DOCSLIB.ORG

Sponge-Associated Bacteria: Specificity, Diversity and Antimicrobial Potential

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

SPONGE-ASSOCIATED BACTERIA: SPECIFICITY, DIVERSITY AND ANTIMICROBIAL POTENTIAL Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultät der Christian-Albrechts-Universität zu Kiel vorgelegt von Dipl.-Biol. Vera Thiel Kiel 2006 Referent/in: Prof. Dr. Johannes F. Imhoff Korreferent/in: Prof. Dr. Peter Schönheit Tag der mündlichen Prüfung: 10. November 2006 Zum Druck genehmigt: Kiel, 10. November 2006 Der Dekan TABLE OF CONTENTS Summary ...........................................................................................................................1 Zusammenfassung ..................................................................................................................2 General Introduction...............................................................................................................4 Theoretical background..............................................................................................4 Sponge-associated bacteria.........................................................................................8 Aim of the thesis.......................................................................................................13 Study objects............................................................................................................14 Sampling sites...........................................................................................................17 Organisation of the thesis .........................................................................................19 Manuscripts: Chapter I Sponge-Specific Bacterial Associations of the Mediterranean Sponge Chondrilla nucula (Demospongiae, Tetractinomorpha) .................................21 Chapter II Spatial Distribution of Sponge-Associated Bacteria in the Mediterranean Sponge Tethya aurantium................................................................................39 Chapter III Phylogenetic Identification of Bacteria with Antimicrobial Activities Isolated from Mediterranean Sponges.............................................................61 Chapter IV Abundance, Bioactivity and Ecological Relevance of Cultured Sponge- Associated Bacteria from the Mediterranean Sea ...........................................65 General Discussion...............................................................................................................83 Conclusion .........................................................................................................................87 Literature .........................................................................................................................88 Acknowledgements ............................................................................................................103 Individual scientific contribution to multiple-author publications.....................................104 Erklärung .......................................................................................................................106 Appendix A ............................................................................................................................I Appendix B .........................................................................................................................VI SUMMARY SUMMARY In the present study sponge-bacteria associations as well as the antimicrobial potential of sponge-associated bacteria was investigated. Culture independent methods were applied to examine diversity, specificity and temporal consistency of sponge-associated bacterial communities while culture-based methods were used to address the antimicrobial potential of bacteria associated with different Mediterranean sponges. For molecular studies, Chondrilla nucula and Tethya aurantium were used as model organisms for sponges containing an apparent high number of associated bacteria (‘bacteriosponges’) and sponges without apparent associated bacteria (‘bacteria-free’ sponges), respectively. Stable and specific bacterial associations were demonstrated for both sponges suggesting that associations between sponges and bacteria are a common occurrence and ‘bacteria-free’ sponges might not exist. Sponge-microbe associations are proposed as ‘microbial consortia inhabiting the micro-environment sponge’. The association of Bdellovibrio-like Deltaproteobacteria as well as putatively ammonia-oxidizing archaea with C. nucula indicate a high complexity of possible interactions not only between sponge and associated bacteria but also within the associated bacterial community. High sequence similarities between sponge-derived and seawater-derived 16S rDNA sequences reflect filter-feeding by sponges and emphasise the need for comparative