DOCSLIB.ORG

Genomic Aberrations and Deregulation of Genes in ETV6/RUNX1-Positive Childhood

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Genomic aberrations and deregulation of genes in ETV6/RUNX1-positive childhood leukemia Doctoral thesis at the Medical University of Vienna for obtaining the academic degree Doctor of Philosophy Submitted by Master rer. nat., Stephan Bastelberger Supervisor: Prof. Dr. Renate Panzer-Grümayer, MD St. Anna Kinderkrebsforschung e.V., Children’s Cancer Research Institute, Zimmermannplatz 10, 1090 Vienna Austria Vienna, 08/2015 1 Contents Summary .................................................................................................................... 4 Zusammenfassung ..................................................................................................... 5 Abbreviations .............................................................................................................. 7 I. General introduction ................................................................................................ 9 Hematopoiesis ..................................................................................................... 9 Commitment to the B-lymphoid lineage ..............................................................10 Childhood acute lymphoblastic leukemia ............................................................11 Classification and prognostic parameters of childhood B cell precursor ALL .....12 Treatment of ALL at initial diagnosis and at relapse ...........................................14 Analysis of gene expression in ALL ....................................................................15 Analysis of genome-wide copy number aberrations in ALL ................................16 ETV6/RUNX1-positive B cell precursor ALL .......................................................17 The ETV6/RUNX1 fusion ....................................................................................18 II. Genetic alterations in glucocorticoid signaling pathway components are associated with adverse prognosis in children with relapsed ETV6/RUNX1-positive acute lymphoblastic leukemia .............................................................................................24 Project background ................................................................................................24 Glucocorticoids and glucocorticoid-mediated signaling ......................................24 Somatic aberrations affecting the glucocorticoid pathway in ETV6/RUNX1- positive acute lymphoblastic leukemia................................................................26 Clinical outcome of children with ETV6/RUNX1-positive relapse .......................26 Study design ..........................................................................................................27 2 Results and Discussion ..........................................................................................28 III. ETV6/RUNX1-induced upregulation of CD133 contributes to stemness features in acute lymphoblastic leukemia cell lines .....................................................................93 Project Background ................................................................................................93 The cancer stem cell model ................................................................................94 The cancer stem cell model in acute lymphoblastic leukemia ............................96 ETV6/RUNX1 induces a stemness associated expression signature .................96 PROM1 (CD133) and stemness .........................................................................97 Study design ..........................................................................................................98 Materials and Methods ...........................................................................................99 Results .................................................................................................................104 Discussion ............................................................................................................113 IV. Further Discussion and Conclusions ..................................................................116 References ..............................................................................................................119 Acknowledgments ...................................................................................................132 Curriculum Vitae ......................................................................................................133 3 Summary The ETV6/RUNX1 gene fusion (also known as TEL/AML) characterizes the largest genetic subgroup (25%) of childhood B cell precursor acute lymphoblastic leukemia. Despite rapid response to treatment and lack of high-risk features, up to 20% of affected cases still suffer a