation repair events. These two possibilities are not mutually RecBCD to DNA polymerase I. recBC polA double mutants exclusive. are lethal (27), phage devoid of their RecBCD-modifying The roles of the helicase and endonuclease activities of functions (A gam and P22 abc) fail to grow on polA strains RecBCD in UV repair appear to be relatively minor; this (38, 67), and both recBC and polA are involved in the repair conclusion is suggested by the observation that the UV of double-stranded breaks after exposure to UV light (52). sensitivities of wild-type, recD, and recF strains are in- The significance of these observations with regard to a creased only 6- to 10-fold by Gam. Since RecBCD is not possible physical link of RecBCD with DNA polymerase I necessary for SOS induction in response to UV, this sensi- has yet to be determined. (iii) The unknown activity may be tization is not due to inhibition of the SOS response. (This part of a protein complex that includes RecB and/or RecC contrasts with the effect of Gam on SOS induction in independent of the RecBCD timer. (iv) Finally, Gam may response to nalidixic acid, a replication inhibitor that makes promote the association of RecBCD with another subunit in E. coli dependent on RecBCD for SOS induction [35]. In this vivo. Thus, the unknown activity might exist only in the case, Gam does inhibit the SOS response [19].) More likely, Gam+ host. This suggests that it might be possible to the relatively small effect of Gam in sensitizing E. coli to UV activate some recombinationally inactive recBC mutants may reflect relatively low levels of UV-induced DNA dou- simply by the production of Gam in vivo. ble-stranded breaks, the proposed target for RecBCD post- Effects of Gam in plasmid-containing recD strains. recD replication repair activities (65). Since the ssDNA endonu- strains, like wild-type cells, are proficient for conjugational clease function is known not to be sufficient for the repair of recombination. However, the presence of plasmids in recD UV-induced damage (27), Gam's sensitization of recD strains but not in wild-type cells severely inhibits conjuga- strains to UV implicates the helicase function of RecBCD in tional recombination (this report). In all likelihood, this has the repair of double-stranded breaks. In keeping with these to do with the presence of large linear multimers in recD assignments, the increased sensitivity of Gam+ recJ strains strains (5, 40). Linear plasmid multimers could act as com- relative to that of recD recJ strains may reflect the inhibition petitive inhibitors for the recombinational machinery that of both SOS induction and dsDNA break repair. normally processes incoming F-factor DNA. RecBC(D-) Finally, an as-yet-uncharacterized activity of RecBCD would be engaged in initiating and/or resolving recombina- may have a role in survival of UV-irradiated E. coli. This tion events between plasmid multimers, leaving little en- activity is hinted at by the difference in UV survival rates of zyme available to promote recombination between donor Gam+ recF hosts and recBC recF strains, a difference which and recipient (chromosomal) DNAs. On the other hand, cannot be due to RecBC(D-) helicase or endonuclease wild-type Gam+ strains are proficient at conjugational re- (since these activities are inhibited by Gam). combination in the presence of plasmids. (Here, the gam- Both the RecBCD and RecF pathways are involved in expressing plasmid supplies Gam protein and acts as a postreplication repair of UV-irradiated DNA. RecBCD is potential substrate for multimerization.) In accordance with thought to act at double-stranded breaks, while RecF is the model described above, this proficiency suggests that primarily involved in the repair of DNA daughter strand Gam does not produce large amounts of linear plasmid gaps; hence the extreme sensitivity of recBC recF double multimers in wild-type strains. While plasmid-borne Gam mutants (23, 