Genomic Aberrations and Deregulation of Genes in ETV6/RUNX1-Positive Childhood

Genomic aberrations and deregulation of genes in ETV6/RUNX1-positive childhood

leukemia

Doctoral thesis at the Medical University of Vienna

for obtaining the academic degree

Doctor of Philosophy

Submitted by

Master rer. nat., Stephan Bastelberger

Supervisor:

Prof. Dr. Renate Panzer-Grümayer, MD

St. Anna Kinderkrebsforschung e.V., Children’s Cancer Research Institute, Zimmermannplatz 10, 1090 Vienna Austria Vienna, 08/2015

Contents Summary ...... 4

Zusammenfassung ...... 5

Abbreviations ...... 7

I. General introduction ...... 9

Hematopoiesis ...... 9

Commitment to the B-lymphoid lineage ...... 10

Childhood acute lymphoblastic leukemia ...... 11

Classification and prognostic parameters of childhood B cell precursor ALL .....12

Treatment of ALL at initial diagnosis and at relapse ...... 14

Analysis of gene expression in ALL ...... 15

Analysis of genome-wide copy number aberrations in ALL ...... 16

ETV6/RUNX1-positive B cell precursor ALL ...... 17

The ETV6/RUNX1 fusion ...... 18

II. Genetic alterations in glucocorticoid signaling pathway components are associated with adverse prognosis in children with relapsed ETV6/RUNX1-positive acute lymphoblastic leukemia ...... 24

Project background ...... 24

Glucocorticoids and glucocorticoid-mediated signaling ...... 24

Somatic aberrations affecting the glucocorticoid pathway in ETV6/RUNX1-

positive acute lymphoblastic leukemia...... 26

Clinical outcome of children with ETV6/RUNX1-positive relapse ...... 26

Study design ...... 27 2

Results and Discussion ...... 28

III. ETV6/RUNX1-induced upregulation of CD133 contributes to stemness features in acute lymphoblastic leukemia cell lines ...... 93

Project Background ...... 93

The cancer stem cell model ...... 94

The cancer stem cell model in acute lymphoblastic leukemia ...... 96

ETV6/RUNX1 induces a stemness associated expression signature ...... 96

PROM1 (CD133) and stemness ...... 97

Study design ...... 98

Materials and Methods ...... 99

Results ...... 104

Discussion ...... 113

IV. Further Discussion and Conclusions ...... 116

References ...... 119

Acknowledgments ...... 132

Curriculum Vitae ...... 133

Summary

The ETV6/RUNX1 gene fusion (also known as TEL/AML) characterizes the largest genetic subgroup (25%) of childhood B cell precursor acute lymphoblastic leukemia.

Despite rapid response to treatment and lack of high-risk features, up to 20% of affected cases still suffer a relapse. A significant proportion of these cases is associated with poor treatment response and dismal outcome.

The first project focuses on the impact of genome-wide aberrations, in general, and on aberrations affecting components of the glucocorticoid-signaling (GC) pathway, in particular. To test for predictive and/or prognostic aberrations, we performed SNP array analysis of 31 relapsed ALL samples from cases with good and poor response to treatment. In 58% of samples, we found deletions in various glucocorticoid signaling pathway-associated genes, but only NR3C1 and ETV6 deletions prevailed in “minimal residual disease”-poor responding (and thus, drug resistant) and subsequently relapsing cases (p<0.05). To prove the necessity of a functional glucocorticoid receptor, we reconstituted wild-type NR3C1 expression in mutant, glucocorticoid-resistant REH cells and studied the glucocorticoid response in vitro and in a xenograft mouse model. While these results prove that glucocorticoid receptor defects are crucial for glucocorticoid resistance in an experimental setting, they do not address the essential clinical situation where GC resistance at relapse is rather part of a global drug resistance.

The second project focuses on stemness properties of ETV6/RUNX1-harboring leukemias. PROM1 encodes CD133 and - based on its self-renewal capabilities – surface CD133 expression has been used as a cancer stem cell marker in various 4 malignancies. Here, we evaluated the proposed contribution of PROM1 to this phenotype. We suppressed PROM1 by lentiviral transduction of shRNAs and assessed PROM1/CD133 expression and clonogenicity in REH and AT-2 cell lines.

Our studies revealed that CD133 is expressed as a function of ETV6/RUNX1 in all cells (p<0.005) and that PROM1 repression leads to a significant reduction of colony forming potential, viability and proliferation (p<0.05). These effects were, however, not as prominent as those obtained by the fusion gene knock down (p<0.005), suggesting the contribution of further components. Overall, our data complement those of others supporting the lack of stem cell hierarchy in childhood ALL, by demonstrating that ETV6/RUNX1 up-regulates PROM1 and thereby, at least partly, exerts self-renewal, engraftment and repopulation potential.

Zusammenfassung

Das ETV6/RUNX1 Fusionsgen (auch als TEL/AML bezeichnet) kennzeichnet die größte genetische Subgruppe (25%) der B Zell Vorläufer Leukämien im Kindesalter.

Obwohl diese Leukämie generell gut auf die Therapie anspricht, erleiden bis zu 20% der erkrankten Kinder ein Rezidiv. Ein bedeutender Anteil dieser Rezidive ist mit schlechtem Ansprechen auf die Therapie und somit ungünstiger Prognose assoziiert.

Das erste Projekt behandelt die Bedeutung genom-weiter genetischer Aberrationen und insbesondere jener, die den Glukokortikoidsignalweg betreffen. Zu diesem

Zweck wurden bei 31 Rezidiv Fällen, mit entweder gutem oder schlechtem

Ansprechen auf die Therapie, SNP Array Analysen durchgeführt. Bei 58% der Fälle fanden wir Deletionen von Genen im Glukokortikoidsignalweg. Lediglich Deletionen

5 von NR3C1 (das Gen, das für den Glukokortikoidrezeptor (GR) kodiert) und ETV6 waren mit hoher minimaler Resterkrankung und einem nachfolgenden Rezidiv assoziiert (p<0.05). Um die Notwendigkeit eines funktionellen GR nachzuweisen, exprimierten wir wt GR in biallelisch mutierten REH Zellen. Diese modifzierten

Zelllinien wurden dann auf das Ansprechen auf Glukokortikoide in vitro und in einem

Xenograft Maus Modell untersucht. Die durchgeführten Experimente bestätigen die zentrale Rolle des GR für das Ansprechen auf Glukokortikoide in E/R-positiven

Leukämien. Da im klinischen Setting jedoch häufig eine Multidrug-Resistenz bei diesen Rezidiven vorliegt, sollte eine NR3C1 Deletion nicht isoliert gesehen werden.

Das zweite Projekt konzentriert sich auf die Stammzelleigenschaften ETV6/RUNX1- positiver Leukämien und untersucht den Beitrag von PROM1 in diesem

Zusammenhang. PROM1 ist verantwortlich für die Expression von CD133 auf der

Zelloberfläche, das als Stammzellmarker in verschiedenen Krebserkrankungen verwendet wird. Durch lentivirale Transduktion von shRNAs wurde die

PROM1/CD133 Expression unterdrückt und die Klonogenität von REH und AT-2

Zelllinien untersucht. Wir beobachteten, dass CD133 in allen Zellen in Abhängigkeit von ETV6/RUNX1 exprimiert wird (p<0.005) und, dass PROM1-Repression zu einer signifikanten Reduktion des koloniebildenden Potentials, von Viabilität und

Proliferation (p<0.05) führt. Ein Knock-Down des ETV6/RUNX1 Fusionsgens verursachte einen ähnlichen, jedoch ausgeprägteren Phänotyp (p<0.05). Dies weist darauf hin, dass noch weitere Faktoren in diesem Prozess beteiligt sind. Insgesamt unterstützen unsere Daten das Fehlen einer Stammzell-Hierarchie bei kindlichen akuten lymphoblastischen Leukämien, eine Meinung, die auch von anderen Gruppen propagiert wird, indem wir die Regulierung von PROM1 durch ETV6/RUNX1 sowie den Beitrag beider Gene hinsichtlich Selbsterneuerungs-, Engraftment- und

Repopulierungs-Potential zeigen. 6

Abbreviations

AGM region aorta, gonads, mesonephros region ALL acute lymphoblastic leukemia AML acute myeloid leukemia BCP-ALL B cell precursor ALL BFM Berlin-Frankfurt-Münster BIM Bcl2-interacting mediator of cell death, BCL2L11 BM MNC bone marrow mononuclear cells BMF BCL2 modifying factor CBF core-binding factor CFU colony forming unit CLP common lymphoid progenitor CML chronic myeloid leukemia CMP common myeloid progenitor CNA copy number aberrations CSC as cancer stem cell DEX dexamethasone E/R ETV6/RUNX1 E/R ETV6/RUNX1 EBF3 early B cell factor 3 EPOR erythropoietin receptor ETS E-twenty-six ETV6 ets variant 6 FISH fluorescence in situ hybridization GC synthetic glucocorticoids GESA gene set enrichment analysis GILZ glucocorticoid-induced leucine zipper GMP granulocyte/monocyte progenitor GR glucocorticoid receptor GRE glucocorticoid response elements HDAC histone deacetylase hGR-α human glucocorticoid receptor alpha HLH helix-loop-helix HR high risk HSC hematopoietic stem cells HSP90 heat shock protein 90 KD knock down LMPP lymphoid primed multipotent progenitor LTRC long term repopulating cell MEP megakaryocyte/erythrocyte progenitor MPP multipotent progenitor MRD minimal residual disease mTOR mammalian target of rapamycin 7

MTT 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide N-Cor nuclear receptor co-repressor NSG NOD/scid/IL2 receptor gamma chain knockout PI propidium iodide PPR prednisolone poor responder PRED prednisolone PUMA BCL2 binding component 3 qRT-PCR quantitative reverse transcription polymerase chain reaction RHD Runt homology domain RU486 mifepristone RUNX1 Runt-related transcription factor 1 SNP single nucleotide polymorphism STRC short term repopulating cell

I. General introduction

Hematopoiesis

The process responsible for genesis and replenishment of all blood cells is termed hematopoiesis. Mature cells of the blood are derived from hematopoietic stem cells

(HSCs). With their self-renewing potential, HSCs can permanently maintain the pool of more differentiated progenitors that subsequently mature into specialized lineages of hematopoietic cells.

Embryonic establishment of the human hematopoietic system takes place in two stages. The first stage, the embryonic or primitive hematopoiesis, takes place in the so called extra embryonic yolk sac, a structure that is composed of a cellular bilayer with either mesodermal or endodermal origin. From the yolk sac’s mesodermal cells, the cells termed “blood islands” are derived. Here, the first embryonic blood cells are produced as nucleated primitive red blood cells (Orkin and Zon, 2002). In addition,

HSCs are emerging from the aorta, gonads, mesonephros (AGM region) and then engraft in the fetal liver, which is the major hematopoietic organ in embryonic development, where HSCs expand further. The stem cells that engrafted here are the source for the definitive erythromyeloid and lymphoid progenitor cells, necessary to maintain blood cell production throughout the organism’s life (Bellantuono, 2004,

Cumano and Godin, 2007, Coskun and Hirschi, 2010).

In humans, the second stage is the adult or definitive hematopoiesis. Throughout the process of gestation, the site of adult hematopoiesis shifts from the AGM region towards the fetal liver and then to the fetal bone marrow. To maintain the hematopoietic system, at least 10 functionally different types of cells have to be generated by pluripotent HSCs and approximately 1 x 1010 white blood cells and 2 x 9

1011 erythrocytes have to be produced every day (Coskun and Hirschi, 2010). HSCs are categorized into long-term and short term repopulating cells (LTRCs and STRCs, respectively). LTRCs can repopulate all types of hematopoietic cells for their overall life span, while STRCs are more restricted, reconstituting cells of myeloid or lymphoid lineage for only a limited duration. So-called multipotent progenitors (MPPs) are derived from STRCs and are responsible for producing lineage restricted progenitor cells, like the common myeloid progenitors (CMPs) and common lymphoid progenitors (CLPs). Hence, MPPs have pluripotent differentiation potential, but do not have a high self-renewing potential like LTRCs and STRCs. CMPs give rise to granulocyte/monocyte progenitors (GMPs), and megakaryocyte/erythrocyte progenitors (MEPs). CLPs give rise to B cells, T cells and natural killer cells (NK- cells). Further progenitor lineages, like early T cell progenitors and B cell/ macrophage bipotent progenitors, have been reported, but are present at lower rates when compared to CMPs or CLPs (Bellantuono, 2004).

Commitment to the B-lymphoid lineage

Lineage commitment in the hematopoietic process is achieved by activating and repressing specific transcriptional programs. While expression of specific growth factors is needed to sustain proliferation and viability of the overall hematopoietic system, they appear not to determine differentiation along the specific lineages. A determining factor in lineage choice and differentiation of hematopoietic cells is the expression and level of expression of specific transcription factors. AIOLOS, E2A,

EBF1, IKAROS, PAX5, RUNX1 and others have been implicated in expression of genes specific to B cells (Tijchon et al., 2013). Overall, hematopoietic lineage

10 specification is intensely studied, but the mechanisms guiding it, so far, remain poorly understood (Orkin, 2000, Nutt and Kee, 2007).

RUNX1 is especially important for the development of the hematopoietic system and in particular for differentiation of B and T cells. During embryonic hematopoiesis,

RUNX1 is needed for the generation of HSCs in the AGM region and expression of high RUNX1 levels can be found in all of the embryo’s HSCs and in all sites that produce HSCs (Orkin and Zon, 2002, Orkin, 2000, Ichikawa et al., 2013). A homozygous germ line deletion of the RUNX1 gene is an embryonic lethal defect that stops adult hematopoiesis (Okuda et al., 2001). Interestingly, RUNX1 is not necessary for further maintaining HSCs, but is a key player for development of megakaryocytes and determining for differentiation of B and T cells (Ichikawa et al.,

2013). Like a majority of transcription factors important for normal hematopoiesis,

RUNX1 is prominently involved in leukemia associated chromosomal translocations

(Orkin, 2000, Tijchon et al., 2013).

Childhood acute lymphoblastic leukemia

Childhood acute lymphoblastic leukemia (ALL) is the overall most frequently occurring cancer in children (Pui et al., 2008, Pui and Evans, 1998, Pui et al., 2004).

ALL can arise from hematological progenitors or stem cells committed to either the B cell or T cell lineage and is caused by abnormal expression of oncogenes, numerical chromosomal aberrations and most importantly, by chromosomal translocations that result in gene-fusions encoding for aberrant transcription factors or activated kinases

(Pui et al., 2004). Hence, these genetic abnormalities lead to altered cellular key functions, like inappropriate self-renewing potential, uncontrolled proliferation and unresponsiveness to induced cell death (Pui et al., 2004, Pui et al., 2008). Since only

<5% of all childhood leukemias are linked to inherited genetic predispositions, overall

ALL cannot be seen as a hereditary disease. So far, the contribution of exogenous factors to the emergence of childhood ALL are not clear (Greaves, 2006b).

While the cell of origin of ALL, precise nature and timing of the causal events are not clear, several studies demonstrated that the origin is prenatal for most childhood ALL subtypes (Fasching et al., 2000, Panzer-Grumayer et al., 2002, Maia et al., 2003,

Anderson et al., 2011, Greaves, 2006a, Hong et al., 2008).

Classification and prognostic parameters of childhood BCP-ALL

B cell precursor ALL (BCP-ALL) is the most prevalent form of childhood ALL (85%), while only ~15% of all ALL cases have a T cell immunophenotype. BCP-ALL is mainly categorized using cytogenetic aberrations, which are rarely found in T cell

ALL. These genetic aberrations are of high importance for therapeutic and prognostic implications (Pui et al., 2008, Pui et al., 2011).

The 2 most common groups within childhood BCP-ALL are either defined by the t(12;21)(p13;22) which generates the ETV6/RUNX1 (E/R) fusion or a hyperdiploid karyotype (>50 chromosomes). Both types are found in ~ 25% of ALL cases, are linked to good prognosis and achieve a 5-year event-free survival of 80-95% (Pui et al., 2004, Armstrong and Look, 2005, Pui et al., 2011). While treatment response is very good in E/R-positive ALL, at least with certain treatment protocols, up to 20% of cases suffer a relapse (Borkhardt et al., 1997 Jul 15, Pui et al., 2004, Loh et al.,

2006).

Figure 1: Estimated frequencies of genotypes in acute lymphoblastic leukemia (ALL). Genotypes of T cell ALL are indicated in purple. Remaining colors show genotypes of BCP-ALL subtypes. Adapted from (Pui et al., 2011).

Additionally, E2A/PBX1, resulting from a t(1;19)(q23;p13) can be detected in approximately 5% of diagnosed BCP-ALL cases and, according to current treatment protocols, is linked to good treatment outcome when using intensive chemotherapy regimens.

In contrast to the latter 3 subtypes and under the current treatment regimens, t(9,22)(q34;q11), t(4;11)(q21;q23) -the BCR/ABL1 and the MLL/AF4 fusions, respectively- and hypodiploidy (displaying <44 chromosomes) are associated with poor outcome in BCP-ALL (Pui et al., 2008, Pui et al., 2011).

Apart from cytogenetic aberrations and immunophenotypic characterization, further prognostic parameters are important for the clinical outcome of BCP-ALL cases. For several ALL subtypes, the patient’s age at initial diagnosis of the leukemia is associated with prognosis: children between the ages 1-9 have a five-year event-free 13 survival of 88%, while adolescents between 10 and 15 years of age have a 5-year event-free survival rate of 73% and infants (<12 months), a 44% 5-year event-free survival rate. The worst outcome is observed in infants below 6 months of age.

To date, the patient’s response to the therapy itself is the best predictive parameter.

In this regard, minimal residual disease (MRD) measurement has become an effective tool to assess treatment response in ALL. MRD has been incorporated into clinical trials and is used as treatment stratifying parameter. MRD levels can be assessed most effectively by PCR analysis or flow cytometry and provide standardized tools to determine the effectiveness of ALL treatment (van Dongen et al., 1998, Pui and Evans, 2006, Conter et al., 2010, Schrappe et al., 2011).

Treatment of ALL at initial diagnosis and at relapse

ALL treatment is characterized by 3 subsequent stages. The first stage is the so called induction therapy. Here, the main goal is to achieve remission of the disease by a very intense treatment aimed at eradicating 90% of the initially present leukemic blast count and re-establishment of normal hematopoiesis. In induction therapy, glucocorticoids (dexamethasone or prednisolone), anthracyclin or asparaginase or both, in addition to vincristine are applied for one month. The current treatment protocols achieve a disease remission, defined by regular blood counts and bone marrow samples that are morphologically normal in approximately 98% of cases.

After achieving remission, consolidation therapy is started. Here, commonly used regimens for ALL include high-dose asparaginase and methotrexate with mercaptopurine over an extended period of time and reinduction therapy. After 4 to 8 months of consolidation treatment, the third and last stage, continuation treatment, also called maintenance treatment, is started. Methotrexate is administered on a

14 weekly basis, while mercaptopurine is given on a daily basis, for total treatment duration of 2 years. If patients have an initial poor response to treatment or are considered especially high-risk patients, allogeneic hematopoietic stem-cell transplantation is considered (Pui and Evans, 2006).

With improvement of survival rates, ALL treatment has started to focus on preventing acute and late deleterious side-effects of treatment. Therefore, carcinogenic or major organ-damaging drugs are avoided or dosage is reduced in standard-risk ALL cases.

Further efforts to reduce treatment-related toxicity are, for instance, the use of toxicity-counteracting drugs and the generation and application of targeted approaches and advanced molecular diagnostics (Pui and Evans, 2006). Under the right circumstances, these advances in therapy could increase cure rates in childhood ALL cells, while reducing toxicity.

Analysis of gene expression in ALL

Profiling gene expression of ALL blasts by microarray or next generation sequencing

-based RNA sequencing allows monitoring the entire transcriptome. This has since led to the discovery of a new childhood ALL subgroup (Ph-like or BCR-ABL1-like) and significantly contributed to our understanding of leukemia in numerous ways

(Andersson et al., 2005, Den Boer et al., 2009): expression analysis is an important tool to reveal potential candidate pathways and genes that might be of prognostic or therapeutic value for specific ALL subtypes (Yeoh et al., 2002, Ross et al., 2003, Pui et al., 2004). Furthermore, expression analysis showed that primary ALLs can be distinguished according to their specific signature upon correlation with established cyto/genetic subgroups. Similarly, leukemic cell lines share a similar gene expression

15 pattern as their primary counterpart, indicating that they represent good models to study the respective leukemia (Fine et al., 2004, Andersson et al., 2005a).

Genome-wide analysis of copy number aberrations in ALL

Single nucleotide polymorphism arrays (SNP arrays) are most effective in detecting loss or gain of genetic material on a genome-wide scale and are powerful means to identify genetic copy number alterations. In ALL, this enabled the detection of ALL- specific deletions affecting genes important for lymphoid differentiation (RAG1-

2,EBF1, PAX5, TCF3, IKZF1-3, LEF1), lymphoid signaling (BTLA), genetic mismatch repair (MSH6, MSH2), tumor suppression (PTEN, RB1) and drug resistance (NR3C1)

(Mullighan et al., 2007, Yang et al., 2012, Mullighan, 2012, Kuster et al., 2011).

Furthermore, analyzing patterns of genetic losses and gains from matched and paired diagnosis and relapse samples by SNP array revealed the clonal origins of relapses of ALL (Fig. 2). Thereby, 52% of relapses were shown to have a similar genetic makeup as the diagnostic leukemia, but did arise from clonal evolution of an ancestral pre-diagnosis clone, while 34% are a direct product of clonal evolution from the dominant diagnosis clone. Only 8% are a reemerged clone identical to the diagnosis clone and 6% of all relapse clones evolved completely independently from the clone present at primary diagnosis of ALL (Mullighan et al., 2008, Mullighan and

Downing, 2009).

Figure 2: Evolution of relapse in ALL. 52% of relapse clones arise either from a shared ancestral clone or by acquiring additional genetic aberrations and since have a clear relationship to the ancestral clone. 34% of relapse clones are directly derived from the leukemia clone present at diagnosis of ALL. 8% of relapses are caused by a clone that is genetically identical to the one present at diagnosis. Only 6% of relapses emerge from a clone that is genetically distinct and evolved independently from the clone present at diagnosis. Adapted from (Mullighan et al., 2008).

ETV6/RUNX1-positive BCP ALL

The E/R fusion, t(12;21)(p13q22), defines one of the largest subgroups of BCP-ALL cases and is the most frequently occurring translocation in childhood cancer (Pui et al., 2011). E/R is nearly exclusively associated with pediatric ALL (Speck and

Gilliland, 2002). While associated with overall favorable prognosis, up to 20% of the affected children experience mostly late relapses (Pui et al., 2011, Kuster et al.,

2011, Conter et al., 2010, Borkhardt et al., 1997 Jul 15, Loh et al., 2006) that can pose a significant challenge to treatment, since they are associated with drug resistance and poor outcome (Pui et al., 2011, Kuster et al., 2011, Malempati et al.,

2007).

The ETV6/RUNX1 fusion

There are several chromosomal translocations that involve the ETV6 or RUNX1 genes. However, E/R is the only one with RUNX1 as a fusion partner that has been identified in ALL. The role of E/R is largely defined by the properties of its fusion partners ETV6 and RUNX1.

ETV6 (ets variant 6) (or TEL) is a ~300 kb gene consisting of 8 exons and is a E- twenty-six (ETS) transcription factor family member. ETS factors play key roles in cell proliferation, cell cycle, cell migration, differentiation and apoptosis and are frequently associated with cancer through gene-fusions (Mikhail et al., 2006, Baens et al., 1996,

Wang et al., 1998). The ETV6 protein is comprised of 2 major domains. The N- terminal helix-loop-helix (HLH) domain is responsible for dimerization. The C- terminally located ETS domain allows binding to consensus ETS DNA-binding sites.

Commonly, ETV6 is described as a repressor of target genes and mediates its activity through binding of the nuclear receptor co-repressor (N-Cor), histone deacetylases (HDAC) and mSin3A. While ETV6 expression can be found in wide variety of tissues, genetic abnormalities of ETV6 are mostly occurring in hematopoietic malignancies of lymphoid and myeloid origin and congenital fibrosarcoma (Zelent et al., 2004).

Murine studies have revealed the importance of Etv6 for yolk sac angiogenic development in the embryo, for the development of the hematopoietic lineages and that Etv6 is a key component for HSC survival. Etv6-/- embryos do not survive E11.5 due to failure in maintaining the developing embryonic vascular system of the yolk sac. Additionally, the embryo displays apoptosis in specific regions (Wang et al.,

1998). In the bone of adult mice, loss of Etv6 function leads to a depletion of HSCs, demonstrating that Etv6 is regulating HSC survival (Hock et al., 2004).

Runt-related transcription factor 1 (RUNX1), also called AML1, is a ~250kb gene, with 12 exons located to chromosome 21q22, and is frequently translocated in hematopoietic malignancies. RUNX1 is a core-binding factors (CBFs) family member, which consists of the 3 interchangeable CBFα subunits (RUNX1-3) and the CBFβ subunit that increases RUNX DNA-binding affinity (Meyers et al., 1993, Mikhail et al.,

2006). All RUNX proteins have a similar 2 domain structure: the Runt homology domain (RHD) for binding to specific DNA motifs and the C-terminally located transactivation domain (TD) for protein-protein interactions (Mikhail et al., 2006).

Expression of RUNX1 is found in most types of hematopoietic cells, including B lymphocytes (Zelent et al., 2004). RUNX1 has two promoters, from where the many alternatively spliced RUNX1 transcripts are generated (Mikhail et al., 2006).

The RUNX1 protein functions mainly as a transcriptional modulator that recruits cofactors to form a nuclear protein complex (Mikhail et al., 2006). Transactivating

RUNX1 activity is mediated by CREB-binding protein (CBP) and p300, two coactivators that boost transcription through histone acetyl transferase activity.

Repression of RUNX1 target genes is, for instance, mediated by mSin3A, which recruits histone deacetylases leading to a compact chromatin structure (Mikhail et al.,

2006).

Figure 3: Schematic representation of full-length ETV6, RUNX1 and ETV6/RUNX1 (E/R) proteins. For ETV6, the pointed domain (PD), the central repression domain and the (ETS) DNA binding domain are depicted. For RUNX1, the Runt DNA binding domain, the mSin3A interaction domain (SID), the p300 interaction domain (p300ID), the transcriptional activation domain and the terminal VWRPY motif are shown. Fusion sites for ETV6 and RUNX1 are indicated by arrows. Numbers depict amino acids bordering key functional domains, where the number 1 is the first methionine. Adapted from (Zelent et al., 2004).

ETV6/RUNX1 is the product of the t(12,21)(p13q22) translocation (Fig. 3), the result of an in frame fusion of the 5’ ETV6-region with RUNX1 that retains nearly all RUNX1 functional regions. The breakpoints of the E/R-fusion are located in the ETV6 intron 5 and intron 1, occasionally also in the second intron of RUNX1. Transcriptional control for the E/R-fusion is provided by the ETV6 promoter (Fig. 3). Of ETV6, the fusion retains only the central repression domain and the helix-loop-helix (HLH) dimerization domain, which is responsible for activating transcriptional repressors. Of RUNX1 the following are needed for the full functionality of the E/R fusion protein: the p300 interaction domain, the mSin3A interaction domain (SID) and the C-terminal VWRPY region of RUNX1 that is responsible for interacting with corepressors (Fig. 3) (Morrow et al., 2007, Zelent et al., 2004).

Initial studies described that that reporter construct-activity, under the regulatory control of specific hematopoietic genes, is suppressed by expression of the E/R protein and that E/R-expression specifically counteracts RUNX1 driven gene activation (Hiebert et al., 1996, Fenrick et al., 1999). E/R can form a very stable repressor complex by binding N-CoR and mSin3A corepressors through the ETV6 oligomerization moiety. Since E/R binds RUNX1 target sequences, it can constitutively repress RUNX1 target genes in an HDAC dependent fashion (Fig. 4)

(Zelent et al., 2004). In addition, the repressive effects mediated by E/R were abrogated by the HDAC inhibitor trichostatin A (Fenrick et al., 1999).

Figure 4: Proposed model of the regulatory function of RUNX1 and ETV6/RUNX1. (a) RUNX1 (AML1) represses target genes by recruitment of mSin3A and HDACs or activates target gene function by recruitment of p300. (b)The ETV6 part of E/R (TEL/AML1) facilitates dimerization, binding of N-Cor and mSin3A. This allows formation of a stable, constitutive repressor complex that is unresponsive to the regulatory mechanisms shown in (a). Adapted from (Zelent et al., 2004).

However, recent studies point to a more complicated mode for the regulatory functions of E/R. One study utilizing expression microarrays in E/R expressing human fibroblast cell lines confirmed the repression of RUNX1 activated genes by

E/R, but also demonstrated that E/R induces RUNX1 repressed genes, suggesting an activating function for the E/R fusion (Wotton et al., 2008).

Further studies support the notion that E/R is also activating transcription of genes: one study demonstrated that expression of E/R in BaF3, a B lymphoid murine cell line, increases surviving and heat shock protein 90 (HSP90) expression (Diakos et al., 2007). In leukemia, E/R upregulates expression of erythropoietin receptor

(EPOR) and E/R directly binds to promotor region of EPOR (Inthal et al., 2008,

Torrano et al., 2011). Further, Kaindl et al. observed that E/R directly induces MDM2 activity by binding to promoter-inherent RUNX1-motifs (Kaindl et al., 2014).

Modeling E/R-positive ALL in mice has yielded further insights into leukemia development and biology. Evidence has emerged that E/R leads to premalignant activity, when expressed in murine fetal liver hematopoietic stem cells. It has been suggested that E/R blocks further differentiation among the lymphoid line, stopping development prior to the lymphoid primed multipotent progenitor (LMPP) or CLP stage. Consequently, this leads to an abnormal increase in HSCs and renders them prone to malignant transformation, hence creating a pool of preleukemic cells

(Schindler et al., 2009, Morrow et al., 2004, Tsuzuki et al., 2004). These findings were corroborated by a zebrafish study that could only demonstrate the aggregation of immature lymphocytes with low frequency and long latency, when E/R was introduced into HSCs , suggesting that for leukemogenesis, E/R has to be expressed in cells more primitive than the CLP stage (Sabaawy et al., 2006).

While highly valuable, none of the mentioned models could reconstruct the full phenotype of E/R-positive BCP-ALL, suggesting that further models are required that 22 incorporate additional oncogenic hits. For instance, several studies have indicated that forward mutagenesis, using the sleeping beauty synthetic DNA transposon system, or loss of genes, frequently associated with E/R-positive ALL, are needed as additional hits to induce a full blown leukemia in mice (van der Weyden et al., 2011,

Schindler et al., 2009, Bernardin et al., 2002).

II. Genetic alterations in glucocorticoid signaling pathway components are associated with adverse prognosis in children with relapsed ETV6/RUNX1-positive acute lymphoblastic leukemia

Project background

E/R-positive leukemia is associated with low risk features and an overall fast response to the currently used treatment regimens (Pui et al., 2011). Despite the overall favorable prognostic outlook, up to 20% of cases treated with BFM-based protocols suffer a relapse (Seeger et al., 1999). Disease recurrence is more difficult to treat and hence responsible for dismal outcome in a notable proportion of patients

(Kuster et al., 2011). A factor implicated in disease recurrence and drug resistance is an impaired glucocorticoid pathway (Kuster et al., 2011).

Glucocorticoids and glucocorticoid-mediated signaling

Synthetic glucocorticoids (GCs) such as prednisolone (PRED) or dexamethasone

(DEX) are essential components in all childhood ALL treatment protocols (Pui and

Evans, 2006, Inaba and Pui, 2010). For instance, in Berlin-Frankfurt-Münster (BFM) based protocols, with the exception of one single dose of intrathecal methotrexate,

PRED is the only agent administered for one week prior to induction treatment

(Schrappe et al., 2012). Based on a bad response to this one week mono treatment with PRED, patients are designated prednisolone poor responders (PPR) and are

24 therefore allocated to high risk treatment, due to their dismal treatment outcome in previous studies (Schrappe et al., 2000, Moricke et al., 2008). However, in relapse treatment protocols multidrug chemotherapy is immediately applied and therefore it is impossible to single out the effects of PRED.