relapse. A significant proportion of these cases is associated with poor treatment response and dismal outcome. The first project focuses on the impact of genome-wide aberrations, in general, and on aberrations affecting components of the glucocorticoid-signaling (GC) pathway, in particular. To test for predictive and/or prognostic aberrations, we performed SNP array analysis of 31 relapsed ALL samples from cases with good and poor response to treatment. In 58% of samples, we found deletions in various glucocorticoid signaling pathway-associated genes, but only NR3C1 and ETV6 deletions prevailed in “minimal residual disease”-poor responding (and thus, drug resistant) and subsequently relapsing cases (p<0.05). To prove the necessity of a functional glucocorticoid receptor, we reconstituted wild-type NR3C1 expression in mutant, glucocorticoid-resistant REH cells and studied the glucocorticoid response in vitro and in a xenograft mouse model. While these results prove that glucocorticoid receptor defects are crucial for glucocorticoid resistance in an experimental setting, they do not address the essential clinical situation where GC resistance at relapse is rather part of a global drug resistance. The second project focuses on stemness properties of ETV6/RUNX1-harboring leukemias. PROM1 encodes CD133 and - based on its self-renewal capabilities – surface CD133 expression has been used as a cancer stem cell marker in various 4 malignancies. Here, we evaluated the proposed contribution of PROM1 to this phenotype. We suppressed PROM1 by lentiviral transduction of shRNAs and assessed PROM1/CD133 expression and clonogenicity in REH and AT-2 cell lines. Our studies revealed that CD133 is expressed as a function of ETV6/RUNX1 in all cells (p<0.005) and that PROM1 repression leads to a significant reduction of colony forming potential, viability and proliferation (p<0.05). These effects were, however, not as prominent as those obtained by the fusion gene knock down (p<0.005), suggesting the contribution of further components. Overall, our data complement those of others supporting the lack of stem cell hierarchy in childhood ALL, by demonstrating that ETV6/RUNX1 up-regulates PROM1 and thereby, at least partly, exerts self-renewal, engraftment and repopulation potential. Zusammenfassung Das ETV6/RUNX1 Fusionsgen (auch als TEL/AML bezeichnet) kennzeichnet die größte genetische Subgruppe (25%) der B Zell Vorläufer Leukämien im Kindesalter. Obwohl diese Leukämie generell gut auf die Therapie anspricht, erleiden bis zu 20% der erkrankten Kinder ein Rezidiv. Ein bedeutender Anteil dieser Rezidive ist mit schlechtem Ansprechen auf die Therapie und somit ungünstiger Prognose assoziiert. Das erste Projekt behandelt die Bedeutung genom-weiter genetischer Aberrationen und insbesondere jener, die den Glukokortikoidsignalweg betreffen. Zu diesem Zweck wurden bei 31 Rezidiv Fällen, mit entweder gutem oder schlechtem Ansprechen auf die Therapie, SNP Array Analysen durchgeführt. Bei 58% der Fälle fanden wir Deletionen von Genen im Glukokortikoidsignalweg. Lediglich Deletionen 5 von NR3C1 (das Gen, das für den Glukokortikoidrezeptor (GR) kodiert) und ETV6 waren mit hoher minimaler Resterkrankung und einem nachfolgenden Rezidiv assoziiert (p<0.05). Um die Notwendigkeit eines funktionellen GR nachzuweisen, exprimierten wir wt GR in biallelisch mutierten REH Zellen. Diese modifzierten Zelllinien wurden dann auf das Ansprechen auf Glukokortikoide in vitro und in einem Xenograft Maus Modell untersucht. Die durchgeführten Experimente bestätigen die zentrale Rolle des GR für das Ansprechen auf Glukokortikoide in E/R-positiven Leukämien. Da im klinischen Setting jedoch häufig eine Multidrug-Resistenz bei diesen Rezidiven vorliegt, sollte eine NR3C1 Deletion nicht isoliert gesehen werden. Das zweite Projekt konzentriert sich auf die Stammzelleigenschaften ETV6/RUNX1- positiver Leukämien und untersucht den Beitrag von PROM1 in diesem Zusammenhang. PROM1 ist verantwortlich für die Expression von CD133 auf der Zelloberfläche, das als Stammzellmarker in verschiedenen Krebserkrankungen verwendet wird. Durch lentivirale Transduktion von shRNAs wurde die PROM1/CD133 Expression unterdrückt und die Klonogenität von REH und AT-2 Zelllinien untersucht. Wir beobachteten, dass CD133 in allen Zellen in Abhängigkeit von ETV6/RUNX1 exprimiert wird (p<0.005) und, dass PROM1-Repression zu einer signifikanten Reduktion des koloniebildenden Potentials, von Viabilität und Proliferation (p<0.05) führt. Ein Knock-Down des ETV6/RUNX1 Fusionsgens verursachte einen ähnlichen, jedoch ausgeprägteren Phänotyp (p<0.05). Dies weist darauf hin, dass noch weitere Faktoren in diesem Prozess beteiligt sind. Insgesamt unterstützen unsere Daten das Fehlen einer Stammzell-Hierarchie bei kindlichen akuten
Recommended publications
  • Unravelling the Cellular Origin and Clinical Prognostic Markers of Infant

