Nucleotide Sequence and Phylogenetic Analysis of a Bamboo Mosaic Potexvirus Isolate from Common Bamboo (Bambusa Vulgaris Mcclure)
Total Page：16
File Type：pdf, Size：1020Kb
YangBot. Bull. et al. Acad. Nucleotide Sin. (1997) sequence 38: 77-84 of BaMV-V RNA 77 Nucleotide sequence and phylogenetic analysis of a bamboo mosaic potexvirus isolate from common bamboo (Bambusa vulgaris McClure) Chi-Chen Yang1,2, Jih-Shiou Liu1, Chan-Pin Lin2 and Na-Sheng Lin1,3 1Institute of Botany, Academia Sinica, Taipei, Taiwan 115, Republic of China 2Department of Plant Pathology and Entomology, National Taiwan University, Taipei, Taiwan, Republic of China (Received September 20, 1996; Accepted January 30, 1997) Abstract. The complete cDNA sequence corresponding to the genomic RNA of an isolate bamboo mosaic potexvirus (BaMV-V) from common bamboo (Bambusa vulgaris McClure) was determined. This isolate is the first potexvirus with which a satellite RNA has been associated. The genome organization of BaMV-V, similar to those of other potexviruses, contained five open reading frames (ORFs 15) coding for polypeptides with molecular weight of 156 kDa, 28 kDa, 13 kDa, 6 kDa, and 25 kDa, respectively. Nucleotide sequence analysis showed a 10.0% difference from the BaMV-O isolate previously described whereas the amino acid comparison showed a difference of 3.2%. When three conservative domains of RNA dependent RNA polymerase (RdRp) were used for phylogenetic analysis, the greatest variation between two strains of each virus was only 12.8% of that between the two closest members of the potexvirus group. The grouping of potexviruses distinct from other groups of plant viruses was also confirmed by a comparision of three conservative motifs of RdRp. Keywords: Bamboo mosaic virus; Nucleotide sequence; Potexvirus. Introduction virus M, PVM) (Zavriev et al., 1991), hordeivirus (e.g. barley stripe mosaic virus, BSMV) (Gustafson and Bamboo mosaic virus (BaMV), a member of the Armour, 1986), furovirus (e.g. beet necrotic yellow vein potexvirus group, has a flexuous rod-shaped morphology virus, BNYVV) (Bouzoubaa et al., 1986) and Nicotiana of 490 nm in length and contains a single-stranded posi- velutina mosaic virus (NVMV) (Randles and Rohde, tive-sense RNA genome (Lin et al., 1977; 1992; 1994). 1990). ORF 5 encodes the capsid protein of the virus. An The complete nucleotide sequence of BaMV from green ORF 6 has been proposed within the coding region of ORF bamboo (Bambusa oldhamii Munro) (isolate BaMV-O) 1 in papaya mosaic virus (PMV) (Sit et al., 1989), clover has been reported (Lin et al., 1994). The RNA genome yellow mosaic virus (CYMV) (Sit et al., 1990), foxtail of BaMV-O is 6366 nucleotides long (excluding poly (A) mosaic virus (FMV) (Bancroft et al., 1991), potato aucuba tail) and contains six putative open reading frames (ORFs mosaic virus (PAMV) (Xu et al., 1994) and BaMV-O (Lin 16) coding for polypeptides with molecular weights of et al., 1994) whereas in narcissus mosaic virus (NMV) 155 kDa, 28 kDa, 13 kDa, 6 kDa, 25 kDa, and 14 kDa, (Zuidema et al., 1989), white clover mosaic virus respectively. The ORFs 15 are common in potexviruses (WClMV) (Beck et al., 1990) and strawberry mild yellow while ORF 6 is divergent. edge-associated virus (SMYEAV) (Jelkmann et al., 1992) The ORF 1 encodes RNA dependent RNA polymerase an ORF 6 is proposed within or downstream of the coding (RdRp), which contains three conservative domains region of the capsid protein gene. However, the function methyltransferase, nucleotide-binding, and polymerase of the putative ORF 6 remains unknown. common in positive strand RNA viruses (Koonin and Within the potexvirus group, the overall nucleotide se- Dolja, 1993). ORFs 24 constitute the triple gene block quence difference among strains of potato virus X (PVX) and are involved in movement of the virus (Beck et al., ranges from 3.7% between X3 (Huisman et al., 1988) and 1991; Angell et al., 1996). Triple gene block occurs not Russian (Skryabin et al., 1988a) strains to 22.6% between only in potexviruses but also in carlaviruses (e.g. potato Russian and Andean (Orman et al., 1990) strains. On the other hand, the nucleotide sequences of the two strains of WClMV, strain M (Forster et al., 1988) and strain O (Beck 3Corresponding author. Fax: 886-2-782-7954; E-mail: et al., 1990), have a 12% divergency. The overall differ- [email protected] ences in their encoded proteins range from 1.8% to 11.2% 4Sequence data reported from this article have been deposited among strains of PVX and 4.4% in the two strains of to the EMBL/GenBank Data Libraries under Accession No. WClMV. L77962. bot382-02.P65 77 2001/3/27, AM 10:36 78 Botanical Bulletin of Academia Sinica, Vol. 38, 1997 Recently a satellite RNA (satBaMV) was identified in cDNA Synthesis, Cloning and Sequencing a BaMV isolate of common bamboo (B. vulgare McClure) Reverse-transcription polymerase chain