GCs assert their function by binding to the high-affinity glucocorticoid receptor (GR), the gene product of the NR3C1 gene, leading to a combination of non-genomic and genomic effects. Non-genomic effects include the initiation of the apoptotic cascade by mitochondrial translocation upon binding of GCs to membrane-associated GR

(Kfir-Erenfeld et al., 2010). The more important genomic effects are triggered by translocation of the activated GR dimers and monomers from the cytoplasm to the nucleus. Here, homo-dimers repress or activate expression of genes by binding to glucocorticoid response elements (GRE) on the DNA, while monomers interact with a number of transcription factors (Inaba and Pui, 2010, Schmidt et al., 2006b, Renner et al., 2003). In the nucleus, apoptosis can be induced by regulating typical apoptosis genes, such as Bcl-2 family member genes (Schmidt et al., 2004, Ploner et al.,

2008). Two pro-apoptotic Bcl-2 family genes have recently been demonstrated to be especially important for GC-induced apoptosis in children with systemic GC treatment

(Ploner et al., 2008): induction of BMF (Bcl2-modifying factor) and BIM (Bcl2- interacting mediator of cell death, BCL2L11). While alterations in genes involved in

GC signaling, primarily in the form of genetic deletions, are involved in the development of GC resistance in ALL (Schmidt et al., 2004), primary GC-resistant leukemia rarely have shown genetic aberrations of NR3C1 (Mullighan et al., 2007,

Irving et al., 2005a, Zhang et al., 2011). At the receptor level, resistance to GCs has been linked with a lack of GR autoinduction or defective GR expression (Schmidt et al., 2004, Schwartz et al., 2010). Thus, the molecular mechanisms that lead to GC resistance remain poorly understood. 25

Somatic aberrations affecting the glucocorticoid pathway in ETV6/RUNX1- positive acute lymphoblastic leukemia

Despite modern sequencing technology, SNP arrays represent an efficient means to determine copy number aberrations (CNAs) on a genome-wide level. SNP array analysis of E/R-positive ALL samples, in comparison to other ALL subtypes, revealed that CNAs occur at an especially high number in this specific subgroup (Mullighan et al., 2007). They affect genes needed for regulating cell cycle, B cell differentiation, apoptosis and GC signaling. While the majority of SNP array studies assessed samples obtained at initial diagnosis of the disease (Mullighan et al., 2007, van Galen et al., 2010, Lilljebjorn et al., 2007), only some included matched diagnosis and relapse material (Kuster et al., 2011, van Delft et al., 2011, Mullighan et al., 2008).

In their study, Kuster et al. recently performed genome wide copy number analysis with SNP 6.0 arrays of 18 matched diagnosis and relapse samples from children with

E/R-positive ALL (Kuster et al., 2011). This enabled the identification of deletions that appear to be specifically associated with E/R-positive leukemia and affect members of the nuclear receptor subfamily 3 (NR3C1, NR3C2) (Kuster et al., 2011). Most strikingly, predominantly heterozygous deletions of the NR3C1 gene were detected at relapse in 28% of study cohort cases suggesting that these deletions could potentially render cells GC resistant.

Clinical outcome of children with ETV6/RUNX1-positive relapse

Overall, E/R-positive leukemia has been described as responsive to treatment and in particular to GC treatment (Conter et al., 2010, Inaba and Pui, 2010, Frost et al.,

2004).

Kuster et al. reported that deletions associated with GC signaling prevail at relapse of

E/R-positive leukemia. Their data suggests that patients with GC-associated deletions could have a worse outcome after relapse (Kuster et al., 2011), but based on the small number of patients, a final conclusion in regard of the outcome after relapse could not be drawn and would require a larger cohort of cases to evaluate

GC-associated deletions and their effects on treatment response and long-term outcome of E/R-positive ALL.

Study design

Based on the fact that NR3C1 (GR) deletions occur in E/R-positive ALL at initial diagnosis, but the incidence of NR3C1 deletions at relapse is higher and that E/R- positive relapsed leukemia appears to be more frequently resistant to treatment than previously assumed, we performed CNA analysis in 31 E/R-positive ALL relapse cases that were treated with ALL-REZ BFM 95/96 and 2002 protocols (Eckert et al.,

2013c, Eckert et al., 2013a). The selection of samples from molecular good and poor responding cases, allowed an association of genetic aberrations with the patients’ treatment response and outcome. Further, to prove the necessity of a functional GR, we substituted the glucocorticoid resistant (NR3C1 mutant) REH cell line with a wild- type NR3C1 expression vector and blocked the GR in the GC-sensitive and wt

NR3C1 AT-1 and AT-2 cell lines. These experiments allowed us to study the in vitro

GC response and to evaluate the in vivo behavior of GR reconstituted REH cells in a xenograft mouse model.

Results and Discussion

Genetic alterations in glucocorticoid signaling pathway components are associated with adverse prognosis in children with relapsed ETV6/RUNX1-positive acute lymphoblastic leukemia

Manuscript submitted

Authors: Reinhard Grausenburger1*; Stephan Bastelberger1*; Cornelia Eckert2; Maximilian Kauer1; Martin Stanulla3; Christian Frech1; Eva Bauer4; Dagmar Stoiber4,5; Arend von Stackelberg2; Andishe Attarbaschi6; Oskar A. Haas1,6; Renate Panzer- Grümayer1§.

1 Children´s Cancer Research Institute, St. Anna Kinderkrebsforschung, Vienna, Austria 2 Department of Pediatrics, Division of Oncology and Hematology, Charité, Berlin, Campus Virchow Klinikum, Berlin, Germany 3 Department of Pediatrics, University Hospital Hannover, Hannover, Germany 4 Ludwig Boltzmann Institute for Cancer Research, Vienna, Austria 5 Institute of Pharmacology, Medical University of Vienna, Vienna, Austria 6 St. Anna Kinderspital, Medical University Vienna, Vienna, Austria

*, these authors equally contributed to the paper; §, corresponding author.

RG and SB performed experiments, analyzed data and compiled results; CE, MS,

AvS and AA provided patients samples and clinical data; MK and CF did statistical analyses; EB and DS performed xenotransplantation; OAH interpreted results and wrote the paper; RPG designed and supervised the study, interpreted results and wrote the paper. All authors read the manuscript and approved its final version.

Abstract

The ETV6/RUNX1 gene fusion defines the largest genetic subgroup of childhood ALL with overall rapid treatment response. However, up to 15% of cases relapse.

Because an impaired glucocorticoid pathway is implicated in disease recurrence we studied the impact of genetic alterations by SNP array analysis in 31 relapsed cases.

In 58% of samples, we found deletions in various glucocorticoid signaling pathway- associated genes, but only NR3C1 and ETV6 deletions prevailed in minimal residual disease poor responding and subsequently relapsing cases (p<0.05). To prove the necessity of a functional glucocorticoid receptor, we reconstituted wild-type NR3C1 expression in mutant, glucocorticoid-resistant REH cells and studied the glucocorticoid response in vitro and in a xenograft mouse model. While these results prove that glucocorticoid receptor defects are crucial for glucocorticoid resistance in an experimental setting, they do not address the essential clinical situation where GC resistance at relapse is rather part of a global drug resistance.

INTRODUCTION

The ETV6/RUNX1 (E/R) gene fusion is the genetic hallmark of the largest subgroup of childhood B cell precursor acute lymphoblastic leukemia (ALL), which also has the overall most favorable prognostic outlook (Pui et al., 2011). Despite its low risk features and rapid response to current treatment regimens, up to 15% of cases still relapse (Seeger et al., 1999). These disease recurrences are more difficult to treat and therefore also responsible for a dismal outcome in a considerable proportion of affected children (Kuster et al., 2011).

Synthetic glucocorticoids (GC) are an integral component of all major childhood ALL treatment protocols (Inaba and Pui, 2010, Pui et al., 2011). In BFM-based first-line protocols, for instance, except for a single dose of intrathecal methotrexate, prednisolone (PRED) is the only drug given for one week prior to a four-drug induction regimen (Schrappe et al., 2000). Following the establishment of the PRED response as an important predictive factor, PRED poor responders (PPR) were assigned to the high-risk arm in consecutive treatment studies. However, such an approach was not feasible in relapse cases, because multidrug chemotherapy is applied instantly and the effect of PRED cannot be singled out anymore. This simple stratifying parameter eventually lost its predominant role, because molecular monitoring of residual disease was proven to be highly relevant and therefore successfully applied for first but also second line treatments (Conter et al., 2010, von

Stackelberg et al., 2004, Eckert et al., 2001).

GCs exert their function by binding to the cognate glucocorticoid receptor (GR). After internalization and transport to the nucleus, monomers will interact with various transcription factors, whereas homo-dimers transcriptionally activate or repress

30 genes that contain glucocorticoid-response elements (Inaba and Pui, 2010, Schmidt et al., 2004). The perturbed regulation of the various components of this signaling pathway, such as the pro- and anti-apoptotic members of the BCL2 family, are implicated in the development of GC resistance in childhood leukemia (Schmidt et al., 2004). Alterations of the involved genes, primarily in form of deletions, are therefore highly relevant in our specific context.

SNP arrays are currently the most efficient method to assess copy number aberrations (CNA) in a genome-wide and systematic fashion. Previous array analyses of E/R-positive ALL had already established that a high number of such

CNA occur specifically in this genetic subgroup (Mullighan et al., 2007). In addition to deletions in genes that are important for the regulation of B cell differentiation, cell cycle and apoptosis, they affect also genes that are involved in immediate GC signaling. The arrays were mainly performed in samples that were obtained at diagnosis (Mullighan et al., 2007, van Galen et al., 2010, Lilljebjorn et al., 2007), but also in smaller matched diagnosis and relapse cohorts (Kuster et al., 2011, van Delft et al., 2011, Mullighan et al., 2008). In these latter studies it emerged that deletions of genes that are involved in the GC-mediated signaling pathway prevail in relapse.

This finding was therefore taken as an indication that these alterations could render the affected cells GC resistant, which in turn would then constitute a significant precondition for disease recurrence. The most common of these deletions affects

NR3C1, the gene that encodes the GR.

Based on the above facts, we were therefore interested to further explore the in vivo and in vitro effects of such GC pathway-associated genetic alterations and, in particular, the potential contribution of an altered GR, because of its exquisite position but unresolved role in relapse cases. We thus performed CNA analyses in 31 an additional cohort of 31 E/R-positive ALL relapse cases that were uniformly treated according to ALL-REZ BFM 95/96 and 2002 protocols (Eckert et al., 2013b, Eckert et al., 2013c). Selecting samples from molecularly good and poor responding cases enabled us to compare the incidence and distribution of the various genetic lesions with the patients' response to treatment and outcome. In addition, we also assessed the effects of NR3C1 deletions on the downstream GR signaling and response to GC in E/R-positive leukemia cell lines.

METHODS

Patients

We studied 31 children and adolescents with E/R-positive ALL and a first isolated or combined bone marrow relapse that were enrolled to ALL-REZ BFM 95/96 and 2002 protocols (Eckert et al., 2013b, Eckert et al., 2013c). Cases were selected based on the availability of material and their molecular response to relapse chemotherapy.

According to minimal residual disease (MRD) criteria, 15 cases had a good and 16 a poor response (Eckert et al., 2001). A second set of diagnostic samples from 12 E/R- positive ALL cases was included with a PPR to first-line treatment from the ALL BFM

2000 protocol (Conter et al., 2010).

Leukemia samples with at least 85% blasts and matched remission samples were obtained from the German and Austrian study centers on institutional review approval and with approval of the respective ethics committee. Informed consent for tissue banking and research studies was obtained from patients, their parents or legal guardians in accordance with the Declaration of Helsinki.

At the time of relapse patients were 8.9 years old (median, range, 5.4-17.6). Based on the duration of their first remission of ≤30 months or longer, relapses were classified as early or late, respectively. Six of 31 were early and the remaining 25 late relapses with median first remission duration of 38 months (range18-153 months).

Clinical and molecular response data are summarized in Table I.

The age of the children with a PPR to front-line therapy was 4.6 years (median, range, 2.8 – 10.5). MRD response and outcome of the respective patients is shown in Table II.

Sample Preparation and SNP Array Analysis

DNA was extracted from bone marrow mononuclear cells (BM MNC) according to standard protocols and used for Affymetrix Genome-Wide Human 6.0 SNP Array analysis. DNA quality control and array hybridization were performed by Atlas

Biolabs (Berlin, Germany) and AROS Applied Biotechnology (Aarhus, Denmark).

Copy number analysis was performed essentially as described previously (Kuster et al., 2011, Inthal et al., 2012, Morak et al., 2012). A short description is provided under

Supplemental Methods.

Mutational Screening of NR3C1

The entire coding region of the human glucocorticoid receptor alpha (hGR-) was sequenced using primers for the flanking regions of exons 2 to 9a. The respective primer sequences are provided as Supplemental Methods.

Quantitative Reverse Transcription PCR (RT-qPCR) and Immunoblotting

Total RNA was isolated with Trizol Reagent (Invitrogen, Carlsbad, CA, USA) and reverse-transcribed with M-MLV Reverse Transcriptase (Promega, Fitchburg, WI,

USA). RT-qPCR was performed using an Applied Biosystems 7500 Real-Time PCR detection system for BMF, NR3C1, BIM and GILZ as well as GUS as endogenous control, using published primer/probe combinations (Kuster et al., 2011, Riml et al.,

2004), and the following BIM primer/probe combination:

fw 5’–CCCTACCTCCCTACAGACAGAGC–3’;

rv 5’–CCTTGCATAGTAAGCGTTAAACTCG–3’;

probe 5’-TGAACCTGCAGATATGCGCCCAGAGATATG–3’.

For SDS-PAGE and immunoblotting, cell lysates were prepared, resolved and transferred, as described previously (Kuster et al., 2011). The following primary antibodies were used: anti-GR (E20, Santa Cruz Biotechnology, Dallas, TX, USA), anti-BMF (9G10, Alexis Biochemicals, San Diego, CA, USA), anti-BIM (5598685, BD

Biosciences Pharmingen, New Jersey, NJ, USA), anti-PUMA (#4976, Cell Signaling,

Danvers, MA, USA) and anti-GAPDH (D16H11, XP™, Cell Signaling). Secondary antibodies were infrared-labeled for detection with the Odyssey Infrared Imaging

System (LI-COR Biosciences, Lincoln, NE, USA).

Cell lines, Cell culture, Glucocorticoid and Inhibitor Treatment

The E/R-positive cell lines REH (DSMZ, Braunschweig, Germany), AT-1 and AT-2

(kindly provided by JD Rowley, University of Chicago, IL, USA) were grown under standard conditions. The synthetic glucocorticoids PRED (Solu-Dacortin, Merck,

Whitehouse Station, NJ, USA) and dexamethasone (Sigma, Vienna, Austria) were dissolved in water and ethanol, respectively, and used at the indicated

34 concentrations. The hGR antagonist Mifepristone (RU486; Sigma) was dissolved in ethanol and used in a 1µM concentration.

Apoptosis and Viability Assays

Apoptosis rates and cell viability were measured by Annexin V/ PI staining (BD-

Pharmingen,) and the 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide

(MTT) assay, respectively, as described previously (Fuka et al., 2012).

Generation of hGR-wt Expressing REH Cells

REH cells that normally lack a functional GR were retrovirally infected with hGR-wt vectors (pLIB-IRES-GFPNeo-hGR-wt) or a DNA-binding mutant, inactive form of hGR (pLIB- IRES-GFPNeo-hGR-R477H), as a control (Riml et al., 2004). Retroviral supernatant was produced by lipofectamine-mediated transduction of Phoenix G/P cell lines and pseudotyped for human cells by co-transfection with an expression plasmid encoding gibbon ape leukemia virus envelope. 5 x 105 REH cells were infected with 1ml viral supernatant in the presence of 6µg/ml Polybrene (Sigma).

Engraftment of NSG Mice with hGR-wt Reconstituted REH Cells

107 REH cells that stably expressed either hGR-wt or DNA-binding mutant hGR were injected into the tail vein of five NOD/scid/IL2 receptor gamma chain deficient (NSG) mice each. Treatment with 15mg/kg dexamethasone (Dexabene; Merckle Recordati,

Ulm, Germany) given intra-peritoneally from Monday to Friday was started one week after the injection of the modified REH cells and continued until the mice became symptomatic. Mice were then sacrificed and their blood, BM and spleen cells screened by FACS for the presence of human cells with an anti-human APC-labeled

CD19 antibody (Becton Dickinson, Vienna, Austria). Xenograft experiments were 35 approved by the Austrian Federal Ministry for Science and Research

(GZ:66.009/0279-II/3b/2012).

Statistical Analysis

The potential association between particular gene deletions and various clinical or biological parameters was tested with Fisher’s exact test. Differences in viability and

GR downstream target expression of parental and genetically modified E/R-positive leukemic cell lines upon exposure to GC and/or RU486 were assessed by the paired two-tailed t-tests. Statistical analysis of leukemia free survival of mice between groups was performed using the log-rank test. P-values p≤0.05 were considered statistically significant.

RESULTS

The mean per case frequency of CNAs in our new cohort of 31 relapse cases, which were analyzed with Affymetrix 6.0 SNP arrays, was 14.2 (range 3 – 28). It was slightly higher than that established in two previous studies (11 and 12.5 CNAs)

(Kuster et al., 2011, van Delft et al., 2011), most likely because of the higher resolution of our arrays, which increased the number of deletions with a size as small as 50kb. In line with previous reports (Kuster et al., 2011, van Delft et al., 2011,

Mullighan et al., 2008), losses (12 per case, range 2 – 28) were significantly more common than gains (mean 1.6 per case, range 0 – 8). A list with all the encountered

CNAs is provided in Supplemental Table I and graphically depicted in Supplemental

Figure 1.

Frequency of Genetic Deletions in E/R-positive Relapses

Similar to previous studies, we classified the respective deletions especially into those that affect genes involved in the GC signaling pathway, B cell development and cell cycle (Mullighan et al., 2008, Kuster et al., 2011, van Delft et al., 2011).

The overall incidence of deletions in the GC signaling gene components BTG1,

NR3C1, NR3C2, BMF, MSH1 and MSH6 was with 58% (18/31 cases) comparable to the one in our previous report although the individual frequencies were slightly different (Table III) (Kuster et al., 2011). For instance, BTG1 deletions were more common in this series than in the former one (35% versus 11%; p=0.1), whereas those in the mismatch repair genes were less common in the present one (3% versus

17%; p=0.1). Five cases (16%) harbored two or more GC signaling-associated gene deletions. Apart from two cases with a bi-allelic NR3C1 deletion they were all mono- allelic. Being aware that in the E/R-positive leukemia cell line REH, which was established from a relapse sample, the non-deleted NR3C1 allele carries a nonsense mutation, we also screened the entire coding region of this gene in 18 representative relapse samples for potential mutations but did not identify any.

In contrast to the GC signaling components, the frequency of deletions in B cell development-associated genes (listed in Supplemental Methods), was with 68%

(21/31 cases) considerably higher than the 39% reported earlier (Kuster et al., 2011, van Delft et al., 2011). This discrepancy can be explained by a better array resolution, which increased the detection rate of the usually small RAG2 deletions from 6 to 10% in previous studies to 32% in our study (Table III) (Kuster et al., 2011, van Delft et al., 2011). Moreover, three cases had bi-allelic and the other seven

37 mono-allelic deletions. Four of the latter also include the adjacent RAG1 gene

(Supplemental Table I and II).

The most common of all remaining recurrent deletions concerned the tumor- suppressor gene ETV6 (19 cases, 61%), followed by BCL2L14, a gene that codes for a mainly pro-apoptotic BH3-only family member, and CDKN1B, which generates the cyclin kinase inhibitor p27. Since both genes flank ETV6, they were co-deleted in 12

(38%) and 11 (35%) cases, respectively. Other common deletions affected genes that encode cell cycle regulators, such as CDKN2A, CDKN2B and RB1 in 11 (35%),

9 (29%) and 3 (10%) cases, respectively (Table III and Supplemental Table II).

Association of Genetic Alterations with Clinical Characteristics and Outcome

Utilizing this information we checked the relationship between individual or particular combinations of deletions and specific clinical risk parameters, such as time of relapse (early versus late), site of relapse (isolated versus combined BM involvement), molecular response to relapse therapy and outcome (Supplemental

Table III).

Of all GC signaling pathway-associated gene deletions only those in NR3C1 were associated with a subsequent relapse (50% versus 8%, p<0.04) and tended to more frequently occur in cases with a poor MRD response to relapse treatment (25% versus 7%; p=0.3).

ETV6 gene deletions prevailed among MRD poor responding cases (81% versus

40%, p<0.05). However, since ETV6 deletions are similarly frequent at diagnosis and at relapse (Kuster et al., 2011, Mullighan et al., 2008, van Delft et al., 2011) and the gene is not expressed in the remaining, non-deleted cases (Patel et al., 2003, Stams

38 et al., 2005), it is difficult to imagine that they can play a major role in the development of drug resistance. The concomitant deletions of the BCL2L14 and/or

CDKN1B genes, which were also more frequent than in our former study (56% versus 20%, p=0.07, and 50% versus 20%, p=0.1, respectively), are in fact much better candidates, because even a partial loss of their function might affect apoptosis and drug response in a substantial way (Liu et al., 2008, Glinskii et al., 2009,

Kullmann et al., 2013). This view is further corroborated by the fact that the deletion frequency of the cell cycle regulators CDKN2A and CDKN2B are also higher in MRD poor responders (50% versus 20% and 40% versus 13%, respectively, p=0.1).

Moreover, the respective deletions predominate in early versus late relapses (69% versus 28%, p=0.1). Taken together, deletions of the NR3C1, BCL2L14, CDKN1B and CDKN2A/B genes create a genetic background that renders an E/R-positive cell population drug-resistant and favors the development of early as well as subsequent relapses in this disease.

Of additional interest is the finding that SLX4IP was deleted in 4 of the overall 6 cases with a subsequent relapse (66% versus 13%, p=0.02) and one with a treatment related death, suggesting this genetic alteration is associated with a dismal outcome. In line with the reported gender prevalence, all these cases were males

(Meissner et al., 2014) and our data thus provide a first hint for its contribution to the observed inferior outcome of male compared to female ALL cases (Conter et al.,

2010).

The only deletions significantly associated with time to relapse in this study were those including MIR650. They were enriched in cases with an early relapse compared to those with a late one (50% versus 4%, p= 0.02), perhaps by affecting cell cycle regulation and proliferation (Girardi et al., 2012, Mraz et al., 2012). 39

CNA Patterns in E/R-positive Cases with an Initial Poor Prednisone Response

Since GC signaling pathway alterations are apparently highly relevant for relapse development in E/R-positive leukemias, we also examined the CNA abnormality patterns in the exceedingly small subgroup of less than 1% of cases that - already after first-line treatment with the BFM 2000 protocol - experiences a poor prednisone response (PPR). The respective results are summarized in Table III and

Supplemental Figure 3. Ten of the 12 selected cases had most likely an isolated PPR because they responded nicely to the subsequent multi-drug induction and consolidation treatment as indicated by a low or intermediate MRD load at the respective time points (Table II). The remaining two cases had a slow early or poor response by MRD analysis. As all PPR cases are stratified as HR, they were treated accordingly (Conter et al., 2010).

With a frequency of 14.8 per case (mean, range 1-27) the overall incidence of CNAs in this PPR group was not different from that established for the entire relapse cohort.

This was also true for the frequency of deletions in genes of the GC signaling pathway (50% versus 58%, p=0.7) in general, and for NR3C1/2 and/or BTG1 genes, in particular. GC signaling gene deletions appeared slightly more common as compared to E/R-positive ALL cases at initial diagnosis (36% and 29%, respectively)

(Kuster et al., 2011, van Delft et al., 2011), whereby NR3C2 deletions seem to be more common in this cohort than in the relapse cohort and previous studies, but the small number of cases precludes any further meaningful detailed analyses regarding the frequency of particular gene deletions.

The only divergence we observed concerned CDKN2A/B gene deletions, which were not only more frequent in PPR than in relapse cases (7/12 (58%), with 3/7 being bi- allelic, versus 9/31 (29%), p=0.09), but which also exceeded the ones encountered in several cohorts of E/R-positive cases with a presumed or confirmed prednisone good response (PGR, 15% - 33%) (Table III and Supplemental Figure 2) (Kuster et al.,

2011, van Delft et al., 2011, Mullighan et al., 2007). While the predictive value of

CDKN2A/B deletions varies among different genetic ALL subgroups (Sulong et al.,

2009, Mirebeau et al., 2006, Graf Einsiedel et al., 2002), their prevalence in PPR

E/R-positive cases provides at least some circumstantial evidence that they are involved and necessary for an appropriate GC signaling. Nevertheless, CDKN2A/B deletions most likely do not influence outcome adversely, at least when treated according to HR protocols, since only the case that relapsed (#42) had an MRD-HR and was therefore multidrug resistant.

The second set of altered genes that differed in their frequency between PPR and relapse cases is implicated in B cell development and differentiation (8% and 68%, respectively; p=0.0006) (Table III). This incidence is also lower compared to that at initial diagnosis of E/R-positive ALL (29% - 39%), reported previously (Kuster et al.,

2011, van Delft et al., 2011, Mullighan et al., 2008).

GR Receptor Function Determines the in vitro Response to GC in E/R-positive

Cell Lines and in a Xenograft Mouse Model

We used GC resistant (REH) and GC sensitive (AT-1, AT-2) E/R-harboring leukemic cell lines to model and assess the consequences of a functional loss of the GR in

E/R-positive leukemias. With the help of SNP array, FISH and sequence analyses, we first checked that in the REH cell line one NR3C1 allele is indeed deleted and the other one affected by a p.(Gln528*) nonsense mutation and also that no such 41 alterations are present in the AT-1 and AT-2 cell lines (data not shown). Consistent with the lack of a functional GR, REH cells were resistant to PRED when exposed to clinically meaningful concentrations (1µg/mL), as indicated by their unchanged viability as well as the inability to induce the GR downstream targets BCL2 modifying factor (BMF), the BCL2-like gene BIM, glucocorticoid-induced leucine zipper (GILZ) and BCL2 binding component 3 (PUMA) (Ploner et al., 2008, Bachmann et al., 2007) at the transcript and the protein levels (Figure 1A-C). By contrast, both GC sensitive cell lines showed a reduced viability upon exposure to the same PRED concentration and the concomitant up-regulation of GR, as well as of the downstream targets at both transcript and protein levels (Figure 1A-C).

Next, we checked whether the functional restoration of GR alone is able to abolish

GC resistance even in case other downstream GC signaling pathway components, such as BTG1, are deleted. For this purpose, we reconstituted REH cells with an hGR-wt and, as a control, the DNA-binding mutant GR R477H encoding expression vector that results in the expression of an inactive GR (Riml et al., 2004). The clone that produced a similar GR protein level as the GR-wt E/R-positive leukemic cell lines was chosen for further experiments (Figure 2A). Exposing reconstituted cells to

PRED diminished their viability, increased their apoptotic rate (Figure 2B) and led to increased BMF, BIM, and GILZ transcript and protein levels (Figure 2A, C). The corresponding reverse experiment, namely blocking the wt GR in the GC-sensitive

AT-1 and AT-2 cell lines, as well as hGR-wt reconstituted REH cells with the synthetic GR antagonist RU486, rendered them GC resistant (Figure 2D–E,

Supplemental Figure 3). Of note, all three cell lines had bi-allelic CDKN2A/B deletions, which did not affect the success of these experiments.

Finally, we also investigated to which extent these effects can be reproduced in an in vivo model by injecting REH cells that ectopically expressed either hGR-wt or the respective DNA-binding mutant hGR vector, as control, into the tail vein of NSG mice. Animals were treated with dexamethasone from week two onwards until clinical signs of disease became apparent. Mice engrafted with hGR-wt reconstituted REH cells survived for a median of 42 days (range 42 - 46) and had thus a significantly longer leukemia-free survival (p<0.002) than the respective controls that developed leukemia already at median 27 days (range 27 – 29) (Supplemental Figure 4). While the bone marrow contained similar proportions of REH cells in both groups (median

77%, range 67% - 88% versus median 79%, range 66% - 93%), the spleen of mice engrafted with REH cells expressing hGR-wt had a significantly lower weight (median

0.07g, range 0.06 – 0.09) compared to those transplanted with mutant hGR- expressing REH cells (median 0.142g, range 0.08 – 0.20; p=0.03), indicating that extramedullary infiltration is impaired by the presence of a functional GR in this setting. The results of our in vitro and in vivo experiments thus clearly confirm a central role of the GR receptor in proper GC signaling in E/R-positive leukemias.

DISCUSSION

GC resistance seems to play an important but still largely unexplained role in childhood ALL cases with an ineffective blast cell clearance, disease recurrence and treatment failure in general, and in the E/R-positive subgroup, in particular (Tissing et al., 2005, Haarman et al., 2004, Kofler et al., 2003, Bachmann et al., 2007, Ploner et al., 2008, Kotani et al., 2010). To identify the GC signaling pathway components that contribute to GC resistance and relapse manifestation, we used genome-wide high- resolution SNP array analysis in 31 E/R-positive relapse cases that were treated

43 according to ALL-REZ BFM 1996 and 2002 protocols. The identified deleted genes were then used to correlate their respective patterns with various clinical parameters and outcome. Based on the crucial position of the GR in the GC signaling pathway and its apparent role in E/R-positive relapses, we also examined whether its functional reconstitution would be sufficient to delay development of leukemia in a xenotransplantation mouse model under GC treatment, despite the presence of additional GC-signaling relevant deletions.

In the series presented herein and in agreement with our previous study (Kuster et al., 2011), we found that at least one of the GC signaling pathway-associated genes is deleted in more than half of the investigated relapse cases, whereas only those affecting the GR-encoding NR3C1 gene are associated with a poor response to treatment and disease recurrence. The most frequent deletions affect ETV6 on chromosome 12p together with the adjacent BCL2L14 and CDKN1B genes as well as CDKN2A/B on chromosome 9p. Apart from ETV6, the respective gene products are all involved in cell cycle and apoptosis regulation (Mirebeau et al., 2006, Kuiper et al., 2007, Hogan et al., 2011). We therefore presume that their loss might significantly add to the emergence of drug resistance.

Although the results of the few studies dealing with E/R-positive diagnosis and/or relapse cases are overall in good agreement, there are nevertheless certain quantitative and qualitative differences. The vast majority of them clearly result from the small number of patients analyzed in the individual studies and/or the dissimilar resolution of the applied tools with which they were generated (Mullighan et al., 2008,

Kuster et al., 2011, van Delft et al., 2011, Bokemeyer et al., 2014). The comparatively high incidence of ETV6, BCL2L14, CDKN1B, CDNK2A/B, NR3C1 and especially the usually smaller RAG1, RAG2 and BTG1 gene deletions in our cohort, for instance, 44 can be easily explained by the fact that they derive from SNP arrays, which have a significantly higher resolution than that of the BAC arrays that were used in a similar study (Bokemeyer et al., 2014). Despite this ascertainment bias, however, it is noteworthy that both studies still identified a clear association between NR3C1,

BCL2L14 and CDKN1B deletions and unfavorable clinical parameters as well as a dismal outcome, which corroborates their relevance at least in the context of BFM-

REZ treatment protocols. NR3C1 deletions, in particular, emerged as the factor that best predicted a subsequent disease recurrence. Particularly in combination with similar lesions, mono-allelic NR3C1 deletions seem in general already sufficient to disrupt the signaling pathway balance. Occasionally, alterations of both alleles, such as the bi-allelic deletions in two of our cases, or a combination of deletion and sequence mutation (Schmidt et al., 2006a), as encountered in the E/R-positive REH cell line, will eliminate the function of the GR completely. Such an extreme form of

GC resistance can be reverted by the ectopic expression of the NR3C1-wt gene in in vitro and in vivo experiments. As substantiated by our analyses of 18 cases, NR3C1 mutations are apparently not present in E/R-positive relapses nor do they occur in any other type of ALL (Irving et al., 2005b). Taken together, the results of our experiments therefore definitely prove that GC resistance can be caused by the absence of a functional GR and, as shown in our in vivo model, under appropriate circumstances, also even become biologically relevant. However, such GR defects are rare and therefore not a prime therapeutic target for overpowering GC resistance in a clinical setting. A much more rewarding approach is the recently reported possibility to re-sensitize multi-drug resistant leukemias to GCs as well as other cytotoxic drugs with obatoclax, a putative antagonist of BCL2 family members, which exerts its action by decreasing the activity of the mammalian target of rapamycin

(mTOR) pathway (Bonapace et al., 2010). Based on our previous observation that 45 the E/R fusion protein up-regulates the PI3K-AKT-mTOR pathway, a mechanism that is also indispensable for disease maintenance, we had already proposed that this pathway could be a worthwhile therapeutic aim (Fuka et al., 2012). Since obatoclax was already tested successfully in phase I trials of hematologic diseases in adults, it is one of the best options for treating GC and multi-drug resistant forms of childhood leukemias including the one addressed herein.