    Unravelling the Cellular Origin and Clinical Prognostic Markers of Infant

    Published Ahead of Print on January 24, 2019, as doi:10.3324/haematol.2018.206375. Copyright 2019 Ferrata Storti Foundation. Unravelling the cellular origin and clinical prognostic markers of infant B-cell acute lymphoblastic leukemia using genome-wide analysis by Antonio Agraz-Doblas, Clara Bueno, Rachael Bashford-Rogers, Anindita Roy, Pauline Schneider, Michela Bardini, Paola Ballerini, Gianni Cazzaniga, Thaidy Moreno, Carlos Revilla, Marta Gut, Maria G Valsecchi, Irene Roberts, Rob Pieters, Paola De Lorenzo, Ignacio Varela, Pablo Menendez, and Ronald W Stam Haematologica 2019 [Epub ahead of print] Citation: Antonio Agraz-Doblas, Clara Bueno, Rachael Bashford-Rogers, Anindita Roy, Pauline Schneider, Michela Bardini, Paola Ballerini, Gianni Cazzaniga, Thaidy Moreno, Carlos Revilla, Marta Gut, Maria G Valsecchi, Irene Roberts, Rob Pieters, Paola De Lorenzo, Ignacio Varela, Pablo Menendez, and Ronald W Stam. Unravelling the cellular origin and clinical prognostic markers of infant B-cell acute lymphoblastic leukemia using genome-wide analysis Haematologica. 2019; 104:xxx doi:10.3324/haematol.2018.206375 Publisher's Disclaimer. E-publishing ahead of print is increasingly important for the rapid dissemination of science. Haematologica is, therefore, E-publishing PDF files of an early version of manuscripts that have completed a regular peer review and have been accepted for publication. E-publishing of this PDF file has been approved by the authors. After having E-published Ahead of Print, manuscripts will then undergo technical and English editing, typesetting, proof correction and be presented for the authors' final approval; the final version of the manuscript will then appear in print on a regular issue of the journal. All legal disclaimers that apply to the journal also pertain to this production process.
  • Download Validation Data

    Download Validation Data

    PrimePCR™Assay Validation Report Gene Information Gene Name FAST kinase domain-containing protein 1 Gene Symbol Fastkd1 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. NM_001191738 UniGene ID Rn.226110 Ensembl Gene ID ENSRNOG00000024335 Entrez Gene ID 311112 Assay Information Unique Assay ID qRnoCEP0034063 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000036585 Amplicon Context Sequence AAAAAAAAAAACTACAGTCATGATCTGCCTGCTCCAAATATCTGTTCTCTCAGGTA GTCCATCCGTGTATCCTTCGTTGACATTGCCATGGAGTTCCA Amplicon Length (bp) 68 Chromosome Location 3:62537455-62537552 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 97 R2 0.9997 cDNA Cq 23.19 cDNA Tm (Celsius) 79 gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Fastkd1, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org.
  • Pathogenesis of ETV6/RUNX1-Positive Childhood Acute Lymphoblastic Leukemia and Mechanisms Underlying Its Relapse

    Pathogenesis of ETV6/RUNX1-Positive Childhood Acute Lymphoblastic Leukemia and Mechanisms Underlying Its Relapse