65, 66). Double-stranded breaks with long protein has been shown to induce the generation of linear ssDNA tails (generated by ssDNA endonucleolytic cleavage plasmid multimers in sbcB backgrounds (13, 44), it is not within a large daughter strand gap) are repaired by either the known if this occurs to the same extent, if at all, in wild-type RecBCD or the RecF pathway (65). In the RecBCD repair cells. In this situation, Gam might mimic the effect of a pathway, the ssDNA tails are processed by either RecBCD recBC mutant, in which few (13) or no (40) plasmid multi- ssDNA exonuclease or exonuclease I to form flush double- mers were detected in the absence of sbcB. If so, plasmids, stranded ends, the preferred substrate for RecBCD (60). The unable to form large amounts of linear multimers, would not RecF pathway has been suggested to act directly on sub- be expected to act as competitive inhibitors of conjugational strates containing ssDNA (20, 47). The sbcB mutation (de- recombination in Gam+ strains. In apparent accord with this creased exonuclease I activity) restores UV resistance to line of reasoning, X recombination is only slightly affected recBC mutants by preventing digestion of 3' single-stranded (down threefold [Table 5]) by the presence of plasmids in tails, thus allowing more of these substrates to enter the recD hosts, possibly because A itself is capable of forming RecF pathway (66). A prediction of this mechanism is that an VOL.V173, 1991 Gam INHIBITION OF RecBCD HELICASE AND X ACTIVATION 5819 sbcB mutation would sensitize recD recF and Gam+ recF not the case for Hfr-mediated and transductional recombi- hosts since no exonuclease function would be available to nations, in which Gam has little effect. This distinction might process these substrates for use in the RecBC(D-) or reflect a fundamental difference in the recombination mech- RecBCD-Gam pathway, respectively. This possibility is anisms of these processes. One of these differences may currently under investigation. involve reciprocality, which demands that both complemen- Do recD mutants contain RecBC helicase activity? There tary products of a recombination event be represented after has been some controversy over whether recD mutants resolution of the recombination intermediate. Models of possess a RecBC(D-) species that can unwind DNA. Chaud- RecBCD-promoted A red gam recombination involve recip- hury and Smith (12) have shown that recBCt hosts (which rocal exchanges between two recombining (mutant) A phage either lack RecD or possess an altered orientation of RecD (whether RecBCD is thought to initiate [54] or resolve [56] within the enzyme complex due to a mutation in recC) such recombinants), where both wild type and its comple- induce the SOS response after exposure to nalidixic acid, an ment (the double mutant) survive the exchange. One current event known to require RecBCD (35). Since recBCt strains model of conjugational recombination proposes initiation of lack exonuclease activity (2, 11) and the ssDNA endonucle- replication at the site of the crossover, resulting in nonre- ase activity of RecBCD is not sufficient for SOS induction ciprocal resolution of recombinational intermediates (see (24), they suggested that this response is due to RecBC(D-) Smith [54] for details). Mahan and Roth have studied the role helicase activity. Along the same line of reasoning, the fact of reciprocality in RecBCD-promoted events (33). They that Gam inhibits RecBCD helicase activity in vitro and found that recombination events that require a fully recipro- increases the sensitivity of recD hosts to UV light (this cal exchange are stimulated by the recBC function; those report) lends support to the hypothesis that RecBC(D-) that do not are independent of recBC. Thus, Gam's inhibi- retains helicase activity in vivo [and, furthermore, that Gam tion of A recombination but not of conjugational recombina- can interact with the RecBC(D-) species]. On