The association between ETV6 gene deletions and a poor response and outcome is, at first sight, intriguing and difficult to understand, as already suggested earlier

(Attarbaschi et al., 2004). However, hetero-dimerization between wt ETV6 and E/R apparently hampers the function of the fusion protein and, increasing the ratio of E/R over normal ETV6 by means of deleting the latter, makes the fusion protein more potent (McLean et al., 1996 Dec 1, Lilljebjorn et al., 2010). Moreover, such deletions commonly also encompass adjacent genes, such as the direct p53 effector BCL2L14 and CDKN1B, which are both key players in apoptosis and cell cycle regulation

(Montpetit et al., 2004). Their loss may therefore be at least as relevant for a progressing disease process as the loss of the ETV6 gene itself.

Another previously not reported observation is the comparatively high number of

CDKN2A/B deletions (35%), which are associated with MRD poor response and early emerging relapses. This finding attracted our attention because such deletions are also very common in T-ALL with a poor PRED response and because conditional expression of its respective product p16INK4A can increase the sensitivity to GC- induced apoptosis through the up-regulation of GR expression (Ausserlechner et al.,

2001).

The small cohort of E/R-positive cases that experienced a PPR already at diagnosis had a similarly high number of deletions in various GC pathway components (58%) as the relapse cases but, as far as can be inferred from the small number, probably already a higher one than PRED good responders. Considering this caveat, the fact that NR3C1 deletions are not as common, whereas CDKN2A/B deletions are more common than in PRED good responders, might indicate that CDKN2A/B deletions are probably more important for a PPR (Ausserlechner et al., 2001). On the other hand, an isolated PPR that concurs with a low or intermediate MRD load does not seem to adversely influence outcome in patients when treated as high risk.

The most common GC signaling associated deleted gene in our cohort of patients was BTG1 (35%). which is in line with the reported predominant occurrence of such deletions in E/R-positive leukemias (Waanders et al., 2012). Despite the facts that this GC pathway component regulates the GR-dependent transcriptional response

(van Galen et al., 2010) and that, as proposed recently, the respective deletions might even act as drivers of leukemogenesis (Waanders et al., 2012), we did not find any association between BTG1 deletions and clinical adverse features, which suggests that at least in the context of current BFM first- and second-line treatment protocols they are irrelevant.

Overall, our findings together with previous ones corroborate the notion that the functional impairment of many GC signaling pathway elements is involved in the emergence of GC resistant E/R-positive cell populations. Many of the affected genes are not only engaged in specific GC-signaling alone but also in a variety of other pathways that are, for instance, coordinating the cell cycle and cell survival. GC resistance at relapse can therefore not be viewed in isolation but must always be 47 seen as part of a more global system of drug resistance. In such a context, a distinct form of GC resistance will lose its relevance as soon as effective drugs, such as obatoclax, will become available for clinical use.

ACKNOWLEDGEMENTS

This work was financially supported by grants from the Austrian National Bank (ÖNB

14500) and Austrian Science Fund (FWF): [P 22073-B19]. The authors thank the St.

Anna Kinderkrebsforschung for supporting the research of RP-G and Ludwig

Boltzmann Institute for Cancer Research. We like to acknowledge the help of Andrea

Inthal and Maria Morak with SNP array analysis and Marion Zeginigg for excellent technical assistance.

COMPETING INTERESTS

The authors declare no competing financial interests.

REFERENCES

1. Pui CH, Carroll WL, Meshinchi S, Arceci RJ. Biology, risk stratification, and therapy of pediatric acute leukemias: an update. J Clin Oncol 2011;29:551- 565. 2. Seeger K, Buchwald D, Peter A, et al. TEL-AML1 fusion in relapsed childhood acute lymphoblastic leukemia. Blood 1999;94:374-376. 3. Kuster L, Grausenburger R, Fuka G, et al. ETV6/RUNX1-positive relapses evolve from an ancestral clone and frequently acquire deletions of genes implicated in glucocorticoid signaling. Blood 2011;117:2658-2667. 4. Inaba H, Pui CH. Glucocorticoid use in acute lymphoblastic leukaemia. The Lancet Oncology 2010;11:1096-1106. 5. Schrappe M, Reiter A, Ludwig WD, et al. Improved outcome in childhood acute lymphoblastic leukemia despite reduced use of anthracyclines and cranial radiotherapy: results of trial ALL-BFM 90. German-Austrian-Swiss ALL- BFM Study Group. Blood 2000;95:3310-3322. 6. Conter V, Bartram CR, Valsecchi MG, et al. Molecular response to treatment redefines all prognostic factors in children and adolescents with B-cell precursor acute lymphoblastic leukemia: results in 3184 patients of the AIEOP-BFM ALL 2000 study. Blood 2010;115:3206-3214. 48

7. von Stackelberg A, Seeger K, Henze G, Eckert C. Clinical significance of minimal residual disease in childhood acute lymphoblastic leukemia after first relapse. Leukemia 2004;18:1727-1728; author reply 1728-1729. 8. Eckert C, Biondi A, Seeger K, et al. . Prognostic value of minimal residual disease in relapsed childhood acute lymphoblastic leukaemia. Lancet 2001;358:1239-1241. 9. Schmidt S, Rainer J, Ploner C, Presul E, Riml S, Kofler R. Glucocorticoid- induced apoptosis and glucocorticoid resistance: molecular mechanisms and clinical relevance. Cell Death Differ 2004;11 Suppl 1:S45-55. 10. Mullighan CG, Goorha S, Radtke I, et al. Genome-wide analysis of genetic alterations in acute lymphoblastic leukaemia. Nature 2007;446:758-764. 11. van Galen JC, Kuiper RP, van Emst L, et al. . BTG1 regulates glucocorticoid receptor autoinduction in acute lymphoblastic leukemia. Blood 2010;115:4810- 4819. 12. Lilljebjorn H, Heidenblad M, Nilsson B, et al. Combined high-resolution array- based comparative genomic hybridization and expression profiling of ETV6/RUNX1-positive acute lymphoblastic leukemias reveal a high incidence of cryptic Xq duplications and identify several putative target genes within the commonly gained region. Leukemia 2007;21:2137-2144. 13. van Delft FW, Horsley S, Colman S, et al. Clonal origins of relapse in ETV6- RUNX1 acute lymphoblastic leukemia. Blood 2011;117:6247-6254. 14. Mullighan CG, Phillips LA, Su X, et al. Genomic analysis of the clonal origins of relapsed acute lymphoblastic leukemia. Science 2008;322:1377-1380. 15. Eckert C, Henze G, Seeger K, et al. . Use of allogeneic hematopoietic stem- cell transplantation based on minimal residual disease response improves outcomes for children with relapsed acute lymphoblastic leukemia in the intermediate-risk group. J Clin Oncol 2013;31:2736-2742. 16. Eckert C, von Stackelberg A, Seeger K, et al. Minimal residual disease after induction is the strongest predictor of prognosis in intermediate risk relapsed acute lymphoblastic leukaemia - long-term results of trial ALL-REZ BFM P95/96. European Journal of Cancer 2013;49:1346-1355. 17. Inthal A, Zeitlhofer P, Zeginigg M, et al. CREBBP HAT domain mutations prevail in relapse cases of high hyperdiploid childhood acute lymphoblastic leukemia. Leukemia 2012;26:1797-1803. 18. Morak M, Attarbaschi A, Fischer S, et al. Small sizes and indolent evolutionary dynamics challenge the potential role of P2RY8-CRLF2-harboring clones as main relapse-driving force in childhood ALL. Blood 2012;120:5134-5142. 19. Riml S, Schmidt S, Ausserlechner MJ, Geley S, Kofler R. Glucocorticoid receptor heterozygosity combined with lack of receptor auto-induction causes glucocorticoid resistance in Jurkat acute lymphoblastic leukemia cells. Cell Death Differ 2004;11 Suppl 1:S65-72. 20. Fuka G, Kantner HP, Grausenburger R, et al. Silencing of ETV6/RUNX1 abrogates PI3K/AKT/mTOR signaling and impairs reconstitution of leukemia in xenografts. Leukemia 2012;26:927-933. 21. Patel N, Goff LK, Clark T, et al. Expression profile of wild-type ETV6 in childhood acute leukaemia. Br J Haematol 2003;122:94-98. 22. Stams WA, den Boer ML, Beverloo HB, et al. Expression levels of TEL, AML1, and the fusion products TEL-AML1 and AML1-TEL versus drug sensitivity and clinical outcome in t(12;21)-positive pediatric acute lymphoblastic leukemia. Clin Cancer Res 2005;11:2974-2980.

23. Liu X, Pan Z, Zhang L, et al. JAB1 accelerates mitochondrial apoptosis by interaction with proapoptotic BclGs. Cell Signal 2008;20:230-240. 24. Glinskii AB, Glinsky GV, Lin HY, et al. Modification of survival pathway gene expression in human breast cancer cells by tetraiodothyroacetic acid (tetrac). Cell Cycle 2009;8:3554-3562. 25. Kullmann MK, Grubbauer C, Goetsch K, et al. The p27-Skp2 axis mediates glucocorticoid-induced cell cycle arrest in T-lymphoma cells. Cell Cycle 2013;12:2625-2635. 26. Meissner B, Bartram T, Eckert C, et al. Frequent and sex-biased deletion of SLX4IP by illegitimate V(D)J-mediated recombination in childhood acute lymphoblastic leukemia. Hum Mol Genet 2014;23:590-601. 27. Girardi C, De Pitta C, Casara S, et al. Analysis of miRNA and mRNA expression profiles highlights alterations in ionizing radiation response of human lymphocytes under modeled microgravity. PLoS One 2012;7:e31293. 28. Mraz M, Dolezalova D, Plevova K, et al. . MicroRNA-650 expression is influenced by immunoglobulin gene rearrangement and affects the biology of chronic lymphocytic leukemia. Blood 2012;119:2110-2113. 29. Sulong S, Moorman AV, Irving JA, et al. A comprehensive analysis of the CDKN2A gene in childhood acute lymphoblastic leukemia reveals genomic deletion, copy number neutral loss of heterozygosity, and association with specific cytogenetic subgroups. Blood 2009;113:100-107. 30. Mirebeau D, Acquaviva C, Suciu S, et al. The prognostic significance of CDKN2A, CDKN2B and MTAP inactivation in B-lineage acute lymphoblastic leukemia of childhood. Results of the EORTC studies 58881 and 58951. Haematologica 2006;91:881-885. 31. Graf Einsiedel H, Taube T, Hartmann R, et al. Deletion analysis of p16(INKa) and p15(INKb) in relapsed childhood acute lymphoblastic leukemia. Blood 2002;99:4629-4631. 32. Ploner C, Rainer J, Niederegger H, et al. The BCL2 rheostat in glucocorticoid- induced apoptosis of acute lymphoblastic leukemia. Leukemia 2008;22:370- 377. 33. Bachmann PS, Gorman R, Papa RA, et al. Divergent mechanisms of glucocorticoid resistance in experimental models of pediatric acute lymphoblastic leukemia. Cancer Res 2007;67:4482-4490. 34. Tissing WJ, Lauten M, Meijerink JP, et al. Expression of the glucocorticoid receptor and its isoforms in relation to glucocorticoid resistance in childhood acute lymphocytic leukemia. Haematologica 2005;90:1279-1281. 35. Haarman EG, Kaspers GJ, Pieters R, Rottier MM, Veerman AJ. Glucocorticoid receptor alpha, beta and gamma expression vs in vitro glucocorticod resistance in childhood leukemia. Leukemia 2004;18:530-537. 36. Kofler R, Schmidt S, Kofler A, Ausserlechner MJ. Resistance to glucocorticoid- induced apoptosis in lymphoblastic leukemia. J Endocrinol 2003;178:19-27. 37. Kotani A, Ha D, Schotte D, den Boer ML, Armstrong SA, Lodish HF. A novel mutation in the miR-128b gene reduces miRNA processing and leads to glucocorticoid resistance of MLL-AF4 acute lymphocytic leukemia cells. Cell Cycle 2010;9:1037-1042. 38. Kuiper RP, Schoenmakers EF, van Reijmersdal SV, et al. High-resolution genomic profiling of childhood ALL reveals novel recurrent genetic lesions affecting pathways involved in lymphocyte differentiation and cell cycle progression. Leukemia 2007;21:1258-1266.

39. Hogan LE, Meyer JA, Yang J, et al. Integrated genomic analysis of relapsed childhood acute lymphoblastic leukemia reveals therapeutic strategies. Blood 2011;118:5218-5226. 40. Bokemeyer A, Eckert C, Meyr F, et al. Copy number genome alterations are associated with treatment response and outcome in relapsed childhood ETV6/RUNX1-positive acute lymphoblastic leukemia. Haematologica 2014;99:706-714. 41. Schmidt S, Irving JA, Minto L, et al. Glucocorticoid resistance in two key models of acute lymphoblastic leukemia occurs at the level of the glucocorticoid receptor. The FASEB journal : official publication of the Federation of American Societies for Experimental Biology 2006;20:2600- 2602. 42. Irving JA, Minto L, Bailey S, Hall AG. Loss of heterozygosity and somatic mutations of the glucocorticoid receptor gene are rarely found at relapse in pediatric acute lymphoblastic leukemia but may occur in a subpopulation early in the disease course. Cancer Res 2005;65:9712-9718. 43. Bonapace L, Bornhauser BC, Schmitz M, et al. . Induction of autophagy- dependent necroptosis is required for childhood acute lymphoblastic leukemia cells to overcome glucocorticoid resistance. J Clin Invest 2010;120:1310- 1323. 44. Attarbaschi A, Mann G, Konig M, et al. Incidence and relevance of secondary chromosome abnormalities in childhood TEL/AML1+ acute lymphoblastic leukemia: an interphase FISH analysis. Leukemia 2004;18:1611-1616. 45. McLean TW, Ringold S, Neuberg D, et al. . TEL/AML-1 dimerizes and is associated with a favorable outcome in childhood acute lymphoblastic leukemia. Blood 1996 Dec 1;88:4252-4258. 46. Lilljebjorn H, Soneson C, Andersson A, et al. The correlation pattern of acquired copy number changes in 164 ETV6/RUNX1-positive childhood acute lymphoblastic leukemias. Hum Mol Genet 2010;19:3150-3158. 47. Montpetit A, Larose J, Boily G, Langlois S, Trudel N, Sinnett D. Mutational and expression analysis of the chromosome 12p candidate tumor suppressor genes in pre-B acute lymphoblastic leukemia. Leukemia 2004;18:1499-1504. 48. Ausserlechner MJ, Obexer P, Wiegers GJ, Hartmann BL, Geley S, Kofler R. The cell cycle inhibitor p16(INK4A) sensitizes lymphoblastic leukemia cells to apoptosis by physiologic glucocorticoid levels. J Biol Chem 2001;276:10984- 10989. 49. Waanders E, Scheijen B, van der Meer LT, et al. The origin and nature of tightly clustered BTG1 deletions in precursor B-cell acute lymphoblastic leukemia support a model of multiclonal evolution. PLoS genetics 2012;8:e1002533. 50. Flohr T, Schrauder A, Cazzaniga G, et al. Minimal residual disease-directed risk stratification using real-time quantitative PCR analysis of immunoglobulin and T-cell receptor gene rearrangements in the international multicenter trial AIEOP-BFM ALL 2000 for childhood acute lymphoblastic leukemia. Leukemia 2008;22:771-782.

TABLES

Table I. Clinical characteristics of 31 E/R-positive relapsed ALL cases Observation 1st Rem. Relapse Pt ID MRD * Outcome time (months) site (months) 1 18 BM poor 2nd relapse 126 2 21 BM poor 2nd relapse 143 3 23 BM/CNS poor 2nd relapse 150 4 30 BM/testis poor 2nd CCR 21 5 30 BM/testis poor 2nd relapse 111 6 31 BM poor 2nd CCR 65 7 36 BM poor 2nd CCR 100 8 37 BM poor 2nd CCR 28 9 38 BM poor 2nd CCR 68 10 39 BM poor 2nd CCR 38 11 40 BM poor 2nd CCR 43 12 42 BM/testis poor 2nd CCR 127 13 45 BM poor 2nd CCR 38 14 49 BM/testis poor 2nd CCR 104 15 65 BM poor 2nd CCR 75 16 106 BM poor 2nd CCR 76 17 26 BM/CNS good 2nd CCR 64 18 31 BM good 2nd CCR 132 19 31 BM/CNS good 2nd CCR 50 20 33 BM good 2nd CCR 124 21 35 BM/CNS good 2nd CCR 37 22 38 BM good 2nd CCR 101 23 39 BM good 2nd CCR 107 24 40 BM good 2nd relapse 53 25 44 BM good 2nd CCR 138 26 50 BM good TRD 14 27 61 BM good 2nd CCR 71 28 68 BM good 2nd CCR 42 29 78 BM/testis good 2nd CCR 76 30 108 BM good 2nd CCR 102 31 153 BM good 2nd relapse 70 *, molecular response to relapse treatment(Eckert et al., 2001); BM, bone marrow; CNS, central nervous system; CCR, complete continuous remission; TRD, treatment related death. Cases 1-16, MRD-poor response; cases 17-31, MRD-good response

Table II. Clinical characteristics of 12 E/R- positive ALL cases with PPR to front line therapy

Observation Pt ID MRD Outcome time (mo)

32 LR CCR 76 33 LR CCR 62 34 LR CCR 88 35 IR CCR 44 36 IR CCR 58 37 IR CCR 91 38 LR CCR 92 39 LR CCR 85 40 LR CCR 61 41 IR CCR 194 SCT, 42 HR relapse, 140 death 43 SER/IR CCR 22 Pt, patient; MRD, minimal residual disease risk group(Flohr et al., 2008); LR, low risk; IR, intermediate risk, HR, high risk; SER, slow early responder; CCR, complete continuous remission; SCT, hematopoietic stem cell transplantation.

Table III. List of selected genes affected by CNAs in relapses and PPR E/R- positive leukemias Chromo- Relapse PPR Diagnosis Gene Cytoband some (n=31) (n=12) Copy Number Loss Number of Cases (%)

GC signaling BTG1 12 q22 11 (35) 2 (17) NR3C1 5 q31.3 5 (16) 1 (8) NR3C2 4 q31.23 4 (13) 3 (25) BMF 15 q14 3 (10) 1 (8) MSH2 2 p21 1 (3) 0 MSH6 2 p16.3 1 (3) 0

Cell cycle regulation CDKN2A 9 p21.3 11 (35) 7 (58) CDKN2B 9 p21.3 9 (29) 7 (58) CDKN1B 12 p13.1 - p12 11 (35) 4 (33) RB1 13 q14.2 3 (10) 0

B-cell development/differentiation RAG2 11 p12 10 (32) 0 EBF1 5 q33.3 4 (13) 1 (8) PAX5 9 p13.2 4 (13) 0 RAG1 11 p12 4 (13) 0 TCF3 19 p13.3 2 (6) 0 BLNK 10 q24.1 1 (3) 0 CD79A 19 q13.2 1 (3) 0 IKZF1 7 p12.2 1 (3) 0 IKZF2 2 q34 1 (3) 0 IRF8 16 q24.1 1 (3) 0

Others ETV6 12 p13.2 19 (61) 7 (58) VPREB1 22 q11.22 19 (61) 7 (58) BCL2L14 12 p12 19 (61) 4 (33) SLX4IP 20 p12.2 8 (26) 1 (8)

Copy Number Gain Number of Cases (%) RUNX1 21 q22.3 3 (10) 1 (8) Chr, chromosome; PPR, prednisone poor response at initial diagnosis.

FIGURE LEGENDS

Figure 1. Response of E/R-positive leukemic cell lines to glucocorticoids.

(A) Western blot analysis of GR signaling components of AT-1, AT-2 (wt GR) and

REH (mutant GR) cell lines after exposure to PRED (1 µg/ml for 24 hrs). Protein abundance was determined using anti-GR, anti-BMF, anti-BIM and anti-PUMA antibodies. GAPDH was used as loading control. (B) Viability of AT-1, AT-2 and REH cells upon exposure to PRED (1µg/ml for 48 hrs), measured by MTT assay. Values are means +/- SD from four independent experiments. **, p≤0.005 (paired t-test). (C)

Quantification of GR, BMF, BIM and GILZ transcripts (RT-qPCR) in response to

PRED (1 µg/ml) exposure for 12 hrs (expressed as fold-change of vehicle treated cells) of all three cell lines. Specific mRNA values were measured in triplicates and normalized to endogenous GUS. Bars represent mean values +/- SD from four individual experiments. *, p≤0.05; **, p≤0.005 (paired t-test).

Figure 2. Response of E/R-positive REH cells to corticosteroids as a function of GR.

(A) Western blot of REH cells stably expressing hGR-wt (wt), or a DNA-binding mutant, inactive hGR (R477H) as a control upon exposure to PRED (Pred, 500

µg/ml) (+) or vehicle (-) for 24 hrs. Protein abundance was determined using anti-GR, anti-BMF and anti-BIM antibodies. GAPDH was used as loading control. (B) Viability measured by MTT (left) and apoptosis by Annexin V staining (right) of the same hGR-wt and mutant hGR (R477H) REH cells as in (A) upon exposure to PRED (500

µg/ml) (+) or vehicle (-) for 48 hrs. Results show data from five biological replicates. *, p≤0.05 (paired t-test). (C) RT-qPCR of GR downstream targets BMF, BIM and GILZ

55 from the same experiments as in (B). Triplicate values are normalized to GUS and depicted as mean fold changes +/- SD from five separate experiments. *, p≤0.05; **, p≤0.005 (paired t-test). (D) Viability (MTT; left) and apoptosis (Annexin V single positive cells; right) of AT-2 cells in response to PRED (1 µg/ml), RU486 (1 µM) or a combination of both. Values are normalized to respective vehicle treated cells and represent means +/- SD of four (viability) and two (apoptosis) biological replicates; **, p≤0.005 (paired t-test); **, p=0.001 (unpaired t-test). (E) Quantification of BMF, BIM and GILZ mRNA levels of cells taken from the same experiments as in (D). Shown are relative mRNA levels of cells upon PRED and RU486 exposure as fold-changes of vehicle treated cells from four biological replicates. Bars represent mean values +/-

SD. *, p≤0.05 (paired t-test).

FIGURES

Figure 1 (Grausenburger et al.)

Figure 2 (Grausenburger et al.)

SUPPLEMENTAL MATERIAL

Overview and Legends:

Supplemental Methods. SNP array analysis, primers for NR3C1 sequencing.

Supplemental Table I. Full listing of regions of CNA in 31 ETV6/RUNX1-positive relapse samples.

Supplemental Table II. Overview of recurrent CNA of E/R-positive relapsed and

PPR leukemias.

Supplemental Table III. Association of recurrent gene deletions with clinical parameters.

Supplemental Figure 1. Overview of recurrent copy number aberrations in 31

ETV6/RUNX1-positive cases at relapse. Each line corresponds to a gain or loss of the region (color code at the bottom of the graph) in the chromosome on the left.

Supplemental Figure 2. Overview of recurrent copy number aberrations in 12

ETV6/RUNX1-positive cases with a poor prednisone response at diagnosis. Each line corresponds to a gain or loss of the region (color code at the bottom of the graph) in the chromosome on the left.

Supplemental Figure 3. Response of mutant and GR-wt harboring E/R-positive cell lines to PRED. Apoptosis assessment of hGR-wt reconstituted REH (wt) and DNA- binding mutant hGR (R477H) control transfected REH cells upon exposure to PRED

(µg/ml) and GR-antagonist mifepristone (RU486, µM) at the indicated concentrations for 48 hrs. *, p≤0.05 (paired t-test).

Supplemental Figure 4. Engraftment of hGR-wt reconstituted REH cells in NSG mice treated with dexamethasone. Kaplan Maier survival curves of NSG mice transplanted with hGR-wt reconstituted REH cells (wt; n=5) and DNA-binding mutant

59 hGR expressing REH as control (R477H; n=5). Treatment with dexamethasone (15 mg/kg intraperitoneally, 5 days per week) was started in the second week after injection and continued until mice demonstrated clinical signs of disease.

Significance of differences was calculated by log-rank test. Values of p≤0.05 were considered significant.

Supplementary Methods

SNP array analysis

St. Louis, MO, USA) was used to analyze Raw signal intensities. Segmentation parameters were chosen as follows: 10 minimum genomic markers per segment, a

P-value threshold of 0.001 and a signal-to-noise ratio of 1. Somatic CNA were identified through comparison with matched germ line patterns of remission samples.

For relapse samples #3335, 3331 and 3394 a file referencing 794 HapMap samples was used instead. The Partek Genome Browser was used for log2 ratio visualization and verification of copy number changes detected by genomic segmentation. Final segmentation tables and counts did not include losses and gains that could have resulted from known CNVs of immunoglobulin (Ig) and T cell receptor (TCR) gene rearrangement related processes at the following locations: 2p11.2 (IGK), 7p14.1

(TCRG), 7q34 (TCRB), 14q11.2 (TCRDIA), 14q32.33 (IGH) and 22q11.22 (IGL).

Deletions of the latter region were not excluded if they derived from a focal deletion of VPREB1.

SNP array data are available upon request.

Primers used for NR3C1 sequencing

NR3C1_2Afw primer: § AGCTGCCTCTTACTCGG

NR3C1_2Arev primer: § GCTTTAAGTCTGTTTCCCCC

NR3C1_2Bfw primer: § CAAAAGTGATGGGAAATGAC

NR3C1_2Brev primer: § TACTGGGGCTTGACAAAA

NR3C1_2Cfw primer: ACCACAGACCAAAGCACC

NR3C1_2Crev primer: AGCACATGAATCTTTAGAGAACAC

NR3C1_3fw primer: § TTGAAGCCAGAGTTCACTGTGAGC

NR3C1_3rev primer: § CCCTGAGAAATGAAAACCAAGTAGAGG

NR3C1_4fw primer: CCTGTGAAACTTTAATAGTGCC

NR3C1_4rev primer: TGTATTCACCTGACTCTCCCC

NR2C1_5fw primer: § TAAACTGTGTAGCGCAGACCTT

NR2C1_5rev primer: § TGTATTCACCTGACTCTCCCC

NR2C1_6fw primer: CAAGGAGCAATGAGATCAATTAG

NR2C1_6rev primer: § GGGAAAATGACACACATACAA

NR2C1_7fw primer: TAAACAGCCAAGATGCAGG

NR2C1_7rev primer: § CATGCTTTTGACATAAGGTGA

NR2C1_8fw primer: GGATGACACAGTGAGACCCTATCT

NR2C1_8rev primer: § CAAGCTATCACCAACATCCACA

NR2C1_9fw primer: CAGTGAGATTGGTATATTCTAGGC

NR2C1_9rev primer: AAAGTGATGACGACTCAACTC

§ from Irving et al. (Irving et al., 2005b)

Genes in B cell development

Genes encoding regulators of B cell development include IL7RA, SPI1, TCF3, IKZF1,

IKZF2, IKZF3, EBF1, PAX5, LEF1, IRF4, IRF8, BCL11A, SOX4, STAT3, STAT5A,

STAT5B, BLNK, RAG1, RAG2, MEF2C, CD79A, GAPBA (Mullighan et al., 2008).

VPREB deletions, found in 19 of 31 (61%) cases, were not caused by rearrangements of the immunoglobulin lambda light chain (IGL) locus at chromosome 22q11, but were nevertheless excluded to allow for comparison with other studies, which all excluded such deletions.

References

1. Irving JA, Minto L, Bailey S, et al. Loss of heterozygosity and somatic mutations of the glucocorticoid receptor gene are rarely found at relapse in pediatric acute lymphoblastic leukemia but may occur in a subpopulation early in the disease course. Cancer research 2005:65(21):9712-9718. 2. Mullighan CG, Phillips LA, Su X, et al. Genomic analysis of the clonal origins of relapsed acute lymphoblastic leukemia. Science 2008:322(5906):1377- 1380.

