DOCSLIB.ORG

Mouse Fastkd1 Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Fastkd1 Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Fastkd1 Knockout Project (CRISPR/Cas9) Objective: To create a Fastkd1 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Fastkd1 gene (NCBI Reference Sequence: NM_177244 ; Ensembl: ENSMUSG00000027086 ) is located on Mouse chromosome 2. 14 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 14 (Transcript: ENSMUST00000073152). Exon 2~7 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 2 starts from about 13.51% of the coding region. Exon 2~7 covers 53.24% of the coding region. The size of effective KO region: ~9200 bp. The KO region does not have any other known gene. Page 1 of 9 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 5 6 7 14 Legends Exon of mouse Fastkd1 Knockout region Page 2 of 9 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 564 bp section upstream of Exon 2 is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section downstream of Exon 7 is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 9 https://www.alphaknockout.com Overview of the GC Content Distribution (up) Window size: 300 bp Sequence 12 Summary: Full Length(564bp) | A(23.23% 131) | C(16.13% 91) | T(39.18% 221) | G(21.45% 121) Note: The 564 bp section upstream of Exon 2 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution (down) Window size: 300 bp Sequence 12 Summary: Full Length(2000bp) | A(26.6% 532) | C(20.65% 413) | T(30.9% 618) | G(21.85% 437) Note: The 2000 bp section downstream of Exon 7 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 4 of 9 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN -------------------------------------------------------------------------------------------------------------- browser details YourSeq 564 1 564 564 100.0% chr2 - 69711563 69712126 564 browser details YourSeq 158 122 288 564 97.7% chr4 + 133490266 133490476 211 browser details YourSeq 156 114 284 564 95.3% chr14 - 11292780 11292949 170 browser details YourSeq 154 118 284 564 96.4% chr10 - 62485305 62485472 168 browser details YourSeq 154 120 292 564 94.8% chr12 + 15824010 15824189 180 browser details YourSeq 152 126 287 564 97.0% chr5 - 148465396 148465557 162 browser details YourSeq 152 120 284 564 97.0% chr2 + 122032228 122032393 166 browser details YourSeq 151 123 284 564 97.0% chr6 - 83993555 83993727 173 browser details YourSeq 151 123 284 564 97.0% chr5 - 135954725 135954888 164 browser details YourSeq 151 123 284 564 97.0% chr17 - 28551895 28552058 164 browser details YourSeq 151 119 284 564 95.8% chr1 - 22335925 22336092 168 browser details YourSeq 150 124 284 564 96.9% chr19 - 6193560 6193722 163 browser details YourSeq 149 123 284 564 96.3% chr6 - 29217675 29217838 164 browser details YourSeq 149 123 284 564 96.3% chr16 - 4284330 4284493 164 browser details YourSeq 149 129 284 564 98.1% chr1 - 43931419 43931576 158 browser details YourSeq 149 131 287 564 97.5% chrX + 71214195 71214351 157 browser details YourSeq 149 130 284 564 98.8% chr16 + 11326496 11326653 158 browser details YourSeq 148 125 284 564 96.9% chr2 + 144405619 144405782 164 browser details YourSeq 148 124 284 564 96.3% chr19 + 44545141 44545303 163 browser details YourSeq 148 123 287 564 95.2% chr13 + 3587526 3587691 166 Note: The 564 bp section upstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 2000 1 2000 2000 100.0% chr2 - 69700363 69702362 2000 browser details YourSeq 226 397 1030 2000 83.5% chr10 - 128825219 128825724 506 browser details YourSeq 221 411 1030 2000 84.2% chr7 - 90431637 90431968 332 browser details YourSeq 219 392 1038 2000 83.1% chr2 - 32003538 32004059 522 browser details YourSeq 206 580 1030 2000 83.4% chr10 + 61421280 61421610 331 browser details YourSeq 194 415 1029 2000 89.5% chr8 - 110916245 110916856 612 browser details YourSeq 189 391 1030 2000 93.3% chr12 - 36018652 36022727 4076 browser details YourSeq 187 447 1037 2000 91.2% chr13 - 29850472 30128081 277610 browser details YourSeq 178 463 1029 2000 92.9% chr9 - 72771715 72772536 822 browser