the other tion may reflect X's dependency on reciprocal exchange. hand, Amundsen et al. (1) reported that unwinding activity Why can't this distinction be observed in recBC mutants? could not be detected in recBCt mutant extracts. (They The reason might be that Gam inactivates those functions of detected RecBCD unwinding activity within cell extracts by RecBCD required for reciprocal exchanges but leaves intact using a gel mobility shift assay similar to the one described in an unknown function (which is inactivated in recBC mu- this paper.) However, this observation is not surprising in tants) that is critical for the generation of conjugational light of the salt sensitivity of the RecBC(D-) helicase recombinants. activity in vitro (41), which would probably make this RecBCD-Gam recombination pathway. What conjugational activity hard to detect in extracts (especially in the absence recombination pathway is active in Gam+ hosts? By formal of SSB). Amundsen et al. (1) also described a class of definition, it is not the RecBCD, RecBCt, or RecF pathway. RecBCD mutations (class I) that show unwinding activity Like the RecBCD and RecBCt pathways, it is dependent on yet lack detectable exonuclease. These mutants block the recB and recC. However, unlike the RecBCD pathway, it is growth of T4 2- phage, leading the authors to suggest that partially dependent on recJ. While the RecBCt and the unwinding activity of RecBCD is sufficient for blocking RecBCD-Gam pathways are only slightly deficient for con- T4 2- phage production. By comparison, recBCt mutants do jugational recombination (11, 45; this report), only the latter allow growth of T4 2-. The authors infer, therefore, that is deficient in A red gam recombination (this report). Also, recBCt hosts do not retain helicase activity in vivo. This unlike the RecF pathway, the RecBCD-Gam pathway is only discrepancy can be explained by the possibility, as the slightly affected by recF mutations. Finally, it cannot be the authors suggest, that the class I mutant's altered exonucle- RecE pathway, since the strains used in this report do not ase degrades DNA to a form which is not acid soluble and is contain the rac prophage. Clearly, the RecBCD-Gam path- therefore undetectable in their assays. An "altered" exonu- way, like the RecBCt pathway, makes use of components clease, which nicks every 400 to 500 bp instead of every 4 to from both the RecBCD and RecF pathways; this complexity 5 bp, would not be detected by an assay that measures serves to highlight the extensive overlap among the formal acid-soluble nucleotides but would probably not allow the pathways of recombination in E. coli. growth of T4 2- mutants. The purification of a class I RecBCD enzyme and analysis of its exonuclease functions ACKNOWLEDGMENTS should answer this question. generated by RecBC(D-) in I thank A. J. Clark, S. Lovett, M. Marinus, F. Stahl, and M. Whether ssDNA is actually Volkert for strains; S. Kushner for the RecBCD-producing plasmid; vivo may depend on the in vivo levels of ssDNA binding and A. R. Poteete for comments on the manuscript. proteins. Demonstration of RecBC(D-) helicase activity This research was supported by Public Health Service grant required the presence of SSB (41). It is possible that A118234 and a Joseph P. Healy endowment grant from the Univer- RecBC(D-) tightly couples rewinding to unwinding and sity of Massachusetts. moves through DNA, under conditions of low levels of SSB or RecA, with no net unwinding. If this is so, RecBC(D-) REFERENCES helicase activity during an SOS response (when recA is 1. Amundsen, S. K., A. M. Neinan, S. M. Thibodeaux, and G. R. induced) and the proposed movement through dsDNA with Smith. 1990. Genetic dissection of the biochemical activities of no net unwinding during A recombination (56, 63) are not RecBCD enzyme. Genetics 126:25-40. incompatible functions for the RecBC(D-) enzyme. 