Supplementary Table I. Full listing of regions of CNA in 31 ETV6/RUNX1-positive relapse samples No of gen ID Chr Start End CN es First 20 genes 1 2 9761079 9783436 1.33 1 YWHAQ 1 2 30549322 30845590 1.24 1 LCLAT1 1 5 122725615 122857507 1.40 2 CEP120/CSNK1G3 1 5 142772808 142985398 0.74 1 NR3C1 1 6 4782650 4864771 1.17 1 CDYL 1 6 90816897 91087689 1.45 2 BACH2/MIR4464 1 6 93873677 93970792 1.37 1 EPHA7 1 6 151362663 151555901 1.31 1 MTHFD1L 1 7 148329137 148416913 1.21 1 CUL1 KIAA1432/ERMP1/MLANA/KIAA2026/MIR4665/RANBP6/IL33/TPD52L3/UHRF2/GLDC/KDM4 1 9 5755170 18680027 1.30 33 C/C9orf123/PTPRD/TYRP1/LURAP1L/MPDZ/FLJ41200/LINC00583/NFIB/ZDHHC21

SLC24A2/MLLT3/MIR4473/MIR4474/FOCAD/MIR491/PTPLAD2/IFNB1/IFNW1/IFNA21/IFNA4/ 1 9 19723799 24451221 1.29 35 IFNA7/IFNA10/IFNA16/IFNA17/IFNA14/IFNA22P/IFNA5/KLHL9/IFNA6 1 9 80388038 80639664 1.24 1 GNAQ 1 9 115134213 115479022 1.29 3 HSDL2/KIAA1958/INIP GHITM/C10orf99/CDHR1/LRIT2/LRIT1/RGR/LOC170425/CCSER2/GRID1- AS1/GRID1/MIR346/WAPAL/OPN4/LDB3/BMPR1A/MMRN2/SNCG/C10orf116/AGAP11/FAM2 1 10 85174999 106305966 1.30 251 5 1 11 120208937 120288443 1.34 1 ARHGEF12 1 12 11803438 11986005 1.33 2 ETV6/RNU6-19 1 12 14409769 14521832 1.30 1 ATF7IP 1 12 92282304 92540005 1.28 2 LOC256021/BTG1 1 12 123848904 123955138 1.46 3 SETD8/RILPL2/SNRNP35 1 12 133417742 133655145 1.34 4 CHFR/ZNF605/ZNF26/ZNF84

1 13 50685399 50732573 1.19 7 DLEU2/MIR3613/TRIM13/KCNRG/MIR16-1/MIR15A/DLEU1 1 15 54283984 55453657 1.31 1 UNC13C

1 18 77722852 77912469 1.25 5 HSBP1L1/TXNL4A/RBFA/ADNP2/PARD6G-AS1 1 20 10416029 10520097 1.27 1 SLX4IP 1 21 27764354 27885964 1.25 1 CYYR1 1 21 38423315 38459885 1.19 2 PIGP/TTC3 1 22 22559722 22600189 0.57 1 VPREB1 1 22 23163688 23189087 1.03 1 MIR650

SOCS5/LOC388948/LOC100134259/MCFD2/TTC7A/C2orf61/CALM2/EPCAM/MIR559/MSH2/ 2 2 46855806 48042020 0.91 13 KCNK12/MSH6/FBXO11 MIR138- 1/TOPAZ1/TCAIM/ZNF445/ZNF167/ZNF660/ZNF197/ZNF35/ZNF502/ZNF501/KIAA1143/KIF1 2 3 43943191 47032030 1.21 52 5/MIR564/TMEM42/TGM4/ZDHHC3/EXOSC7/CLEC3B/CDCP1/TMEM158 2 3 59999157 61391776 1.16 1 FHIT 2 5 94068809 94353709 1.13 1 MCTP1 2 5 97291110 97447398 1.15 0 PCDHB9/PCDHB10/PCDHB11/PCDHB12/PCDHB13/PCDHB14/PCDHB18/PCDHB19P/PCDH B15/SLC25A2/TAF7/PCDHGA1/PCDHGA2/PCDHGA3/PCDHGB1/PCDHGA4/PCDHGB2/PCD 2 5 140567773 145935394 1.23 65 HGA5/PCDHGB3 2 5 142779875 143201295 0.53 3 NR3C1/MIR5197/HMHB1 2 9 21892180 21992943 1.19 2 C9orf53/CDKN2A 2 10 91650893 91787207 1.24 0 2 11 36613271 36634829 1.33 2 RAG2/C11orf74 2 11 47884683 47991873 1.20 0 2 12 869230 889770 1.18 1 WNK1

OLR1/TMEM52B/GABARAPL1/KLRD1/KLRK1/KLRC4- KLRK1/KLRC4/KLRC3/KLRC2/KLRC1/KLRAP1/MAGOHB/STYK1/CSDA/TAS2R7/TAS2R8/TA 2 12 10321177 14815843 1.25 70 S2R9/TAS2R10/PRR4/PRH1-PRR4

2 12 25403536 25542348 1.22 1 KRAS 2 12 31840251 32139758 1.28 3 AMN1/H3F3C/KIAA1551 2 19 4921540 5025472 1.32 3 UHRF1/MIR4747/KDM4B 2 19 12554050 12664497 1.09 2 ZNF709/ZNF564 2 20 10417430 10520097 1.15 1 SLX4IP 2 22 22384389 22617891 1.34 1 VPREB1 3 3 25703406 25827782 1.35 3 TOP2B/MIR4442/NGLY1

CCRL2/LTF/RTP3/LRRC2/LRRC2- AS1/TDGF1/LOC100132146/ALS2CL/TMIE/PRSS50/PRSS46/PRSS45/PRSS42/MYL3/PTH1 3 3 46431902 49992226 1.27 100 R/CCDC12/NBEAL2/NRADDP/SETD2/KIF9-AS1 3 3 112054135 112216838 1.41 2 CD200/BTLA

3 4 53588542 53745460 1.27 4 ERVMER34-1/LOC152578/RASL11B/SCFD2 3 4 69413896 69481329 1.34 1 UGT2B17 3 5 172265834 172407369 1.32 3 ERGIC1/LOC100268168/RPL26L1 3 6 32412565 32453602 1.32 1 HLA-DRA

GRIK2/HACE1/LINC00577/LIN28B/BVES/BVES- AS1/POPDC3/PREP/PRDM1/ATG5/AIM1/RTN4IP1/QRSL1/LOC100422737/C6orf203/BEND3/ 3 6 101968079 170906568 1.24 377 PDSS2/SOBP/SCML4/SEC63 3 7 69707523 69870843 1.24 1 AUTS2

TCEB1/TMEM70/LY96/JPH1/GDAP1/MIR5681A/MIR5681B/FLJ39080/MIR2052/PI15/CRISPL 3 8 74856101 146247365 2.91 384 D1/HNF4G/ZFHX4-AS1/ZFHX4/PEX2/PKIA/ZC2HC1A/IL7/STMN2/HEY1 ACER2/SLC24A2/MLLT3/MIR4473/MIR4474/FOCAD/MIR491/PTPLAD2/IFNB1/IFNW1/IFNA2 3 9 19447059 23609243 1.32 35 1/IFNA4/IFNA7/IFNA10/IFNA16/IFNA17/IFNA14/IFNA22P/IFNA5/KLHL9 IFNW1/IFNA21/IFNA4/IFNA7/IFNA10/IFNA16/IFNA17/IFNA14/IFNA22P/IFNA5/KLHL9/IFNA6/I 3 9 21130774 22417843 0.57 24 FNA13/IFNA2/IFNA8/IFNA1/MIR31HG/IFNE/MIR31/MTAP 3 9 115249112 115479022 0.61 2 KIAA1958/INIP 3 10 1463300 1514672 1.26 1 ADARB2

INCENP/SCGB1D1/SCGB2A1/SCGB1D2/SCGB2A2/SCGB1D4/ASRGL1/SCGB1A1/AHNAK/E 3 11 61920475 65896896 1.25 172 EF1G/MIR3654/TUT1/MTA2/EML3/ROM1/B3GAT3/GANAB/INTS5/C11orf48/METTL12 LOC374443/CLEC2D/CLECL1/CD69/KLRF1/CLEC2B/KLRF2/CLEC2A/CLEC12A/CLEC1B/CL EC12B/CLEC9A/CLEC1A/CLEC7A/OLR1/TMEM52B/GABARAPL1/KLRD1/KLRK1/KLRC4- 3 12 9808513 16189456 1.29 99 KLRK1 3 12 92215168 92540005 1.30 2 LOC256021/BTG1 3 12 121801687 121935754 2.66 2 RNF34/KDM2B 3 13 33175316 33279711 1.20 1 PDS5B 3 20 10416029 10454448 1.23 1 SLX4IP 3 20 33389155 33683931 1.23 9 NCOA6/HMGB3P1/GGT7/ACSS2/GSS/MYH7B/MIR499A/MIR499B/TRPC4AP 3 22 22569726 22600189 1.34 1 VPREB1 3 X 33631322 33708910 0.57 0 ZNF595/ZNF718/ZNF876P/ZNF732/ZNF141/ABCA11P/ZNF721/PIGG/PDE6B/ATP5I/MYL5/M 4 4 12281 10358206 2.33 142 FSD7/PCGF3/LOC100129917/CPLX1/GAK/TMEM175/DGKQ/SLC26A1/IDUA 4 4 149339652 149904687 1.28 1 NR3C2 4 4 152984315 153252423 1.23 1 FBXW7 4 9 21970150 22010676 0.49 3 CDKN2A/CDKN2B-AS1/CDKN2B 4 10 114167986 114615950 1.56 4 ACSL5/ZDHHC6/VTI1A/MIR4295 4 12 14519792 14718886 1.18 2 ATF7IP/PLBD1 4 12 92299836 92540005 1.13 2 LOC256021/BTG1 RTF1/ITPKA/LTK/RPAP1/TYRO3/MGA/MIR626/MAPKBP1/JMJD7/JMJD7- 4 15 41700499 42465696 1.36 18 PLA2G4B/PLA2G4B/SPTBN5/MIR4310/EHD4/PLA2G4E/PLA2G4D/PLA2G4F/VPS39 4 15 66038338 66063509 0.87 2 DENND4A/MIR4511 4 20 1225056 1242914 1.36 1 RAD21L1 4 22 17177181 17380825 1.15 2 XKR3/HSFY1P1 4 22 22559722 22606141 0.47 1 VPREB1 4 22 23153777 23237417 1.20 2 MIR650/IGLL5 5 4 149161218 149915247 1.35 1 NR3C2 5 7 38281983 38391700 2.56 2 TARP/LOC100506776

5 7 142353140 142500072 0.99 4 MTRNR2L6/PRSS1/PRSS3P2/PRSS2 5 8 101960732 102149321 1.41 2 YWHAZ/FLJ42969

5 9 36689921 37286448 1.43 6 MIR4475/PAX5/MIR4540/MIR4476/LOC100506710/ZCCHC7

5 11 7724568 7896124 1.46 5 OVCH2/OR5P2/OR5P3/OR5E1P/LOC283299 ETV6/RNU6-19/BCL2L14/MIR1244-2/MIR1244-1/MIR1244- 3/LRP6/MANSC1/LOH12CR2/LOH12CR1/DUSP16/CREBL2/GPR19/CDKN1B/APOLD1/MIR6 5 12 11805520 25355995 1.36 86 13/DDX47/RPL13AP20/GPRC5A/MIR614 5 13 41587767 41625583 1.21 1 ELF1 5 14 22487793 22625513 2.90 0 5 18 53250046 53735571 1.36 2 TCF4/MIR4529 5 22 22740434 23256893 1.35 8 ZNF280B/ZNF280A/PRAME/LOC648691/POM121L1P/GGTLC2/MIR650/IGLL5

RAP2C/MBNL3/HS6ST2/HS6ST2- AS1/USP26/TFDP3/GPC4/GPC3/MIR363/MIR92A2/MIR19B2/MIR20B/MIR18B/MIR106A/CCD 5 X 131332038 155233847 3.13 260 C160/PHF6/HPRT1/MIR450B/MIR450A1/MIR450A2 6 1 196726541 196777453 3.63 1 CFHR3 6 5 158349942 158521589 1.38 1 EBF1 6 6 32453602 32638615 3.11 5 HLA-DRB5/HLA-DRB6/HLA-DRB1/HLA-DQA1/HLA-DQB1 6 6 156603481 156875789 1.48 0 6 8 88850867 89117946 1.45 2 DCAF4L2/MMP16 6 20 1560862 1583633 3.64 1 SIRPB1 6 X 129091168 129127618 1.22 0 7 1 89149972 89867558 0.94 11 PKN2/GTF2B/CCBL2/RBMXL1/GBP3/GBP1/GBP2/GBP7/GBP4/GBP5/GBP6

COA6/TARBP1/LOC100506795/IRF2BP2/LINC00184/LOC100506810/TOMM20/SNORA14B/ 7 1 234512487 235726316 0.97 15 RBM34/ARID4B/MIR4753/GGPS1/TBCE/B3GALNT2/GNG4 7 4 38906309 39147641 0.88 4 FAM114A1/MIR574/TMEM156/KLHL5

7 4 76599610 76728831 0.91 1 USO1 7 5 123988168 124084291 0.97 1 ZNF608 7 5 172265834 172346150 1.07 1 ERGIC1 7 6 28246779 28316511 1.01 2 PGBD1/ZNF323 7 6 109230654 109282778 0.87 1 ARMC2 7 6 151362663 151561780 0.98 2 MTHFD1L/AKAP12 7 7 38292407 38399502 1.01 2 TARP/LOC100506776 7 11 36603029 36634771 0.29 2 RAG2/C11orf74 7 11 122536143 122626055 0.97 1 UBASH3B IQSEC3/LOC574538/SLC6A12/SLC6A13/KDM5A/CCDC77/B4GALNT3/NINJ2/WNK1/RAD52/ ERC1/LOC100292680/FBXL14/WNT5B/MIR3649/ADIPOR2/CACNA2D4/LRTM2/LOC1002717 7 12 150442 12031094 2.44 204 02/DCP1B 7 12 89676489 89745354 0.94 1 DUSP6 7 15 26035710 26108982 1.01 2 ATP10A/MIR4715 7 15 93377674 93459290 0.88 3 LOC100507217/CHD2/MIR3175 7 19 28917102 29595067 1.04 2 LOC148145/LOC100505835 ANKRD30BP2/MIR3156- 3/POTED/C21orf15/ANKRD20A11P/LIPI/RBM11/ABCC13/HSPA13/SAMSN1/SAMSN1- 7 21 14434787 35483150 3.34 135 AS1/LOC388813/NRIP1/USP25/LINC00478/MIR99A/MIRLET7C/MIR125B2/C21orf37/CXADR 7 22 22384389 22447015 0.37 0 7 X 32429619 32742518 1.16 1 DMD 8 1 193213189 193239525 0.90 3 CDC73/MIR1278/B3GALT2 8 2 47176182 47192189 1.05 1 TTC7A SCN5A/SCN10A/SCN11A/WDR48/GORASP1/TTC21A/CSRNP1/XIRP1/CX3CR1/CCR8/SLC2 8 3 38639124 50003732 1.65 184 5A38/RPSA/SNORA6/SNORA62/MOBP/MYRIP/EIF1B-AS1/EIF1B/ENTPD3/ENTPD3-AS1 MME/LOC100507537/PLCH1/C3orf33/SLC33A1/GMPS/KCNAB1/KCNAB1-AS2/KCNAB1- AS1/SSR3/TIPARP- AS1/TIPARP/LOC730091/PA2G4P4/LEKR1/LOC339894/LOC100498859/CCNL1/VEPH1/PTX 8 3 154654489 160933328 2.81 44 3 8 3 160933328 161719983 2.81 3 NMD3/SPTSSB/OTOL1

CT64/SI/SLITRK3/BCHE/ZBBX/SERPINI2/WDR49/PDCD10/SERPINI1/LOC646168/GOLIM4/ 8 3 162626283 169551507 7.02 19 EGFEM1P/MIR551B/MECOM/TERC/ACTRT3/MYNN/LRRC34/LRRIQ4

LRRIQ4/LRRC31/SAMD7/LOC100128164/SEC62/GPR160/PHC3/PRKCI/SKIL/CLDN11/SLC7 8 3 169551507 171551444 2.70 17 A14/RPL22L1/EIF5A2/SLC2A2/TNIK/MIR569/PLD1 TMEM212/FNDC3B/GHSR/TNFSF10/NCEH1/ECT2/SPATA16/NLGN1/NAALADL2/NAALADL2 8 3 171551444 174922923 3.73 10 -AS3 NAALADL2/NAALADL2-AS3/MIR4789/TBL1XR1/LINC00578/KCNMB2- 8 3 174922923 179072534 1.16 12 IT1/KCNMB2/ZMAT3/PIK3CA/KCNMB3/ZNF639/MFN1 TPRG1/TPRG1- AS2/TP63/MIR944/LEPREL1/CLDN1/CLDN16/TMEM207/IL1RAP/GMNC/SNAR- 8 3 189007777 193365494 1.13 23 I/OSTN/UTS2D/CCDC50/PYDC2/FGF12/MB21D2/HRASLS/MGC2889/ATP13A5 8 4 149345793 149909834 1.17 1 NR3C2 PLEKHG4B/LRRC14B/CCDC127/SDHA/PDCD6/AHRR/C5orf55/EXOC3/PP7080/SLC9A3/MIR 8 5 15532 24409699 2.86 92 4456/CEP72/TPPP/ZDHHC11/BRD9/TRIP13/LOC100506688/NKD2/SLC12A7/MIR4635 8 5 142779875 143347716 0.47 3 NR3C1/MIR5197/HMHB1 LOC100507584/MIR1275/GRM4/HMGA1/C6orf1/NUDT3/RPS10- NUDT3/RPS10/PACSIN1/SPDEF/C6orf106/SNRPC/UHRF1BP1/TAF11/ANKS1A/TCP11/SCU 8 6 33851153 36785304 1.24 48 BE3/ZNF76/DEF6/PPARD C9orf66/DOCK8/KANK1/DMRT1/DMRT3/DMRT2/SMARCA2/FLJ35024/VLDLR/KCNV2/KIAA0 8 9 187500 39794638 1.21 241 020/RFX3/GLIS3/GLIS3-AS1/SLC1A1/SPATA6L/PPAPDC2/CDC37L1/AK3/RCL1 SPATA31A1/SPATA31A2/FAM74A1/SPATA31A3/FAM74A3/ZNF658/SPATA31A5/SPATA31A 4/SPATA31A7/LOC653501/ZNF658B/MGC21881/KGFLP2/LOC643648/ANKRD20A2/ANKRD 8 9 39794638 129659315 2.79 450 20A3/FAM95B1/FOXD4L2/FOXD4L4/LOC286297 RALGPS1/ANGPTL2/GARNL3/SLC2A8/ZNF79/RPL12/SNORA65/LRSAM1/FAM129B/STXBP 8 9 129659315 134029892 1.28 96 1/MIR3911/C9orf117/PTRH1/TTC16/TOR2A/SH2D3C/MIR3960/MIR2861/CDK9/FPGS NUP214/FAM78A/PPAPDC3/PRRC2B/SNORD62A/SNORD62B/POMT1/UCK1/RAPGEF1/ME 8 9 134029892 141091395 1.28 173 D27/NTNG2/SETX/TTF1/C9orf171/BARHL1/DDX31/GTF3C4/AK8/C9orf9/TSC1 8 10 111771586 111864592 1.15 1 ADD3

IQSEC3/LOC574538/SLC6A12/SLC6A13/KDM5A/CCDC77/B4GALNT3/NINJ2/WNK1/RAD52/ ERC1/LOC100292680/FBXL14/WNT5B/MIR3649/ADIPOR2/CACNA2D4/LRTM2/LOC1002717 8 12 150442 36356124 1.23 335 02/DCP1B 8 12 94520359 94920624 1.20 3 PLXNC1/CCDC41/LOC144486 SCN1A/SCN9A/SCN7A/XIRP2/B3GALT1/STK39/CERS6/MIR4774/CERS6- AS1/NOSTRIN/SPC25/G6PC2/ABCB11/DHRS9/LRP2/BBS5/KBTBD10/FASTKD1/PPIG/CCD 9 2 166865907 170841698 1.22 26 C173 LINC00471/NMUR1/C2orf57/PTMA/MIR1244-2/MIR1244-1/MIR1244- 3/PDE6D/COPS7B/MIR1471/NPPC/DIS3L2/ALPP/ECEL1P2/ALPPL2/ALPI/ECEL1/PRSS56/C 9 2 232337257 235765751 1.12 52 HRND/CHRNG FGD5P1/TPRXL/CHCHD4/TMEM43/XPC/LSM3/SLC6A6/GRIP2/CCDC174/C3orf20/FGD5/FG 9 3 13973262 15184600 1.22 15 D5-AS1/NR2C2/MRPS25/ZFYVE20 9 5 157648276 158482345 1.16 1 EBF1 NT5E/SNX14/SYNCRIP/SNHG5/SNORD50A/SNORD50B/HTR1E/CGA/ZNF292/GJB7/SMIM8/ 9 6 85899810 90754051 1.18 34 C6orf163/C6orf164/C6orf165/SLC35A1/RARS2/ORC3/AKIRIN2/SPACA1/CNR1 MANEA/FUT9/UFL1/FHL5/GPR63/NDUFAF4/KLHL32/MIR548H3/MMS22L/MIR2113/POU3F2/ 9 6 95096818 102954270 1.20 24 FBXL4/FAXC/COQ3/PNISR/USP45/TSTD3/CCNC/PRDM13/MCHR2 PDSS2/SOBP/SCML4/SEC63/OSTM1/NR2E1/SNX3/LACE1/FOXO3/LINC00222/ARMC2/SES 9 6 107517225 118038218 1.20 71 N1/CEP57L1/CCDC162P/CD164/PPIL6/SMPD2/MICAL1/ZBTB24/AKD1 9 7 14648146 16395409 1.20 5 DGKB/AGMO/MEOX2/ISPD/LOC100506025 LUZP6/MTPN/CHRM2/LOC349160/MIR490/PTN/DGKI/CREB3L2/LOC100130880/AKR1D1/MI 9 7 135648906 158321402 1.19 211 R4468/TRIM24/SVOPL/ATP6V0A4/TMEM213/KIAA1549/ZC3HAV1L/ZC3HAV1/TTC26/UBN2 FOCAD/MIR491/PTPLAD2/IFNB1/IFNW1/IFNA21/IFNA4/IFNA7/IFNA10/IFNA16/IFNA17/IFNA 9 9 20992984 24761768 1.47 32 14/IFNA22P/IFNA5/KLHL9/IFNA6/IFNA13/IFNA2/IFNA8/IFNA1

TUBB8/ZMYND11/DIP2C/MIR5699/PRR26/LARP4B/GTPBP4/IDI2/IDI2- AS1/IDI1/WDR37/LINC00200/ADARB2/ADARB2- 9 10 72759 7076371 2.79 49 AS1/LINC00700/LINC00701/PFKP/PITRM1/PITRM1-AS1/KLF6 9 11 36603029 36636737 1.25 2 RAG2/C11orf74 USP5/TPI1/SPSB2/RPL13P5/DSTNP2/LRRC23/ENO2/ATN1/C12orf57/PTPN6/MIR200C/MIR 9 12 6972604 10288899 1.23 80 141/PHB2/SCARNA12/EMG1/LPCAT3/C1S/C1R/C1RL/C1RL-AS1

ETV6/RNU6-19/BCL2L14/MIR1244-2/MIR1244-1/MIR1244- 3/LRP6/MANSC1/LOH12CR2/LOH12CR1/DUSP16/CREBL2/GPR19/CDKN1B/APOLD1/MIR6 9 12 11941407 16325533 1.24 47 13/DDX47/RPL13AP20/GPRC5A/MIR614 9 12 120437070 120558783 1.21 2 CCDC64/RAB35 RPS29/LRR1/RPL36AL/MGAT2/DNAAF2/POLE2/KLHDC1/KLHDC2/NEMF/ARF6/C14orf182/ 9 14 49325921 53425226 1.22 41 C14orf183/METTL21D/SOS2/L2HGDH/ATP5S/CDKL1/MAP4K5/ATL1/SAV1 KCNK13/PSMC1/NRDE2/CALM1/LINC00642/TTC7B/RPS6KA5/C14orf159/SNORA11B/GPR6 9 14 90516305 93743695 1.22 31 8/CCDC88C/SMEK1/CATSPERB/TC2N/FBLN5/TRIP11/ATXN3/NDUFB1 KCNJ6/DSCR4/DSCR8/DSCR10/KCNJ15/ERG/LINC00114/ETS2/PSMG1/BRWD1/BRWD1- 9 21 39074366 48096958 1.24 129 IT2/BRWD1-AS1/HMGN1/WRB/LCA5L/SH3BGR/C21orf88/B3GALT5/IGSF5/PCP4 10 2 20497349 20550563 1.25 1 PUM2 10 2 131011199 131182814 1.34 4 CCDC115/IMP4/PTPN18/LOC100216479 10 2 136886218 137067052 1.10 0 10 8 82021893 82061370 1.18 1 PAG1 10 11 36618421 36639805 0.67 2 RAG2/C11orf74 10 12 11691129 12080631 1.22 3 LOC338817/ETV6/RNU6-19 10 19 20261344 20408212 1.29 1 ZNF486 10 21 39825715 39832312 1.20 1 ERG 10 22 22569726 22600189 0.55 1 VPREB1 RBMS3/TGFBR2/GADL1/STT3B/OSBPL10/OSBPL10- AS1/ZNF860/GPD1L/CMTM8/CMTM7/CMTM6/DYNC1LI1/CNOT10/TRIM71/CCR4/GLB1/TMP 11 3 29795066 33468418 0.92 21 PE/CRTAP/SUSD5/FBXL2 RNGTT/PNRC1/SRSF12/PM20D2/GABRR1/GABRR2/UBE2J1/RRAGD/ANKRD6/LYRM2/MD 11 6 89622237 123608575 1.35 149 N1/CASP8AP2/GJA10/BACH2/MIR4464/MAP3K7/MIR4643/EPHA7/TSG1/MANEA 11 6 128021510 129623794 1.08 3 THEMIS/PTPRK/LAMA2 11 11 16066907 16489321 1.36 1 SOX6 ETV6/RNU6-19/BCL2L14/MIR1244-2/MIR1244-1/MIR1244- 3/LRP6/MANSC1/LOH12CR2/LOH12CR1/DUSP16/CREBL2/GPR19/CDKN1B/APOLD1/MIR6 11 12 11721934 15153481 1.33 42 13/DDX47/RPL13AP20/GPRC5A

AGBL1/LOC727915/LINC00052/NTRK3/NTRK3-AS1/MRPL46/MRPS11/DET1/MIR1179/MIR7- 11 15 87057566 97234113 1.33 73 2/MIR3529/AEN/ISG20/ACAN/HAPLN3/MFGE8/ABHD2/RLBP1/FANCI/POLG ZFPM1/MIR5189/ZC3H18/IL17C/CYBA/MVD/SNAI3- AS1/SNAI3/RNF166/CTU2/PIEZO1/MIR4722/CDT1/APRT/GALNS/TRAPPC2L/PABPN1L/CBF 11 16 88526057 89263856 1.39 23 A2T3/ACSF3/LINC00304 11 21 35302367 35582244 1.34 4 LINC00649/MRPS6/SLC5A3/LINC00310 11 22 22569726 22600189 0.64 1 VPREB1 12 1 167576496 167667501 1.18 1 RCSD1 12 2 64660170 64754657 1.17 3 LGALSL/AFTPH/MIR4434 12 3 196222716 196452177 1.20 7 RNF168/C3orf43/WDR53/FBXO45/LRRC33/CEP19/PIGX 12 8 6566803 6641273 1.14 3 AGPAT5/MIR4659A/MIR4659B 12 9 36963513 37286448 1.19 5 PAX5/MIR4540/MIR4476/LOC100506710/ZCCHC7 ETV6/RNU6-19/BCL2L14/MIR1244-2/MIR1244-1/MIR1244- 3/LRP6/MANSC1/LOH12CR2/LOH12CR1/DUSP16/CREBL2/GPR19/CDKN1B/APOLD1/MIR6 12 12 11937837 27088553 1.24 95 13/DDX47/RPL13AP20/GPRC5A/MIR614 12 12 92274538 92540005 1.20 2 LOC256021/BTG1 12 13 77750831 77807716 1.05 2 MYCBP2/MYCBP2-AS1 DEFB128/DEFB129/DEFB132/C20orf96/ZCCHC3/SOX12/NRSN2/TRIB3/RBCK1/TBC1D20/C 12 20 156876 3886336 2.64 81 SNK2A1/TCF15/SRXN1/SCRT2/SLC52A3/FAM110A/ANGPT4/RSPO4/PSMF1/TMEM74B 12 20 3886336 4057428 1.29 4 PANK2/MIR103A2/MIR103B2/RNF24 SMOX/LOC728228/ADRA1D/PRNP/PRND/PRNT/RASSF2/SLC23A2/TMEM230/PCNA/PCNA- 12 20 4057428 7884872 2.67 26 AS1/CDS2/PROKR2/LINC00658/LOC643406/LINC00654/GPCPD1/C20orf196/CHGB/TRMT6 LOC284751/PTPN1/MIR645/FAM65C/PARD6B/BCAS4/ADNP/DPM1/MOCS3/KCNG1/NFATC 12 20 48819828 52181260 1.29 16 2/MIR3194/ATP9A/SALL4/ZFP64/TSHZ2 13 1 77685625 77775109 1.23 1 AK5 LOC100506795/IRF2BP2/LINC00184/LOC100506810/TOMM20/SNORA14B/RBM34/ARID4B/ MIR4753/GGPS1/TBCE/B3GALNT2/GNG4/LYST/MIR1537/NID1/GPR137B/ERO1LB/EDARA 13 1 234665324 238408404 1.21 27 DD/LGALS8 13 5 71911815 72146584 1.11 1 TNPO1 13 5 172200044 172261576 1.36 1 ERGIC1

13 6 134579488 134601914 1.21 1 SGK1 13 8 108262334 108509904 1.14 1 ANGPT1 MLLT3/MIR4473/MIR4474/FOCAD/MIR491/PTPLAD2/IFNB1/IFNW1/IFNA21/IFNA4/IFNA7/IF 13 9 20376390 23135278 1.27 33 NA10/IFNA16/IFNA17/IFNA14/IFNA22P/IFNA5/KLHL9/IFNA6/IFNA13 13 9 80389598 80646880 1.18 1 GNAQ 13 10 27044224 27149390 1.05 1 ABI1 13 10 63710197 63843961 1.13 2 ARID5B/MIR548AV 13 11 36600360 36634829 1.34 3 RAG1/RAG2/C11orf74 PLAC1L/MS4A3/MS4A2/MS4A6A/MS4A4A/MS4A6E/MS4A7/MS4A14/MS4A5/MS4A1/MS4A1 13 11 59717036 64467075 1.20 150 2/MS4A13/LINC00301/MS4A8B/MS4A15/MS4A10/CCDC86/PTGDR2/ZP1/PRPF19 13 11 65345841 65427392 1.29 8 EHBP1L1/KCNK7/MAP3K11/PCNXL3/MIR4690/SIPA1/MIR4489/RELA PRH1- PRR4/PRH1/TAS2R13/PRH2/TAS2R14/TAS2R50/TAS2R20/TAS2R19/TAS2R31/TAS2R46/T 13 12 11108940 12037591 1.27 21 AS2R43/TAS2R30/LOC100129361/TAS2R42/PRB3/PRB4/PRB1/PRB2/LOC338817/ETV6 13 12 22239179 22452947 1.37 1 ST8SIA1 13 12 92276664 92540005 1.07 2 LOC256021/BTG1 13 13 48984725 49080520 0.61 3 RB1/LPAR6/RCBTB2 NUSAP1/NDUFAF1/RTF1/ITPKA/LTK/RPAP1/TYRO3/MGA/MIR626/MAPKBP1/JMJD7/JMJD7 13 15 41641385 42941339 1.19 29 -PLA2G4B/PLA2G4B/SPTBN5/MIR4310/EHD4/PLA2G4E/PLA2G4D/PLA2G4F/VPS39 DET1/MIR1179/MIR7- 2/MIR3529/AEN/ISG20/ACAN/HAPLN3/MFGE8/ABHD2/RLBP1/FANCI/POLG/MIR9- 13 15 89034866 93532456 1.19 60 3/LOC254559/RHCG/LOC283761/TICRR/KIF7/PLIN1 13 18 53253602 53502917 1.17 2 TCF4/MIR4529 EFNA2/MUM1/NDUFS7/GAMT/DAZAP1/RPS15/APC2/C19orf25/PCSK4/REEP6/ADAMTSL5/ 13 19 1280623 2722102 1.25 50 PLK5/MEX3D/MBD3/UQCR11/TCF3/ONECUT3/ATP8B3/REXO1/MIR1909 13 20 10416029 10458099 1.23 1 SLX4IP 14 3 112059140 112214671 1.22 2 CD200/BTLA 14 4 149363996 149904298 1.26 0 14 4 180051293 181043450 1.20 0

SIL1/SNHG4/MATR3/SNORA74A/PAIP2/SLC23A1/MZB1/PROB1/SPATA24/DNAJC18/ECSC 14 5 138420756 170557564 1.22 277 R/TMEM173/UBE2D2/CXXC5/PSD2/NRG2/PURA/IGIP/CYSTM1/PFDN1 14 6 156602219 156879521 1.23 0 CREB3L2/LOC100130880/AKR1D1/MIR4468/TRIM24/SVOPL/ATP6V0A4/TMEM213/KIAA154 14 7 137576799 138872117 1.21 12 9/ZC3HAV1L/ZC3HAV1/TTC26 VCPIP1/C8orf44/C8orf44- 14 8 67559219 67974122 1.19 11 SGK3/SGK3/PTTG3P/MCMDC2/SNHG6/SNORD87/TCF24/PPP1R42/COPS5 14 11 36603029 36634771 0.49 2 RAG2/C11orf74 FOXJ2/C3AR1/NECAP1/CLEC4A/POU5F1P3/ZNF705A/FAM66C/FAM90A1/FAM86FP/LOC38 14 12 8188101 12502145 1.27 89 9634/CLEC6A/CLEC4D/CLEC4E/AICDA/MFAP5/RIMKLB/A2ML1/PHC1/M6PR/KLRG1 14 12 55785128 55803395 0.97 1 OR6C65 14 13 25281954 25331691 1.37 1 ATP12A 14 13 80913529 81358214 1.21 1 SPRY2 14 13 84664600 84709229 1.14 0 14 18 53253602 53751130 1.21 3 TCF4/MIR4529/LOC100505474 RHPN2/GPATCH1/WDR88/LRP3/SLC7A10/CEBPA/CEBPA- 14 19 33518793 34992150 1.24 17 AS1/CEBPG/PEPD/CHST8/KCTD15/LSM14A/KIAA0355/GPI/PDCD2L/UBA2/WTIP ANKRD30BP2/MIR3156- 3/POTED/C21orf15/ANKRD20A11P/LIPI/RBM11/ABCC13/HSPA13/SAMSN1/SAMSN1- 14 21 11124005 48096958 2.53 293 AS1/LOC388813/NRIP1/USP25/LINC00478/MIR99A/MIRLET7C/MIR125B2/C21orf37/CXADR 14 22 22523067 22601471 1.24 1 VPREB1 14 X 32488630 32526393 3.54 1 DMD MIR3675/NBPF1/CROCCP2/MST1P2/ESPNP/MST1L/MST1P9/CROCC/MFAP2/ATP13A2/SD 15 1 16870320 32342973 1.35 236 HB/PADI2/PADI1/PADI3/PADI4/PADI6/RCC2/ARHGEF10L/ACTL8/IGSF21 15 2 54795731 54880143 1.15 2 SPTBN1/RPL23AP32 15 3 35681260 35761823 1.16 1 ARPP21 15 3 71728158 73229034 1.17 9 EIF4E3/GPR27/PROK2/LOC201617/RYBP/SHQ1/GXYLT2/PPP4R2/EBLN2 RPL22L1/EIF5A2/SLC2A2/TNIK/MIR569/PLD1/TMEM212/FNDC3B/GHSR/TNFSF10/NCEH1/ ECT2/SPATA16/NLGN1/NAALADL2/NAALADL2- 15 3 170342564 178433433 1.09 21 AS3/MIR4789/TBL1XR1/LINC00578/KCNMB2-IT1

