DOCSLIB.ORG

Genetic Mechanisms of Pitx1 Action in Murine Hindlimb Development

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genetic Mechanisms of Pitx1 Action in Murine Hindlimb Development 1 Genetic mechanisms of Pitx1 action in murine hindlimb development Stephen Nemec, Division of Experimental Medicine, McGill University, Montreal August 2017 A thesis submitted to McGill University in partial fulfillment of the degree of PhD © Stephen Nemec 2017 2 Table of Contents Contents Page Abstract 4 Acknowledgements 8 Abbreviations 9 Preface – Contribution to knowledge 10 Contribution of authors 11 Introduction 13 Figures 1 and 2: Basics of limb anatomy and development 13 Evolutionary origins of the limb 14 Chick embryology and the early study of the limb 16 Molecular limb development 21 Hox genes – Engines of limb development 25 The genetics of forelimb vs. hindlimb development 30 Pitx1: major regulator of HL-specific pattern 30 Tbx4 and Tbx5 – limb-type-specific Tbox paralogs 35 Tbx4, Tbx5 and developmental anomalies in humans 41 Pitx1 Tbx4 42 Purpose and Aims 45 Pitx1 directly modulates the core limb development 46 program to implement hindlimb identity Contributions 47 Abstract 48 Introduction 49 Results 51 Discussion 60 Materials and Methods 65 Figure Legends 69 Figures 74 Interlude A – From Sox9 to signaling 89 Shh signaling influences the 91 phenotype of Pitx1-/- hindlimbs Contributions 92 Abstract 93 Introduction 94 Results 96 Discussion 98 Materials and Methods 100 Figure Legends 102 Figures 104 Interlude B – Regulatory complexity and developmental constraints 110 3 Table of Contents (continued) Contents Page Regulatory integration of Hox factor action with 111 Tbox factors in limb development Contributions 112 Abstract 113 Introduction 114 Results 116 Discussion 124 Materials and Methods 128 Figure Legends 134 Figures 141 Discussion 152 Evolutionary constraints determine the 152 developmental roles of limb-type-specific genes Future Directions 156 References 159 4 Abstract In tetrapods, the forelimbs (FL) and hindlimbs (HL) emerge from the flank of the developing embryo as buds of mesenchyme sheathed in ectoderm. Each limb is divided into three segments that develop sequentially along the proximodistal axis: the proximal stylopod, the intermediate zeugopod, and the distal autopod. In the human FL, for example, these segments correspond to the one-bone humerus, the radius and ulna of the forearm, and the five digits of the hand. The musculoskeletal morphologies of FL and HL vary in accordance with the utility of each limb, however, and these differences arise from differences in the genetic programs that drive their development. Pitx1, a transcription factor gene that is expressed exclusively in HL, is necessary for the patterning and development of HL: the genetic and genomic mechanisms by which Pitx1 achieves HL identity are the subject of this thesis. Remarkably, the developmental programs that drive FL vs. HL development are characterized by very few differences, both transcriptionally and in terms of the genome-wide distribution of histone modifications. Pitx1 predominantly binds to putative enhancers that are in a common and active state in both limbs, suggesting that Pitx1 confers HL identity by modulating transcription rather than reconfiguring the genome to deploy a broad, HL-specific developmental program. Further, many of the genes that show Pitx1-dependent expression in HL, notably Sox9, Tbx15, Tbx18, are common elements of the FL program. We propose a model in which Pitx1 establishes HL identity by tweaking this core limb program. In this study, we also show that Pitx1-/- HL are deficient in the expression of several regulators associated with the anterior compartment of the limb, including the 5 anterioposterior (AP) patterning genes Gli3 and Gria2. This result led us to hypothesize that the anterior progenitors in the Pitx1-/- do not develop anterior structures because of an increased proximity to Shh signaling in the posterior of the limb. We studied the limbs of Pitx1-/-;Shh+/- embryos and discovered that decreasing the Shh gene dosage in Pitx1-/- mice decreases the severity of the Pitx1-/- phenotype: femur length is less drastically shortened and strain-sensitive digit one phenotypes are less frequent and severe in Pitx1-/- mice that are heterozygous for Shh. Reducing the dose of Shh does not rescue all Pitx1-directed HL characteristics, however: the knee, for example, remains malformed. Taken together, these studies show that Pitx1 directs the implementation of HL identity by direct TF action on the core limb development program. It is our interpretation