details YourSeq 175 431 1030 2000 80.8% chr9 + 102687275 102687580 306 browser details YourSeq 160 440 1034 2000 87.8% chr13 - 58118806 58119408 603 browser details YourSeq 159 869 1039 2000 97.1% chrX + 160412251 160412422 172 browser details YourSeq 149 399 1034 2000 86.2% chr1 - 161140720 161141274 555 browser details YourSeq 148 867 1039 2000 93.5% chr10 - 5537020 5537193 174 browser details YourSeq 148 388 1011 2000 92.1% chr11 + 68366040 68416026 49987 browser details YourSeq 147 867 1039 2000 91.1% chr11 - 106280536 106280705 170 browser details YourSeq 147 736 1029 2000 86.2% chr13 + 111682094 111682347 254 browser details YourSeq 147 868 1034 2000 95.2% chr11 + 33581594 33581766 173 browser details YourSeq 146 636 1017 2000 86.8% chr10 - 91136591 91136912 322 browser details YourSeq 145 867 1029 2000 95.8% chr17 - 64303980 64304173 194 Note: The 2000 bp section downstream of Exon 7 is BLAT searched against the genome. No significant similarity is found. Page 5 of 9 https://www.alphaknockout.com Gene and protein information: Fastkd1 FAST kinase domains 1 [ Mus musculus (house mouse) ] Gene ID: 320720, updated on 10-Oct-2019 Gene summary Official Symbol Fastkd1 provided by MGI Official Full Name FAST kinase domains 1 provided by MGI Primary source MGI:MGI:2444596 See related Ensembl:ENSMUSG00000027086 Gene type protein coding RefSeq status PROVISIONAL Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as mKIAA1800; 5330408N05Rik Expression Ubiquitous expression in CNS E18 (RPKM 4.3), CNS E11.5 (RPKM 3.6) and 27 other tissues See more Orthologs human all Genomic context Location: 2; 2 C2 See Fastkd1 in Genome Data Viewer Exon count: 14 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 2 NC_000068.7 (69686820..69712606, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 2 NC_000068.6 (69524877..69550663, complement) Chromosome 2 - NC_000068.7 Page 6 of 9 https://www.alphaknockout.com Transcript information: This gene has 4 transcripts Gene: Fastkd1 ENSMUSG00000027086 Description FAST kinase domains 1 [Source:MGI Symbol;Acc:MGI:2444596] Gene Synonyms 5330408N05Rik Location Chromosome 2: 69,686,815-69,713,516 reverse strand. GRCm38:CM000995.2 About this gene This gene has 4 transcripts (splice variants), 192 orthologues, 5 paralogues and is a member of 1 Ensembl protein family. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Fastkd1-201 ENSMUST00000073152.12 2865 829aa ENSMUSP00000072896.6 Protein coding CCDS16096 Q6DI86 TSL:1 GENCODE basic APPRIS P2 Fastkd1-202 ENSMUST00000102706.3 2511 800aa ENSMUSP00000099767.3 Protein coding - Q6DI86 TSL:5 GENCODE basic APPRIS ALT2 Fastkd1-203 ENSMUST00000129260.1 3200 No protein - Retained intron - - TSL:1 Fastkd1-204 ENSMUST00000140776.1 2414 No protein - Retained intron - - TSL:1 Page 7 of 9 https://www.alphaknockout.com 46.70 kb Forward strand 69.68Mb 69.69Mb 69.70Mb 69.71Mb 69.72Mb Genes Klhl41-201 >protein coding Ppig-202 >protein coding (Comprehensive set... Ppig-201 >protein coding Ppig-212 >lncRNA Ppig-203 >lncRNA Ppig-204 >lncRNA Ppig-211 >lncRNA Contigs AL929083.8 > AL845261.17 > Genes (Comprehensive set... < Fastkd1-201protein coding < Fastkd1-202protein coding < Fastkd1-204retained intron < Fastkd1-203retained intron Regulatory Build 69.68Mb 69.69Mb 69.70Mb 69.71Mb 69.72Mb Reverse strand 46.70 kb Regulation Legend CTCF Open Chromatin Promoter Promoter Flank Transcription Factor Binding Site Gene Legend Protein Coding Ensembl protein coding merged Ensembl/Havana Non-Protein Coding RNA gene processed transcript Page 8 of 9 https://www.alphaknockout.com Transcript: ENSMUST00000073152 < Fastkd1-201protein coding Reverse strand 25.79 kb ENSMUSP00000072... Low complexity (Seg) SMART RAP domain Pfam FAST kinase leucine-rich RAP domain FAST kinase-like protein, subdomain 2 PROSITE profiles RAP domain PANTHER PTHR21228 PTHR21228:SF29 All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend missense variant synonymous variant Scale bar 0 80 160 240 320 400 480 560 640 720 829 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 9 of 9.