controls. However, distinct bacterial communities associated with two different sponge-species living in close proximity in their natural habitat demonstrate low impact of the ambient seawater for sponge-bacteria associations. The bacterial populations in the two model organisms differed in community structure and diversity. Bacterial sequences obtained from C. nucula were affiliated to other sponge-derived sequences in large parts (79%), while only a minor fraction (22%) of T. aurantium-associated phylotypes shared similarity with known sponge-associated bacteria. Further, comparison of cortex and endosome revealed spatial differences in the T. aurantium-associated bacterial community. Antimicrobially active bacteria were isolated from different sponges, demonstrating that cultivable sponge-associated bacteria exhibit a high potential for the search of new antimicrobial substances with biotechnological application. The cultivable bacterial communities associated with at least six different sponges were found to be dominated by a single alphaproteobacterial phylotype revealing antimicrobial activity. Kind of association, specificity as well as way of acquisition is still uncertain and critically discussed in this study. 1 ZUSAMMENFASSUNG ZUSAMMENFASSUNG In der vorliegenden Arbeit wurden Assoziationen mariner Bakterien mit Schwämmen und das antimikrobielle Potential dieser schwamm-assoziierten Bakterien untersucht. Diversität, Spezifität und Stabilität der Assoziationen wurden mithilfe molekularbiologischer Methoden untersucht, während das antimikrobielle Potential assoziierter Bakterien verschiedener Mittelmeerschwämme mittels Isolationsmethoden bestimmt wurde. Am Beispiel der Mittelmeerschwämme Chondrilla nucula und Tethya aurantium wurden assoziierte bakterielle Gemeinschaften sogenannter ‘Bakterienschwämme’ und ‘bakterien-freier’ Schwämme studiert. Es wurden stabile, spezifische bakterielle Assoziationen in beiden Schwämmen nachgewiesen. Dies deutet darauf hin, dass Schwämme unter natürlichen Bedingungen regelmäßig mit Bakterien in Assoziation leben und es keine ‘bakterien-freien’ Schwämme gibt. Schwämme können als bakterieller Lebensraum bezeichnet werden und fungieren nicht ausschließlich als Partner oder Wirt spezifischer Assoziationen. Sowohl Bdellovibrio- ähnliche Deltaproteobakterien als auch möglicherweise Ammonium-oxidierende Archaea wurden in Assoziation mit C. nucula nachgewiesen und deuten auf eine komplexe bakterielle Gemeinschaft hin, die eine Vielzahl verschiedener Interaktionen nicht nur zwischen Schwamm und Bakterium, sondern auch zwischen assoziierten Mikroorganismen beinhaltet. Da Schwämme filtrierende Tiere sind, dringen Bakterien des Umgebungswassers mit dem Wasser in das Kanalsystem der Schwämme ein. Jedoch weisen die bakteriellen Gemeinschaften unterschiedlicher Schwämme des gleichen Habitats deutliche Unterschiede auf. Dies deutet darauf hin, dass die gefundenen bakteriellen Gemeinschaften schwammart- spezifisch sind und der Einfluss des umgebenden Meerwassers gering ist. Die bakteriellen Gemeinschaften der untersuchten Schwämme unterscheiden sich sowohl in der Zusammensetzung als auch in der Diversität spezifisch assoziierter Bakterien. In C. nucula weisen 79% der bakteriellen Sequenzen Ähnlichkeit zu bekannten schwamm-assoziierten Bakterien auf, während es in T. aurantium nur 22% sind. Ferner wurde in T. aurantium eine räumliche Verteilung der bakteriellen Gemeinschaft innerhalb des Schwammes nachgewiesen. Schwamm-assoziierte Bakterien stellen ein hohes Potential zur Isolierung neuer Substanzen für die biotechnologische Nutzung dar. Antimikrobiell wirksame Bakterien wurden aus unterschiedlichen Mittelmeerschwämmen als dominante Arten der kultivierbaren bakteriellen Gemeinschaft isoliert. In mindestens sechs unterschiedlichen Schwämmen dominierte ein einziger Phylotyp aus der Gruppe der Alphaproteobakterien mit 2 ZUSAMMENFASSUNG antimikrobiellen Eigenschaften die assoziierte Gemeinschaft. Art der Assoziation, Spezifität und Art der Aufnahme in den Schwamm sind noch unbekannt und werden in dieser Arbeit kritisch diskutiert. 3 GENERAL INTRODUCTION GENERAL INTRODUCTION THEORETICAL BACKGROUND Sponges Sponges (phylum Porifera, Latin: ‘pore bearer’) live primarily in marine environments, but also inhabit freshwater habitats such as lakes and rivers, as well as fjords and estuaries (Frost 1991). Sponges are benthic, sessile and filter feeding, multicellular organisms; phylogenetically belonging to the first true metazoans. They are regarded as the oldest animal phylum with recent representatives. Sponges already existed millions of years before the so called ‘Cambrian Explosion’, when most of the recent animals evolved. Fossil records of all classes of the Porifera document their existence
Recommended publications
  • National Monitoring Program for Biodiversity and Non-Indigenous Species in Egypt