FTMT/SRFBP1/LOX/ZNF474/LOC100505841/SNCAIP/MGC32805/SNX2/SNX24/PPIC/PRDM 15 5 120264054 135509681 1.13 102 6/CEP120/CSNK1G3/ZNF608/GRAMD3/ALDH7A1/PHAX/C5orf48/LMNB1/MARCH3 LRRC16A/SCGN/HIST1H2AA/HIST1H2BA/HIST1H2APS1/SLC17A4/SLC17A1/SLC17A3/SLC 17A2/TRIM38/HIST1H1A/HIST1H3A/HIST1H4A/HIST1H4B/HIST1H3B/HIST1H2AB/HIST1H2B 15 6 25563739 28513432 1.16 106 B/HIST1H3C/HIST1H1C/HFE SEC63/OSTM1/NR2E1/SNX3/LACE1/FOXO3/LINC00222/ARMC2/SESN1/CEP57L1/CCDC16 15 6 108171409 113371279 1.13 40 2P/CD164/PPIL6/SMPD2/MICAL1/ZBTB24/AKD1/FIG4/GPR6/WASF1 15 6 150000791 150136322 1.52 3 LATS1/NUP43/PCMT1 15 6 156602219 156879521 1.14 0 15 9 21940263 22005264 1.28 4 C9orf53/CDKN2A/CDKN2B-AS1/CDKN2B IQSEC3/LOC574538/SLC6A12/SLC6A13/KDM5A/CCDC77/B4GALNT3/NINJ2/WNK1/RAD52/ ERC1/LOC100292680/FBXL14/WNT5B/MIR3649/ADIPOR2/CACNA2D4/LRTM2/LOC1002717 15 12 150442 10380936 2.79 167 02/DCP1B ETV6/RNU6-19/BCL2L14/MIR1244-2/MIR1244-1/MIR1244- 3/LRP6/MANSC1/LOH12CR2/LOH12CR1/DUSP16/CREBL2/GPR19/CDKN1B/APOLD1/MIR6 15 12 12031094 13724702 1.12 29 13/DDX47/RPL13AP20/GPRC5A/MIR614 15 12 14541628 14641217 1.08 1 ATF7IP 15 12 91983502 92534887 1.13 2 LOC256021/BTG1 GLTP/TCHP/GIT2/ANKRD13A/C12orf76/IFT81/ATP2A2/ANAPC7/ARPC3/GPN3/FAM216A/VP 15 12 110283299 112003414 1.14 24 S29/RAD9B/PPTC7/TCTN1/HVCN1/PPP1CC/CCDC63/MYL2/LOC100131138 15 13 41554860 41593697 0.96 1 ELF1 15 15 41918802 42088517 1.08 3 MGA/MIR626/MAPKBP1 SLC7A9/CEP89/C19orf40/RHPN2/GPATCH1/WDR88/LRP3/SLC7A10/CEBPA/CEBPA- 15 19 33307603 35035740 1.18 20 AS1/CEBPG/PEPD/CHST8/KCTD15/LSM14A/KIAA0355/GPI/PDCD2L/UBA2/WTIP 15 20 10416029 10522319 1.17 1 SLX4IP TPTE/BAGE2/BAGE3/BAGE4/BAGE5/BAGE/ANKRD30BP2/MIR3156- 3/POTED/C21orf15/ANKRD20A11P/LIPI/RBM11/ABCC13/HSPA13/SAMSN1/SAMSN1- 15 21 10736871 23818991 2.82 37 AS1/LOC388813/NRIP1/USP25 D21S2088E/LOC339622/LINC00158/MIR155HG/MIR155/LINC00515/MRPL39/JAM2/ATP5J/G ABPA/APP/CYYR1/ADAMTS1/ADAMTS5/MIR4759/MIR5009/LINC00113/LINC00314/LINC001 15 21 24331510 36299914 2.30 113 61/N6AMT1 15 22 22382337 22602746 1.24 1 VPREB1 76

15 X 31611508 31726457 2.92 1 DMD 16 1 59280377 59476616 1.27 1 LOC100131060 16 3 28972626 29321996 1.37 0 16 6 11238467 11443753 1.29 1 NEDD9 16 9 31119709 33039505 1.33 9 ACO1/DDX58/TOPORS/LOC100129250/NDUFB6/TAF1L/TMEM215/APTX/DNAJA1 16 10 1463300 1614496 1.38 2 ADARB2/ADARB2-AS1 16 11 36608025 36634829 1.08 2 RAG2/C11orf74 16 12 12026844 12037591 0.88 2 ETV6/RNU6-19 CHEK2P2/HERC2P3/GOLGA6L6/GOLGA8CP/NBEAP1/POTEB/NF1P2/CT60/LOC646214/CX ADRP2/LOC727924/OR4M2/OR4N4/OR4N3P/REREP3/MIR4509-2/MIR4509-1/MIR4509- 16 15 20016328 23644704 2.75 32 3/GOLGA8DP/GOLGA6L1 MIR4508/MKRN3/MAGEL2/NDN/PWRN2/PWRN1/NPAP1/SNRPN/SNURF/SNORD107/PAR- SN/PAR5/SNORD64/SNORD108/SNORD109B/SNORD109A/SNORD116-1/SNORD116- 16 15 23644704 102469041 1.47 790 2/SNORD116-9/SNORD116-3 DOC2B/RPH3AL/LOC100506388/C17orf97/FAM101B/VPS53/FAM57A/GEMIN4/DBIL5P/GLO 16 17 526 21521636 1.25 399 D4/RNMTL1/NXN/TIMM22/ABR/MIR3183/BHLHA9/TUSC5/YWHAE/CRK/MYO1C 16 20 33385141 33675856 1.19 9 NCOA6/HMGB3P1/GGT7/ACSS2/GSS/MYH7B/MIR499A/MIR499B/TRPC4AP 16 21 35302367 35446410 1.23 3 LINC00649/MRPS6/SLC5A3 16 22 22569726 22600189 0.55 1 VPREB1 PLCXD1/GTPBP6/LINC00685/PPP2R3B/SHOX/CRLF2/CSF2RA/MIR3690/IL3RA/SLC25A6/A 16 X 168477 123129709 1.34 725 SMTL-AS1/ASMTL/P2RY8/AKAP17A/ASMT/DHRSX/ZBED1/CD99P1/LINC00102/CD99 17 11 111452767 111478541 1.32 1 SIK2 17 20 1561616 1595919 3.25 1 SIRPB1 BCYRN1/GJB1/ZMYM3/NONO/ITGB1BP2/TAF1/INGX/OGT/ACRC/CXCR3/FLJ46446/LOC10 17 X 70909096 71068249 1.47 14 0132741/CXorf49/CXorf49B 18 4 56723842 56812371 1.24 1 EXOC1 RPL23AP53/ZNF596/FBXO25/C8orf42/ERICH1/ERICH1- AS1/LOC286083/DLGAP2/CLN8/MIR596/ARHGEF10/KBTBD11/MYOM2/CSMD1/LOC100287 18 8 165096 24688222 1.22 196 015/MCPH1/ANGPT2/AGPAT5/MIR4659A/MIR4659

CHD7/LOC100130298/CLVS1/ASPH/MIR4470/NKAIN3/UG0898H09/GGH/TTPA/YTHDF3/LO C286184/LOC100130155/MIR124- 18 8 61605799 146298156 2.95 456 2/LOC401463/BHLHE22/CYP7B1/LINC00251/LOC286186/ARMC1/MTFR1 18 8 82021893 82057511 1.18 1 PAG1 18 9 21892180 21995480 0.43 3 C9orf53/CDKN2A/CDKN2B-AS1 18 10 1462797 1517256 1.28 1 ADARB2 18 10 80634351 80830067 1.27 2 LOC283050/ZMIZ1 18 10 111767761 111870032 1.15 2 LOC100505933/ADD3 18 11 36598268 36634829 1.24 3 RAG1/RAG2/C11orf74 PRB3/PRB4/PRB1/PRB2/LOC338817/ETV6/RNU6-19/BCL2L14/MIR1244-2/MIR1244- 18 12 11340321 13804947 1.21 34 1/MIR1244-3/LRP6/MANSC1/LOH12CR2/LOH12CR1/DUSP16/CREBL2/GPR19/CDKN1B 18 12 92113230 92540005 1.17 2 LOC256021/BTG1 18 22 22381971 22600189 0.45 1 VPREB1 19 1 66799365 66813272 1.00 1 PDE4B 19 1 245399850 245513709 1.10 1 KIF26B 19 2 114157997 114211746 1.04 1 CBWD2 19 9 36988937 37030722 1.15 3 PAX5/MIR4540/MIR4476 19 10 111778733 111870032 1.49 1 ADD3 19 12 11803646 12023764 1.14 2 ETV6/RNU6-19 PLCXD1/GTPBP6/LINC00685/PPP2R3B/SHOX/CRLF2/CSF2RA/MIR3690/IL3RA/SLC25A6/A 19 X 168477 141374615 1.11 846 SMTL-AS1/ASMTL/P2RY8/AKAP17A/ASMT/DHRSX/ZBED1/CD99P1/LINC00102/CD9 20 1 152558349 152586177 1.32 1 LCE3C 20 3 35681260 35765400 1.01 1 ARPP21 SETD2/KIF9- AS1/KIF9/KLHL18/PTPN23/SCAP/ELP6/CSPG5/SMARCC1/DHX30/MIR1226/MAP4/CDC25A/ 20 3 47056860 49397338 1.22 61 MIR4443/CAMP/ZNF589/NME6/SPINK8/FBXW12/PLXNB1 DENND6A/SLMAP/FLNB/DNASE1L3/ABHD6/RPP14/PXK/PDHB/KCTD6/ACOX2/FAM107A/F 20 3 57661099 62711641 1.19 19 AM3D/C3orf67/FHIT/PTPRG/PTPRG-AS1/C3orf14/FEZF2/CADPS 20 6 91126376 96312249 1.12 5 MAP3K7/MIR4643/EPHA7/TSG1/MANEA 20 6 99942617 100130546 1.17 4 USP45/TSTD3/CCNC/PRDM13

20 6 100175340 101013253 1.12 4 MCHR2/LOC728012/SIM1/ASCC3 SOBP/SCML4/SEC63/OSTM1/NR2E1/SNX3/LACE1/FOXO3/LINC00222/ARMC2/SESN1/CEP 20 6 107904602 115839749 1.18 47 57L1/CCDC162P/CD164/PPIL6/SMPD2/MICAL1/ZBTB24/AKD1/FIG4 DSE/FAM26F/BET3L/FAM26E/FAM26D/RWDD1/RSPH4A/ZUFSP/KPNA5/FAM162B/GPRC6 20 6 116649278 121883876 1.14 30 A/RFX6/VGLL2/ROS1/DCBLD1/GOPC/NUS1/SLC35F1/CEP85L/BRD7P3 20 11 36600360 36641468 1.34 3 RAG1/RAG2/C11orf74 20 12 11803438 12101846 1.21 2 ETV6/RNU6-19 20 12 14521832 14588077 1.09 1 ATF7IP 20 13 50241336 50349149 1.34 2 EBPL/KPNA3 20 22 22382337 22662978 1.30 2 VPREB1/LOC96610 20 X 32922221 33068067 1.14 1 DMD 21 1 193107546 193121974 1.32 2 CDC73/MIR1278 21 8 79622348 80202376 2.36 2 ZC2HC1A/IL7 ETV6/RNU6-19/BCL2L14/MIR1244-2/MIR1244-1/MIR1244- 3/LRP6/MANSC1/LOH12CR2/LOH12CR1/DUSP16/CREBL2/GPR19/CDKN1B/APOLD1/MIR6 21 12 11803188 16209357 1.34 47 13/DDX47/RPL13AP20/GPRC5A/MIR614 21 12 92282184 92534887 1.34 2 LOC256021/BTG1 VWA8/MIR5006/VWA8- AS1/DGKH/AKAP11/TNFSF11/FAM216B/EPSTI1/DNAJC15/ENOX1/CCDC122/LACC1/LINC0 21 13 42452868 61970668 1.35 114 0284/SMIM2-IT1/SERP2/TSC22D1/TSC22D1-AS1/LINC00330/NUFIP1 PRSS57/PALM/C19orf21/PTBP1/MIR4745/LPPR3/MIR3187/AZU1/PRTN3/ELANE/CFD/MED1 21 19 694463 4176584 1.47 126 6/R3HDM4/KISS1R/ARID3A/WDR18/GRIN3B/C19orf6/CNN2/ABCA7 21 22 22566512 22600189 1.26 1 VPREB1 21 X 33154513 33358912 1.55 1 DMD 22 2 213015688 213249033 1.41 1 ERBB4 22 2 213860610 213879015 1.34 1 IKZF2 22 11 15995143 16485276 1.64 1 SOX6 22 11 21557629 21636706 1.42 1 NELL1 23 3 10113145 10290110 1.29 5 FANCD2/FANCD2OS/BRK1/VHL/IRAK2 23 3 112054135 112214671 1.31 2 CD200/BTLA

23 6 28252114 28319206 1.33 3 PGBD1/ZNF323/ZKSCAN3 PHIP/HMGN3/LOC100288198/LCA5/SH3BGRL2/RNY4/C6orf7/ELOVL4/TTK/BCKDHB/FAM46 23 6 79736781 171051006 1.29 464 A/IBTK/TPBG/UBE3D/DOPEY1/PGM3/RWDD2A/ME1/PRSS35/SNAP91 FAM20C/LOC100288524/LOC442497/PDGFA/FLJ44511/PRKAR1B/HEATR2/SUN1/GET4/AD 23 7 43259 30353863 2.83 209 AP1/COX19/CYP2W1/C7orf50/MIR339/GPR146/GPER/ZFAND2A/UNCX/MICALL2/INTS1 23 10 111767761 111868109 1.18 2 LOC100505933/ADD3 23 12 11803646 12066705 1.30 2 ETV6/RNU6-19 23 12 92274867 92540005 1.23 2 LOC256021/BTG1 23 15 26035521 26108982 1.21 2 ATP10A/MIR4715 23 16 3602914 3654993 1.32 2 NLRC3/SLX4 24 5 142753967 143028861 1.29 1 NR3C1 24 8 113936307 113966254 1.15 2 CSMD3/MIR2053 24 12 92218127 92540005 1.19 2 LOC256021/BTG1 24 14 93814341 93930259 1.23 2 UNC79/COX8C EIF2AK4/SRP14/LOC100131089/BMF/BUB1B/PAK6/C15orf56/ANKRD63/PLCB2/C15orf52/P 24 15 40326496 44103437 1.26 96 HGR1/DISP2/KNSTRN/IVD/BAHD1/CHST14/MRPL42P5/C15orf57/RPUSD2/CASC5 KIF7/PLIN1/PEX11A/WDR93/MESP1/MESP2/ANPEP/AP3S2/C15orf38- AP3S2/MIR5094/C15orf38/ZNF710/IDH2/SEMA4B/CIB1/GDPGP1/TTLL13/NGRN/GABARAPL 24 15 90181206 91981924 1.26 33 3/ZNF774 SLCO3A1/ST8SIA2/C15orf32/LOC100144604/FAM174B/ASB9P1/LOC100507217/CHD2/MIR 24 15 92393096 94926557 1.32 11 3175/RGMA/MCTP2 24 16 61744672 61782573 1.17 1 CDH8 24 16 75040301 75233518 1.27 3 ZNRF1/LDHD/ZFP1 24 19 4933332 4980882 1.19 3 UHRF1/MIR4747/KDM4B CD79A/ARHGEF1/RABAC1/ATP1A3/GRIK5/ZNF574/POU2F2/LOC100505622/MIR4323/DED 24 19 42383161 48975922 1.30 229 D2/ZNF526/GSK3A/ERF/CIC/PAFAH1B3/PRR19/TMEM145/MEGF8/CNFN/LOC100996307 24 20 10416029 10454448 1.27 1 SLX4IP 24 22 22569726 22600189 0.97 1 VPREB1 24 X 32457251 32485693 1.20 1 DMD LOC340094/ADAMTS16/KIAA0947/FLJ33360/MED10/UBE2QL1/LOC255167/NSUN2/SRD5A 25 5 3704056 16788265 1.46 47 1/PAPD7/MIR4278/MIR4454/LOC442132/ADCY2/C5orf49/FASTKD3/MTRR/LOC729506/LOC

100505738/MIR4458

25 5 21761116 25077122 1.48 5 CDH12/PMCHL1/PRDM9/CDH10/LOC340107 FAM81B/TTC37/ARSK/GPR150/RFESD/SPATA9/RHOBTB3/GLRX/C5orf27/ELL2/MIR583/PC 25 5 94721836 103789735 1.40 32 SK1/CAST/ERAP1/ERAP2/LNPEP/LIX1/RIOK2/RGMB/FLJ35946 FAM114A2/MFAP3/GALNT10/FLJ38109/SAP30L/HAND1/MIR3141/LARP1/C5orf4/CNOT8/GE 25 5 153347948 160641361 1.43 49 MIN5/MRPL22/KIF4B/SGCD/PPP1R2P3/TIMD4/HAVCR1/HAVCR2/MED7/FAM71B DCDC2/KAAG1/MRS2/GPLD1/ALDH5A1/KIAA0319/TDP2/ACOT13/C6orf62/GMNN/FAM65B/ CMAHP/LRRC16A/SCGN/HIST1H2AA/HIST1H2BA/HIST1H2APS1/SLC17A4/SLC17A1/SLC1 25 6 24298119 30666631 1.45 180 7A3 ZNF292/GJB7/SMIM8/C6orf163/C6orf164/C6orf165/SLC35A1/RARS2/ORC3/AKIRIN2/SPACA 25 6 87858124 125646855 1.43 166 1/CNR1/RNGTT/PNRC1/SRSF12/PM20D2/GABRR1/GABRR2/UBE2J1/RRAGD CHN2/PRR15/LOC646762/MIR550A3/ZNRF2P2/DPY19L2P3/WIPF3/SCRN1/FKBP14/PLEKH A8/C7orf41/ZNRF2/MIR550A1/MIR550B1/DKFZP586I1420/NOD1/GGCT/LOC401320/GARS/ 25 7 29466241 34111253 1.41 45 CRHR2 TNS3/C7orf65/LINC00525/PKD1L1/C7orf69/HUS1/SUN3/C7orf57/UPP1/ABCA13/CDC14C/V 25 7 46041381 51818468 1.42 20 WC2/ZPBP/C7orf72/IKZF1/FIGNL1/DDC/LOC100129427/GRB10/COBL 25 12 46147122 46386869 1.36 2 ARID2/SCAF11 TMCO5A/SPRED1/FAM98B/RASGRP1/C15orf53/C15orf54/THBS1/FSIP1/GPR176/EIF2AK4/ 25 15 38017165 42049330 1.42 56 SRP14/LOC100131089/BMF/BUB1B/PAK6/C15orf56/ANKRD63/PLCB2/C15orf52/PHGR1 NBR1/TMEM106A/TMEM106A- AS1/LOC100130581/ARL4D/MIR2117/DHX8/ETV4/MEOX1/SOST/DUSP3/C17orf105/MPP3/C 25 17 41307249 81049727 2.46 587 D300LG/MPP2/FAM215A/PPY/PYY/NAGS/TMEM101 URI1/ZNF536/DKFZp566F0947/TSHZ3/THEG5/ZNF507/LOC400684/DPY19L3/PDCD5/ANKR 25 19 30399147 35584097 1.45 47 D27/RGS9BP/NUDT19/TDRD12/SLC7A9/CEP89/C19orf40/RHPN2/GPATCH1/WDR88/LRP3 25 20 10410462 10467659 1.46 2 MKKS/SLX4IP 26 1 247271344 247653844 1.14 7 C1orf229/ZNF124/MIR3916/VN1R5/ZNF496/NLRP3/OR2B11 26 4 57619529 57743482 1.60 1 SPINK2 26 4 133186513 134073538 1.22 1 PCDH10 26 6 73989715 74375721 1.65 10 KHDC1/C6orf147/DPPA5/KHDC3L/OOEP/DDX43/MB21D1/MTO1/EEF1A1/SLC17A5 FAM20C/LOC100288524/LOC442497/PDGFA/FLJ44511/PRKAR1B/HEATR2/SUN1/GET4/AD 26 7 43259 3333516 1.68 41 AP1/COX19/CYP2W1/C7orf50/MIR339/GPR146/GPER/ZFAND2A/UNCX/MICALL2/INTS1

NPTX2/TMEM130/TRRAP/MIR3609/SMURF1/KPNA7/MYH16/ARPC1A/ARPC1B/PDAP1/BUD 26 7 98043737 102317099 1.68 117 31/PTCD1/ATP5J2-PTCD1/CPSF4/ATP5J2/ZNF789/ZNF394/ZKSCAN5/FAM200A PTK2/DENND3/SLC45A4/LOC731779/GPR20/PTP4A3/MROH5/MIR4472- 1/LINC00051/TSNARE1/BAI1/ARC/JRK/PSCA/LY6K/LOC100288181/THEM6/SLURP1/LYPD2 26 8 141997821 146298156 1.69 110 /LYNX1 26 9 115249112 115472793 1.18 2 KIAA1958/INIP ODF3/BET1L/RIC8A/SIRT3/PSMD13/NLRP6/ATHL1/IFITM5/IFITM2/IFITM1/IFITM3/B4GALNT 26 11 198510 2353798 1.66 85 4/PKP3/SIGIRR/ANO9/PTDSS2/RNH1/HRAS/LRRC56/C11orf3 ETV6/RNU6-19/BCL2L14/MIR1244-2/MIR1244-1/MIR1244- 3/LRP6/MANSC1/LOH12CR2/LOH12CR1/DUSP16/CREBL2/GPR19/CDKN1B/APOLD1/MIR6 26 12 12047763 19939428 1.16 58 13/DDX47/RPL13AP20/GPRC5A/MIR614 26 12 91885369 92540005 1.28 2 LOC256021/BTG1 26 15 50926066 51089834 1.53 2 TRPM7/SPPL2A MLYCD/OSGIN1/NECAB2/SLC38A8/MBTPS1/HSDL1/DNAAF1/TAF1C/ADAD2/KCNG4/WFD 26 16 83877193 90287536 1.68 99 C1/ATP2C2/KIAA1609/COTL1/KLHL36/USP10/CRISPLD2/ZDHHC7/KIAA0513/FAM92B

LINC00673/LINC00511/SLC39A11/SSTR2/COG1/FAM104A/C17orf80/CPSF4L/CDC42EP4/S 26 17 70297748 81049727 1.67 233 DK2/LINC00469/LOC400620/RPL38/MGC16275/TTYH2/DNAI2/KIF19/BTBD17 26 20 10412568 10517937 1.27 2 MKKS/SLX4IP GRIK1/GRIK1-AS2/GRIK1-AS1/CLDN17/LINC00307/CLDN8/KRTAP24-1/KRTAP25- 1/KRTAP26-1/KRTAP27-1/KRTAP23-1/KRTAP13-2/MIR4327/KRTAP13-1/KRTAP13- 26 21 31049518 41435857 2.61 127 3/KRTAP13-4/KRTAP15-1/KRTAP19-1/KRTAP19-2/KRTAP19-3 26 22 22571144 22600876 1.10 1 VPREB1 27 1 89612828 89741835 1.09 3 GBP7/GBP4/GBP5 27 3 185778409 185794283 1.45 1 ETV5 27 5 179045410 179051668 1.29 1 HNRNPH1 HTR1E/CGA/ZNF292/GJB7/SMIM8/C6orf163/C6orf164/C6orf165/SLC35A1/RARS2/ORC3/AKI 27 6 86617593 169807673 1.10 419 RIN2/SPACA1/CNR1/RNGTT/PNRC1/SRSF12/PM20D2/GABRR1 FOCAD/MIR491/PTPLAD2/IFNB1/IFNW1/IFNA21/IFNA4/IFNA7/IFNA10/IFNA16/IFNA17/IFNA 27 9 20764007 22214489 1.12 28 14/IFNA22P/IFNA5/KLHL9/IFNA6/IFNA13/IFNA2/IFNA8/IFNA1

27 10 23728095 23766209 1.10 1 OTUD1 27 14 89805608 89823799 1.19 1 FOXN3 27 19 41826999 41859864 1.28 2 CCDC97/TGFB1 ARHGAP35/NPAS1/TMEM160/ZC3H4/SAE1/BBC3/MIR3190/MIR3191/CCDC9/PRR24/C5AR 27 19 47368421 48432426 1.13 44 1/GPR77/DHX34/MEIS3/SLC8A2/KPTN/NAPA-AS1/NAPA/ZNF541/GLTSCR1 27 22 22515702 22600189 1.14 1 VPREB1 28 3 185804258 185807183 1.24 1 ETV5 28 4 12281 61927 2.52 2 ZNF595/ZNF718 28 7 38289310 38310910 1.22 1 TARP 28 10 23728095 23769628 1.21 1 OTUD1 28 12 14525237 14650727 1.05 1 ATF7IP 28 12 16015857 16147927 1.09 2 STRAP/DERA DDX11L10/POLR3K/SNRNP25/RHBDF1/MPG/NPRL3/HBZ/HBM/HBA2/HBA1/HBQ1/LUC7L/I 28 16 60777 21100618 3.15 323 TFG3/RGS11/ARHGDIG/PDIA2/AXIN1/MRPL28/TMEM8A/LOC100134368 KIAA0556/GSG1L/XPO6/SBK1/EIF3CL/EIF3C/CLN3/APOBR/IL27/NUPR1/CCDC101/SULT1A 28 16 27725106 54782732 3.19 190 2/SULT1A1/ATXN2L/TUFM/MIR4721/SH2B1/ATP2A1/LOC100289092/RABEP2 CMIP/LOC100129617/PLCG2/SDR42E1/HSD17B2/MPHOSPH6/CDH13/MIR3182/HSBP1/ML 28 16 81483276 90287536 3.29 108 YCD/OSGIN1/NECAB2/SLC38A8/MBTPS1/HSDL1/DNAAF1/TAF1C/ADAD2/KCNG4/WFDC1 TPTE/BAGE2/BAGE3/BAGE4/BAGE5/BAGE/ANKRD30BP2/MIR3156- 3/POTED/C21orf15/ANKRD20A11P/LIPI/RBM11/ABCC13/HSPA13/SAMSN1/SAMSN1- 28 21 10736871 48096958 3.36 299 AS1/LOC388813/NRIP1/USP25 28 22 22518179 22600189 0.43 1 VPREB1 28 22 22937122 23060915 1.06 2 POM121L1P/GGTLC2

CFHR2/CFHR5/F13B/ASPM/ZBTB41/CRB1/DENND1B/C1orf53/LHX9/NEK7/ATP6V1G3/PTP 29 1 196916579 249224389 2.45 465 RC/LOC100131234/MIR181B1/MIR181A1/NR5A2/FAM58BP/SMIM16/ZNF281/KIF14 29 2 3997838 4329416 1.45 1 LOC100505964 ATAD2B/UBXN2A/MFSD2B/C2orf44/FKBP1B/SF3B14/TP53I3/PFN4/FAM228B/FAM228A/ITS 29 2 24122506 39313967 1.49 146 N2/NCOA1/PTRHD1/CENPO/ADCY3/DNAJC27/DNAJC27-AS1/EFR3B/POMC/DNMT3A 29 3 178932002 178936440 2.79 1 PIK3CA 83

PLEKHG4B/LRRC14B/CCDC127/SDHA/PDCD6/AHRR/C5orf55/EXOC3/PP7080/SLC9A3/MIR 29 5 15532 93273221 2.41 396 4456/CEP72/TPPP/ZDHHC11/BRD9/TRIP13/LOC100506688/NKD2/SLC12A7/MIR4635 29 7 37488832 38399502 1.42 9 ELMO1/MIR1200/GPR141/NME8/SFRP4/EPDR1/STARD3NL/TARP/LOC100506776 29 10 1462797 1614496 1.49 2 ADARB2/ADARB2-AS1 IQSEC3/LOC574538/SLC6A12/SLC6A13/KDM5A/CCDC77/B4GALNT3/NINJ2/WNK1/RAD52/ ERC1/LOC100292680/FBXL14/WNT5B/MIR3649/ADIPOR2/CACNA2D4/LRTM2/LOC1002717 29 12 150442 4733220 2.51 45 02/DCP1B KCNA6/KCNA1/KCNA5/NTF3/ANO2/VWF/CD9/PLEKHG6/TNFRSF1A/SCNN1A/LTBR/CD27- 29 12 4933401 12023764 2.50 157 AS1/CD27/TAPBPL/VAMP1/MRPL51/NCAPD2/SCARNA10/GAPDH/IFFO1 DDX11L10/POLR3K/SNRNP25/RHBDF1/MPG/NPRL3/HBZ/HBM/HBA2/HBA1/HBQ1/LUC7L/I 29 16 60777 90287536 2.45 950 TFG3/RGS11/ARHGDIG/PDIA2/AXIN1/MRPL28/TMEM8A/LOC100134368 TPTE/BAGE2/BAGE3/BAGE4/BAGE5/BAGE/ANKRD30BP2/MIR3156- 3/POTED/C21orf15/ANKRD20A11P/LIPI/RBM11/ABCC13/HSPA13/SAMSN1/SAMSN1- 29 21 10736871 36276230 2.40 150 AS1/LOC388813/NRIP1 29 22 22569726 22600189 0.94 1 VPREB1 DNASE1L1/TAZ/ATP6AP1/GDI1/FAM50A/PLXNA3/LAGE3/UBL4A/SLC10A3/FAM3A/G6PD/IK 29 X 153639398 154105996 3.14 25 BKG/FAM223B/FAM223A/CTAG1A/CTAG1B/CTAG2/GAB3/DKC1 30 3 112054135 112218935 1.16 2 CD200/BTLA 30 3 176913696 177492114 0.23 2 TBL1XR1/LINC00578 30 4 149263230 149363996 1.13 1 NR3C2 CTNNA1/LRRTM2/SIL1/SNHG4/MATR3/SNORA74A/PAIP2/SLC23A1/MZB1/PROB1/SPATA2 30 5 137922660 139444336 1.13 18 4/DNAJC18/ECSCR/TMEM173/UBE2D2/CXXC5/PSD2/NRG2 30 5 141076309 141466438 1.15 6 PCDH1/LOC729080/KIAA0141/PCDH12/RNF14/GNPDA1 30 5 141669356 142033863 1.16 2 SPRY4/FGF1 MLLT3/MIR4473/MIR4474/FOCAD/MIR491/PTPLAD2/IFNB1/IFNW1/IFNA21/IFNA4/IFNA7/IF 30 9 20085521 25566918 0.62 35 NA10/IFNA16/IFNA17/IFNA14/IFNA22P/IFNA5/KLHL9/IFNA6/IFNA13 MOB2/DUSP8/LOC338651/KRTAP5-1/KRTAP5-2/KRTAP5-3/KRTAP5-4/KRTAP5- 5/FAM99A/FAM99B/KRTAP5- 30 11 1747694 3648293 1.18 53 6/IFITM10/CTSD/SYT8/TNNI2/LSP1/MIR4298/TNNT3/MRPL23/MRPL23-AS1 30 12 14521832 14749873 1.10 2 ATF7IP/PLBD1 30 13 48886046 49176186 1.15 4 RB1/LPAR6/RCBTB2/LINC00462

GPATCH2L/RNU6-6/RNU6- 19/ESRRB/VASH1/ANGEL1/C14orf166B/IRF2BPL/KIAA1737/ZDHHC22/TMEM63C/NGB/MIR 30 14 76595684 77878869 1.15 18 1260A/POMT2/GSTZ1/TMED8/SAMD15/NOXRED1 FOXN3/FOXN3-AS1/FOXN3- 30 14 89595439 91076893 1.11 11 AS2/EFCAB11/TDP1/KCNK13/PSMC1/NRDE2/CALM1/LINC00642/TTC7B 30 22 22569726 22600189 1.09 1 VPREB1 30 22 22804830 23222762 1.12 7 ZNF280B/ZNF280A/PRAME/LOC648691/POM121L1P/GGTLC2/MIR650 PLCXD1/GTPBP6/LINC00685/PPP2R3B/SHOX/CRLF2/CSF2RA/MIR3690/IL3RA/SLC25A6/A 30 X 168477 2698815 1.14 22 SMTL-AS1/ASMTL/P2RY8/AKAP17A/ASMT/DHRSX/ZBED1/CD99P1/LINC00102/CD99 30 X 154946468 155233847 1.24 3 SPRY3/VAMP7/IL9R ZNF167/ZNF660/ZNF197/ZNF35/ZNF502/ZNF501/KIAA1143/KIF15/MIR564/TMEM42/TGM4/ 31 3 44604230 47816120 1.07 58 ZDHHC3/EXOSC7/CLEC3B/CDCP1/TMEM158/LARS2/LARS2-AS1/LIMD1/LIMD1-AS1 31 5 57323836 57335945 0.84 0 31 8 39233131 39386079 0.87 2 ADAM5/ADAM3A 31 8 97301488 98400946 1.39 4 PTDSS1/SDC2/CPQ/TSPYL5 31 9 115249112 115391607 1.07 1 KIAA1958 31 11 4968313 4975981 1.04 1 OR51A4 31 11 36598268 36636737 1.04 3 RAG1/RAG2/C11orf74 31 11 120208937 120288443 1.34 1 ARHGEF12 IQSEC3/LOC574538/SLC6A12/SLC6A13/KDM5A/CCDC77/B4GALNT3/NINJ2/WNK1/RAD52/ ERC1/LOC100292680/FBXL14/WNT5B/MIR3649/ADIPOR2/CACNA2D4/LRTM2/LOC1002717 31 12 150442 12009898 2.73 204 02/DCP1B 31 13 46963486 47322513 1.06 1 LRCH1

GOSR1/TBC1D29/LRRC37BP1/SH3GL1P2/SUZ12P1/CRLF3/ATAD5/TEFM/ADAP2/RNF135/ 31 17 28802118 30413776 1.34 26 DPRXP4/MIR4733/NF1/OMG/EVI2B/EVI2A/RAB11FIP4/MIR4724/MIR193A/MIR4725 31 18 74843268 74872992 1.27 1 MBP 31 19 36866647 37019923 1.10 6 ZFP14/ZFP82/LOC644189/ZNF566/LOC728752/ZNF260 31 20 1560552 1582149 1.00 1 SIRPB1

TPTE/BAGE2/BAGE3/BAGE4/BAGE5/BAGE/ANKRD30BP2/MIR3156- 3/POTED/C21orf15/ANKRD20A11P/LIPI/RBM11/ABCC13/HSPA13/SAMSN1/SAMSN1- 31 21 10736871 36405441 2.99 150 AS1/LOC388813/NRIP1/USP25 31 X 32199200 32996573 0.37 1 DMD CN, copy number; Genome position (in bp) according to the UCSC Genome Browser (NCBI Build 37.1).