    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 21), pp: 35445-35459 Review Pathogenesis of ETV6/RUNX1-positive childhood acute lymphoblastic leukemia and mechanisms underlying its relapse Congcong Sun1, Lixian Chang1 and Xiaofan Zhu1 1 Center for Pediatric Blood Disease, State Key Laboratory of Experimental Hematology, Institute of Hematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences, and Peking Union Medical College, Tianjin, P.R. China Correspondence to: Xiaofan Zhu, email: [email protected] Keywords: ETV6/RUNX1, childhood acute lymphoblastic leukemia, mechanisms, initiation, relapse Received: November 21, 2016 Accepted: February 23, 2017 Published: March 18, 2017 Copyright: Sun et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC-BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT ETV6/RUNX1 (E/R) is the most common fusion gene in childhood acute lymphoblastic leukemia (ALL). Multiple lines of evidence imply a “two-hit” model for the molecular pathogenesis of E/R-positive ALL, whereby E/R rearrangement is followed by a series of secondary mutations that trigger overt leukemia. The cellular framework in which E/R arises and the maintenance of a pre-leukemic condition by E/R are fundamental to the mechanism that underlies leukemogenesis. Accordingly, a variety of studies have focused on the relationship between the clones giving rise to the primary and recurrent E/R-positive ALL. We review here the most recent insights into the pathogenic mechanisms underlying E/R-positive ALL, as well as the molecular abnormalities prevailing at relapse.
  • Genetic Analysis of Over One Million People Identifies 535 New Loci Associated with Blood 2 Pressure Traits

    Genetic Analysis of Over One Million People Identifies 535 New Loci Associated with Blood 2 Pressure Traits

    1 Genetic analysis of over one million people identifies 535 new loci associated with blood 2 pressure traits. 3 4 Table of Contents 5 SUPPLEMENTARY TABLES LEGENDS……………………………………………………………………………….…….3 6 SUPPLEMENTARY FIGURES LEGENDS ........................................................................................ 6 7 SUPPLEMENTARY METHODS ................................................................................................... 10 8 1. UK Biobank data .................................................................................................................................... 10 9 2. UKB Quality Control ............................................................................................................................... 10 10 3. Phenotypic data ..................................................................................................................................... 11 11 4. UKB analysis ........................................................................................................................................... 11 12 5. Genomic inflation and confounding ....................................................................................................... 12 13 6. International Consortium for Blood Pressure (ICBP) GWAS .................................................................... 12 14 7. Meta-analyses of discovery datasets ..................................................................................................... 13 15 8. Linkage Disequilibrium calculations ......................................................................................................
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
  • Analysis of the Indacaterol-Regulated Transcriptome in Human Airway

    Analysis of the Indacaterol-Regulated Transcriptome in Human Airway

    Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2018/04/13/jpet.118.249292.DC1 1521-0103/366/1/220–236$35.00 https://doi.org/10.1124/jpet.118.249292 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 366:220–236, July 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Analysis of the Indacaterol-Regulated Transcriptome in Human Airway Epithelial Cells Implicates Gene Expression Changes in the s Adverse and Therapeutic Effects of b2-Adrenoceptor Agonists Dong Yan, Omar Hamed, Taruna Joshi,1 Mahmoud M. Mostafa, Kyla C. Jamieson, Radhika Joshi, Robert Newton, and Mark A. Giembycz Departments of Physiology and Pharmacology (D.Y., O.H., T.J., K.C.J., R.J., M.A.G.) and Cell Biology and Anatomy (M.M.M., R.N.), Snyder Institute for Chronic Diseases, Cumming School of Medicine, University of Calgary, Calgary, Alberta, Canada Received March 22, 2018; accepted April 11, 2018 Downloaded from ABSTRACT The contribution of gene expression changes to the adverse and activity, and positive regulation of neutrophil chemotaxis. The therapeutic effects of b2-adrenoceptor agonists in asthma was general enriched GO term extracellular space was also associ- investigated using human airway epithelial cells as a therapeu- ated with indacaterol-induced genes, and many of those, in- tically relevant target. Operational model-fitting established that cluding CRISPLD2, DMBT1, GAS1, and SOCS3, have putative jpet.aspetjournals.org the long-acting b2-adrenoceptor agonists (LABA) indacaterol, anti-inflammatory, antibacterial, and/or antiviral activity. Numer- salmeterol, formoterol, and picumeterol were full agonists on ous indacaterol-regulated genes were also induced or repressed BEAS-2B cells transfected with a cAMP-response element in BEAS-2B cells and human primary bronchial epithelial cells by reporter but differed in efficacy (indacaterol $ formoterol .
  • Characterisation of the Genomic Landscape of CRLF2‐Rearranged Acute Lymphoblastic Leukemia