    National Monitoring Program for Biodiversity and Non-Indigenous Species in Egypt

    UNITED NATIONS ENVIRONMENT PROGRAM MEDITERRANEAN ACTION PLAN REGIONAL ACTIVITY CENTRE FOR SPECIALLY PROTECTED AREAS National monitoring program for biodiversity and non-indigenous species in Egypt PROF. MOUSTAFA M. FOUDA April 2017 1 Study required and financed by: Regional Activity Centre for Specially Protected Areas Boulevard du Leader Yasser Arafat BP 337 1080 Tunis Cedex – Tunisie Responsible of the study: Mehdi Aissi, EcApMEDII Programme officer In charge of the study: Prof. Moustafa M. Fouda Mr. Mohamed Said Abdelwarith Mr. Mahmoud Fawzy Kamel Ministry of Environment, Egyptian Environmental Affairs Agency (EEAA) With the participation of: Name, qualification and original institution of all the participants in the study (field mission or participation of national institutions) 2 TABLE OF CONTENTS page Acknowledgements 4 Preamble 5 Chapter 1: Introduction 9 Chapter 2: Institutional and regulatory aspects 40 Chapter 3: Scientific Aspects 49 Chapter 4: Development of monitoring program 59 Chapter 5: Existing Monitoring Program in Egypt 91 1. Monitoring program for habitat mapping 103 2. Marine MAMMALS monitoring program 109 3. Marine Turtles Monitoring Program 115 4. Monitoring Program for Seabirds 118 5. Non-Indigenous Species Monitoring Program 123 Chapter 6: Implementation / Operational Plan 131 Selected References 133 Annexes 143 3 AKNOWLEGEMENTS We would like to thank RAC/ SPA and EU for providing financial and technical assistances to prepare this monitoring programme. The preparation of this programme was the result of several contacts and interviews with many stakeholders from Government, research institutions, NGOs and fishermen. The author would like to express thanks to all for their support. In addition; we would like to acknowledge all participants who attended the workshop and represented the following institutions: 1.
  • Distinguishing Characteristics of Sponges

    Distinguishing Characteristics of Sponges

    Distinguishing characteristics of sponges Continue Sponges are amazing creatures with some unique characteristics. Here is a brief overview of sponges and their features. You are here: Home / Uncategorized / Characteristics of sponges: BTW, They are animals, NOT plants! Sponges are amazing creatures with some unique characteristics. Here is a brief overview of sponges and their features. Almost all of us are familiar with commercial sponges, which are used for various purposes, such as cleaning. There are several living sponges found in both seawater as well as fresh water. These living species are not plants, but are classified as porifera animals. The name of this branch is derived from the pores on the body of the sponge, and it means the bearer of pores in Greek. It is believed that there are about 5000 to 10,000 species of sponges, and most of them are found in seawater. So sponges are unique aquatic animals with some interesting characteristics. Would you like to write to us? Well, we are looking for good writers who want to spread the word. Get in touch with us and we'll talk... Let's work together! Sponges are mainly found as part of marine life; but, about 100 to 150 species can be found in fresh water. They may resemble plants, but are actually sessile animals (inability to move). Sponges are often found attached to rocks and coral reefs. You can find them in different forms. While some of them are tube-like and straight, some others have a fan-like body. Some are found as crusts on rocks.
  • Appendix: Some Important Early Collections of West Indian Type Specimens, with Historical Notes

    Appendix: Some Important Early Collections of West Indian Type Specimens, with Historical Notes