that Pitx1 tinkers with the expression of common limb genes to generate, at the local level, the anatomical features that comprise HL identity. Last, we studied the transcriptional mechanisms of Tbx4 and Tbx5, two paralogous Tbox TF genes with expression restricted to the HL and FL, respectively, and with roles in muscle connective tissue patterning. This work revealed a genome- wide preference for these TFs to bind composite DNA motifs containing binding sites for both Tbox and Hox TFs. Studying the interaction of Tbx4/Tbx5 with Hox led to the conclusion that Hox TF action modulates Tbx4/Tbx5 transcriptional activity, a mode of interaction that could have far-reaching developmental consequences in light of the diversity of Hox and Tbox factors and domains of expression. 6 Chez les tétrapodes, les membres antérieurs et postérieurs émergent du flanc de l’embryon en développement de manière à former des bourgeons de mésenchyme entourés d’ectoderme. Chaque membre est divisé en trois segments se développant séquentiellement le long de l’axe proximal-distal : le stylopode en position proximale, le zeugopode en position intermédiaire ainsi que l’autopode situé de manière plus distale. Ainsi sont retrouvés chez les membres antérieurs humains l’humérus, le radius et l’cubitus de l’avant-bras et les cinq doigts de la main, correspondant aux segments susmentionnés. Toutefois, les morphologies musculo-squelettiques des membres antérieurs et postérieurs varient selon l’utilité de chaque membre et ces différences émergent de différences au niveau du programme génétique menant à leur développement. Pitx1, un gène codant pour un facteur de transcription exclusivement exprimé dans le membre postérieur, est nécessaire au modelage et au développement du membre postérieur : les mécanismes génétiques et génomiques à partir desquels Pitx1 mène à l’identité du membre postérieur sont le sujet de cette thèse. De façon remarquable, les programmes développementaux menant à la formation des membres antérieurs et postérieurs sont caractérisés par très peu de différences, et ce, non seulement au niveau transcriptionnel, mais aussi en terme de distribution génomique de modification des histones. Pitx1 lie de manière prédominante des séquences activatrices putatives dont l’état est commun et actif dans les membres à la fois antérieurs et postérieurs. Ceci suggère que Pitx1 confère l’identité d’un membre postérieur en modulant la transcription plutôt qu’en reconfigurant le génome de manière à déployer un programme développemental nouveau et spécifique aux membres postérieurs. De plus, les gènes dont l’expression dépend de Pitx1 dans les 7 membres postérieurs, notamment Sox9, Tbx15 et Tbx18 sont des éléments communs du programme développemental des membres antérieurs. Nous proposons un modèle dans lequel Pitx1 instaure l’identité postérieure des membres en ajustant le programme développemental commun aux deux types de membres. Dans cette étude, nous montrons également que les membres postérieurs d’individus Pitx1-/- présentent une déficience dans l’expression de plusieurs régulateurs associés au compartiment antérieur du membre, ce qui inclut les gènes de modelage antéro-postérieurs Gli3 et Gria2. Ce résultat nous a mené à suggérer que les individus Pitx1-/- ne développent pas de structures antérieures à cause d’une proximité accrue à la signalisation de Shh dans la région postérieure du membre. Nous avons étudié les membres d’embryons Pitx1-/-;Shh+/- et découvert qu’une exposition accrue la signalisation de Shh chez les souris Pitx1-/- mène à la réduction de la longueur du fémur et accentuent des aspects du phénotype Pitx1-/- spécifiques à la lignée, ce qui inclut la perte du premier doigt. Néanmoins, le fait de réduire la dose de Shh ne rétablit pas toutes les caractéristiques du membre postérieur liées à Pitx1: le genou, par exemple, reste malformé. En somme, ces études montrent que Pitx1 dirige l’instauration de l’identité du membre postérieur en agissant comme facteur de transcription directement sur le programme développemental commun aux deux types de membre. Notre interprétation des résultats est que Pitx1 ajuste l’expression de gènes communs aux deux membres pour générer les caractéristiques anatomiques uniques au membre postérieur. Enfin, nous avons étudié les mécanismes transcriptionnels de Tbx4 et Tbx5, deux gènes qui encodent des facteurs de transcription Tbox et dont l’expression est 8 restreinte aux membres postérieurs et antérieurs respectivement, et possédant un rôle dans le modelage des tissus conjonctifs musculaires. Ce travail a révélé, de la part de ces facteurs de transcription, une préférence au niveau génomique pour la liaison de motifs d’ADN composites contenant des sites de liaison pour des facteurs de transcription Tbox et Hox. L’étude des interactions de Tbx4/Tbx5 avec les facteurs Hox a mené à la conclusion suivante : l’action des facteurs de transcription Hox module l’activité transcriptionnelle de Tbx4/Tbx5. Ce mode d’interaction pourrait avoir des conséquences développementales considérables étant donné la diversité des facteurs Hox