Load more

Recommended publications
  • Unravelling the Cellular Origin and Clinical Prognostic Markers of Infant
    Published Ahead of Print on January 24, 2019, as doi:10.3324/haematol.2018.206375. Copyright 2019 Ferrata Storti Foundation. Unravelling the cellular origin and clinical prognostic markers of infant B-cell acute lymphoblastic leukemia using genome-wide analysis by Antonio Agraz-Doblas, Clara Bueno, Rachael Bashford-Rogers, Anindita Roy, Pauline Schneider, Michela Bardini, Paola Ballerini, Gianni Cazzaniga, Thaidy Moreno, Carlos Revilla, Marta Gut, Maria G Valsecchi, Irene Roberts, Rob Pieters, Paola De Lorenzo, Ignacio Varela, Pablo Menendez, and Ronald W Stam Haematologica 2019 [Epub ahead of print] Citation: Antonio Agraz-Doblas, Clara Bueno, Rachael Bashford-Rogers, Anindita Roy, Pauline Schneider, Michela Bardini, Paola Ballerini, Gianni Cazzaniga, Thaidy Moreno, Carlos Revilla, Marta Gut, Maria G Valsecchi, Irene Roberts, Rob Pieters, Paola De Lorenzo, Ignacio Varela, Pablo Menendez, and Ronald W Stam. Unravelling the cellular origin and clinical prognostic markers of infant B-cell acute lymphoblastic leukemia using genome-wide analysis Haematologica. 2019; 104:xxx doi:10.3324/haematol.2018.206375 Publisher's Disclaimer. E-publishing ahead of print is increasingly important for the rapid dissemination of science. Haematologica is, therefore, E-publishing PDF files of an early version of manuscripts that have completed a regular peer review and have been accepted for publication. E-publishing of this PDF file has been approved by the authors. After having E-published Ahead of Print, manuscripts will then undergo technical and English editing, typesetting, proof correction and be presented for the authors' final approval; the final version of the manuscript will then appear in print on a regular issue of the journal. All legal disclaimers that apply to the journal also pertain to this production process.
    [Show full text]
  • Download Validation Data
    PrimePCR™Assay Validation Report Gene Information Gene Name FAST kinase domain-containing protein 1 Gene Symbol Fastkd1 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. NM_001191738 UniGene ID Rn.226110 Ensembl Gene ID ENSRNOG00000024335 Entrez Gene ID 311112 Assay Information Unique Assay ID qRnoCEP0034063 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000036585 Amplicon Context Sequence AAAAAAAAAAACTACAGTCATGATCTGCCTGCTCCAAATATCTGTTCTCTCAGGTA GTCCATCCGTGTATCCTTCGTTGACATTGCCATGGAGTTCCA Amplicon Length (bp) 68 Chromosome Location 3:62537455-62537552 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 97 R2 0.9997 cDNA Cq 23.19 cDNA Tm (Celsius) 79 gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Fastkd1, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org.
    [Show full text]
  • Genetic Variation As a Tool for Identifying Novel Transducers of Itch
    Genetic variation as a tool for identifying novel transducers of itch By Takeshi Morita A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Molecular and Cell Biology in the Graduate Division of the University of California, Berkeley Committee in charge: Professor Diana M. Bautista, Co-Chair Professor Rachel B. Brem, Co-Chair Professor John Ngai Professor Kristin Scott Professor Michael W. Nachman Summer 2016 Abstract Genetic variation as a tool for identifying novel transducers of itch by Takeshi Morita Doctor of Philosophy in Molecular and Cell Biology University of California, Berkeley Professor Diana M. Bautista, Co-Chair Professor Rachel B. Brem, Co-Chair The mammalian somatosensory system mediates itch, the irritating sensation that elicits a desire to scratch. Millions of people worldwide suffer from chronic itch that fails to respond to current drugs and therapies. Even though recent studies have begun to elucidate the basic characteristics of the itch circuitry, we have little understanding about the molecules and signaling mechanisms that underlie detection and transduction of itch sensation, especially during chronic itch conditions. We have taken a genomic approach by harnessing natural variation in itch-evoked scratching behaviors in mice to identify novel molecular players that are involved in itch signal transduction at the level of primary sensory neurons. From our analysis, we identified numerous candidate itch genes, and further identified a serotonin receptor, HTR7 as a key transducer that is required for both development and maintenance of chronic itch. We further investigated the genetic basis of variation in itch, and identified a set of genes and regulatory pathways that may be involved in controlling itch behaviors.