    Appendix: Some important early collections of West Indian type specimens, with historical notes Duchassaing & Michelotti, 1864 between 1841 and 1864, we gain additional information concerning the sponge memoir, starting with the letter dated 8 May 1855. Jacob Gysbert Samuel van Breda A biography of Placide Duchassaing de Fonbressin was (1788-1867) was professor of botany in Franeker (Hol­ published by his friend Sagot (1873). Although an aristo­ land), of botany and zoology in Gent (Belgium), and crat by birth, as we learn from Michelotti's last extant then of zoology and geology in Leyden. Later he went to letter to van Breda, Duchassaing did not add de Fon­ Haarlem, where he was secretary of the Hollandsche bressin to his name until 1864. Duchassaing was born Maatschappij der Wetenschappen, curator of its cabinet around 1819 on Guadeloupe, in a French-Creole family of natural history, and director of Teyler's Museum of of planters. He was sent to school in Paris, first to the minerals, fossils and physical instruments. Van Breda Lycee Louis-le-Grand, then to University. He finished traveled extensively in Europe collecting fossils, especial­ his studies in 1844 with a doctorate in medicine and two ly in Italy. Michelotti exchanged collections of fossils additional theses in geology and zoology. He then settled with him over a long period of time, and was received as on Guadeloupe as physician. Because of social unrest foreign member of the Hollandsche Maatschappij der after the freeing of native labor, he left Guadeloupe W etenschappen in 1842. The two chief papers of Miche­ around 1848, and visited several islands of the Antilles lotti on fossils were published by the Hollandsche Maat­ (notably Nevis, Sint Eustatius, St.
  • Table S1. Primers Used for PCR Amplification

    Table S1. Primers Used for PCR Amplification

    Table S1. Primers used for PCR amplification Name Primer Sequence (5’-3’) Gene target Taxon target Reference First PCR round DGGE analysis FGPH19 TACGGCAARGGTGGNATHG nifH Diazotrophic (Simonet et al. 1991) POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) 799F AACMGGATTAGATACCCKG 16S rRNA Bacteria (Chelius and Triplett 2001) 1492R TACGGYTACCTTGTTACGACTT 16S rRNA Bacteria (Chelius and Triplett 2001) F203α CCGCATACGCCCTACGGGGGAAAGATTTAT 16S rRNA Alphaproteobacteria (Gomes et al. 2001) F948β CGCACAAGCGGTGGATGA 16S rRNA Betaproteobacteria (Gomes et al. 2001) F243HCG GGATGAGCCCGCGGCCTA 16S rRNA Actinobacteria (Heuer et al. 1997) BACF GGGAAACCGGGGCTAATACCGGAT 16S rRNA Firmicutes (Garbeva et al. 2003) Second PCR round DGGE analysis POLF-GC CGCCCGCCGCGCCCCGCGCCCGGCCCGCCCCCG nifH Diazotrophic (Poly et al. 2001) CCCCTGCGAYCCSAARGCBGACTC AQER GACGATGTAGATITCCTG nifH Diazotrophic (Poly et al. 2001) F968-GC CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGC 16S rRNA Bacteria (Heuer et al. 1999) ACGGGGGGAACGAAGAACCTTAC R1401 CGGTGTGTACAAGACCC 16S rRNA Bacteria (Heuer et al. 1997) qPCR analysis POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) POLF TGCGAYCCSAARGCBGACTC nifH Diazotrophic (Poly et al. 2001) 6S-27F AGAGTTTGATCCTGGCTCAG 16S rRNA Bacteria Bulgari et al., 2014 338R GCTGCCTCCCGTAGGAGT 16S rRNA Bacteria Bulgari et al., 2014 Table 2. Primers used for Ion Torrent pyrosequencing analysis. Primer Primer sequence (5´-3´) Reference 967F-PP CNACGCGAAGAACCTTANC (Jünemann et al. 2012) 967F-UC1 CAACGCGAAAAACCTTACC (Jünemann et al. 2012) 967F-UC2 CAACGCGCAGAACCTTACC (Jünemann et al. 2012) 967F-UC3 ATACGCGARGAACCTTACC (Jünemann et al. 2012) 967F-AQ CTAACCGANGAACCTYACC (Jünemann et al. 2012) 1046R CGACAGCCATGCANCACCT (Jünemann et al. 2012) 1046R-PP CGACAACCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ1 CGACGGCCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ2 CGACGACCATGCANCACCT (Jünemann et al. 2012) Table S3. Alpha diversity indices. Statistical analysis of the total endophytic and diazotrophic endophytic bacterial community associated with sweet sorghum cv.
  • Cystic Fibrosis Mice Develop Spontaneouschronic Bordetella