2. Amundsen, S. K., A. F. Taylor, A. M. Chaudhury, and G. R. essential third subunit of Phage versus conjugational recombination in Gam+ host. It Smith. 1986. recD: the gene for an phage recombination exonuclease V. Proc. Natl. Acad. Sci. USA 83:5558-5562. has been argued that the existence of 3. Barbour, S. D., and A. J. Clark. 1970. Biochemical and genetic systems is due to the fact that most phage have to deactivate studies of recombination proficiency in Escherichia coli. I. the host recombination system (i.e., RecBCD) for survival Enzymatic activity associated with the recB+ and recC+ genes. (25). This may be true for lambda, since as far as the phage Proc. Natl. Acad. Sci. USA 65:955-961. is concerned, production of Gam in vivo completely mimics 4. Benzinger, R., L. W. Enquist, and A. Skalka. 1975. Transfection the effects of null mutations in recBC (Table 5), but this is ofEscherichia coli spheroplasts. V. Activity of RecBC nuclease 5820 MURPHY J. BACTERIOL.

in rec+ and rec- spheroplast measured with different forms of recB and recC mutants. J. Bacteriol. 120:1213-1218. bacteriophage DNA. J. Virol. 15:861-871. 28. Kushner, S. R. 1974. Differential thermolability of exonuclease 5. Biek, D. P., and S. N. Cohen. 1986. Identification and charac- and endonuclease activities of the RecBC nuclease isolated terization of recD, a gene affecting plasmid maintenance and from thermosensitive recB and recC mutants. J. Bacteriol. recombination in Escherichia coli. J. Bacteriol. 167:594-603. 120:1219-1222. 6. Bochner, B. R., H. Huang, G. L. Schieven, and B. N. Ames. 29. Lloyd, R. G., and C. Buckman. 1985. Identification and genetic 1980. Positive selection for the loss of tetracycline resistance. J. analysis of sbcC mutations in commonly used recBC sbcB Bacteriol. 143:926-933. strains of Escherichia coli K-12. J. Bacteriol. 164:836-844. 7. Bradford, M. M. 1976. A rapid and sensitive method for the 30. Lovett, S. T., and R. D. Kolodner. 1989. Identification and quantitation of microgram quantities of protein utilizing the purification of a single-stranded-DNA-specific exonuclease en- principle of protein-dye binding. Anal. Biochem. 72:248-254. coded by the recJ gene of Escherichia coli. Proc. Natl. Acad. 8. Brent, R., and M. Ptashne. 1981. Mechanism of action of the Sci. USA 86:2627-2631. lexA gene product. Proc. Natl. Acad. Sci. USA 78:4204-4208. 31. Lovett, S. T., C. Luisi-DeLuca, and R. D. Kolodner. 1988. The 9. Chalker, A. F., D. R. F. Leach, and R. G. Lloyd. 1988. genetic dependence of recombination in recD mutants of Esch- Escherichia coli sbcC mutants permit stable propagation of erichia coli. Genetics 120:37-45. DNA replicons containing a long palindrome. Gene 71:201-205. 32. Mackay, V., and S. Linn. 1976. Selective inhibition of the 10. Chaudhury, A. M., and G. R. Smith. 1984. Escherichia coli DNase activity of the recBC enzyme by the DNA binding recBC deletion mutants. J. Bacteriol. 160:788-791. protein from Escherichia coli. J. Biol. Chem. 251:3716-3719. 11. Chaudhury, A. M., and G. R. Smith. 1984. A new class of 33. Mahan, M. J., and J. R. Roth. 1989. Role of recBC function in Escherichia coli recBC mutants: implications for the role of formation of chromosomal rearrangements: a two step model RecBC enzyme in homologous recombination. Proc. Natl. for recombination. Genetics 121:433-443. Acad. Sci. USA 81:7850-7854. 34. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular 12. Chaudhury, A. M., and G. R. Smith. 1985. Role of Escherichia cloning: a laboratory manual. Cold Spring Harbor Laboratory, coli RecBC enzyme in SOS induction. Mol. Gen. Genet. 201: Cold Spring Harbor, N.Y. 525-528. 35. McPartland, A., L. Green, and H. Echols. 1980. Control of recA 13. Cohen, A., and A. J. Clark. 1986. Synthesis of linear plasmid gene RNA in E. coli: regulatory and signal genes. Cell 20:731- multimers in Escherichia coli K-12. J. Bacteriol. 167:327-335. 737. 14. Cox, M., and I. R. Lehman. 