Load more

Recommended publications
  • Variable Clinical Expression in Patients with a Germline MEN1 Disease Gene Mutation: Clues to a Genotype–Phenotype Correlation
    CLINICS 2012;67(S1):49-56 DOI:10.6061/clinics/2012(Sup01)10 REVIEW Variable clinical expression in patients with a germline MEN1 disease gene mutation: clues to a genotype–phenotype correlation Cornelis J. Lips,I Koen M. Dreijerink,I Jo W. Ho¨ ppenerII I University Medical Center Utrecht, Department of Internal Medicine & Endocrinology, Utrecht, The Netherlands. II University Medical Center Utrecht, Department of Metabolic & Endocrine Diseases, Utrecht, The Netherlands. Multiple endocrine neoplasia type 1 is an inherited endocrine tumor syndrome, predominantly characterized by tumors of the parathyroid glands, gastroenteropancreatic tumors, pituitary adenomas, adrenal adenomas, and neuroendocrine tumors of the thymus, lungs or stomach. Multiple endocrine neoplasia type 1 is caused by germline mutations of the multiple endocrine neoplasia type 1 tumor suppressor gene. The initial germline mutation, loss of the wild-type allele, and modifying genetic and possibly epigenetic and environmental events eventually result in multiple endocrine neoplasia type 1 tumors. Our understanding of the function of the multiple endocrine neoplasia type 1 gene product, menin, has increased significantly over the years. However, to date, no clear genotype– phenotype correlation has been established. In this review we discuss reports on exceptional clinical presentations of multiple endocrine neoplasia type 1, which may provide more insight into the pathogenesis of this disorder and offer clues for a possible genotype–phenotype correlation. KEYWORDS: Multiple Endocrine Neoplasia type 1; MEN1; Menin; Genotype–Phenotype Correlation; Clinical Expression. Lips CJ, Dreijerink KM, Ho¨ ppener JW. Variable clinical expression in patients with a germline MEN1 disease gene mutation: clues to a genotype– phenotype correlation. Clinics. 2012;67(S1):49-56.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • An Evolutionary Conserved Region (ECR) in the Human Dopamine Receptor D4 Gene Supports Reporter Gene Expression in Primary Cultu
    Paredes et al. BMC Neuroscience 2011, 12:46 http://www.biomedcentral.com/1471-2202/12/46 RESEARCHARTICLE Open Access An evolutionary conserved region (ECR) in the human dopamine receptor D4 gene supports reporter gene expression in primary cultures derived from the rat cortex Ursula M Paredes1,2, Vivien J Bubb1, Kate Haddley1, Gabriele A Macho1,3 and John P Quinn1* Abstract Background: Detecting functional variants contributing to diversity of behaviour is crucial for dissecting genetics of complex behaviours. At a molecular level, characterisation of variation in exons has been studied as they are easily identified in the current genome annotation although the functional consequences are less well understood; however, it has been difficult to prioritise regions of non-coding DNA in which genetic variation could also have significant functional consequences. Comparison of multiple vertebrate genomes has allowed the identification of non-coding evolutionary conserved regions (ECRs), in which the degree of conservation can be comparable with exonic regions suggesting functional significance. Results: We identified ECRs at the dopamine receptor D4 gene locus, an important gene for human behaviours. The most conserved non-coding ECR (D4ECR1) supported high reporter gene expression in primary cultures derived from neonate rat frontal cortex. Computer aided analysis of the sequence of the D4ECR1 indicated the potential transcription factors that could modulate its function. D4ECR1 contained multiple consensus sequences for binding the transcription factor Sp1, a factor previously implicated in DRD4 expression. Co-transfection experiments demonstrated that overexpression of Sp1 significantly decreased the activity of the D4ECR1 in vitro. Conclusion: Bioinformatic analysis complemented by functional analysis of the DRD4 gene locus has identified a) a strong enhancer that functions in neurons and b) a transcription factor that may modulate the function of that enhancer.