    Cystic Fibrosis Mice Develop Spontaneouschronic Bordetella

    ISSN 2470-3176 SciO p Forschene n HUB for Sc i e n t i f i c R e s e a r c h Journal of Infectious Pulmonary Diseases Research Article Volume: 3.2 Open Access Received date: 11 Oct 2017; Accepted date: 28 Cystic Fibrosis Mice Develop Spontaneous Oct 2017; Published date: 02 Nov 2017. Chronic Bordetella Airway Infections Citation: Darrah R, Bonfield T, LiPuma JJ, Litman P, Hodges CA, et al. (2017) Cystic Fibrosis Mice Darrah R1*, Bonfield T2, LiPuma JJ3, Litman P1, Hodges CA4, Jacono F5 and Develop Spontaneous Chronic Bordetella Airway Drumm M6 Infections. J Infect Pulm Dis 3(2): doi http://dx.doi. org/10.16966/2470-3176.128 1Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA 2Department of Pediatrics, Case Western Reserve University, Cleveland Ohio, USA Copyright: © 2017 Darrah R, et al. This is an 3Department of Pediatrics and Communicable Diseases, University of Michigan Medical School, Ann open-access article distributed under the terms Arbor, Michigan, USA of the Creative Commons Attribution License, 4Departments of Radiology, Biomedical Engineering, and Pediatrics, Case Western Reserve University, which permits unrestricted use, distribution, and Cleveland Ohio, USA reproduction in any medium, provided the original 5Department of Medicine, Case Western Reserve University, and Louis Stokes VA Cleveland Medical author and source are credited. Center, USA 6Departments of Pediatrics and Genetics Genome Sciences, Case Western Reserve University, Cleveland Ohio, USA *Corresponding author: Rebecca Darrah, Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA, Tel: 216-368-4911; E-mail: [email protected] Abstract Chronic pulmonary disease and infection is the primary cause of morbidity and mortality in people with cystic fibrosis (CF).
  • Bordetella Petrii Clinical Isolate Isolates of This Species Have Been Previously Reported from 4

    Bordetella Petrii Clinical Isolate Isolates of This Species Have Been Previously Reported from 4

    routine laboratory protocols. Initial susceptibility testing Bordetella petrii using disk diffusion indicated apparent susceptibility of the isolate to erythromycin, gentamicin, ceftriaxone, and Clinical Isolate piperacillin/tazobactam. The isolate was resistant to amox- icillin, co-amoxiclav, tetracycline, clindamycin, ciproflo- Norman K. Fry,* John Duncan,* Henry Malnick,* xacin, and metronidazole. After initial sensitivity results, a Marina Warner,* Andrew J. Smith,† 6-week course of oral clarithromycin (500 mg, 8 hourly) Margaret S. Jackson,† and Ashraf Ayoub† was begun. We describe the first clinical isolate of Bordetella petrii At follow-up appointments 3 months and 6 months from a patient with mandibular osteomyelitis. The only pre- after antimicrobial drug therapy ceased, clinical and radi- viously documented isolation of B. petrii occurred after the ographic findings were not unusual, and the infected area initial culture of a single strain from an environmental healed successfully. Despite the successful clinical out- source. come, the isolate was subsequently shown to be resistant to clarithromycin in vitro (Table). Improvement of the 67-year-old man visited an emergency dental clinic, osteomyelitis may also have been facilitated by the biopsy Awhere he complained of toothache in the lower right procedure, during which a sequestrum of bone was mandibular quadrant. Examination showed a root-filled removed. lower right canine tooth that was mobile and tender to per- The gram-negative bacillus (designated strain cussion. The tooth was extracted uneventfully under local GDH030510) was submitted to the Health Protection anesthesia. The patient returned after several days with Agency, Centre for Infections, London, for identification. pain at the extraction site. A localized alveolar osteitis was Preliminary tests results were consistent with those diagnosed, and local debridement measures were institut- described for members of the genus Bordetella.
  • Vitek®2 Id & Ast Cards