Supplemental Table II: Recurrent CNAs of E/R-positive relapsed and PPR leukemias

Patient ID 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43

2361* 2292* 3453 2701 3082 2772 3394 3064 3335 3304 2536 3331 2755* 2984 2973* 3087 2509* 3209 2575* 3342 2773 2742* 3182 2419* 3504 3017 3311 2981* 2761 3016 FB71 M210 BB50 M20 M223 U84 M137 T93 C33 W31 F14 LE001 UPN 2550* Genes in Region Cytoband Copy Number Loss GC signaling BTG1 12q22 x x x x x x x x x x x x x NR3C1 5q31.3 x b b x x x NR3C2 4q31.1 x x x x x x x BMF 15q14 x x x x MSH2 2p21 x MSH6 2p16 x Cell cycle regulation CDKN2A 9p21 x x b b x x x x b x b x b x x b x b CDKN2B 9p21 x b b x x x x x b x b x x b x b CDKN1B 12p13.1-p12 x x x x x x x x x x x x x x x RB1 13q14.2 b x x B cell development RAG2 11p13 x b x b x b x x x x EBF1 5q34 x x x x x PAX5 9p13 x x x x RAG1 11p13 x x x x TCF3 19p13.3 x x BLNK 10q23.2 x CD79A 19q13.2 x IKZF1 7p13-p11.1 x IKZF2 2q34 x IRF8 16q24.1 x Others ETV6 12p13 x x x x x x x x b x x x x x x x x x x x x x x x b x SLX4IP 20p12.2 x x x x x x x x VPREB1 22q11.22 b x x b x b x x b b x x x x x x x x x x x x x x x Copy Number Gain RUNX1 21q22.3 x x b x x x, monoallelic deletion; b, biallelic deletion; a bold line has been inserted to separate relapse cases (# 1 - 31) from prednisone poor responders (PPR # 32 - 43); *, these cases were also included in: (Bokemeyer et al., 2014).

1. Bokemeyer A, Eckert C, Meyr F, et al. Copy number genome alterations are associated with treatment response and outcome in relapsed childhood ETV6/RUNX1-positive acute lymphoblastic leukemia. Haematologica 2014:99(4):706-714.

Supplemental Table III: Association of recurrent gene deletions with clinical parameters* Gene (losses) P

MRD (n=31) Good (n=15) Poor (n=16) ETV6 6(40%) 13(81%) 0.03

Outcome (n=30) 2.CCR (n=24) 2. Relapse (n=6) SLX4IP 3(13%) 4(66%) 0.03 NR3C1 2(8%) 3(50%) 0.04

Occurrence of relapse (n=31) Early (n=6) Late (n=25) MIR650 3(50%) 1(4%) 0.02

*, only statistically significant associations are shown; MRD, minimal residual disease.

Supplemental Figure 1

Supplemetal Figure 2

Supplemental Figure 3

Supplemental Figure 4

End of Manuscript Grausenburger et al.

III. ETV6/RUNX1-induced upregulation of CD133 contributes to stemness features in acute lymphoblastic leukemia cell lines

Authors: Stephan Bastelberger, Kamilla Malinowska, Gerhard Fuka, Renate Panzer-

Grümayer.

SB performed experiments, analyzed data, and wrote the manuscript; KM cloned and established lentiviral vectors; GF designed and established sh-G1 and sh-PROM1-1;

RPG designed, supervised the study, interpreted data and edited the manuscript.

Project Background

The E/R gene fusion represents the initiating event in leukemogenesis, generating a preleukemic clone that requires secondary mutations in order to produce overt leukemia (Schindler et al., 2009, Hong et al., 2008, Morrow et al., 2004). Several studies have demonstrated that E/R mediates the distinctive features that are required to maintain a full blown leukemia (Fuka et al., 2012, Mangolini et al., 2013,

Hong et al., 2008) Especially the experiments performed by Hong et al. indicate that expression of E/R has a significant impact on self-renewal, which is considered a stem cell defining feature (Hong et al., 2008).

The cancer stem cell model

Normal hematopoiesis is organized in a hierarchy, where few multipotent stem cells give rise to all mature blood cells (McCulloch, 1983). Hematopoietic stem cells are characterized by two main features: potent self-renewal capacity at the single cell level and the ability to differentiate into various progenitor cells, capable to further maturing along specific pathways to maintain all different lineages of hematopoietic cells (Clarke et al., 2006).

Similar to normal hematopoiesis, xenotransplant experiments of primary acute myeloid leukemia (AML) samples have shown that only few immature blasts have the potential to initiate and maintain leukemia in immunodeficient mice (Bonnet and Dick,

1997). Several recent studies could confirm that AML is maintained by an immunophenotypically distinct, but diverse set of immature cells, which are described to be either CD34+ CD38- or CD34+ CD38+ (Goardon et al., 2011, Hope et al., 2004,

Taussig et al., 2010). Similar experiments defined cancer repopulating cells in several other malignancies (Singh et al., 2004, Al-Hajj and Clarke, 2004). Due to their similarities with normal stem cells these cancer-repopulating cells are referred to as cancer stem cells (CSCs) (Clarke et al., 2006). Their biological properties make

CSCs prime candidates for the source of disease relapse.

Although CSCs have been a focus of cancer research for the last 15 years (Bomken et al., 2010), there is still an ongoing debate regarding the origin of CSCs: it remains unclear whether CSCs are derived from normal stem cells, which have undergone malignant transformation, or from more differentiated cells, where the malignant transformation has reactivated stemness features. Therefore, it is important to discriminate between the cell of origin, defining from which cell the malignancy originated and where the first oncogenic event took place, and the CSC itself, defined

94 by its ability to propagate the cancer through self-renewal and the ability to differentiate (Clarke et al., 2006, Bomken et al., 2010).

The hierarchical cancer stem cell model appears to be applicable to several types of cancers, since further xenotransplantation studies have revealed a CSC hierarchy in breast, brain, colon and lung cancer (Singh et al., 2004, Al-Hajj and Clarke, 2004,

O'Brien et al., 2007). CSCs share many features of normal stem cells that support their long life-span and impaired propensity to undergo apoptosis (Dean et al., 2005).

In addition, CSC populations enter the cell cycle infrequently (Clarke et al., 2006,

Dean et al., 2005), which makes them more resistant to most forms of standard therapeutic agents that usually target the fast-cycling bulk of cancer cells.

However, the hierarchical CSC model does not apply to all types of cancer. In melanoma, it has been demonstrated that, irrespective of immunophenotype, a high number of (1:4) cancer cells could propagate the tumor (Quintana et al., 2008).

During malignant progression of chronic myeloid leukemia (CML) towards blast crisis, the CSC phenotype can shift towards more differentiated cells and the frequency of

CSC is increased (Jamieson et al., 2004). Hence, at least in CML, during disease progression the CSC phenotype and its frequency could be subject to change.

While the clinical benefit of specifically targeting CSC remains to be demonstrated, it is widely assumed that eradicating CSCs during therapy could be very effective in preventing relapse (Bomken et al., 2010). Therefore, identifying CSCs and the pathways mediating these properties is the first step in improving cure rates and contributing to the prevention of relapse (Eppert et al., 2011).

The cancer stem cell model in acute lymphoblastic leukemia

Early studies have proposed a hierarchic CSC model for ALL, demonstrating that only leukemic cells with an immature stem cell-like immunophenotype (CD34+CD38- and CD34+CD19-) have the potential to engraft and repopulate leukemia in immune- deficient mice (Cobaleda et al., 2000, Cox et al., 2004). However, several newer studies, using more heavily immunosuppressed mouse strains (NSG strains instead of SCID or NOD/SCID strains) for xenotransplantation experiments, have challenged this notion. Two studies have shown engraftment of more mature CD19+ lymphoid blasts, rather than immature CD19- blasts (Castor et al., 2005, Hong et al., 2008).

Most notably, Vormoor’s group reported on BCP-ALL blasts of all stages of maturation retaining their stemness potential at a very high frequency (1:40) (le

Viseur et al., 2008, Rehe et al., 2013). This indicates that the immunophentypically heterogeneous populations in ALL are the product of clonal evolution and a stochastic stem cell model (Anderson et al., 2011, Notta et al., 2011), where lymphoid blasts with diverse immunophenotpyes can have stem cell properties (Rehe et al., 2013). Since the majority of ALL cells are capable of propagating the leukemia, targeting CSCs based on a distinctive immunophenotype is not possible (Rehe et al.,

2013). Therefore, understanding the mechanisms driving stemness in ALL will be critical in an attempt to develop specific therapies (Bomken et al., 2010).

ETV6/RUNX1 induces a stemness associated expression signature

A mechanistic link between leukemic fusion oncogenes, essential for initiating and maintaining leukemia and expression of genes closely linked to self-renewal has been demonstrated for MLL/AF4 in ALL and AML1/MTG8 in AML (Gessner et al.,

2010, Mak et al., 2012b). In line, there is specific data to support the impact of E/R on

96 stemness features of ALL (Fuka et al., 2012, Mangolini et al., 2013, Hong et al.,

2008). Transplanting E/R-transduced HSCs and pro-B cells, derived from human cord blood cells, into NOD/SCID mice resulted in the establishment of a pre-leukemic clone that displayed self-renewal (Hong et al., 2008). Further evidence for a role of

E/R in self-renewal of ALL cells is provided by E/R knock down (KD) experiments that resulted in reduced repopulation capacity of E/R-positive leukemia cell lines in vitro (Mangolini et al., 2013) and in vivo (Fuka et al., 2012).

In addition, the E/R KD model enabled the identification of E/R-regulated genes and pathways (Fuka et al., 2012). The resulting data indicate that E/R induces the expression of genes associated with HSCs: gene set enrichment analysis (GSEA) revealed the “Jaatinen hematopoietic stem cell UP” signature, which is generated from the mRNA profile of cord blood CD133-positive versus CD133-negative sorted cells (Jaatinen et al., 2006, Fuka et al., 2011), scores significantly upon E/R KD. In addition, the term designated “Andersson-UP”, derived from data originating from a similar experiment with CD34+/-lineage-negative sorted leukemia stem cells

(Andersson et al., 2005b) scored significantly. Among the top regulated genes in these sets were PROM1, KIT and CDK6. All genes were similarly induced by E/R and are clearly associated with hematopoietic stem or progenitor cells (Masson and

Ronnstrand, 2009, Scheicher et al., 2014). This points to the underlying genes and regulatory mechanisms that could mediate the stemness features exerted by E/R

(Fuka et al., 2012, Fuka et al., 2011, Hong et al., 2008).

PROM1 (CD133) and stemness

PROM1 and especially expression of the glycoprotein’s CD133 epitopes (defined by the antibodies 293C or AC133) have been described as CSC markers in a variety of

97 malignancies (Miraglia et al., 1997, Yin et al., 1997, Mizrak et al., 2008, Kemper et al., 2010). While the biological function of PROM1 is still unclear (Irollo, 2013), detection of CD133 on the cell surface, with 293C or AC133 antibodies, has been frequently associated with high in vitro and/or in vivo self-renewing potential of cancer cells (Rappa et al., 2008, Kemper et al., 2010, Mak et al., 2012a), including

ALL cells (Cox et al., 2009, Mak et al., 2012b)

Study design

Stemness and, in particular, self-renewal are important factors in leukemogenesis and have implications for disease reoccurrence (Bomken et al., 2010, Clarke et al.,

2006). Based on reports that E/R expression is needed for the repopulation-capacity of ALL cell lines (Mangolini et al., 2013, Fuka et al., 2012) and alters self-renewal in pre-leukemic cells (Hong et al., 2008), it appears likely that E/R is critical for stemness of BCP-ALL cells. However, neither the genes nor the mechanism by which E/R exerts these features are clear.

Consequently, we tested whether PROM1 expression contributes to the stemness characteristics mediated by E/R in ALL. Therefore, we suppressed expression of

PROM1 and, for comparison, ETV6/RUNX1 with short hairpin RNAs in E/R harboring

AT-2 and REH leukemic cell lines and assessed the respective functional consequences.

Materials and Methods

Cell lines and cell culture

E/R-positive leukemia derived cell lines AT-2 (kindly provided by JD Rowley,

University of Chicago, IL, USA) and REH (DSMZ, Braunschweig, Germany) were cultured using IMDM (Iscove’s Modified Dulbecco’s Medium, Gibco, Vienna, Austria) using 10% FCS and 1% Penicilin-Streptomycin (Gibco, Vienna, Austria) at 37°C in

5% CO2 .

RNA-isolation, cDNA synthesis and reverse transcription-quantitative PCR (RT- qPCR)

Total cellular RNA was isolated with Trizol reagent according to the manufacturer’s recommendations (Invitrogen, Carlsbad, CA, USA). 2µg of RNA was reverse transcribed using random hexamer, oligo (dT15) primers and M-MLV Reverse

Transcriptase (Promega, Fitchburg, WI, USA). RT-qPCR was performed using an

Applied Biosystems 7500 Real-Time PCR detection system with the following primer/probe combinations:

PROM1 forward: 5’-CACCAAGTTCTACCTCATGT-3’

PROM1 reverse: 5’-ATGTTGTGATGGGCTTGTCA-3’

PROM1 probe: 5’-CCCGGATCAAAAGGAGTCGG-3’

GUS forward: 5’-GAAAATATGTGGTTGGAGAGCTCATT-3’

GUS reverse: 5’-CCGAGTGAAGATCCCCTTTTTA-3’

GUS probe: 5’-CCAGCACTCTCGTCGGTGACTGTTCA-3’

E/R forward: 5’-CTCTGTCTCCCCGCCTGAA-3’

E/R reverse: 5’-CGGCTCGTGCTGGCAT-3’

E/R probe: 5’-TCCCAATGGGCATGGCGTGC-3’ 99

RT-qPCR was done with Taqman Universal PCR master mix, 100 nmol/l forward and reverse primers and 50 nmol/l Taqman probes. Quantification of PROM1 and E/R transcripts was done in triplicates and normalized to GUS as endogenous reference.

Protein extraction and western blot analysis

Whole cell lysates for imunoblotting were prepared with 100 µl high salt buffer (20 mM Tris pH 7.5, 400 mM NaCl, 1 mM EDTA, 1,5 mM MgCL2, 1% Trtion X-100, 10% glycerol). The buffer was supplemented with 1% complete protease inhibitor and 1 mM Na3VO4. After 15 min incubation on ice, extracts were centrifuged (13.000 rpm) for 20 min to remove cell debris. Bradford assay was used to determine protein concentration.

2x loading buffer was added to protein extracts. Samples were denatured at 95°C for

5 min. 100 µg samples were separated on 15% SDS PAGE gels. Nitrocellulose membranes were used for transfer blotting. Membranes were incubated with 1x blocking reagent (in TBS) and washed 3 times for 5 min with TBS.

The following primary antibodies used were: anti-CD133 (W6B3C1, Miltenyi Biotec), anti-RUNX1 (C19 X, Santa Cruz Biotech). Anti-GAPDH (6C5, Santa Cruz

Biotechnology) was used as loading control.

Secondary antibodies were either infrared labeled, for detection with the Odyssey

Infrared System (LI-COR Biosciences, Lincoln, NE) or horseradish peroxidase (Bio-

Rad, Hercules, CA, USA) labeled for detection with an enhanced chemiluminescence detection system (Thermo Scientific, Waltham, MA, USA).

Flow cytometry, CFSE and Apoptosis staining

All flow cytometry samples were analyzed with FACS LSR Fortessa flow cytometer

(Becton Dickinson) and FlowJo software package (Tree Star, Ashland, OR, USA). 100

To measure CD133 expression on the cell surface, cells were stained with anti

CD133/2-ABs (293C) according to the manufacturer’s recommendations (Miltenyi biotec, Bergisch Gladbach, Germany).

Proliferation was measured by labeling cells with CFSE (Carboxyfluorescein

Succinimidyl Ester) (Sigma-Aldrich, Vienna, Austria). Intensity was first measured by

FACS 24h after labeling. Mean fluorescence intensity (MFI) was measured in triplicates and calculated with FlowJo software package (Tree Star, Ashland, OR,

USA). ΔMFI was calculated for each time point as MFI(KD cells) – MFI(control cells) and normalized to the first measurement (ΔMFI(day8)).

Apoptosis was determined by incubating cells with FITC Annexin V antibodies

(#556420, BD Pharmigen, Franklin Lakes, NJ, USA) and propidium iodide (Sigma-

Aldrich, Vienna, Austria) in the presence of Annexin binding buffer (50 mM HEPES,

700 mM NaCl, 12.5 mM CaCl2, pH 7.4) for 15 min in the dark at room temperature.

The proportion of pre-apoptotic and apoptotic cells (total Annexin V positive) was determined with FACS.

MTT assay

3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide based colorimetric assays (Sigma-Aldrich, Vienna, Austria) were performed in 96-well plates after 3-4h of incubation with MTT reagent to determine cell viability according to the manufacturer’s instructions. Colorimetric measurements were performed in triplicates.

Colony-forming assays

1 x 104 cells were resuspended in 600 µl resuspension buffer (R&D Systems,

Vienna, Austria) and 2.7 ml methylcellulose solution (HSC002, R&D Systems).

Colony-forming assays were carried out in 24-well plates. 600µl of methylcellulose 101 mixture was plated in one of 4 wells each. Colony formation of AT-2 and REH cell lines was assessed after 6 and 4 weeks after plating, respectively. Colony formation was assessed in triplicates. Each replicate is the mean value of counted colonies

(>50 cells) generated from 5 equally sized, standardized grid sections of 0.5cm2. shRNA mediated knockdown system

For E/R silencing in AT-2 and REH cells we used the validated G1 sequence targeting the fusion region (Fuka et al., 2012):

Sh-G1:

5’-CACCGGGAGAATAGCAGAATGCATCGAAATGCATTCTGCTATTCTCCC-3’

For PROM1 silencing we used 2 sequences targeting the exon5 of PROM1:

Sh-PROM1-2:

5’-CCCTTAATGATATACCTGATTCGTCAGGTATATCATTAAGGGC-3’ has been previously described and tested (Bourseau-Guilmain et al., 2011) and sh-PROM1-1:

5’-GGAAACTGGCAGATAGCAATTTTCGAATTGCTATCTGCCAGTTTCC-3’ was newly designed by G. Fuka and established by K. Malinowska for this study. As a non-targeting shRNA control we used LacZ (Invitrogen, Carlsbad, CA, USA).

We utilized One Shot Stbl3TM Chemically Competent E.coli for cloning and propagation of lentiviral expression vectors (InvitrogenTM). Lentiviral particles containing the U6 promoter based RNAi cassette for shRNA expression were produced by using the BlockiT Lentiviral RNAi Expression System (Invitrogen) according to the manufacturer’s recommendations. 5-7 x 106 leukemia cells were transduced by 3 subsequent infections with 1 ml lentiviral supernatant in the presence of 5 µg/ml polybrene.

102

Transduced leukemic cell lines were selected for lentiviral integration with 5 µg/ ml blasticidin (Invitrogen) for 2 weeks.

103

Results

ETV6/RUNX1-depletion diminishes CD133 expression in leukemic cell lines

First, we confirmed the presence of PROM1 protein in E/R-positive AT-2 and REH cells and evaluated whether the stem cell associated CD133 (293C) epitope can be detected on E/R-positive cell lines. We determined total PROM1 protein levels with immunoblotting in both cell lines (Fig. 5 A). Detection of CD133 on the cell surface by flow cytometry with 293C antibody was performed, since total protein levels alone are not necessarily indicative of CSCs (Kemper et al., 2010). In both cell lines CD133 epitope (293C) was found on the cell surface (in comparison to isotype-specific antibody stainings; Fig. 5 B). This demonstrates that E/R-positive leukemia cell lines

AT-2 and REH express PROM1 protein in the cell, but also the CD133 epitope on the cell surface.

Based on previous observations by Fuka et al., showing that the E/R-fusion is responsible for the upregulation of PROM1 mRNA expression (Fuka et al., 2012), we next asked whether E/R also affects total PROM1 protein and cell surface CD133

(293C) levels. Hence, we silenced expression of E/R with a lentiviral vector transfer of specific shRNAs into AT-2 and REH cells and evaluated PROM1 expression on the transcript and total protein level, as well as cell surface CD133 (293C) expression. Experiments were carried out according to the time course depicted in

Fig. 5 C.

We confirmed E/R-depletion in AT-2 and REH cells compared to non-targeting controls (Fig. 5 D); more specifically, E/R transcripts were reduced by 51% in both cell lines. Depletion of E/R also reduced PROM1 transcript levels (Fig.5 D) (REH and

AT-2 by 42% and 33%, respectively) and total protein levels (Fig. 5 E). These

104 findings demonstrate a regulation of PROM1 transcript and protein expression by the

E/R-fusion.

Based on the fact that only expression of the stem cell specific CD133 epitope is associated with stemness in cancer (Kemper et al., 2010), we proceeded to evaluated cell surface CD133 (293C) expression of E/R-depleted cell lines with flow cytometry and found significantly reduced CD133 (293C) cell surface expression in both cell lines (by 51%; p=0.042 and 78%; p=0.003, respectively; Fig. 5 F). Thus, expression of the stemness-associated CD133 epitope on the cell surface is mediated by E/R expression.

CD133 interferes with proliferation and self-renewal of ETV6/RUNX1-positive leukemic cell lines

Subsequently, we were interested in the function of PROM1 (CD133) in exerting stemness in ALL. Therefore, we silenced PROM1 by lentiviral transduction of 2 different shRNAs (shPROM1-1 and shPROM1-2) in AT-2 and REH cells and determined the functional consequences.

Silencing of PROM1, evaluation of PROM1 transcript, total protein and cell surface

CD133 (293C) levels, as well as functional experiments were carried out according to the time course depicted under Fig. 5 C. After leukemia cell lines were transduced and selected for lentiviral integration over a period of 2 weeks (day -14 to day 0),

PROM1 RNA levels were quantified on day 7 and 14. On day 7 we observed the overall strongest reduction of PROM1 transcript (for AT-2: by 52% and 37%, respectively, for shPROM1-1 and 2; p≤0.045 and for REH 50% and 38%, respectively, for shPROM1-1 and 2; p≤0.047, Fig. 6 A) and a clear reduction of

PROM1 total protein (Fig. 6 B).

105

Figure 5: Expression of PROM1 (CD133) in E/R-positive leukemic cell lines and upon E/R depletion. (A) Western blot analysis of PROM1 in E/R-positive AT-2 and REH cell lines and E/R-negative NALM6 cells. Protein abundance was determined using anti-PROM1 antibodies (W6B3C1). GAPDH was used 106 as a loading control. (B) Cell surface CD133-expression of AT-2 and REH cells was monitored by FACS using anti CD133/2 antibody (293C). Isotype-specific antibody stainings were performed as controls. (C) Experimental setup for evaluation of lentiviral transduction, clonogenic potential, apoptosis, viability and proliferation upon E/R and PROM1 depletion (D) Quantification of PROM1 transcripts (RT-qPCR) upon E/R KD (day 7) in AT-2 and REH cells. KD was confirmed by mRNA values normalized to endogenous GUS. Bars represent mean values +/- SD from 3 individual experiments. *, p≤0.05; **, p≤0.005 (paired t-test). (E) Western blot analysis of PROM1 in AT-2 and REH cells upon E/R KD. Protein abundance was determined using anti-RUNX1 (C19 X) antibody and anti-PROM1 (W6B3C1) antibodies. GAPDH was used as a loading control. (F) Cell surface analysis of CD133 expression by FACS using anti-CD133/2 (293C) antibody of E/R-depleted AT-2 and REH cells, isotype-specific antibody staining shown for comparison.(left panel); MFI (mean fluorescence intensity) of CD133 (293C) was normalized to MFI (293C) of non-targeting controls bars represent mean values +/- SD from three individual experiments. *, p≤0.05; **, p≤0.005 (paired t-test) (right panel).

Further, we detected a significant reduction of cell surface CD133 (293C) upon

PROM1 depletion. MFI (CD133) in AT-2 cells was reduced by 68% and 63% and in

REH cells by 82% and 70%, for sh-PROM1-1 and 2 ,respectively (p≤0.005; Fig. 6 C).

While on day 14 suppression by shPROM1-1 was stable, PROM1 transcript and surface CD133 (293C) epitope levels increased in shPROM1-2 expressing cells (Fig.

6 A and C). Hence, we started all experiments regarding the functional consequences of PROM1 depletion on day 7 after selection. Here we detected the lowest PROM1 levels, allowing us to evaluate the functional outcome of the respective depletion.

107

Figure 6: shRNA mediated silencing of PROM1 in E/R-positive leukemia cell lines. Leukemia cell lines (AT-2 and REH) were transduced with lentiviral constructs expressing 2 different shRNAs targeting PROM1 (sh-PROM1-1, sh-PROM1-2). (A) 7 and 14 days after selection, expression of PROM1 was quantified (RT-qPCR). Specific mRNA values were normalized to endogenous GUS. Bars represent mean values +/- SD from 3 individual experiments. *, p≤0.05; **, p≤0.005 (paired t- 108 test). (B) Protein abundance of PROM1 upon PROM1 KD was detected by western blot analysis using anti-PROM1 (W6B3C1) antibody. GAPDH was used as a loading control. Data are representative of three independent E/R KD experiments. (C) Top: Cell surface analysis of CD133 expression by FACS of PROM1-depleted AT-2 and REH cells using anti-CD133/2 (293C) antibody and compared to non- targeting controls (D7). Isotype-specific antibody stainings were performed. Bottom: MFI of 293C stainings of PROM1-depleted cells normalized to MFI (293C) of non-targeting treated controls. Bars represent mean values +/- SD from three individual experiments. *, p≤0.05; **, p≤0.005 (paired t-test).

To support our hypothesis that CD133 contributes to stemness of E/R-positive ALL, we determined the clonogenic potential of PROM1-depleted AT-2 and REH cells.

Therefore, we tested the ability of PROM1-depleted AT-2 and REH cells to form single cell derived colonies in methylcellulose after 4 and 6 weeks, respectively. The results were compared with those obtained from non-targeting controls. The same set-up was performed using these cell lines upon E/R KD. To confirm successful suppression of PROM1 and E/R transcripts over this time span, transcript levels of

KD cells, cultured in parallel with the methylcellulose assays, were quantified after 4 weeks (Fig. 7 C).

We observed that colony number was significantly reduced in PROM1-depleted samples, compared with control cells expressing non-targeting shRNA (Fig. 7 A and

B). KD of PROM1 with both shRNAs reduced colony forming units (CFUs) of AT-2 and REH in a similar fashion (≥22%; p≤0.005). E/R-depletion reduced CFU of the two cell lines by ≥33% (p≤0.005) (Fig. 7 B). Hence, overall sh-G1 reduced colony formation potential significantly more than shRNAs targeting PROM1 (p<0.05; Fig. 7

B). The reduced clonogenicity of PROM1-depleted cells indicates that PROM1 is an important contributing factor for self-renewal of AT-2 and REH cells. However, depletion of E/R has a much stronger effect on self-renewal of ALL cells in in vitro assays.

109

Figure 7: Suppression of PROM1 modulates clonogenicity of AT-2 and REH leukemic cell lines. (A) Colony formation of non-targeting control cells, E/R-depleted and PROM1-depleted AT-2 and REH cells, after 6 and 4 weeks, respectively, in methylcellulose. (B) Plots show CFUs relative to non- targeting control cultures. Bars represent mean values +/- SD from three individual experiments. p≤0.005 (paired t-test). (C) Quantification of E/R transcript levels in E/R-depleted and PROM1 transcript levels in PROM1-depleted cells (RT-qPCR), respectively, on day 28. Specific mRNA values were normalized to endogenous GUS. Bars represent mean values +/- SD from 2 experiments. (D) 110

Analysis of apoptosis by Annexin V/ PI staining and (E) metabolic activity by MTT in E/R-KD and PROM1-KD cells in relation to non-targeting controls. All bars show data from 3 biological replicates. *, p≤0.05; **, p≤0.005 (paired t-test).

To evaluate whether a reduction of PROM1 leads to increased cell death, we assessed the proportion of apoptotic cells with flow cytometry using Annexin V/PI

(AnnV) staining in AT-2 and REH cell lines. We observed a moderate increase in preapoptotic cells upon PROM-1 KD. On the other hand, E/R-depletion resulted in a strong increase of of preapoptotic populations (11% and 16% respectively in AT-2 and REH cells (p≤0.036; Fig. 7 D).

Effects of PROM1-depletion on viability and proliferation of E/R-positive AT-2 and

REH cells was similar. We performed MTT-assays and CFSE-stainings and found that both shRNAs targeting PROM1 reduced cell viability significantly in AT-2 cells by

52% and 24% (p=0.004 and p=0.049 respectively, Fig. 7E) and in REH cells by 48% and 37% (p=0.042 and p=0.049; Fig. 7E).

In addition, suppressing PROM1 expression reduced the proliferative capacity of AT-

2 and REH. Between day 16 and day 20, we observed a significant difference in cellular proliferation, measured by dilution of the CFSE signal in PROM1 depleted versus control cells. Sh-PROM1-1 treated AT-2 and REH cells displayed a 0.22 and a 0.58 fold difference on day 16 and a 0.57 and a 0.65 fold difference in MFI on day

20 (p≤0.042, Fig.8). In a similar fashion, sh-PROM1-2 reduced proliferation of AT-2 and REH cells, with a 0.18 and 0.49 fold difference in MFI on day 16 and a 0.39 and

0.62 fold difference on day 20 (p≤0.044, Fig.8). These results suggest that the lower clonogenicity of PROM1-depleted cells is accompanied by a reduced cellular viability and proliferation.

111

Figure 8: Suppression of PROM1 modulates proliferation of AT-2 and REH leukemia cell lines. Analysis of PROM1-depleted AT-2 and REH proliferation rates by CFSE staining. Top: Histograms show CFSE intensity of PROM1-depleted and control cells on day 12, 16, and 20 for one experiment. Bottom: Bars represent ∆MFI normalized to non-targeting control cells of three individual experiments measured on day 12, 16 and 20. *, p≤0.05; **, p≤0.005 (paired t-test).

112

Discussion

The E/R fusion has long been suspected to be the key driver behind the leukemic transformation process. Recently, additional evidence is emerging that the continuous expression of the chimeric protein is essential for leukemia maintenance and disease progression, a major perquisite for this being self-renewal: the single cells’ ability to continuously reconstitute the disease, by giving rise to the cells that comprise the leukemia. Despite the fact, that a potential role of E/R for self-renewal of ALL has been established in in vitro and in vivo models (Mangolini et al., 2013,

Fuka et al., 2012, Hong et al., 2008), so far the mechanisms behind this remained elusive. The data presented herein demonstrates in 2 E/R-positive leukemic cell lines that impaired E/R expression is associated with a reduction of PROM1 and cell surface CD133 (293C) expression. However, PROM1 expression seems only to contribute to the self-renewal and clonal expansion exerted by E/R in vitro.