    [Show full text]
  • The BTB-ZF Family of Transcription Factors: Key Regulators of Lineage
    The BTB-ZF Family of Transcription Factors: Key Regulators of Lineage Commitment and Effector Function Development in the Immune System This information is current as of September 27, 2021. Aimee M. Beaulieu and Derek B. Sant'Angelo J Immunol 2011; 187:2841-2847; ; doi: 10.4049/jimmunol.1004006 http://www.jimmunol.org/content/187/6/2841 Downloaded from References This article cites 103 articles, 44 of which you can access for free at: http://www.jimmunol.org/content/187/6/2841.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 27, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2011 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The BTB-ZF Family of Transcription Factors: Key Regulators of Lineage Commitment and Effector Function Development in the Immune System Aimee M. Beaulieu* and Derek B. Sant’Angelo*,†,‡ Successful immunity depends upon the activity of mul- 1, -2, -4, -5, and -7 (1–11).
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Cell-Specific Alterations in Pitx1 Regulatory Landscape Activation Caused 2 by the Loss of a Single Enhancer
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.10.434611; this version posted March 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Cell-specific alterations in Pitx1 regulatory landscape activation caused 2 by the loss of a single enhancer 3 4 5 Raquel Rouco1,2*, Olimpia Bompadre1,2*, Antonella Rauseo1,2, Olivier Fazio3, Fabrizio Thorel3, 6 Rodrigue Peraldi1,2, Guillaume Andrey1,2 7 8 9 1Department of Genetic Medicine and Development, Faculty of Medicine, University of 10 Geneva, Geneva, Switzerland 11 2Institute of Genetics and Genomics in Geneva (iGE3), University of Geneva, Geneva, 12 Switzerland 13 3 Transgenesis Core Facility, Faculty of Medicine, University of Geneva, Geneva, Switzerland 14 15 *Authors contributed equally 16 Correspondence: [email protected] 17 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.10.434611; this version posted March 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 18 Abstract 19 20 Most developmental genes rely on multiple transcriptional enhancers for their accurate expression 21 during embryogenesis. Because enhancers may have partially redundant activities, the loss of one 22 of them often leads to a partial loss of gene expression and concurrent moderate phenotypic 23 outcome, if any.