    Characterisation of the Genomic Landscape of CRLF2‐Rearranged Acute Lymphoblastic Leukemia

    Characterisation of the Genomic Landscape of CRLF2- rearranged Acute Lymphoblastic Leukemia Lisa J Russell1*, Lisa Jones1, Amir Enshaei1, Stefano Tonin1, Sarra L Ryan1, Jeyanthy Eswaran1 , Sirintra Nakjang2, Elli Papaemmanuil3,4, Jose M C Tubio4, Adele K Fielding5, Ajay Vora6, Peter J Campbell4, Anthony V Moorman1, and Christine J Harrison1 1 Leukaemia Research Cytogenetics Group, Northern Institute for Cancer Research, Newcastle University, Newcastle-upon-Tyne, UK 2 Bioinformatics Support Unit, Newcastle University, Newcastle-upon-Tyne, UK 3 Memorial Sloan Kettering Cancer Center, USA 4 Cancer Genome Project, Wellcome Trust Sanger Institute, Hinxton, UK 5 Research Department of Haemaoloty, UCL Cancer Institute, London, UK 6 Department of Haematology, Sheffield Children’s Hospital, Sheffield, UK; AVM and CJH contributed equally to this study Running Title – Genomic landscape of CRLF2 rearranged leukemia Correspondence to: Dr Lisa J Russell, Wolfson Childhood Cancer Research Centre, Northern Institute for Cancer Research, Newcastle University, Level 6, Herschel Building, Brewery Lane, Newcastle upon Tyne, NE1 7RU, [email protected]. Acknowledgements Support by: The Kay Kendall Leukaemia Fund, Leuka, European Haematology Association and Bloodwise (formerly Leukaemia and Lymphoma Research) This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an ‘Accepted Article’, doi: 10.1002/gcc.22439 This article is protected by copyright. All rights reserved. Genes, Chromosomes & Cancer Page 2 of 147 Deregulated expression of the type I cytokine receptor, CRLF2, is observed in 5-15% of precursor B-cell acute lymphoblastic leukaemia (B-ALL).
  • Genetic Mechanisms of Pitx1 Action in Murine Hindlimb Development

    Genetic Mechanisms of Pitx1 Action in Murine Hindlimb Development

    1 Genetic mechanisms of Pitx1 action in murine hindlimb development Stephen Nemec, Division of Experimental Medicine, McGill University, Montreal August 2017 A thesis submitted to McGill University in partial fulfillment of the degree of PhD © Stephen Nemec 2017 2 Table of Contents Contents Page Abstract 4 Acknowledgements 8 Abbreviations 9 Preface – Contribution to knowledge 10 Contribution of authors 11 Introduction 13 Figures 1 and 2: Basics of limb anatomy and development 13 Evolutionary origins of the limb 14 Chick embryology and the early study of the limb 16 Molecular limb development 21 Hox genes – Engines of limb development 25 The genetics of forelimb vs. hindlimb development 30 Pitx1: major regulator of HL-specific pattern 30 Tbx4 and Tbx5 – limb-type-specific Tbox paralogs 35 Tbx4, Tbx5 and developmental anomalies in humans 41 Pitx1 Tbx4 42 Purpose and Aims 45 Pitx1 directly modulates the core limb development 46 program to implement hindlimb identity Contributions 47 Abstract 48 Introduction 49 Results 51 Discussion 60 Materials and Methods 65 Figure Legends 69 Figures 74 Interlude A – From Sox9 to signaling 89 Shh signaling influences the 91 phenotype of Pitx1-/- hindlimbs Contributions 92 Abstract 93 Introduction 94 Results 96 Discussion 98 Materials and Methods 100 Figure Legends 102 Figures 104 Interlude B – Regulatory complexity and developmental constraints 110 3 Table of Contents (continued) Contents Page Regulatory integration of Hox factor action with 111 Tbox factors in limb development Contributions 112 Abstract 113 Introduction 114 Results 116 Discussion 124 Materials and Methods 128 Figure Legends 134 Figures 141 Discussion 152 Evolutionary constraints determine the 152 developmental roles of limb-type-specific genes Future Directions 156 References 159 4 Abstract In tetrapods, the forelimbs (FL) and hindlimbs (HL) emerge from the flank of the developing embryo as buds of mesenchyme sheathed in ectoderm.
  • Genetic Variation As a Tool for Identifying Novel Transducers of Itch