    Vitek®2 Id & Ast Cards

    ® VITEK 2 ID & AST CARDS Reliable • safe • rapid RESULTS YOU CAN TRUST FOCUS The VITEK 2 ADVANCED EXPERT SYSTEM™ software lets you focus your time where it is most required in ® the lab. The ADVANCED EXPERT SYSTEM™ validates VITEK 2 ID & AST CARDS ON WHAT every result and quickly identi es those truly needing a Microbiologist’s valuable time and attention. This allows the majority of results to be quickly and con dently reported to clinicians without need for MATTERS 2,8,11,13,15 review Rapid, Flexible, E cient EFFICIENCY THROUGH AUTOMATION VITEK 2 cards o er the shortest preparation time in the industry, considerably reducing labor Each self-contained, costs1,3,7,9,10,14. They also have the least contaminated waste, o ering up to 64% cost savings for disposal disposable test card compared to other systems6,10,12.The cards provide provides rapid and INNOVATIVE AND FLEXIBLE DESIGN increased standardization and automated, same-day accurate species- results helping clinicians to optimise antibiotic level identi cation or • Each card contains microwells with biochemicals or antimicrobials therapy sooner2,3. susceptibility results with • Ready and simple to use accurate MICs* based on • Pre-applied barcodes for maximum traceability • EUCAST and CLSI compliant AST formulations available Designed for VITEK 2 automated systems, VITEK 2 reference CLSI** and identi cation (ID) and susceptibility (AST) cards provide ISO *** MIC methods UP TO 50% FEWER PREPARATION STEPS THAN and EUCAST****, OTHER SYSTEMS,3,9,10: reliable and accurate results for clinically important US FDA*****, bacteria and yeasts1,2,4,5 or CLSI® breakpoint • Inoculation with a simple, standardised suspension of organism in saline interpretations1,3,4,5,7,8,10.
  • Incidence and Identity of Photosynthetic Symbionts in Caribbean Coral Reef Sponge Assemblages

    Incidence and Identity of Photosynthetic Symbionts in Caribbean Coral Reef Sponge Assemblages

    J. Mar. mz. A». KA! (2007), 87, 1683-1692 doi: 10.1017/S0025315407058213 Printed in the United Kingdom Incidence and identity of photosynthetic symbionts in Caribbean coral reef sponge assemblages Patrick M. Erwin and Robert W. Thacker* University of Alabama at Birmingham, 109 Campbell Hall, 1300 University Boulevard, Birmingham, Alabama 35294-1170, USA. Corresponding author, e-mail: [email protected] Marine sponges are abundant and diverse components of coral reefs and commonly harbour photosynthetic symbionts in these environments. The most prevalent symbiont is the cyanobacterium, Synechococcus spongiarum, isolated from taxonomically diverse hosts from geographically distant regions. We combined analyses of chlorophyll-a (chl-a) concentrations with line-intercept transect surveys to assess the abundance and diversity of reef sponges hosting photosymbionts on Caribbean coral reefs in the Bocas del Toro Archipelago, Panama. To identify symbionts, we designed PCR primers that specifically amplify a fragment of the 16S ribosomal RNA gene from S. spongiarum and used these primers to screen potential host sponges for the presence of this symbiont. Chlorophyll-a data divided the sponge community into two disparate groups, species with high (>125 Mg/g, N=20) and low (<50 Mg/g, N=38) chl-a concentrations. Only two species exhibited intermediate (50— 125 (Jg/g) chl-a concentrations; these species represented hosts with reduced symbiont populations, including bleached Xestospongia muta and the mangrove form of Chondrilla nucula (C. nucula f. hermatypicd). Sponges with high and intermediate chl-a concentrations accounted for over one-third of the species diversity and abundance of sponges in these communities. Most (85%) of these sponges harboured S.
  • Which Organisms Are Used for Anti-Biofouling Studies