    [Show full text]
  • Single Cell Regulatory Landscape of the Mouse Kidney Highlights Cellular Differentiation Programs and Disease Targets
    ARTICLE https://doi.org/10.1038/s41467-021-22266-1 OPEN Single cell regulatory landscape of the mouse kidney highlights cellular differentiation programs and disease targets Zhen Miao 1,2,3,8, Michael S. Balzer 1,2,8, Ziyuan Ma 1,2,8, Hongbo Liu1,2, Junnan Wu 1,2, Rojesh Shrestha 1,2, Tamas Aranyi1,2, Amy Kwan4, Ayano Kondo 4, Marco Pontoglio 5, Junhyong Kim6, ✉ Mingyao Li 7, Klaus H. Kaestner2,4 & Katalin Susztak 1,2,4 1234567890():,; Determining the epigenetic program that generates unique cell types in the kidney is critical for understanding cell-type heterogeneity during tissue homeostasis and injury response. Here, we profile open chromatin and gene expression in developing and adult mouse kidneys at single cell resolution. We show critical reliance of gene expression on distal regulatory elements (enhancers). We reveal key cell type-specific transcription factors and major gene- regulatory circuits for kidney cells. Dynamic chromatin and expression changes during nephron progenitor differentiation demonstrates that podocyte commitment occurs early and is associated with sustained Foxl1 expression. Renal tubule cells follow a more complex differentiation, where Hfn4a is associated with proximal and Tfap2b with distal fate. Mapping single nucleotide variants associated with human kidney disease implicates critical cell types, developmental stages, genes, and regulatory mechanisms. The single cell multi-omics atlas reveals key chromatin remodeling events and gene expression dynamics associated with kidney development. 1 Renal, Electrolyte, and Hypertension Division, Department of Medicine, University of Pennsylvania, Perelman School of Medicine, Philadelphia, PA, USA. 2 Institute for Diabetes, Obesity, and Metabolism, University of Pennsylvania, Perelman School of Medicine, Philadelphia, PA, USA.
    [Show full text]
  • Expression Pattern of the Class I Homeobox Genes in Ovarian Carcinoma
    J Gynecol Oncol Vol. 21, No. 1:29-37, March 2010 DOI:10.3802/jgo.2010.21.1.29 Original Article Expression pattern of the class I homeobox genes in ovarian carcinoma Jin Hwa Hong1, Jae Kwan Lee1, Joong Jean Park2, Nak Woo Lee1, Kyu Wan Lee1, Jung Yeol Na1 Departments of 1Obstetrics and Gynecology, 2Physiology, Korea University College of Medicine, Seoul, Korea Objective: Although some sporadic reports reveal the link between the homeobox (HOX) genes and ovarian carcinoma, there is no comprehensive analysis of the expression pattern of the class I homeobox genes in ovarian carcinoma that determines the candidate genes involved in ovarian carcinogenesis. Methods: The different patterns of expression of 36 HOX genes were analyzed, including 4 ovarian cancer cell lines and 4 normal ovarian tissues. Using a reverse transcription-polymerase chain reaction (RT-PCR) and quantification analysis, the specific gene that showed a significantly higher expression in ovarian cancer cell lines than in normal ovaries was selected, and western blot analysis was performed adding 7 ovarian cancer tissue specimens. Finally, immunohistochemical and immunocytochemical analyses were performed to compare the pattern of expression of the specific HOX gene between ovarian cancer tissue and normal ovaries. Results: Among 36 genes, 11 genes had a different level of mRNA expression between the cancer cell lines and the normal ovarian tissues. Of the 11 genes, only HOXB4 had a significantly higher level of expression in ovarian cancer cell lines than in normal ovaries (p=0.029). Based on western blot, immunohistochemical, and immunocytochemical analyses, HOXB4 was expressed exclusively in the ovarian cancer cell lines or cancer tissue specimens, but not in the normal ovaries.