reaction (RT- (designated BaMV-V) (Lin and Hsu, 1994). SatBaMV was PCR) was performed for the generation of cDNA of encapsidated with the BaMV-V capsid protein, which se- BaMV-L RNA (Sambrook et al., 1989). Primer B21 rologically reacted with anti-BaMV-O capsid protein se- (ACGGGAGCTC(T) , with a SacI site at the 5' end) and 15 rum (Lin and Hsu, 1994). Moreover, both genomic RNAs B36 (GCTATGTGCTTGCCAGCGGA, nts 31133132 of BaMV-O and BaMV-V support the replication of based on BaMV-O RNA) (Lin et al., 1994) were used to satBaMV (Lin and Hsu, 1994). It was also found that the amplify the 3' half fragment; whereas primer B33 capsid protein of BaMV-V encapsidates its subgenomic (TGCGGATCCTAATACGACTCACTATAGAAAAGCA RNAs whereas the BaMV-O isolate does not (Lin et al., TTCCAAAC, 5' terminal nt 116 with a BamHI site at unpubl. data). In this report, the complete nucleotide se- the 5' end and a T7 promoter in italic) and B35 quence of genomic RNA of BaMV-V was determined. The (TTCCAATGCGTGTCCACCCA, complementary to nts comparison of potexvirus strains, the grouping of mem- 34733492 based on BaMV-O RNA) were used to am- bers within the potexvirus group, and their phylogenetic plify the 5' half fragment (Figure 1). The amplified frag- relationships to three conservative domains of RdRp are ments were gel-eluted and then cloned into a TA cloning also presented. vector (TA Cloning Kit, Invitrogen Co., San Diego, CA). A common BstXI site in the overlapping region of these Materials and Methods two clones was used to cut the fragments and the subse- quent ligation reaction for the full-length cDNA construc- Virus Purification and RNA Extraction tion. The full-length cDNA was then cloned into the SacI BaMV-V is an isolate with satellite RNA from com- site of pUC119. Sequencing of the cDNA insert was per- mon bamboo (B. vulgaris) (Lin and Hsu, 1994). BaMV-L formed as described by Wang et al. (1988). (previously designated BaMV-V/S-) (Lin and Hsu, 1994) is the satellite-free isolate derived from BaMV-V. The pu- Sequence Data and Phylogenetic Analysis rification of BaMV and the viral RNA were as described The nucleotide sequence of BaMV-V was aligned with previously (Lin and Chen, 1991; Lin et al., 1992). BaMV-O manually. Gaps were introduced to optimize the alignment. Putative ORFs were analyzed by the computer RNA Sequencing program DNA Strider 1.2 (Marck, 1988). Three conser- The method used to determine RNA direct sequencing vative motifs in ORF 1, i.e. methlytransferase domain was as described in Fichot and Girard (1990). Primer B14 (Rozanov et al., 1992), NTP-binding domain (Hodgman, (CCGTTCAAGCGTGTTTGC) complementary to BaMV- 1988; Gorbalenya et al., 1989), and polymerase domain O nucleotide 236253 (Lin et al., 1994) was used to de- (Argos, 1988; Koonin, 1991) were used for phylogenetic termine the 5' terminal sequence of BaMV-L RNA. analysis among strains and members of the potexvirus Sequence data were then used for the synthesis of primer group. Other plant virus groups with the triple gene block B33 (see next section) for the construction of the 5' end and the closely related tymovirus group (Koonin and Dolja, cDNA clone pBaL1-8. 1993) were used to compare the solidity of the grouping Figure 1. Cloning strategy and genome organization of BaMV-V genomic RNA. (a) Synthetic primers used for the construction of cDNA clones of the 5' end (pBaL18), the 3' end (pBaL23B) and the full-length fragment (pBa19) of BaMV-V genomic RNA. (b) Genome organization and the putative five ORFs. The start and end codons for each ORF are indicated. bot382-02.P65 78 2001/3/27, AM 10:37 Yang et al. Nucleotide sequence of BaMV-V RNA 79 of potexviruses. Alignment of amino acid residues and showed four gaps in this region. The imperfect repeat of phylogenetic tree calculations were done by the program the pentanucleotide GAAAA, which is proposed as an Clustal W (Thompson et al., 1994). Tree-drawings were encapsidation signal found in PMV (Lok and AbouHaidar, done by the program NJPlot (Gouy, 1995). 1986), is not present in the two BaMV isolates. However, the adenosine-adenosine dinucleotides at the third and Results and Discussion fourth positions of the 5' end pentanucleotide repeat, an important feature for assembly in PMV (Sit et al., 1994), Direct RNA Sequencing and Full-Length cDNA are present. Interestingly, satBaMV, which shares 63% se- Clone quence homology with BaMV-O in their 5' end untranslated regions, does retain the three consecutive RNA direct sequencing of the 5' extreme using primer pentanucleotides with AA dinucleotides in its third and B14 revealed the 5' terminal sequence, 5'- fourth positions and was encapsidated with capsid protein GAAAAGCAUUCCAAAC-3'. This sequence was used to of BaMV into rod-shaped particles (Lin and Hsu, 1994). synthesize the primer B33 for the construction of 5'-half No obvious RNA secondary structures such as those pro- cDNA clones.