    [Show full text]
  • Genomics of Inherited Bone Marrow Failure and Myelodysplasia Michael
    Genomics of inherited bone marrow failure and myelodysplasia Michael Yu Zhang A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington 2015 Reading Committee: Mary-Claire King, Chair Akiko Shimamura Marshall Horwitz Program Authorized to Offer Degree: Molecular and Cellular Biology 1 ©Copyright 2015 Michael Yu Zhang 2 University of Washington ABSTRACT Genomics of inherited bone marrow failure and myelodysplasia Michael Yu Zhang Chair of the Supervisory Committee: Professor Mary-Claire King Department of Medicine (Medical Genetics) and Genome Sciences Bone marrow failure and myelodysplastic syndromes (BMF/MDS) are disorders of impaired blood cell production with increased leukemia risk. BMF/MDS may be acquired or inherited, a distinction critical for treatment selection. Currently, diagnosis of these inherited syndromes is based on clinical history, family history, and laboratory studies, which directs the ordering of genetic tests on a gene-by-gene basis. However, despite extensive clinical workup and serial genetic testing, many cases remain unexplained. We sought to define the genetic etiology and pathophysiology of unclassified bone marrow failure and myelodysplastic syndromes. First, to determine the extent to which patients remained undiagnosed due to atypical or cryptic presentations of known inherited BMF/MDS, we developed a massively-parallel, next- generation DNA sequencing assay to simultaneously screen for mutations in 85 BMF/MDS genes. Querying 71 pediatric and adult patients with unclassified BMF/MDS using this assay revealed 8 (11%) patients with constitutional, pathogenic mutations in GATA2 , RUNX1 , DKC1 , or LIG4 . All eight patients lacked classic features or laboratory findings for their syndromes.
    [Show full text]
  • C6orf203 Controls OXPHOS Function Through Modulation of Mitochondrial Protein Biosynthesis
    bioRxiv preprint doi: https://doi.org/10.1101/704403; this version posted July 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. C6orf203 controls OXPHOS function through modulation of mitochondrial protein biosynthesis number of characters excluding Materials and Methods: 40,651 Sara Palacios-Zambrano1,2, Luis Vázquez-Fonseca1,2, Cristina González-Páramos1,2, Laura Mamblona1,2, Laura Sánchez-Caballero3, Leo Nijtmans3, Rafael Garesse1,2 and Miguel Angel Fernández-Moreno1,2,* 1 Departamento de Bioquímica, Instituto de Investigaciones Biomédicas “Alberto Sols” UAM CSIC and Centro de Investigación Biomédica en Red en Enfermedades Raras (CIBERER). Facultad de Medicina, Universidad Autónoma de Madrid. Madrid 28029, Spain. 2 Instituto de Investigación Sanitaria Hospital 12 de Octubre (imas12), Madrid 28041, Spain. 3 Department of Pediatrics, Radboud Center for Mitochondrial Medicine, Radboud University Medical Center, Nijmegen, The Netherlands. * To whom correspondence should be addressed. Tel:+34 91 497 31 29; Email: [email protected] Running title “C6orf203 controls mt-proteins synthesis” bioRxiv preprint doi: https://doi.org/10.1101/704403; this version posted July 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. ABSTRACT Mitochondria are essential organelles present in the vast majority of eukaryotic cells. Their central function is to produce cellular energy through the OXPHOS system, and functional alterations provoke so-called mitochondrial OXPHOS diseases. It is estimated that several hundred mitochondrial proteins have unknown functions. Very recently, C6orf203 was described to participate in mitochondrial transcription under induced mitochondrial DNA depletion stress conditions.