    Which Organisms Are Used for Anti-Biofouling Studies

    Table S1. Semi-systematic review raw data answering: Which organisms are used for anti-biofouling studies? Antifoulant Method Organism(s) Model Bacteria Type of Biofilm Source (Y if mentioned) Detection Method composite membranes E. coli ATCC25922 Y LIVE/DEAD baclight [1] stain S. aureus ATCC255923 composite membranes E. coli ATCC25922 Y colony counting [2] S. aureus RSKK 1009 graphene oxide Saccharomycetes colony counting [3] methyl p-hydroxybenzoate L. monocytogenes [4] potassium sorbate P. putida Y. enterocolitica A. hydrophila composite membranes E. coli Y FESEM [5] (unspecified/unique sample type) S. aureus (unspecified/unique sample type) K. pneumonia ATCC13883 P. aeruginosa BAA-1744 composite membranes E. coli Y SEM [6] (unspecified/unique sample type) S. aureus (unspecified/unique sample type) graphene oxide E. coli ATCC25922 Y colony counting [7] S. aureus ATCC9144 P. aeruginosa ATCCPAO1 composite membranes E. coli Y measuring flux [8] (unspecified/unique sample type) graphene oxide E. coli Y colony counting [9] (unspecified/unique SEM sample type) LIVE/DEAD baclight S. aureus stain (unspecified/unique sample type) modified membrane P. aeruginosa P60 Y DAPI [10] Bacillus sp. G-84 LIVE/DEAD baclight stain bacteriophages E. coli (K12) Y measuring flux [11] ATCC11303-B4 quorum quenching P. aeruginosa KCTC LIVE/DEAD baclight [12] 2513 stain modified membrane E. coli colony counting [13] (unspecified/unique colony counting sample type) measuring flux S. aureus (unspecified/unique sample type) modified membrane E. coli BW26437 Y measuring flux [14] graphene oxide Klebsiella colony counting [15] (unspecified/unique sample type) P. aeruginosa (unspecified/unique sample type) graphene oxide P. aeruginosa measuring flux [16] (unspecified/unique sample type) composite membranes E.
  • Table S5. the Information of the Bacteria Annotated in the Soil Community at Species Level

    Table S5. the Information of the Bacteria Annotated in the Soil Community at Species Level

    Table S5. The information of the bacteria annotated in the soil community at species level No. Phylum Class Order Family Genus Species The number of contigs Abundance(%) 1 Firmicutes Bacilli Bacillales Bacillaceae Bacillus Bacillus cereus 1749 5.145782459 2 Bacteroidetes Cytophagia Cytophagales Hymenobacteraceae Hymenobacter Hymenobacter sedentarius 1538 4.52499338 3 Gemmatimonadetes Gemmatimonadetes Gemmatimonadales Gemmatimonadaceae Gemmatirosa Gemmatirosa kalamazoonesis 1020 3.000970902 4 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas indica 797 2.344876284 5 Firmicutes Bacilli Lactobacillales Streptococcaceae Lactococcus Lactococcus piscium 542 1.594633558 6 Actinobacteria Thermoleophilia Solirubrobacterales Conexibacteraceae Conexibacter Conexibacter woesei 471 1.385742446 7 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas taxi 430 1.265115184 8 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas wittichii 388 1.141545794 9 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas sp. FARSPH 298 0.876754244 10 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sorangium cellulosum 260 0.764953367 11 Proteobacteria Deltaproteobacteria Myxococcales Polyangiaceae Sorangium Sphingomonas sp. Cra20 260 0.764953367 12 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas panacis 252 0.741416341
  • Insights Into the Pathogenicity of Burkholderia Pseudomallei