1987. Enzymes of general recom- 36. Muench, K. H. 1971. Preparation and purification of nucleic bination. Annu. Rev. Biochem. 56:229-262. acids, p. 515-523. In G. L. Cantoni, and D. R. Davies (ed.), 15. Dykstra, C. C., D. Prashner, and S. R. Kushner. 1984. Physical Procedures in nucleic acid research, vol. 2. Harper and Row, and biochemical analysis of the cloned recB and recC genes of New York. Escherichia coli K-12. J. Bacteriol. 157:21-27. 37. Murphy, K. C., L. Casey, N. Yannoutsos, A. R. Poteete, and 16. Finch, P. W., A. Storey, K. Brown, I. D. Hickson, and P. T. R. W. Hendrix. 1987. Localization of a DNA-binding determi- Emmerson. 1986. Complete nucleotide sequence of recD, the nant in the bacteriophage P22 Erf protein. J. Mol. Biol. 194:105- structural gene for the a subunit of exonuclease V of Esche- 117. richia coli. Nucleic Acids Res. 14:8583-8594. 38. Murphy, K. C., A. C. Fenton, and A. R. Poteete. 1987. Sequence 17. Finch, P. W., A. Storey, K. E. Chapman, K. Brown, I. D. of the bacteriophage P22 anti-RecBCD (abc) genes and proper- Hickson, and P. T. Emmerson. 1986. Complete nucleotide ties of P22 abc region deletion mutants. Virology 160:456-464. sequence of the Escherichia coli recB gene. Nucleic Acids Res. 39. Naom, I. S., S. J. Morton, D. R. F. Leach, and R. G. Lloyd. 14:8573-8582. 1989. Molecular organization of sbcC, a gene that affects genetic 18. Finch, P. W., R. E. Wilson, K. Brown, I. D. Hickson, A. E. recombination and the viability of DNA palindromes in Esche- Tomkinson, and P. T. Emmerson. 1986. Complete nucleotide richia coli K-12. Nucleic Acids Res. 17:8033-8045. sequence of the Escherichia coli recC gene and of the thyA-recC 40. Niki, H., T. Ogura, and S. Hiraga. 1990. Linear multimer intergenic region. Nucleic Acids Res. 14:4437-4451. formation of plasmid DNA in Escherichia coli hopE (recD) 19. Friedman, S. A., and J. B. Hays. 1986. Selective inhibition of mutants. Mol. Gen. Genet. 224:1-9. Escherichia coli RecBC activities by plasmid-encoded GamS 41. Palas, K. M., and S. R. Kushner. 1990. Biochemical and function of phage lambda. Gene 43:255-263. physical characterization of exonuclease V from Escherichia 20. Ganesan, A. K., and P. C. Seawell. 1975. The effect of lexA and coli. J. Biol. Chem. 265:3447-3454. recF mutations on post-replication repair and DNA synthesis in 42. Ponticelli, A. S., D. W. Schultz, A. F. Taylor, and G. R. Smith. Escherichia coli K-12. Mol. Gen. Genet. 141:189-206. 1985. Chi-dependent DNA strand cleavage by RecBC enzyme. 21. Goldmark, P. J., and S. Linn. 1970. An endonuclease activity Cell 41:145-151. from Escherichia coli absent from certain rec- strains. Proc. 43. Poteete, A. R., and A. C. Fenton. 1984. K red-dependent growth Natl. Acad. Sci. USA 67:434 441. and recombination of phage P22. Virology 134:161-167. 22. Hays, J. B., T. A. G. Smith, S. A. Friedman, E. Lee, and G. L. 44. Poteete, A. R., A. C. Fenton, and K. C. Murphy. 1988. Modu- Coffman. 1984. RecF and RecBC function during recombination lation of Escherichia coli RecBCD activity by the bacteriophage of nonreplicating, UV-irradiated phage X DNA and during other A Gam and P22 Abc functions. J. Bacteriol. 170:2012-2021. recombination processes. Cold Spring Harbor Symp. Quant. 45. Poteete, A. R., and M. R. Volkert. 1988. Activation of recF- Biol. 49:475-483. dependent recombination in Escherichia coli by bacteriophage X 23. Horii, Z., and A. J. Clark. 1973. Genetic analysis of the recF and P22-encoded functions. J. Bacteriol. 170:4379-4381. pathway to genetic recombination in Escherichia coli K12: 46. Roman, L. J., and S. C. Kowalczykowski. 1989. Characterization isolation and characterization of mutants. J. Mol. Biol. 80:327- of the helicase assay of the Escherichia coli RecBCD enzyme 344. using a novel helicase assay. Biochemistry 28:2863-2873. 24. Karu, A. E., and E. D. Belk. 1982. Induction of E. coli recA 47. Rothman, R. H., and A. J. Clark. 