    [Show full text]
  • And Brain-Specific Expression of KLHL Family Genes
    International Journal of Molecular Sciences Article Epigenetics of Muscle- and Brain-Specific Expression of KLHL Family Genes Kenneth C. Ehrlich 1, Carl Baribault 2 and Melanie Ehrlich 3,* 1 Center for Biomedical Informatics and Genomics, Tulane University Health Sciences Center, New Orleans, LA 70112, USA; [email protected] 2 Center for Research and Scientific Computing (CRSC), Tulane University Information Technology, Tulane University, New Orleans, LA 70112, USA; [email protected] 3 Center for Biomedical Informatics and Genomics, Tulane Cancer Center, Hayward Genetics Program, Tulane University Health Sciences Center, New Orleans, LA 70112, USA * Correspondence: [email protected]; Tel.: +1-504-939-0916 Received: 16 October 2020; Accepted: 6 November 2020; Published: 9 November 2020 Abstract: KLHL and the related KBTBD genes encode components of the Cullin-E3 ubiquitin ligase complex and typically target tissue-specific proteins for degradation, thereby affecting differentiation, homeostasis, metabolism, cell signaling, and the oxidative stress response. Despite their importance in cell function and disease (especially, KLHL40, KLHL41, KBTBD13, KEAP1, and ENC1), previous studies of epigenetic factors that affect transcription were predominantly limited to promoter DNA methylation. Using diverse tissue and cell culture whole-genome profiles, we examined 17 KLHL or KBTBD genes preferentially expressed in skeletal muscle or brain to identify tissue-specific enhancer and promoter chromatin, open chromatin (DNaseI hypersensitivity), and DNA hypomethylation. Sixteen of the 17 genes displayed muscle- or brain-specific enhancer chromatin in their gene bodies, and most exhibited specific intergenic enhancer chromatin as well. Seven genes were embedded in super-enhancers (particularly strong, tissue-specific clusters of enhancers). The enhancer chromatin regions typically displayed foci of DNA hypomethylation at peaks of open chromatin.
    [Show full text]
  • Control of the Physical and Antimicrobial Skin Barrier by an IL-31–IL-1 Signaling Network
    The Journal of Immunology Control of the Physical and Antimicrobial Skin Barrier by an IL-31–IL-1 Signaling Network Kai H. Ha¨nel,*,†,1,2 Carolina M. Pfaff,*,†,1 Christian Cornelissen,*,†,3 Philipp M. Amann,*,4 Yvonne Marquardt,* Katharina Czaja,* Arianna Kim,‡ Bernhard Luscher,€ †,5 and Jens M. Baron*,5 Atopic dermatitis, a chronic inflammatory skin disease with increasing prevalence, is closely associated with skin barrier defects. A cy- tokine related to disease severity and inhibition of keratinocyte differentiation is IL-31. To identify its molecular targets, IL-31–dependent gene expression was determined in three-dimensional organotypic skin models. IL-31–regulated genes are involved in the formation of an intact physical skin barrier. Many of these genes were poorly induced during differentiation as a consequence of IL-31 treatment, resulting in increased penetrability to allergens and irritants. Furthermore, studies employing cell-sorted skin equivalents in SCID/NOD mice demonstrated enhanced transepidermal water loss following s.c. administration of IL-31. We identified the IL-1 cytokine network as a downstream effector of IL-31 signaling. Anakinra, an IL-1R antagonist, blocked the IL-31 effects on skin differentiation. In addition to the effects on the physical barrier, IL-31 stimulated the expression of antimicrobial peptides, thereby inhibiting bacterial growth on the three-dimensional organotypic skin models. This was evident already at low doses of IL-31, insufficient to interfere with the physical barrier. Together, these findings demonstrate that IL-31 affects keratinocyte differentiation in multiple ways and that the IL-1 cytokine network is a major downstream effector of IL-31 signaling in deregulating the physical skin barrier.