    Genetic Variation As a Tool for Identifying Novel Transducers of Itch

    Genetic variation as a tool for identifying novel transducers of itch By Takeshi Morita A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Molecular and Cell Biology in the Graduate Division of the University of California, Berkeley Committee in charge: Professor Diana M. Bautista, Co-Chair Professor Rachel B. Brem, Co-Chair Professor John Ngai Professor Kristin Scott Professor Michael W. Nachman Summer 2016 Abstract Genetic variation as a tool for identifying novel transducers of itch by Takeshi Morita Doctor of Philosophy in Molecular and Cell Biology University of California, Berkeley Professor Diana M. Bautista, Co-Chair Professor Rachel B. Brem, Co-Chair The mammalian somatosensory system mediates itch, the irritating sensation that elicits a desire to scratch. Millions of people worldwide suffer from chronic itch that fails to respond to current drugs and therapies. Even though recent studies have begun to elucidate the basic characteristics of the itch circuitry, we have little understanding about the molecules and signaling mechanisms that underlie detection and transduction of itch sensation, especially during chronic itch conditions. We have taken a genomic approach by harnessing natural variation in itch-evoked scratching behaviors in mice to identify novel molecular players that are involved in itch signal transduction at the level of primary sensory neurons. From our analysis, we identified numerous candidate itch genes, and further identified a serotonin receptor, HTR7 as a key transducer that is required for both development and maintenance of chronic itch. We further investigated the genetic basis of variation in itch, and identified a set of genes and regulatory pathways that may be involved in controlling itch behaviors.
  • The Clinical Utility of Optical Genome Mapping for the Assessment of Genomic Aberrations in Acute Lymphoblastic Leukemia

    The Clinical Utility of Optical Genome Mapping for the Assessment of Genomic Aberrations in Acute Lymphoblastic Leukemia

    cancers Article The Clinical Utility of Optical Genome Mapping for the Assessment of Genomic Aberrations in Acute Lymphoblastic Leukemia Jonathan Lukas Lühmann 1,† , Marie Stelter 1,†, Marie Wolter 1, Josephine Kater 1, Jana Lentes 1, Anke Katharina Bergmann 1, Maximilian Schieck 1 , Gudrun Göhring 1, Anja Möricke 2, Gunnar Cario 2, Markéta Žaliová 3 , Martin Schrappe 2, Brigitte Schlegelberger 1, Martin Stanulla 4 and Doris Steinemann 1,* 1 Department of Human Genetics, Hannover Medical School, 30625 Hannover, Germany; [email protected] (J.L.L.); [email protected] (M.S.); [email protected] (M.W.); [email protected] (J.K.); [email protected] (J.L.); [email protected] (A.K.B.); [email protected] (M.S.); [email protected] (G.G.); [email protected] (B.S.) 2 Department of Pediatrics I, ALL-BFM Study Group, Christian-Albrechts University Kiel and University Medical Center Schleswig-Holstein, 24105 Kiel, Germany; [email protected] (A.M.); [email protected] (G.C.); [email protected] (M.S.) 3 Department of Paediatric Haematology and Oncology, 2nd Faculty of Medicine, Charles University and University Hospital Motol, CZ-15006 Prague, Czech Republic; [email protected] 4 Pediatric Hematology and Oncology, Hannover Medical School, 30625 Hannover, Germany; [email protected] * Correspondence: [email protected] † These authors equally contributed to this work. Citation: Lühmann, J.L.; Stelter, M.; Wolter, M.; Kater, J.; Lentes, J.; Bergmann, A.K.; Schieck, M.; Simple Summary: The stratification of childhood ALL is currently based on various diagnostic Göhring, G.; Möricke, A.; Cario, G.; assays.
  • Genomics of Inherited Bone Marrow Failure and Myelodysplasia Michael