    Insights Into the Pathogenicity of Burkholderia Pseudomallei

    REVIEWS Melioidosis: insights into the pathogenicity of Burkholderia pseudomallei W. Joost Wiersinga*, Tom van der Poll*, Nicholas J. White‡§, Nicholas P. Day‡§ and Sharon J. Peacock‡§ Abstract | Burkholderia pseudomallei is a potential bioterror agent and the causative agent of melioidosis, a severe disease that is endemic in areas of Southeast Asia and Northern Australia. Infection is often associated with bacterial dissemination to distant sites, and there are many possible disease manifestations, with melioidosis septic shock being the most severe. Eradication of the organism following infection is difficult, with a slow fever-clearance time, the need for prolonged antibiotic therapy and a high rate of relapse if therapy is not completed. Mortality from melioidosis septic shock remains high despite appropriate antimicrobial therapy. Prevention of disease and a reduction in mortality and the rate of relapse are priority areas for future research efforts. Studying how the disease is acquired and the host–pathogen interactions involved will underpin these efforts; this review presents an overview of current knowledge in these areas, highlighting key topics for evaluation. Melioidosis is a serious disease caused by the aerobic, rifamycins, colistin and aminoglycosides), but is usually Gram-negative soil-dwelling bacillus Burkholderia pseu- susceptible to amoxicillin-clavulanate, chloramphenicol, domallei and is most common in Southeast Asia and doxycycline, trimethoprim-sulphamethoxazole, ureido- Northern Australia. Melioidosis is responsible for 20% of penicillins, ceftazidime and carbapenems2,4. Treatment all community-acquired septicaemias and 40% of sepsis- is required for 20 weeks and is divided into intravenous related mortality in northeast Thailand. Reported cases are and oral phases2,4. Initial intravenous therapy is given likely to represent ‘the tip of the iceberg’1,2, as confirmation for 10–14 days; ceftazidime or a carbapenem are the of disease depends on bacterial isolation, a technique that drugs of choice.
  • National Monitoring Program for Biodiversity and Non-Indigenous Species in Egypt

    National Monitoring Program for Biodiversity and Non-Indigenous Species in Egypt

    National monitoring program for biodiversity and non-indigenous species in Egypt January 2016 1 TABLE OF CONTENTS page Acknowledgements 3 Preamble 4 Chapter 1: Introduction 8 Overview of Egypt Biodiversity 37 Chapter 2: Institutional and regulatory aspects 39 National Legislations 39 Regional and International conventions and agreements 46 Chapter 3: Scientific Aspects 48 Summary of Egyptian Marine Biodiversity Knowledge 48 The Current Situation in Egypt 56 Present state of Biodiversity knowledge 57 Chapter 4: Development of monitoring program 58 Introduction 58 Conclusions 103 Suggested Monitoring Program Suggested monitoring program for habitat mapping 104 Suggested marine MAMMALS monitoring program 109 Suggested Marine Turtles Monitoring Program 115 Suggested Monitoring Program for Seabirds 117 Suggested Non-Indigenous Species Monitoring Program 121 Chapter 5: Implementation / Operational Plan 128 Selected References 130 Annexes 141 2 AKNOWLEGEMENTS 3 Preamble The Ecosystem Approach (EcAp) is a strategy for the integrated management of land, water and living resources that promotes conservation and sustainable use in an equitable way, as stated by the Convention of Biological Diversity. This process aims to achieve the Good Environmental Status (GES) through the elaborated 11 Ecological Objectives and their respective common indicators. Since 2008, Contracting Parties to the Barcelona Convention have adopted the EcAp and agreed on a roadmap for its implementation. First phases of the EcAp process led to the accomplishment of 5 steps of the scheduled 7-steps process such as: 1) Definition of an Ecological Vision for the Mediterranean; 2) Setting common Mediterranean strategic goals; 3) Identification of an important ecosystem properties and assessment of ecological status and pressures; 4) Development of a set of ecological objectives corresponding to the Vision and strategic goals; and 5) Derivation of operational objectives with indicators and target levels.