    [Show full text]
  • High-Throughput Sirna Screening Reveals Functional Interactions and Redundancies Of
    bioRxiv preprint doi: https://doi.org/10.1101/2020.08.05.238006; this version posted August 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. High-throughput siRNA screening reveals functional interactions and redundancies of human processive exoribonucleases Anna Hojka-Osinska1,2, ‡, Aleksander Chlebowski2,‡, Ewelina P. Owczarek2, Kamila Afek2, Kamila Kłosowska2, Roman J. Szczesny2#, Andrzej Dziembowski1,2,3# 1 International Institute of Molecular and Cell Biology, 02-109, Warsaw, Poland 2 Institute of Biochemistry and Biophysics Polish Academy of Sciences, 02-106, Warsaw, Poland 3Department of Genetics and Biotechnology, Faculty of Biology, University of Warsaw, 02- 096, Warsaw, Poland ‡These authors contributed equally to this work *Corresponding author 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.08.05.238006; this version posted August 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. ABSTRACT Processive exoribonucleases, the executors of RNA decay, participate in multiple physical and functional interactions. Unlike physical ones, functional relationships have not been investigated in human cells. Here we have screened cells deficient in DIS3, XRN2, EXOSC10, DIS3L, and DIS3L2 with a custom siRNA library and determined their functional interactions with diverse pathways of RNA metabolism.
    [Show full text]
  • The Role of the MLL-HOXA9 Axis in Normal and Malignant
    The Role of the MLL-HOXA9 Axis in Normal and Malignant Hematopoiesis by Jingya Wang A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Molecular and Cellular Pathology) in the University of Michigan 2013 Doctoral Committee: Professor Jay L. Hess, Chair Assistant Professor Tomasz Cierpicki Professor Eric R. Fearon Assistant Professor Maria E. Figueroa Professor Tom K. Kerppola Associate Professor Xiaochun Yu © Jingya Wang 2013 To My parents and My husband ii Acknowledgement This dissertation would not have been possible without the tremendous support and guidance from my advisor, Dr. Jay L. Hess. Jay’s enthusiasm and dedication towards scientific research have always been a great source of inspiration. His scientific vision and openness to novel ideas greatly influenced my scientific career. I would also like to thank Jay for encouraging me to pursue my interest in statistics and the opportunity to apply my knowledge to biomedical research. I deeply appreciate Jay’s invaluable advice and generous support for the next stage of my career. My sincere appreciations also go to Drs. Andrew Muntean and Maria (“Ken”) Figueroa. Throughout my graduate study, Andy was actively involved in many aspects of my projects and my scientific career, including providing technical assistance and scientific thinking, and most importantly, sharing his insights of science and being a better scientist. I could not have been where I am without his generous help. Ken led me into the field of high throughput sequencing data analysis, and patiently discussed experimental design to algorithm in details. Her presence also contributes greatly to the completion of this thesis.
    [Show full text]
  • Supplemental Solier
    Supplementary Figure 1. Importance of Exon numbers for transcript downregulation by CPT Numbers of down-regulated genes for four groups of comparable size genes, differing only by the number of exons. Supplementary Figure 2. CPT up-regulates the p53 signaling pathway genes A, List of the GO categories for the up-regulated genes in CPT-treated HCT116 cells (p<0.05). In bold: GO category also present for the genes that are up-regulated in CPT- treated MCF7 cells. B, List of the up-regulated genes in both CPT-treated HCT116 cells and CPT-treated MCF7 cells (CPT 4 h). C, RT-PCR showing the effect of CPT on JUN and H2AFJ transcripts. Control cells were exposed to DMSO. β2 microglobulin (β2) mRNA was used as control. Supplementary Figure 3. Down-regulation of RNA degradation-related genes after CPT treatment A, “RNA degradation” pathway from KEGG. The genes with “red stars” were down- regulated genes after CPT treatment. B, Affy Exon array data for the “CNOT” genes. The log2 difference for the “CNOT” genes expression depending on CPT treatment was normalized to the untreated controls. C, RT-PCR showing the effect of CPT on “CNOT” genes down-regulation. HCT116 cells were treated with CPT (10 µM, 20 h) and CNOT6L, CNOT2, CNOT4 and CNOT6 mRNA were analysed by RT-PCR. Control cells were exposed to DMSO. β2 microglobulin (β2) mRNA was used as control. D, CNOT6L down-regulation after CPT treatment. CNOT6L transcript was analysed by Q- PCR. Supplementary Figure 4. Down-regulation of ubiquitin-related genes after CPT treatment A, “Ubiquitin-mediated proteolysis” pathway from KEGG.