    Genomics of Inherited Bone Marrow Failure and Myelodysplasia Michael

    Genomics of inherited bone marrow failure and myelodysplasia Michael Yu Zhang A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington 2015 Reading Committee: Mary-Claire King, Chair Akiko Shimamura Marshall Horwitz Program Authorized to Offer Degree: Molecular and Cellular Biology 1 ©Copyright 2015 Michael Yu Zhang 2 University of Washington ABSTRACT Genomics of inherited bone marrow failure and myelodysplasia Michael Yu Zhang Chair of the Supervisory Committee: Professor Mary-Claire King Department of Medicine (Medical Genetics) and Genome Sciences Bone marrow failure and myelodysplastic syndromes (BMF/MDS) are disorders of impaired blood cell production with increased leukemia risk. BMF/MDS may be acquired or inherited, a distinction critical for treatment selection. Currently, diagnosis of these inherited syndromes is based on clinical history, family history, and laboratory studies, which directs the ordering of genetic tests on a gene-by-gene basis. However, despite extensive clinical workup and serial genetic testing, many cases remain unexplained. We sought to define the genetic etiology and pathophysiology of unclassified bone marrow failure and myelodysplastic syndromes. First, to determine the extent to which patients remained undiagnosed due to atypical or cryptic presentations of known inherited BMF/MDS, we developed a massively-parallel, next- generation DNA sequencing assay to simultaneously screen for mutations in 85 BMF/MDS genes. Querying 71 pediatric and adult patients with unclassified BMF/MDS using this assay revealed 8 (11%) patients with constitutional, pathogenic mutations in GATA2 , RUNX1 , DKC1 , or LIG4 . All eight patients lacked classic features or laboratory findings for their syndromes.
  • &lt;Abstract Centered&gt; an ABSTRACT of the THESIS OF

    <Abstract Centered> an ABSTRACT of the THESIS OF

    AN ABSTRACT OF THE DISSERTATION OF Michael Austin Garland for the degree of Doctor of Philosophy in Toxicology presented on June 14, 2019. Title: Transcriptomic Approaches for Discovering Regenerative and Developmental Regulatory Networks in Zebrafish Abstract approved: _____________________________________________________________________ Robert L. Tanguay Zebrafish are capable of fully regenerating organs and tissue such as their caudal fin, which is similar to a human regrowing an arm or a leg. In contrast, most mammals including humans have a greatly reduced capacity for wound healing. The ability of zebrafish to undergo this regenerative process, called epimorphic regeneration, hinges on the capacity to form a blastema at the wound site. The blastema quickly recapitulates the developmental processes involved in complex tissue formation to restore lost or damaged tissue. One key mechanism for inducing blastema formation is global repression of genes involved in tissue differentiation and maintenance. Induction of repressive factors, such as microRNAs (miRNAs), are involved in reprogramming cells during epimorphic regeneration. The upstream mechanism by which zebrafish undergo epimorphic regeneration remains elusive. Furthermore, while focus is shifting toward regulatory RNAs such as miRNAs, the full complement of their repressive activities is unknown. We took a transcriptomics approach to investigating epimorphic regeneration and fin development. Parallel sequencing of total RNA and small RNA samples was performed on regenerating fin tissue at 1 day post-amputation (dpa). Most miRNAs had increased expression, consistent with global repression of genes involved in cell specialization during de-differentiation. We identified predicted interactions between miRNAs and genes involved in transcriptional regulation, chromatin modification, and developmental signaling. miR-146a and miR-146b are anti- inflammatory miRNAs that were predicted to target eya4, which is involved in chromatin remodeling and innate immunity.