1977. The dependence of protein via recBC and alternate pathways: quantitation by postreplication repair on uvrB in a recF mutant of Escherichia enzyme-linked immunosorbent assay (ELISA). Mol. Gen. coli K-12. Mol. Gen. Genet. 155:279-286. Genet. 185:275-282. 48. Schagger, H., and G. von Jagow. 1987. Tricine-sodium dodecyl 25. Karu, A. E., Y. Sakaki, H. Echols, and S. Linn. 1975. The -y sulfate-polyacrylamide gel electrophoresis for separation of protein specified by bacteriophage X. J. Biol. Chem. 250:7377- proteins in the range from 1 to 100 kDa. Anal. Biochem. 7387. 166:368-379. 26. Kulkarni, S. K., and F. W. Stahl. 1989. Interaction between the 49. Scharff, R., M. A. Hanson, and R. W. Hendler. 1983. A cellular sbcC gene of Escherichia coli and the gam gene of phage X. factor involved in the formation of a DNA-synthesizing complex Genetics 123:249-253. from DNA polymerase I in Escherichia coli. Biochim. Biophys. 27. Kushner, S. R. 1974. In vivo studies of temperature-sensitive Acta 739:265-275. VOL. 173, 1991 X Gam INHIBITION OF RecBCD HELICASE AND X ACTIVATION 5821

50. Schultz, D. W., A. F. Taylor, and G. R. Smith. 1983. Escherichia DNA unwinding activity of the RecBC enzyme of Escherichia coli RecBC pseudorevertants lacking Chi recombinational hot- coli. J. Mol. Biol. 185:431-443. spot activity. J. Bacteriol. 155:664-680. 61. Taylor, A. F., and G. R. Smith. 1990. Action of RecBCD 51. Semerjian, A. V., D. C. Mafloy, and A. R. Poteete. 1989. Genetic enzyme on cruciform DNA. J. Mol. Biol. 211:117-134. structure of the bacteriophage P22 PL operon. J. Mol. Biol. 62. Telander-Muskavitch, K. M., and S. Linn. 1981. recBC-like 207:1-13. enzymes: exonuclease V deoxyribonuclease, p. 233-250. In P. 52. Sharma, R. C., and K. C. Smith. 1987. Role of DNA polymerase Boyer (ed.), The enzymes, vol. XIV. Academic Press, Inc., I in postreplication repair: a reexamination with Escherichia coli Orlando, Fla. 4polA. J. Bacteriol. 169:4559-4564. 63. Thaler, D. S., E. Sampson, I. Siddiqi, S. M. Rosenberg, L. C. 53. Smith, G. R. 1988. Homologous recombination in procaryotes. Thomason, F. W. Stahl, and M. M. Stahl. 1989. Recombination Microbiol. Rev. 52:1-28. of bacteriophage X in recD mutants of Escherichia coli. Genome 54. Smith, G. R. 1991. Conjugational recombination in E. coli: 31:53-67. myths and mechanisms. Cell 64:19-27. 64. Unger, R. C., and A. J. Clark. 1972. Interaction of the recom- 55. Stahl, F. W., and M. M. Stahl. 1977. Recombination pathway X specificity of Chi. Genetics 86:715-725. bination pathways of bacteriophage and its host Escherichia coli K-12: effects on exonuclease V activity. J. Mol. Biol. 56. Stahl, F. W., L. C. Thomason, I. Siddiqi, and M. M. Stahl. 1990. 70:539-548. Further tests of a recombination model in which X removes the RecD subunit from the RecBCD enzyme in Escherichia coli. 65. Wang, T. V., and K. C. Smith. 1983. Mechanisms for recF- Genetics 126:519-533. dependent and recB-dependent pathways of postreplication 57. Syvaoja, J. E. 1987. ATP-stimulated polymerase activity involv- repair in UV-irradiated Escherichia coli uvrB. J. Bacteriol. ing DNA polymerase I and a recB-dependent factor in extracts 156:1093-1098. of Escherichia coli cells. Acta Chem. Scand. Ser. B 41:332-335. 66. Wang, T. V., and K. C. Smith. 1985. Mechanism of sbcB- 58. Taylor, A. F. 1988. RecBCD enzyme of Escherichia coli, p. suppression of the recBC-deficiency in postreplication repair in 231-263. In R. Kucherlapati and G. R. Smith (ed.), Genetic UV-irradiated Escherichia coli K-12. Mol. Gen. Genet. 201: recombination. American Society for Microbiology, Washing- 186-191. ton, D.C. 67. Zissler, J., E. Singer, and F. Schaefer. 1971. The role of recom- 59. Taylor, A. F., and G. R. Smith. 1980. Unwinding and rewinding bination in the growth of bacteriophage X. I. The gamma gene, p. of DNA by the RecBC enzyme. Cell 22:447-457. 455-468. In A. D. Hershey (ed.), The bacteriophage lambda. 60. Taylor, A. F., and G. R. Smith. 1985. Substrate specificity of the Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.