    [Show full text]
  • A Six Gene Expression Signature Defines Aggressive Subtypes and Predicts Outcome in Childhood and Adult Acute Lymphoblastic Leukemia
    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 6, No. 18 A six gene expression signature defines aggressive subtypes and predicts outcome in childhood and adult acute lymphoblastic leukemia Jin Wang1,2, Jian-Qing Mi1, Alexandra Debernardi2, Anne-Laure Vitte2, Anouk Emadali2, Julia A. Meyer3, Konstantina Charmpi4, Bernard Ycart4, Mary B. Callanan2, William L. Carroll3, Saadi Khochbin2 and Sophie Rousseaux2 1 State Key Laboratory for Medical Genomics and Department of Hematology, Shanghai Institute of Hematology, Collaborative Innovation Center of Systems Biomedicine, Pôle Sino-Français des Sciences du Vivant et Genomique, Rui Jin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China 2 INSERM, Université Grenoble Alpes, Institut Albert Bonniot, Grenoble, France 3 NYU Cancer Institute, NYU Langone Medical Center, New York, USA 4 Laboratoire Jean Kuntzmann, CNRS, Grenoble, France Correspondence to: Sophie Rousseaux, email: [email protected] Correspondence to: Saadi Khochbin, email: [email protected] Correspondence to: Jian-Qing Mi, email: [email protected] Keywords: cancer, personalized medicine, risk stratification, minimum residual disease, cancer stem cells Received: March 15, 2015 Accepted: April 22, 2015 Published: May 12, 2015 This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Abnormal gene expression in cancer represents an under-explored source of cancer markers and therapeutic targets. In order to identify gene expression signatures associated with survival in acute lymphoblastic leukemia (ALL), a strategy was designed to search for aberrant gene activity, which consists of applying several filters to transcriptomic datasets from two pediatric ALL studies.
    [Show full text]
  • Synthesis of UMI ( 8 Bases )
    TAN TANTA CU O USLA 20180030515A1DA MATA MATA MALTA MARTINI ( 19) United States (12 ) Patent Application Publication (10 ) Pub. No. : US 2018/ 0030515 A1 Regev et al. (43 ) Pub . Date : Feb . 1 . 2018 ( 54 ) DROPLET -BASED METHOD AND Related U . S . Application Data APPARATUS FOR COMPOSITE (63 ) Continuation - in -part of application No . PCT/ SINGLE - CELL NUCLEIC ACID ANALYSIS US2015 / 049178 , filed on Sep . 9 , 2015 . ( 71) Applicants : The Broad Institute Inc ., Cambridge, (60 ) Provisional application No . 62 /048 ,227 , filed on Sep . MA (US ) ; Massachusetts Institute of 9 , 2014 , provisional application No. 62 / 146 ,642 , filed Technology , Cambridge , MA (US ) ; on Apr. 13 , 2015 . President and Fellows of Harvard College, Cambridge, MA (US ) Publication Classification (51 ) Int . CI. (72 ) Inventors : Aviv Regev , Cambridge, MA (US ) ; C120 1 /68 (2006 .01 ) Evan Zane MACOSKO , Cambridge , GO6K 19 / 06 ( 2006 . 01 ) MA (US ) ; Steven Andrew ( 2006 .01 ) MCCARROLL , Cambridge , MA (US ) ; C12N 15 / 10 Alexander K . SHALEK , Cambridge, (52 ) U . S . CI. MA (US ) ; Anindita BASU , Cambridge , CPC .. .. C12Q 1/ 6809 ( 2013. 01 ) ; C12N 15 / 1096 MA (US ) ; Christopher B . FORD , (2013 . 01 ) ; C12Q 1 /6869 ( 2013 .01 ) ; C12Q Cambridge, MA (US ) ; Hongkun 1 /6834 ( 2013. 01 ) ; G06K 19 / 06 ( 2013. 01 ) PARK , Lexington , MA (US ) ; David A . (57 ) ABSTRACT WEITZ , Bolton , MA (US ) The present invention generally relates to a combination of molecular barcoding and emulsion - based microfluidics to (21 ) Appl. No. : 15 / 453 ,405 isolate , lyse , barcode , and prepare nucleic acids from indi (22 ) Filed : Mar. 8 , 2017 vidual cells in a high - throughput manner . Synthesis of UMI ( 8 bases) 8 rounds of synthesis • Millions of the same cell barcode per bead • 48 differentmolecular barcodes (UMIS ) per bead Patent Application Publication Feb .
    [Show full text]