Several fusion oncogenes have been demonstrated to mediate stemness by upregulation of PROM1, as, for instance, the MLL/AF4 fusion and most likely the majority of MLL-rearranged fusions present in leukemia (Mak et al., 2012b). This demonstrates that induction of PROM1 expression by fusion gene is an important mechanism in leukemia development and maintenance, applicable not exclusively to

E/R-positive ALL.

Taking into account that the E/R-fusion is an early or even initiating event in leukemia development, self-renewal mechanisms are likely to be affected at an early stage and to play an important role in leukemogenesis (Hong et al., 2008). In support of this assumption, ectopic expression of E/R triggered increased self-renewal in fetal liver hematopoietic stem cells (Hotfilder, 2002) and human cord blood cells. The latter

113 resulted in the expansion of a preleukemic clone with increased self-renewing potential (Hong et al., 2008). Our findings are of particular interest in this context, as they suggest that the upregulation of PROM1 and of the CD133 epitope might contribute to these features.

Expression of cell surface CD133 (293C or AC133) was originally used to identify rare cancer stem cells in malignancies with hierarchical structure (Mizrak et al., 2008,

Irollo, 2013, Takahashi et al., 2014, Yin et al., 1997). The findings that E/R-positive leukemia cell lines (AT-2 and REH) expressed surface CD133 (293C) in all cells (Fig.

5 A) rather suggests that the entire leukemic cell population has self-renewal potential. This is in line with a stochastic cancer stem cell model for E/R-positive ALL, where most leukemic blasts have self-renewing potential.

Since E/R supposedly is leukemia initiating and maintaining, the regulation of CD133 through E/R and the consequential loss of self-renewal upon E/R-depletion

(Mangolini et al., 2013, Fuka et al., 2012) (Fig. 7 A and B) makes it less likely that self-renewal in these cells is residual programing of a transformed primitive stem cell.

It rather indicates that self-renewal is maintained by a continuously active, reactivated stem cell program that is imposed by E/R expression on leukemia cells.

Our observation that knockdown of PROM1 significantly impairs proliferation and viability (Fig. 8 and 7 E) may, at first sight, appear counter-intuitive, but is rather a typical property of lymphoid cells: to compensate for the high proliferative potential of normal or malignant lymphoid cells, expression of genes exerting self-renewal is induced (Gessner et al., 2010, Liu et al., 1999, Lobetti-Bodoni et al., 2010, Son et al.,

2003). Hence, KD of PROM1 in BCP-ALL cells might directly impair the proliferative potential and viability, or lead to apoptosis (Fig. 7 D, E and Fig. 8) (Fuka et al., 2012,

Mak et al., 2012b). This scenario is in line with the notion that in the lymphoid 114 lineage, unlike in the myeloid one (e.g. AML), differentiation and self-renewal are not dissociated features (McCulloch, 1983), indicating that the clonal expansion of ALL cells is directly dependent on self-renewal (Rehe et al., 2013).

Together, there is strong evidence for a non-hierarchical, stochastic stem cell model in ALL cells (le Viseur et al., 2008, Rehe et al., 2013), while in E/R-positive ALL, specifically, this matter is not resolved, yet (le Viseur et al., 2008, Hong et al., 2008).

This study provides, however, first insight into a potential mechanism by which E/R exerts self-renewal in all leukemic blasts, irrespective of their maturation status. E/R does so by controlling expression of PROM1 and its stem cell linked CD133 cell surface epitopes, thereby increasing self-renewal and clonal expansion in leukemia cells. Hence, this work is in concords with a stochastic model for stemness of E/R- positive ALL cells.

In conclusion, our data complement those of others supporting the lack of stem cell hierarchy in childhood ALL, by demonstrating that ETV6/RUNX1 up-regulation of

PROM1 impairs clonogenic properties of leukemic cells.

115

IV. Further Discussion and Conclusions

Resistance to GCs is important for blast clearance, relapse and general treatment response of childhood ALL (Ploner et al., 2008, Bachmann et al., 2007, Tissing et al.,

2005, Kofler et al., 2003, Kuster et al., 2011). In this study, 53% of all E/R-positive relapse cases displayed one or more genetic aberrations affecting GC pathway components. Of these aberrations, affecting GC signaling associated genes, only the ones targeting the NR3C1 gene, which codes for GR, are associated with a secondary relapse. The overall most frequently reoccurring deletion in relapse cases affected ETV6, with its neighbor genes BCL2L14 and CDKN1B (chromosome 12p) and CDKN2A/B (chromosome 9p). The latter 3 genes are important apoptosis and cell cycle regulators (Hogan et al., 2011, Kuiper et al., 2007, Mirebeau et al., 2006) and hence deletions affecting BCL2L14, CDKN1B and CDKN2A/B might add significantly to drug resistance in ALL. Similar findings were reported from another

BFM study, which also identified an association between deletions affecting NR3C1,

BCL2L14 and CDKN1B, and adverse outcome as well as unfavorable clinical parameters in E/R-positive relapses, hence underlining the prognostic relevance of these deletions for poor response in the context of BFM-REZ protocols (Bokemeyer et al., 2014). Both studies stress the importance of deletions affecting NR3C1 in predicting unsuccessful relapse treatment and a subsequent secondary relapse.

While hemizygous lesions of NR3C1 predominate in E/R-positive relapsing ALL cases, GR function can, rarely though, be lost by NR3C1 aberrations on both alleles

(like by bi-allelic deletion of NR3C1 in 2 cases of our cohort) or by a simultaneous sequence mutation and deletion, as detected in REH cells and then confer GC

116 resistance. Such extreme forms of resistance to GCs can be reverted by ectopic re- expression of the wild type NR3C1 gene in E/R-positive leukemia derived cell lines as shown in our in vitro and in vivo experiments.

58% of all E/R-positive ALL cases with a PPR at diagnosis displayed deletions affecting various GC pathway components. This is a higher incidence of GC signaling associated deletions, when compared to previous studies performed with samples from initial diagnosis of E/R-positive cases (Kuster et al., 2011, van Delft et al.,

2011). Interestingly, the incidence of NR3C1 deletions in our PPR group was lower compared to the frequency of our relapse cohort, but CDKN2A/B deletions were almost twice as frequent. Importantly, PPR cases primarily responded nicely to chemotherapy and were not consequently associated with multi-drug resistance.

These cases did not relapse and thus, an isolated prednisolone poor response does not affect prognosis when treated appropriately.

Overall, since GR signaling-associated gene defects in relapsing ALL cases are frequently concurring with mulit-drug resistance and GC resistance at initial diagnosis is extremely rare, counteracting the impaired GR signaling is not a prime treatment option in E/R-positive leukemia. Instead, a more general approach targeting multidrug resistance for the relapsing cases using, for instance, obatoclax or inhibitors interfering with E/R might potentially be more rewarding.

The second part of this thesis demonstrates that while CD133 expression clearly contributes to stemness of E/R-positive ALL, E/R itself exerts a much stronger respective effect. Most likely, expression of several other stemness-linked genes, like for instance KIT and CDK6, is sustained by E/R (Fuka et al., 2011). Therefore,

117 targeting a single factor, like CD133, might not be ideal for suppressing stemness of

E/R-positive leukemia cells.

Since CD133 expression is induced by E/R, CD133 is present on the cell surface of all E/R-positive cells. Considering that the majority of E/R-positive leukemic blasts might have properties akin to CSC, as demonstrated by le Viseur et al. in vivo, a

CD133+ CSC-population, that significantly contributes to drug resistance and disease reoccurrence according to the hierarchic CSC model, does apparently not exist in

E/R-positive ALL. It therefore seems likely, that a stochastic stem cell structure exists in E/R-positive ALL, where most cells have an equal potential for self-renewal. Given the high treatment success in E/R-positive ALL (Pui et al., 2004), altering treatment of E/R-positive leukemia cells by targeting stemness-associated genes might therefore not be superior to conventional chemotherapy.

118

References

AL-HAJJ, M. & CLARKE, M. F. 2004. Self-renewal and solid tumor stem cells. Oncogene, 23, 7274-82. ANDERSON, K., LUTZ, C., VAN DELFT, F. W., BATEMAN, C. M., GUO, Y., COLMAN, S. M., KEMPSKI, H., MOORMAN, A. V., TITLEY, I., SWANSBURY, J., KEARNEY, L., ENVER, T. & GREAVES, M. 2011. Genetic variegation of clonal architecture and propagating cells in leukaemia. Nature, 469, 356-61. ANDERSSON, A., EDEN, P., LINDGREN, D., NILSSON, J., LASSEN, C., HELDRUP, J., FONTES, M., BORG, A., MITELMAN, F., JOHANSSON, B., HOGLUND, M. & FIORETOS, T. 2005a. Gene expression profiling of leukemic cell lines reveals conserved molecular signatures among subtypes with specific genetic aberrations. Leukemia, 19, 1042-50. ANDERSSON, A., OLOFSSON, T., LINDGREN, D., NILSSON, B. R., RITZ, C., EDÃ©N, P., LASSEN, C., RÃ¥DE, J., FONTES, M., MÃ¶RSE, H., HELDRUP, J., BEHRENDTZ, M., MITELMAN, F., HÃ¶GLUND, M., JOHANSSON, B. & FIORETOS, T. 2005b. Molecular signatures in childhood acute leukemia and their correlations to expression patterns in normal hematopoietic subpopulations. Proceedings of the National Academy of Sciences of the United States of America, 102, 19069-19074. ARMSTRONG, S. A. & LOOK, A. T. 2005. Molecular genetics of acute lymphoblastic leukemia. J Clin Oncol, 23, 6306-15. ATTARBASCHI, A., MANN, G., KONIG, M., DWORZAK, M. N., TREBO, M. M., MUHLEGGER, N., GADNER, H., HAAS, O. A. & AUSTRIAN BERLIN- FRANKFURT-MUNSTER COOPERATIVE STUDY, G. 2004. Incidence and relevance of secondary chromosome abnormalities in childhood TEL/AML1+ acute lymphoblastic leukemia: an interphase FISH analysis. Leukemia, 18, 1611-6. AUSSERLECHNER, M. J., OBEXER, P., WIEGERS, G. J., HARTMANN, B. L., GELEY, S. & KOFLER, R. 2001. The cell cycle inhibitor p16(INK4A) sensitizes lymphoblastic leukemia cells to apoptosis by physiologic glucocorticoid levels. J Biol Chem, 276, 10984-9. BACHMANN, P. S., GORMAN, R., PAPA, R. A., BARDELL, J. E., FORD, J., KEES, U. R., MARSHALL, G. M. & LOCK, R. B. 2007. Divergent mechanisms of glucocorticoid resistance in experimental models of pediatric acute lymphoblastic leukemia. Cancer Res, 67, 4482-90. BAENS, M., PEETERS, P., GUO, C., AERSSENS, J. & MARYNEN, P. 1996. Genomic organization of TEL: the human ETS-variant gene 6. Genome Res, 6, 404-13. BELLANTUONO, I. 2004. Haemopoietic stem cells. Int J Biochem Cell Biol, 36, 607- 20. BERNARDIN, F., YANG, Y., CLEAVES, R., ZAHURAK, M., CHENG, L., CIVIN, C. I. & FRIEDMAN, A. D. 2002. TEL-AML1, expressed from t(12;21) in human acute lymphocytic leukemia, induces acute leukemia in mice. Cancer Res, 62, 3904-8. BOKEMEYER, A., ECKERT, C., MEYR, F., KOERNER, G., VON STACKELBERG, A., ULLMANN, R., TURKMEN, S., HENZE, G. & SEEGER, K. 2014. Copy number genome alterations are associated with treatment response and

119

outcome in relapsed childhood ETV6/RUNX1-positive acute lymphoblastic leukemia. Haematologica, 99, 706-14. BOMKEN, S., FISER, K., HEIDENREICH, O. & VORMOOR, J. 2010. Understanding the cancer stem cell. Br J Cancer, 103, 439-45. BONAPACE, L., BORNHAUSER, B. C., SCHMITZ, M., CARIO, G., ZIEGLER, U., NIGGLI, F. K., SCHAFER, B. W., SCHRAPPE, M., STANULLA, M. & BOURQUIN, J. P. 2010. Induction of autophagy-dependent necroptosis is required for childhood acute lymphoblastic leukemia cells to overcome glucocorticoid resistance. The Journal of clinical investigation, 120, 1310-23. BONNET, D. & DICK, J. E. 1997. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat Med, 3, 730- 7. BORKHARDT, A., CAZZANIGA, G., VIEHMANN, S., VALSECCHI, M. G., LUDWIG, W. D., BURCI, L., MANGIONI, S., SCHRAPPE, M., RIEHM, H., LAMPERT, F., BASSO, G., MASERA, G., HARBOTT, J. & BIONDI, A. 1997 Jul 15. Incidence and clinical relevance of TEL/AML1 fusion genes in children with acute lymphoblastic leukemia enrolled in the German and Italian multicenter therapy trials. Associazione Italiana Ematologia Oncologia Pediatrica and the Berlin- Frankfurt-Munster Study Group. Blood, 90, 571-7. BOURSEAU-GUILMAIN, E., GRIVEAU, A., BENOIT, J. P. & GARCION, E. 2011. The importance of the stem cell marker prominin-1/CD133 in the uptake of transferrin and in iron metabolism in human colon cancer Caco-2 cells. PLoS One, 6, e25515. CASTOR, A., NILSSON, L., ASTRAND-GRUNDSTROM, I., BUITENHUIS, M., RAMIREZ, C., ANDERSON, K., STROMBECK, B., GARWICZ, S., BEKASSY, A. N., SCHMIEGELOW, K., LAUSEN, B., HOKLAND, P., LEHMANN, S., JULIUSSON, G., JOHANSSON, B. & JACOBSEN, S. E. 2005. Distinct patterns of hematopoietic stem cell involvement in acute lymphoblastic leukemia. Nat Med, 11, 630-7. CLARKE, M. F., DICK, J. E., DIRKS, P. B., EAVES, C. J., JAMIESON, C. H., JONES, D. L., VISVADER, J., WEISSMAN, I. L. & WAHL, G. M. 2006. Cancer stem cells--perspectives on current status and future directions: AACR Workshop on cancer stem cells. Cancer Res, 66, 9339-44. COBALEDA, C., GUTIERREZ-CIANCA, N., PEREZ-LOSADA, J., FLORES, T., GARCIA-SANZ, R., GONZALEZ, M. & SANCHEZ-GARCIA, I. 2000. A primitive hematopoietic cell is the target for the leukemic transformation in human philadelphia-positive acute lymphoblastic leukemia. Blood, 95, 1007- 13. CONTER, V., BARTRAM, C. R., VALSECCHI, M. G., SCHRAUDER, A., PANZER- GRUMAYER, R., MORICKE, A., ARICO, M., ZIMMERMANN, M., MANN, G., DE ROSSI, G., STANULLA, M., LOCATELLI, F., BASSO, G., NIGGLI, F., BARISONE, E., HENZE, G., LUDWIG, W. D., HAAS, O. A., CAZZANIGA, G., KOEHLER, R., SILVESTRI, D., BRADTKE, J., PARASOLE, R., BEIER, R., VAN DONGEN, J. J., BIONDI, A. & SCHRAPPE, M. 2010. Molecular response to treatment redefines all prognostic factors in children and adolescents with B-cell precursor acute lymphoblastic leukemia: results in 3184 patients of the AIEOP-BFM ALL 2000 study. Blood, 115, 3206-14. COSKUN, S. & HIRSCHI, K. K. 2010. Establishment and regulation of the HSC niche: Roles of osteoblastic and vascular compartments. Birth Defects Res C Embryo Today, 90, 229-42.

120

COX, C. V., DIAMANTI, P., EVELY, R. S., KEARNS, P. R. & BLAIR, A. 2009. Expression of CD133 on leukemia-initiating cells in childhood ALL. Blood, 113, 3287-96. COX, C. V., EVELY, R. S., OAKHILL, A., PAMPHILON, D. H., GOULDEN, N. J. & BLAIR, A. 2004. Characterization of acute lymphoblastic leukemia progenitor cells. Blood, 104, 2919-25. CUMANO, A. & GODIN, I. 2007. Ontogeny of the hematopoietic system. Annu Rev Immunol, 25, 745-85. DEAN, M., FOJO, T. & BATES, S. 2005. Tumour stem cells and drug resistance. Nat Rev Cancer, 5, 275-84. DIAKOS, C., KRAPF, G., GERNER, C., INTHAL, A., LEMBERGER, C., BAN, J., DOHNAL, A. M. & PANZER-GRUMAYER, E. R. 2007. RNAi-mediated silencing of TEL/AML1 reveals a heat-shock protein- and survivin-dependent mechanism for survival. Blood, 109, 2607-10. ECKERT, C., BIONDI, A., SEEGER, K., CAZZANIGA, G., HARTMANN, R., BEYERMANN, B., POGODDA, M., PROBA, J. & HENZE, G. 2001. Prognostic value of minimal residual disease in relapsed childhood acute lymphoblastic leukaemia. Lancet, 358, 1239-41. ECKERT, C., HENZE, G., SEEGER, K., HAGEDORN, N., MANN, G., PANZER- GRUMAYER, R., PETERS, C., KLINGEBIEL, T., BORKHARDT, A., SCHRAPPE, M., SCHRAUDER, A., ESCHERICH, G., SRAMKOVA, L., NIGGLI, F., HITZLER, J. & VON STACKELBERG, A. 2013a. Use of Allogeneic Hematopoietic Stem-Cell Transplantation Based on Minimal Residual Disease Response Improves Outcomes for Children With Relapsed Acute Lymphoblastic Leukemia in the Intermediate-Risk Group. J Clin Oncol. ECKERT, C., HENZE, G., SEEGER, K., HAGEDORN, N., MANN, G., PANZER- GRUMAYER, R., PETERS, C., KLINGEBIEL, T., BORKHARDT, A., SCHRAPPE, M., SCHRAUDER, A., ESCHERICH, G., SRAMKOVA, L., NIGGLI, F., HITZLER, J. & VON STACKELBERG, A. 2013b. Use of allogeneic hematopoietic stem-cell transplantation based on minimal residual disease response improves outcomes for children with relapsed acute lymphoblastic leukemia in the intermediate-risk group. J Clin Oncol, 31, 2736-42. ECKERT, C., VON STACKELBERG, A., SEEGER, K., GROENEVELD, T. W., PETERS, C., KLINGEBIEL, T., BORKHARDT, A., SCHRAPPE, M., ESCHERICH, G. & HENZE, G. 2013c. Minimal residual disease after induction is the strongest predictor of prognosis in intermediate risk relapsed acute lymphoblastic leukaemia - long-term results of trial ALL-REZ BFM P95/96. European journal of cancer, 49, 1346-55. EPPERT, K., TAKENAKA, K., LECHMAN, E. R., WALDRON, L., NILSSON, B., VAN GALEN, P., METZELER, K. H., POEPPL, A., LING, V., BEYENE, J., CANTY, A. J., DANSKA, J. S., BOHLANDER, S. K., BUSKE, C., MINDEN, M. D., GOLUB, T. R., JURISICA, I., EBERT, B. L. & DICK, J. E. 2011. Stem cell gene expression programs influence clinical outcome in human leukemia. Nat Med, 17, 1086-93. FASCHING, K., PANZER, S., HAAS, O. A., MARSCHALEK, R., GADNER, H. & PANZER-GRUMAYER, E. R. 2000. Presence of clone-specific antigen receptor gene rearrangements at birth indicates an in utero origin of diverse types of early childhood acute lymphoblastic leukemia. Blood, 95, 2722-4. FENRICK, R., AMANN, J. M., LUTTERBACH, B., WANG, L., WESTENDORF, J. J., DOWNING, J. R. & HIEBERT, S. W. 1999. Both TEL and AML-1 contribute repression domains to the t(12;21) fusion protein. Mol Cell Biol, 19, 6566-74. 121

FINE, B. M., STANULLA, M., SCHRAPPE, M., HO, M., VIEHMANN, S., HARBOTT, J. & BOXER, L. M. 2004. Gene expression patterns associated with recurrent chromosomal translocations in acute lymphoblastic leukemia. Blood, 103, 1043-9. FLOHR, T., SCHRAUDER, A., CAZZANIGA, G., PANZER-GRUMAYER, R., VAN DER VELDEN, V., FISCHER, S., STANULLA, M., BASSO, G., NIGGLI, F. K., SCHAFER, B. W., SUTTON, R., KOEHLER, R., ZIMMERMANN, M., VALSECCHI, M. G., GADNER, H., MASERA, G., SCHRAPPE, M., VAN DONGEN, J. J., BIONDI, A., BARTRAM, C. R. & INTERNATIONAL, B. F. M. S. G. 2008. Minimal residual disease-directed risk stratification using real-time quantitative PCR analysis of immunoglobulin and T-cell receptor gene rearrangements in the international multicenter trial AIEOP-BFM ALL 2000 for childhood acute lymphoblastic leukemia. Leukemia, 22, 771-82. FROST, B. M., FORESTIER, E., GUSTAFSSON, G., NYGREN, P., HELLEBOSTAD, M., JONSSON, O. G., KANERVA, J., SCHMIEGELOW, K., LARSSON, R. & LONNERHOLM, G. 2004. Translocation t(12;21) is related to in vitro cellular drug sensitivity to doxorubicin and etoposide in childhood acute lymphoblastic leukemia. Blood, 104, 2452-7. FUKA, G., KANTNER, H. P., GRAUSENBURGER, R., INTHAL, A., BAUER, E., KRAPF, G., KAINDL, U., KAUER, M., DWORZAK, M. N., STOIBER, D., HAAS, O. A. & PANZER-GRUMAYER, R. 2012. Silencing of ETV6/RUNX1 abrogates PI3K/AKT/mTOR signaling and impairs reconstitution of leukemia in xenografts. Leukemia, 26, 927-33. FUKA, G., KAUER, M., KOFLER, R., HAAS, O. A. & PANZER-GRUMAYER, R. 2011. The Leukemia-Specific Fusion Gene ETV6/RUNX1 Perturbs Distinct Key Biological Functions Primarily by Gene Repression. PLoS One, 6, e26348. GESSNER, A., THOMAS, M., CASTRO, P. G., BUCHLER, L., SCHOLZ, A., BRUMMENDORF, T. H., SORIA, N. M., VORMOOR, J., GREIL, J. & HEIDENREICH, O. 2010. Leukemic fusion genes MLL/AF4 and AML1/MTG8 support leukemic self-renewal by controlling expression of the telomerase subunit TERT. Leukemia, 24, 1751-9. GIRARDI, C., DE PITTA, C., CASARA, S., SALES, G., LANFRANCHI, G., CELOTTI, L. & MOGNATO, M. 2012. Analysis of miRNA and mRNA expression profiles highlights alterations in ionizing radiation response of human lymphocytes under modeled microgravity. PLoS One, 7, e31293. GLINSKII, A. B., GLINSKY, G. V., LIN, H. Y., TANG, H. Y., SUN, M., DAVIS, F. B., LUIDENS, M. K., MOUSA, S. A., HERCBERGS, A. H. & DAVIS, P. J. 2009. Modification of survival pathway gene expression in human breast cancer cells by tetraiodothyroacetic acid (tetrac). Cell cycle, 8, 3554-62. GOARDON, N., MARCHI, E., ATZBERGER, A., QUEK, L., SCHUH, A., SONEJI, S., WOLL, P., MEAD, A., ALFORD, K. A., ROUT, R., CHAUDHURY, S., GILKES, A., KNAPPER, S., BELDJORD, K., BEGUM, S., ROSE, S., GEDDES, N., GRIFFITHS, M., STANDEN, G., STERNBERG, A., CAVENAGH, J., HUNTER, H., BOWEN, D., KILLICK, S., ROBINSON, L., PRICE, A., MACINTYRE, E., VIRGO, P., BURNETT, A., CRADDOCK, C., ENVER, T., JACOBSEN, S. E., PORCHER, C. & VYAS, P. 2011. Coexistence of LMPP-like and GMP-like leukemia stem cells in acute myeloid leukemia. Cancer Cell, 19, 138-52. GRAF EINSIEDEL, H., TAUBE, T., HARTMANN, R., WELLMANN, S., SEIFERT, G., HENZE, G. & SEEGER, K. 2002. Deletion analysis of p16(INKa) and

122

p15(INKb) in relapsed childhood acute lymphoblastic leukemia. Blood, 99, 4629-31. GREAVES, M. 2006a. The causation of childhood leukemia: a paradox of progress? Discov Med, 6, 24-8. GREAVES, M. 2006b. Infection, immune responses and the aetiology of childhood leukaemia. Nat Rev Cancer, 6, 193-203. HAARMAN, E. G., KASPERS, G. J., PIETERS, R., ROTTIER, M. M. & VEERMAN, A. J. 2004. Glucocorticoid receptor alpha, beta and gamma expression vs in vitro glucocorticod resistance in childhood leukemia. Leukemia, 18, 530-7. HIEBERT, S. W., SUN, W., DAVIS, J. N., GOLUB, T., SHURTLEFF, S., BUIJS, A., DOWNING, J. R., GROSVELD, G., ROUSSELL, M. F., GILLILAND, D. G., LENNY, N. & MEYERS, S. 1996. The t(12;21) translocation converts AML-1B from an activator to a repressor of transcription. Mol Cell Biol, 16, 1349-55. HOCK, H., MEADE, E., MEDEIROS, S., SCHINDLER, J. W., VALK, P. J., FUJIWARA, Y. & ORKIN, S. H. 2004. Tel/Etv6 is an essential and selective regulator of adult hematopoietic stem cell survival. Genes Dev, 18, 2336-41. HOGAN, L. E., MEYER, J. A., YANG, J., WANG, J., WONG, N., YANG, W., CONDOS, G., HUNGER, S. P., RAETZ, E., SAFFERY, R., RELLING, M. V., BHOJWANI, D., MORRISON, D. J. & CARROLL, W. L. 2011. Integrated genomic analysis of relapsed childhood acute lymphoblastic leukemia reveals therapeutic strategies. Blood, 118, 5218-26. HONG, D., GUPTA, R., ANCLIFF, P., ATZBERGER, A., BROWN, J., SONEJI, S., GREEN, J., COLMAN, S., PIACIBELLO, W., BUCKLE, V., TSUZUKI, S., GREAVES, M. & ENVER, T. 2008. Initiating and cancer-propagating cells in TEL-AML1-associated childhood leukemia. Science, 319, 336-9. HOPE, K. J., JIN, L. & DICK, J. E. 2004. Acute myeloid leukemia originates from a hierarchy of leukemic stem cell classes that differ in self-renewal capacity. Nat Immunol, 5, 738-43. HOTFILDER, M. 2002. Immature CD34+CD19- progenitor/stem cells in TEL/AML1- positive acute lymphoblastic leukemia are genetically and functionally normal. Blood, 100, 640-646. ICHIKAWA, M., YOSHIMI, A., NAKAGAWA, M., NISHIMOTO, N., WATANABE- OKOCHI, N. & KUROKAWA, M. 2013. A role for RUNX1 in hematopoiesis and myeloid leukemia. Int J Hematol, 97, 726-34. INABA, H. & PUI, C. H. 2010. Glucocorticoid use in acute lymphoblastic leukaemia. The lancet oncology, 11, 1096-106. INTHAL, A., KRAPF, G., BECK, D., JOAS, R., KAUER, M. O., OREL, L., FUKA, G., MANN, G. & PANZER-GRUMAYER, E. R. 2008. Role of the erythropoietin receptor in ETV6/RUNX1-positive acute lymphoblastic leukemia. Clin Cancer Res, 14, 7196-204. INTHAL, A., ZEITLHOFER, P., ZEGINIGG, M., MORAK, M., GRAUSENBURGER, R., FRONKOVA, E., FAHRNER, B., MANN, G., HAAS, O. A. & PANZER- GRUMAYER, R. 2012. CREBBP HAT domain mutations prevail in relapse cases of high hyperdiploid childhood acute lymphoblastic leukemia. Leukemia, 26, 1797-803. IROLLO, E. 2013. CD133: to be or not to be, is this the real question? Am J Transl Res, 5(6), 563-581. IRVING, J. A., BLOODWORTH, L., BOWN, N. P., CASE, M. C., HOGARTH, L. A. & HALL, A. G. 2005a. Loss of heterozygosity in childhood acute lymphoblastic leukemia detected by genome-wide microarray single nucleotide polymorphism analysis. Cancer research, 65, 3053-8. 123

IRVING, J. A., MINTO, L., BAILEY, S. & HALL, A. G. 2005b. Loss of heterozygosity and somatic mutations of the glucocorticoid receptor gene are rarely found at relapse in pediatric acute lymphoblastic leukemia but may occur in a subpopulation early in the disease course. Cancer research, 65, 9712-8. JAATINEN, T., HEMMORANTA, H., HAUTANIEMI, S., NIEMI, J., NICORICI, D., LAINE, J., YLI-HARJA, O. & PARTANEN, J. 2006. Global gene expression profile of human cord blood-derived CD133+ cells. Stem Cells, 24, 631-41. JAMIESON, C. H., AILLES, L. E., DYLLA, S. J., MUIJTJENS, M., JONES, C., ZEHNDER, J. L., GOTLIB, J., LI, K., MANZ, M. G., KEATING, A., SAWYERS, C. L. & WEISSMAN, I. L. 2004. Granulocyte-macrophage progenitors as candidate leukemic stem cells in blast-crisis CML. N Engl J Med, 351, 657-67. KAINDL, U., MORAK, M., PORTSMOUTH, C., MECKLENBRAUKER, A., KAUER, M., ZEGINIGG, M., ATTARBASCHI, A., HAAS, O. A. & PANZER- GRUMAYER, R. 2014. Blocking ETV6/RUNX1-induced MDM2 overexpression by Nutlin-3 reactivates p53 signaling in childhood leukemia. Leukemia, 28, 600-8. KEMPER, K., SPRICK, M. R., DE BREE, M., SCOPELLITI, A., VERMEULEN, L., HOEK, M., ZEILSTRA, J., PALS, S. T., MEHMET, H., STASSI, G. & MEDEMA, J. P. 2010. The AC133 epitope, but not the CD133 protein, is lost upon cancer stem cell differentiation. Cancer Res, 70, 719-29. KFIR-ERENFELD, S., SIONOV, R. V., SPOKOINI, R., COHEN, O. & YEFENOF, E. 2010. Protein kinase networks regulating glucocorticoid-induced apoptosis of hematopoietic cancer cells: fundamental aspects and practical considerations. Leukemia & lymphoma, 51, 1968-2005. KOFLER, R., SCHMIDT, S., KOFLER, A. & AUSSERLECHNER, M. J. 2003. Resistance to glucocorticoid-induced apoptosis in lymphoblastic leukemia. J Endocrinol, 178, 19-27. KOTANI, A., HA, D., SCHOTTE, D., DEN BOER, M. L., ARMSTRONG, S. A. & LODISH, H. F. 2010. A novel mutation in the miR-128b gene reduces miRNA processing and leads to glucocorticoid resistance of MLL-AF4 acute lymphocytic leukemia cells. Cell cycle, 9, 1037-42. KUIPER, R. P., SCHOENMAKERS, E. F., VAN REIJMERSDAL, S. V., HEHIR-KWA, J. Y., VAN KESSEL, A. G., VAN LEEUWEN, F. N. & HOOGERBRUGGE, P. M. 2007. High-resolution genomic profiling of childhood ALL reveals novel recurrent genetic lesions affecting pathways involved in lymphocyte differentiation and cell cycle progression. Leukemia, 21, 1258-66. KULLMANN, M. K., GRUBBAUER, C., GOETSCH, K., JAKEL, H., PODMIRSEG, S. R., TROCKENBACHER, A., PLONER, C., CATO, A. C., WEISS, C., KOFLER, R. & HENGST, L. 2013. The p27-Skp2 axis mediates glucocorticoid-induced cell cycle arrest in T-lymphoma cells. Cell cycle, 12, 2625-35. KUSTER, L., GRAUSENBURGER, R., FUKA, G., KAINDL, U., KRAPF, G., INTHAL, A., MANN, G., KAUER, M., RAINER, J., KOFLER, R., HALL, A., METZLER, M., MEYER, L. H., MEYER, C., HARBOTT, J., MARSCHALEK, R., STREHL, S., HAAS, O. A. & PANZER-GRUMAYER, R. 2011. ETV6/RUNX1-positive relapses evolve from an ancestral clone and frequently acquire deletions of genes implicated in glucocorticoid signaling. Blood, 117, 2658-67. LE VISEUR, C., HOTFILDER, M., BOMKEN, S., WILSON, K., ROTTGERS, S., SCHRAUDER, A., ROSEMANN, A., IRVING, J., STAM, R. W., SHULTZ, L. D., HARBOTT, J., JURGENS, H., SCHRAPPE, M., PIETERS, R. & VORMOOR, J. 2008. In childhood acute lymphoblastic leukemia, blasts at

124

different stages of immunophenotypic maturation have stem cell properties. Cancer Cell, 14, 47-58. LILLJEBJORN, H., HEIDENBLAD, M., NILSSON, B., LASSEN, C., HORVAT, A., HELDRUP, J., BEHRENDTZ, M., JOHANSSON, B., ANDERSSON, A. & FIORETOS, T. 2007. Combined high-resolution array-based comparative genomic hybridization and expression profiling of ETV6/RUNX1-positive acute lymphoblastic leukemias reveal a high incidence of cryptic Xq duplications and identify several putative target genes within the commonly gained region. Leukemia, 21, 2137-44. LILLJEBJORN, H., SONESON, C., ANDERSSON, A., HELDRUP, J., BEHRENDTZ, M., KAWAMATA, N., OGAWA, S., KOEFFLER, H. P., MITELMAN, F., JOHANSSON, B., FONTES, M. & FIORETOS, T. 2010. The correlation pattern of acquired copy number changes in 164 ETV6/RUNX1-positive childhood acute lymphoblastic leukemias. Hum Mol Genet, 19, 3150-8. LIU, K., SCHOONMAKER, M. M., LEVINE, B. L., JUNE, C. H., HODES, R. J. & WENG, N. P. 1999. Constitutive and regulated expression of telomerase reverse transcriptase (hTERT) in human lymphocytes. Proc Natl Acad Sci U S A, 96, 5147-52. LIU, X., PAN, Z., ZHANG, L., SUN, Q., WAN, J., TIAN, C., XING, G., YANG, J., LIU, X., JIANG, J. & HE, F. 2008. JAB1 accelerates mitochondrial apoptosis by interaction with proapoptotic BclGs. Cell Signal, 20, 230-40. LOBETTI-BODONI, C., BERNOCCO, E., GENUARDI, E., BOCCADORO, M. & LADETTO, M. 2010. Telomeres and telomerase in normal and malignant B- cells. Hematol Oncol, 28, 157-67. LOH, M. L., GOLDWASSER, M. A., SILVERMAN, L. B., POON, W. M., VATTIKUTI, S., CARDOSO, A., NEUBERG, D. S., SHANNON, K. M., SALLAN, S. E. & GILLILAND, D. G. 2006. Prospective analysis of TEL/AML1-positive patients treated on Dana-Farber Cancer Institute Consortium Protocol 95-01. Blood, 107, 4508-13. MAIA, A. T., VAN DER VELDEN, V. H., HARRISON, C. J., SZCZEPANSKI, T., WILLIAMS, M. D., GRIFFITHS, M. J., VAN DONGEN, J. J. & GREAVES, M. F. 2003. Prenatal origin of hyperdiploid acute lymphoblastic leukemia in identical twins. Leukemia, 17, 2202-6. MAK, A. B., NIXON, A. M., KITTANAKOM, S., STEWART, J. M., CHEN, G. I., CURAK, J., GINGRAS, A. C., MAZITSCHEK, R., NEEL, B. G., STAGLJAR, I. & MOFFAT, J. 2012a. Regulation of CD133 by HDAC6 promotes beta-catenin signaling to suppress cancer cell differentiation. Cell Rep, 2, 951-63. MAK, A. B., NIXON, A. M. & MOFFAT, J. 2012b. The mixed lineage leukemia (MLL) fusion-associated gene AF4 promotes CD133 transcription. Cancer Res, 72, 1929-34. MALEMPATI, S., GAYNON, P. S., SATHER, H., LA, M. K., STORK, L. C. & CHILDREN'S ONCOLOGY, G. 2007. Outcome after relapse among children with standard-risk acute lymphoblastic leukemia: Children's Oncology Group study CCG-1952. J Clin Oncol, 25, 5800-7. MANGOLINI, M., DE BOER, J., WALF-VORDERWULBECKE, V., PIETERS, R., DEN BOER, M. L. & WILLIAMS, O. 2013. STAT3 mediates oncogenic addiction to TEL-AML1 in t(12;21) acute lymphoblastic leukemia. Blood, 122, 542-9. MASSON, K. & RONNSTRAND, L. 2009. Oncogenic signaling from the hematopoietic growth factor receptors c-Kit and Flt3. Cell Signal, 21, 1717-26.

125

MCCULLOCH, E. A. 1983. Stem cells in normal and leukemic hemopoiesis (Henry Stratton Lecture, 1982). Blood, 62, 1-13. MCLEAN, T. W., RINGOLD, S., NEUBERG, D., STEGMAIER, K., TANTRAVAHI, R., RITZ, J., KOEFFLER, H. P., TAKEUCHI, S., JANSSEN, J. W., SERIU, T., BARTRAM, C. R., SALLAN, S. E., GILLILAND, D. G. & GOLUB, T. R. 1996 Dec 1. TEL/AML-1 dimerizes and is associated with a favorable outcome in childhood acute lymphoblastic leukemia. Blood, 88, 4252-8. MEISSNER, B., BARTRAM, T., ECKERT, C., TRKA, J., PANZER-GRUMAYER, R., HERMANOVA, I., ELLINGHAUS, E., FRANKE, A., MORICKE, A., SCHRAUDER, A., TEIGLER-SCHLEGEL, A., DORGE, P., VON STACKELBERG, A., BASSO, G., BARTRAM, C. R., KIRSCHNER- SCHWABE, R., BORNHAUSER, B., BOURQUIN, J. P., CAZZANIGA, G., HAUER, J., ATTARBASCHI, A., IZRAELI, S., ZALIOVA, M., CARIO, G., ZIMMERMANN, M., AVIGAD, S., SOKALSKA-DUHME, M., METZLER, M., SCHRAPPE, M., KOEHLER, R., TE KRONNIE, G. & STANULLA, M. 2014. Frequent and sex-biased deletion of SLX4IP by illegitimate V(D)J-mediated recombination in childhood acute lymphoblastic leukemia. Hum Mol Genet, 23, 590-601. MEYERS, S., DOWNING, J. R. & HIEBERT, S. W. 1993. Identification of AML-1 and the (8;21) translocation protein (AML-1/ETO) as sequence-specific DNA- binding proteins: the runt homology domain is required for DNA binding and protein-protein interactions. Mol Cell Biol, 13, 6336-45. MIKHAIL, F. M., SINHA, K. K., SAUNTHARARAJAH, Y. & NUCIFORA, G. 2006. Normal and transforming functions of RUNX1: a perspective. J Cell Physiol, 207, 582-93. MIRAGLIA, S., GODFREY, W., YIN, A. H., ATKINS, K., WARNKE, R., HOLDEN, J. T., BRAY, R. A., WALLER, E. K. & BUCK, D. W. 1997. A novel five- transmembrane hematopoietic stem cell antigen: isolation, characterization, and molecular cloning. Blood, 90, 5013-21. MIREBEAU, D., ACQUAVIVA, C., SUCIU, S., BERTIN, R., DASTUGUE, N., ROBERT, A., BOUTARD, P., MECHINAUD, F., PLOUVIER, E., OTTEN, J., VILMER, E., CAVE, H. & EORTC, C. L. G. 2006. The prognostic significance of CDKN2A, CDKN2B and MTAP inactivation in B-lineage acute lymphoblastic leukemia of childhood. Results of the EORTC studies 58881 and 58951. Haematologica, 91, 881-5. MIZRAK, D., BRITTAN, M. & ALISON, M. 2008. CD133: molecule of the moment. J Pathol, 214, 3-9. MONTPETIT, A., LAROSE, J., BOILY, G., LANGLOIS, S., TRUDEL, N. & SINNETT, D. 2004. Mutational and expression analysis of the chromosome 12p candidate tumor suppressor genes in pre-B acute lymphoblastic leukemia. Leukemia, 18, 1499-504. MORAK, M., ATTARBASCHI, A., FISCHER, S., NASSIMBENI, C., GRAUSENBURGER, R., BASTELBERGER, S., KRENTZ, S., CARIO, G., KASPER, D., SCHMITT, K., RUSSELL, L. J., POTSCHGER, U., STANULLA, M., ECKERT, C., MANN, G., HAAS, O. A. & PANZER-GRUMAYER, R. 2012. Small sizes and indolent evolutionary dynamics challenge the potential role of P2RY8-CRLF2-harboring clones as main relapse-driving force in childhood ALL. Blood, 120, 5134-42. MORICKE, A., REITER, A., ZIMMERMANN, M., GADNER, H., STANULLA, M., DORDELMANN, M., LONING, L., BEIER, R., LUDWIG, W. D., RATEI, R., HARBOTT, J., BOOS, J., MANN, G., NIGGLI, F., FELDGES, A., HENZE, G., 126

WELTE, K., BECK, J. D., KLINGEBIEL, T., NIEMEYER, C., ZINTL, F., BODE, U., URBAN, C., WEHINGER, H., NIETHAMMER, D., RIEHM, H. & SCHRAPPE, M. 2008. Risk-adjusted therapy of acute lymphoblastic leukemia can decrease treatment burden and improve survival: treatment results of 2169 unselected pediatric and adolescent patients enrolled in the trial ALL- BFM 95. Blood, 111, 4477-89. MORROW, M., HORTON, S., KIOUSSIS, D., BRADY, H. J. & WILLIAMS, O. 2004. TEL-AML1 promotes development of specific hematopoietic lineages consistent with preleukemic activity. Blood, 103, 3890-6. MORROW, M., SAMANTA, A., KIOUSSIS, D., BRADY, H. J. & WILLIAMS, O. 2007. TEL-AML1 preleukemic activity requires the DNA binding domain of AML1 and the dimerization and corepressor binding domains of TEL. Oncogene, 26, 4404-14. MRAZ, M., DOLEZALOVA, D., PLEVOVA, K., STANO KOZUBIK, K., MAYEROVA, V., CERNA, K., MUSILOVA, K., TICHY, B., PAVLOVA, S., BORSKY, M., VERNER, J., DOUBEK, M., BRYCHTOVA, Y., TRBUSEK, M., HAMPL, A., MAYER, J. & POSPISILOVA, S. 2012. MicroRNA-650 expression is influenced by immunoglobulin gene rearrangement and affects the biology of chronic lymphocytic leukemia. Blood, 119, 2110-3. MULLIGHAN, C. G. 2012. The molecular genetic makeup of acute lymphoblastic leukemia. Hematology Am Soc Hematol Educ Program, 2012, 389-96. MULLIGHAN, C. G. & DOWNING, J. R. 2009. Genome-wide profiling of genetic alterations in acute lymphoblastic leukemia: recent insights and future directions. Leukemia, 23, 1209-18. MULLIGHAN, C. G., GOORHA, S., RADTKE, I., MILLER, C. B., COUSTAN-SMITH, E., DALTON, J. D., GIRTMAN, K., MATHEW, S., MA, J., POUNDS, S. B., SU, X., PUI, C. H., RELLING, M. V., EVANS, W. E., SHURTLEFF, S. A. & DOWNING, J. R. 2007. Genome-wide analysis of genetic alterations in acute lymphoblastic leukaemia. Nature, 446, 758-64. MULLIGHAN, C. G., PHILLIPS, L. A., SU, X., MA, J., MILLER, C. B., SHURTLEFF, S. A. & DOWNING, J. R. 2008. Genomic analysis of the clonal origins of relapsed acute lymphoblastic leukemia. Science, 322, 1377-80. NOTTA, F., MULLIGHAN, C. G., WANG, J. C., POEPPL, A., DOULATOV, S., PHILLIPS, L. A., MA, J., MINDEN, M. D., DOWNING, J. R. & DICK, J. E. 2011. Evolution of human BCR-ABL1 lymphoblastic leukaemia-initiating cells. Nature, 469, 362-7. NUTT, S. L. & KEE, B. L. 2007. The transcriptional regulation of B cell lineage commitment. Immunity, 26, 715-25. O'BRIEN, C. A., POLLETT, A., GALLINGER, S. & DICK, J. E. 2007. A human colon cancer cell capable of initiating tumour growth in immunodeficient mice. Nature, 445, 106-10. OKUDA, T., NISHIMURA, M., NAKAO, M. & FUJITA, Y. 2001. RUNX1/AML1: a central player in hematopoiesis. Int J Hematol, 74, 252-7. ORKIN, S. H. 2000. Diversification of haematopoietic stem cells to specific lineages. Nat Rev Genet, 1, 57-64. ORKIN, S. H. & ZON, L. I. 2002. Hematopoiesis and stem cells: plasticity versus developmental heterogeneity. Nat Immunol, 3, 323-8. PANZER-GRUMAYER, E. R., FASCHING, K., PANZER, S., HETTINGER, K., SCHMITT, K., STOCKLER-IPSIROGLU, S. & HAAS, O. A. 2002. Nondisjunction of chromosomes leading to hyperdiploid childhood B-cell

127

precursor acute lymphoblastic leukemia is an early event during leukemogenesis. Blood, 100, 347-9. PATEL, N., GOFF, L. K., CLARK, T., FORD, A. M., FOOT, N., LILLINGTON, D., HING, S., PRITCHARD-JONES, K., JONES, L. K. & SAHA, V. 2003. Expression profile of wild-type ETV6 in childhood acute leukaemia. Br J Haematol, 122, 94-8. PLONER, C., RAINER, J., NIEDEREGGER, H., EDUARDOFF, M., VILLUNGER, A., GELEY, S. & KOFLER, R. 2008. The BCL2 rheostat in glucocorticoid-induced apoptosis of acute lymphoblastic leukemia. Leukemia, 22, 370-7. PUI, C. H., CARROLL, W. L., MESHINCHI, S. & ARCECI, R. J. 2011. Biology, risk stratification, and therapy of pediatric acute leukemias: an update. J Clin Oncol, 29, 551-65. PUI, C. H. & EVANS, W. E. 1998. Acute lymphoblastic leukemia. N Engl J Med, 339, 605-615. PUI, C. H. & EVANS, W. E. 2006. Treatment of acute lymphoblastic leukemia. The New England journal of medicine, 354, 166-78. PUI, C. H., RELLING, M. V. & DOWNING, J. R. 2004. Acute lymphoblastic leukemia. N Engl J Med, 350, 1535-48. PUI, C. H., ROBISON, L. L. & LOOK, A. T. 2008. Acute lymphoblastic leukaemia. Lancet, 371, 1030-43. QUINTANA, E., SHACKLETON, M., SABEL, M. S., FULLEN, D. R., JOHNSON, T. M. & MORRISON, S. J. 2008. Efficient tumour formation by single human melanoma cells. Nature, 456, 593-8. RAPPA, G., FODSTAD, O. & LORICO, A. 2008. The stem cell-associated antigen CD133 (Prominin-1) is a molecular therapeutic target for metastatic melanoma. Stem Cells, 26, 3008-17. REHE, K., WILSON, K., BOMKEN, S., WILLIAMSON, D., IRVING, J., DEN BOER, M. L., STANULLA, M., SCHRAPPE, M., HALL, A. G., HEIDENREICH, O. & VORMOOR, J. 2013. Acute B lymphoblastic leukaemia-propagating cells are present at high frequency in diverse lymphoblast populations. EMBO Mol Med, 5, 38-51. RENNER, K., AUSSERLECHNER, M. J. & KOFLER, R. 2003. A conceptual view on glucocorticoid-lnduced apoptosis, cell cycle arrest and glucocorticoid resistance in lymphoblastic leukemia. Curr Mol Med, 3, 707-17. RIML, S., SCHMIDT, S., AUSSERLECHNER, M. J., GELEY, S. & KOFLER, R. 2004. Glucocorticoid receptor heterozygosity combined with lack of receptor autoinduction causes glucocorticoid resistance in Jurkat acute lymphoblastic leukemia cells. Cell Death Differ, 11 Suppl 1, S65-72. ROSS, M. E., ZHOU, X., SONG, G., SHURTLEFF, S. A., GIRTMAN, K., WILLIAMS, W. K., LIU, H. C., MAHFOUZ, R., RAIMONDI, S. C., LENNY, N., PATEL, A. & DOWNING, J. R. 2003. Classification of pediatric acute lymphoblastic leukemia by gene expression profiling. Blood, 102, 2951-9. SABAAWY, H. E., AZUMA, M., EMBREE, L. J., TSAI, H.-J., STAROST, M. F. & HICKSTEIN, D. D. 2006. TEL-AML1 transgenic zebrafish model of precursor B cell acute lymphoblastic leukemia. Proceedings of the National Academy of Sciences, 103, 15166-15171. SCHEICHER, R., HOELBL-KOVACIC, A., BELLUTTI, F., TIGAN, A. S., PRCHAL- MURPHY, M., HELLER, G., SCHNECKENLEITHNER, C., SALAZAR-ROA, M., ZOCHBAUER-MULLER, S., ZUBER, J., MALUMBRES, M., KOLLMANN, K. & SEXL, V. 2014. CDK6 as a key regulator of hematopoietic and leukemic stem cell activation. Blood. 128

SCHINDLER, J. W., VAN BUREN, D., FOUDI, A., KREJCI, O., QIN, J., ORKIN, S. H. & HOCK, H. 2009. TEL-AML1 corrupts hematopoietic stem cells to persist in the bone marrow and initiate leukemia. Cell Stem Cell, 5, 43-53. SCHMIDT, S., IRVING, J. A., MINTO, L., MATHESON, E., NICHOLSON, L., PLONER, A., PARSON, W., KOFLER, A., AMORT, M., ERDEL, M., HALL, A. & KOFLER, R. 2006a. Glucocorticoid resistance in two key models of acute lymphoblastic leukemia occurs at the level of the glucocorticoid receptor. The FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 20, 2600-2. SCHMIDT, S., RAINER, J., PLONER, C., PRESUL, E., RIML, S. & KOFLER, R. 2004. Glucocorticoid-induced apoptosis and glucocorticoid resistance: molecular mechanisms and clinical relevance. Cell Death Differ, 11 Suppl 1, S45-55. SCHMIDT, S., RAINER, J., RIML, S., PLONER, C., JESACHER, S., ACHMULLER, C., PRESUL, E., SKVORTSOV, S., CRAZZOLARA, R., FIEGL, M., RAIVIO, T., JANNE, O. A., GELEY, S., MEISTER, B. & KOFLER, R. 2006b. Identification of glucocorticoid-response genes in children with acute lymphoblastic leukemia. Blood, 107, 2061-9. SCHRAPPE, M., HUNGER, S. P., PUI, C. H., SAHA, V., GAYNON, P. S., BARUCHEL, A., CONTER, V., OTTEN, J., OHARA, A., VERSLUYS, A. B., ESCHERICH, G., HEYMAN, M., SILVERMAN, L. B., HORIBE, K., MANN, G., CAMITTA, B. M., HARBOTT, J., RIEHM, H., RICHARDS, S., DEVIDAS, M. & ZIMMERMANN, M. 2012. Outcomes after induction failure in childhood acute lymphoblastic leukemia. The New England journal of medicine, 366, 1371-81. SCHRAPPE, M., REITER, A., LUDWIG, W. D., HARBOTT, J., ZIMMERMANN, M., HIDDEMANN, W., NIEMEYER, C., HENZE, G., FELDGES, A., ZINTL, F., KORNHUBER, B., RITTER, J., WELTE, K., GADNER, H. & RIEHM, H. 2000. Improved outcome in childhood acute lymphoblastic leukemia despite reduced use of anthracyclines and cranial radiotherapy: results of trial ALL-BFM 90. German-Austrian-Swiss ALL-BFM Study Group. Blood, 95, 3310-22. SCHRAPPE, M., VALSECCHI, M. G., BARTRAM, C. R., SCHRAUDER, A., PANZER-GRUMAYER, R., MORICKE, A., PARASOLE, R., ZIMMERMANN, M., DWORZAK, M., BULDINI, B., REITER, A., BASSO, G., KLINGEBIEL, T., MESSINA, C., RATEI, R., CAZZANIGA, G., KOEHLER, R., LOCATELLI, F., SCHAFER, B. W., ARICO, M., WELTE, K., VAN DONGEN, J. J., GADNER, H., BIONDI, A. & CONTER, V. 2011. Late MRD response determines relapse risk overall and in subsets of childhood T-cell ALL: results of the AIEOP-BFM- ALL 2000 study. Blood, 118, 2077-84. SCHWARTZ, J. R., SARVAIYA, P. J. & VEDECKIS, W. V. 2010. Glucocorticoid receptor knock down reveals a similar apoptotic threshold but differing gene regulation patterns in T-cell and pre-B-cell acute lymphoblastic leukemia. Molecular and cellular endocrinology, 320, 76-86. SEEGER, K., BUCHWALD, D., PETER, A., TAUBE, T., VON STACKELBERG, A., SCHMITT, G. & HENZE, G. 1999. TEL-AML1 fusion in relapsed childhood acute lymphoblastic leukemia. Blood, 94, 374-6. SINGH, S. K., CLARKE, I. D., HIDE, T. & DIRKS, P. B. 2004. Cancer stem cells in nervous system tumors. Oncogene, 23, 7267-73. SON, N. H., JOYCE, B., HIEATT, A., CHREST, F. J., YANOVSKI, J. & WENG, N.-P. 2003. Stable telomere length and telomerase expression from naı̈ve to memory B-lymphocyte differentiation. Mechanisms of Ageing and Development, 124, 427-432. 129

SPECK, N. A. & GILLILAND, D. G. 2002. Core-binding factors in haematopoiesis and leukaemia. Nat Rev Cancer, 2, 502-13. STAMS, W. A., DEN BOER, M. L., BEVERLOO, H. B., MEIJERINK, J. P., VAN WERING, E. R., JANKA-SCHAUB, G. E. & PIETERS, R. 2005. Expression levels of TEL, AML1, and the fusion products TEL-AML1 and AML1-TEL versus drug sensitivity and clinical outcome in t(12;21)-positive pediatric acute lymphoblastic leukemia. Clin Cancer Res, 11, 2974-80. SULONG, S., MOORMAN, A. V., IRVING, J. A., STREFFORD, J. C., KONN, Z. J., CASE, M. C., MINTO, L., BARBER, K. E., PARKER, H., WRIGHT, S. L., STEWART, A. R., BAILEY, S., BOWN, N. P., HALL, A. G. & HARRISON, C. J. 2009. A comprehensive analysis of the CDKN2A gene in childhood acute lymphoblastic leukemia reveals genomic deletion, copy number neutral loss of heterozygosity, and association with specific cytogenetic subgroups. Blood, 113, 100-7. TAKAHASHI, M., MATSUOKA, Y., SUMIDE, K., NAKATSUKA, R., FUJIOKA, T., KOHNO, H., SASAKI, Y., MATSUI, K., ASANO, H., KANEKO, K. & SONODA, Y. 2014. CD133 is a positive marker for a distinct class of primitive human cord blood-derived CD34-negative hematopoietic stem cells. Leukemia, 28, 1308-15. TAUSSIG, D. C., VARGAFTIG, J., MIRAKI-MOUD, F., GRIESSINGER, E., SHARROCK, K., LUKE, T., LILLINGTON, D., OAKERVEE, H., CAVENAGH, J., AGRAWAL, S. G., LISTER, T. A., GRIBBEN, J. G. & BONNET, D. 2010. Leukemia-initiating cells from some acute myeloid leukemia patients with mutated nucleophosmin reside in the CD34(-) fraction. Blood, 115, 1976-84. TIJCHON, E., HAVINGA, J., VAN LEEUWEN, F. N. & SCHEIJEN, B. 2013. B-lineage transcription factors and cooperating gene lesions required for leukemia development. Leukemia, 27, 541-52. TISSING, W. J., LAUTEN, M., MEIJERINK, J. P., DEN BOER, M. L., KOPER, J. W., SONNEVELD, P. & PIETERS, R. 2005. Expression of the glucocorticoid receptor and its isoforms in relation to glucocorticoid resistance in childhood acute lymphocytic leukemia. Haematologica, 90, 1279-81. TORRANO, V., PROCTER, J., CARDUS, P., GREAVES, M. & FORD, A. M. 2011. ETV6-RUNX1 promotes survival of early B lineage progenitor cells via a dysregulated erythropoietin receptor. Blood, 118, 4910-8. TSUZUKI, S., SETO, M., GREAVES, M. & ENVER, T. 2004. Modeling first-hit functions of the t(12;21) TEL-AML1 translocation in mice. Proc Natl Acad Sci U S A, 101, 8443-8. VAN DELFT, F. W., HORSLEY, S., COLMAN, S., ANDERSON, K., BATEMAN, C., KEMPSKI, H., ZUNA, J., ECKERT, C., SAHA, V., KEARNEY, L., FORD, A. & GREAVES, M. 2011. Clonal origins of relapse in ETV6-RUNX1 acute lymphoblastic leukemia. Blood, 117, 6247-54. VAN DER WEYDEN, L., GIOTOPOULOS, G., RUST, A. G., MATHESON, L. S., VAN DELFT, F. W., KONG, J., CORCORAN, A. E., GREAVES, M. F., MULLIGHAN, C. G., HUNTLY, B. J. & ADAMS, D. J. 2011. Modeling the evolution of ETV6-RUNX1-induced B-cell precursor acute lymphoblastic leukemia in mice. Blood, 118, 1041-51. VAN DONGEN, J. J., SERIU, T., PANZER-GRUMAYER, E. R., BIONDI, A., PONGERS-WILLEMSE, M. J., CORRAL, L., STOLZ, F., SCHRAPPE, M., MASERA, G., KAMPS, W. A., GADNER, H., VAN WERING, E. R., LUDWIG, W. D., BASSO, G., DE BRUIJN, M. A., CAZZANIGA, G., HETTINGER, K., VAN DER DOES-VAN DEN BERG, A., HOP, W. C., RIEHM, H. & BARTRAM, 130

C. R. 1998. Prognostic value of minimal residual disease in acute lymphoblastic leukaemia in childhood. Lancet, 352, 1731-8. VAN GALEN, J. C., KUIPER, R. P., VAN EMST, L., LEVERS, M., TIJCHON, E., SCHEIJEN, B., WAANDERS, E., VAN REIJMERSDAL, S. V., GILISSEN, C., VAN KESSEL, A. G., HOOGERBRUGGE, P. M. & VAN LEEUWEN, F. N. 2010. BTG1 regulates glucocorticoid receptor autoinduction in acute lymphoblastic leukemia. Blood, 115, 4810-9. VON STACKELBERG, A., SEEGER, K., HENZE, G. & ECKERT, C. 2004. Clinical significance of minimal residual disease in childhood acute lymphoblastic leukemia after first relapse. Leukemia, 18, 1727-8; author reply 1728-9. WAANDERS, E., SCHEIJEN, B., VAN DER MEER, L. T., VAN REIJMERSDAL, S. V., VAN EMST, L., KROEZE, Y., SONNEVELD, E., HOOGERBRUGGE, P. M., VAN KESSEL, A. G., VAN LEEUWEN, F. N. & KUIPER, R. P. 2012. The origin and nature of tightly clustered BTG1 deletions in precursor B-cell acute lymphoblastic leukemia support a model of multiclonal evolution. PLoS genetics, 8, e1002533. WANG, L. C., SWAT, W., FUJIWARA, Y., DAVIDSON, L., VISVADER, J., KUO, F., ALT, F. W., GILLILAND, D. G., GOLUB, T. R. & ORKIN, S. H. 1998. The TEL/ETV6 gene is required specifically for hematopoiesis in the bone marrow. Genes Dev, 12, 2392-402. WOTTON, S., TERRY, A., KILBEY, A., JENKINS, A., HERZYK, P., CAMERON, E. & NEIL, J. C. 2008. Gene array analysis reveals a common Runx transcriptional programme controlling cell adhesion and survival. Oncogene. YANG, J. J., CHENG, C., DEVIDAS, M., CAO, X., CAMPANA, D., YANG, W., FAN, Y., NEALE, G., COX, N., SCHEET, P., BOROWITZ, M. J., WINICK, N. J., MARTIN, P. L., BOWMAN, W. P., CAMITTA, B., REAMAN, G. H., CARROLL, W. L., WILLMAN, C. L., HUNGER, S. P., EVANS, W. E., PUI, C. H., LOH, M. & RELLING, M. V. 2012. Genome-wide association study identifies germline polymorphisms associated with relapse of childhood acute lymphoblastic leukemia. Blood, 120, 4197-204. YEOH, E. J., ROSS, M. E., SHURTLEFF, S. A., WILLIAMS, W. K., PATEL, D., MAHFOUZ, R., BEHM, F. G., RAIMONDI, S. C., RELLING, M. V., PATEL, A., CHENG, C., CAMPANA, D., WILKINS, D., ZHOU, X., LI, J., LIU, H., PUI, C. H., EVANS, W. E., NAEVE, C., WONG, L. & DOWNING, J. R. 2002. Classification, subtype discovery, and prediction of outcome in pediatric acute lymphoblastic leukemia by gene expression profiling. Cancer Cell, 1, 133-43. YIN, A. H., MIRAGLIA, S., ZANJANI, E. D., ALMEIDA-PORADA, G., OGAWA, M., LEARY, A. G., OLWEUS, J., KEARNEY, J. & BUCK, D. W. 1997. AC133, a novel marker for human hematopoietic stem and progenitor cells. Blood, 90, 5002-12. ZELENT, A., GREAVES, M. & ENVER, T. 2004. Role of the TEL-AML1 fusion gene in the molecular pathogenesis of childhood acute lymphoblastic leukaemia. Oncogene, 23, 4275-83. ZHANG, J., MULLIGHAN, C. G., HARVEY, R. C., WU, G., CHEN, X., EDMONSON, M., BUETOW, K. H., CARROLL, W. L., CHEN, I. M., DEVIDAS, M., GERHARD, D. S., LOH, M. L., REAMAN, G. H., RELLING, M. V., CAMITTA, B. M., BOWMAN, W. P., SMITH, M. A., WILLMAN, C. L., DOWNING, J. R. & HUNGER, S. P. 2011. Key pathways are frequently mutated in high-risk childhood acute lymphoblastic leukemia: a report from the Children's Oncology Group. Blood, 118, 3080-7.

131

Acknowledgments

I want to express my sincere gratitude to…

Renate Panzer-Grümayer for giving me the big opportunity to work on these projects and for her supervision and guidance throughout my PhD studies.

My committee members Christian Seiser, Oskar Haas and Reinhard Kofler for their time, feedback and support.

All current and former members of the Panzer lab at the CCRI for the great working atmosphere, but especially: Reinhard, Kamilla, Ulli, Chrisi, Herzi and Maria for great scientific support and a lot of fun.

All the present and former colleagues of the CCRI. Especially Ela, Dave, Anna,

Dieter and Susi (thank you for all the food!).

My parents, for always supporting me.

Katharina, for always listening, her constant encouragement and advice.

132

Curriculum Vitae

Name Stephan Daniel Nam-Phuong Bastelberger

Current address Kalvarienberggasse 39; 1170 Vienna; Austria Email [email protected] Date of birth 27.06.1985 Place of birth Eggenfelden; Germany Citizenship German

Education

2011-2015 PhD programm Medical University of Vienna. PhD thesis at the Children's Cancer Research Institute, Vienna, Austria, group of Renate Panzer.

Thesis title: GENOMIC ABERRATIONS AND DEREGULATIONS OF GENES IN ETV6/RUNX1- POSITIVE CHILDHOOD LEUKEMIA

2009-2011 Master studies in Molecular Life Science and Molecular Medicine at the Paris Lodron University Salzburg and Johannes Keppler University Linz. Master thesis at the lab of Cornelia Hauser- Kronberger, Department of Pathology, Paracelsus Medical University Salzburg

Thesis title: TENASCIN-C AND CKS-1 AS PREDICTIVE MARKERS IN NEOADJUVANT BREAST CANCER THERAPY

2005-2009 Bachelor studies in Molecular Life Science at the Paris Lodron University Salzburg and Johannes Keppler University Linz. 2004-2005 Diploma studies in Chemistry at the University of Regensburg, Germany 1995-2004 König-Karlmann-Gymnasium, focus on natural sciences, Altötting (Germany)

133