    [Show full text]
  • A Three-Dimensional Organoid Model Recapitulates Tumorigenic Aspects
    www.nature.com/scientificreports OPEN A three-dimensional organoid model recapitulates tumorigenic aspects and drug responses of Received: 22 June 2018 Accepted: 10 October 2018 advanced human retinoblastoma Published: xx xx xxxx Duangporn Saengwimol1, Duangnate Rojanaporn2, Vijender Chaitankar3, Pamorn Chittavanich4, Rangsima Aroonroch5, Tatpong Boontawon4, Weerin Thammachote4, Natini Jinawath4, Suradej Hongeng6 & Rossukon Kaewkhaw4 Persistent or recurrent retinoblastoma (RB) is associated with the presence of vitreous or/and subretinal seeds in advanced RB and represents a major cause of therapeutic failure. This necessitates the development of novel therapies and thus requires a model of advanced RB for testing candidate therapeutics. To this aim, we established and characterized a three-dimensional, self-organizing organoid model derived from chemotherapy-naïve tumors. The responses of organoids to drugs were determined and compared to relate organoid model to advanced RB, in terms of drug sensitivities. We found that organoids had histological features resembling retinal tumors and seeds and retained DNA copy-number alterations as well as gene and protein expression of the parental tissue. Cone signal circuitry (M/L+ cells) and glial tumor microenvironment (GFAP+ cells) were primarily present in organoids. Topotecan alone or the combined drug regimen of topotecan and melphalan efectively targeted proliferative tumor cones (RXRγ+ Ki67+) in organoids after 24-h drug exposure, blocking mitotic entry. In contrast, methotrexate showed the least efcacy against tumor cells. The drug responses of organoids were consistent with those of tumor cells in advanced disease. Patient-derived organoids enable the creation of a faithful model to use in examining novel therapeutics for RB. Retinoblastoma (RB) is a serious childhood retinal tumor that, if lef untreated, can cause death within 1–2 years.
    [Show full text]
  • Liebenberg Syndrome
    Liebenberg syndrome Description Liebenberg syndrome is a condition that involves abnormal development of the arms, resulting in characteristic arm malformations that can vary in severity. In people with this condition, bones and other tissues in the elbows, forearms, wrists, and hands have characteristics of related structures in the lower limbs. For example, bones in the elbows are abnormally shaped, which affects mobility of the joints. The stiff elbows function more like knees, unable to rotate as freely as elbows normally do. Bones in the wrists are joined together (fused), forming structures that resemble those in the ankles and heels and causing permanent bending of the hand toward the thumb (radial deviation). The bones in the hands (metacarpals) are longer than normal, and the fingers are short (brachydactyly), similar to the proportions of bones found in the feet. In addition, muscles and tendons that are typically found only in the hands and not in the feet are missing in people with Liebenberg syndrome. Affected individuals also have joint deformities (contractures) that limit movement of the elbows, wrists, and hands. Development of the lower limbs is normal in people with this condition. Individuals with Liebenberg syndrome have no other health problems related to this condition, and life expectancy is normal. Frequency Liebenberg syndrome is a rare condition. Fewer than 10 affected families have been described in the medical literature. Causes Liebenberg syndrome is caused by genetic changes near the PITX1 gene. The protein produced from this gene plays a critical role in lower limb development by controlling the activity of other genes involved in limb development, directing the shape and structure of bones and other tissues in the legs and feet.
    [Show full text]
  • Grimme, Acadia.Pdf
    MECHANISM OF ACTION OF HISTONE DEACETYLASE INHIBITORS ON SURVIVAL MOTOR NEURON 2 PROMOTER by Acadia L. Grimme A thesis submitted to the Faculty of the University of Delaware in partial fulfillment of the requirements for the degree of Bachelors of Science in Biological Sciences with Distinction Spring 2018 © 2018 Acadia Grimme All Rights Reserved MECHANISM OF ACTION OF HISTONE DEACETYLASE INHIBITORS ON SURVIVAL MOTOR NEURON 2 PROMOTER by Acadia L. Grimme Approved: __________________________________________________________ Matthew E. R. Butchbach, Ph.D. Professor in charge of thesis on behalf of the Advisory Committee Approved: __________________________________________________________ Deni S. Galileo, Ph.D. Professor in charge of thesis on behalf of the Advisory Committee Approved: __________________________________________________________ Carlton R. Cooper, Ph.D. Committee member from the Department of Biological Sciences Approved: __________________________________________________________ Gary H. Laverty, Ph.D. Committee member from the Board of Senior Thesis Readers Approved: __________________________________________________________ Michael Chajes, Ph.D. Chair of the University Committee on Student and Faculty Honors ACKNOWLEDGMENTS I would like to acknowledge my thesis director Dr. Butchbach for his wonderful guidance and patience as I worked through my project. He has been an excellent research mentor over the last two years and I am forever thankful that he welcomed me into his lab. His dedication to his work inspires me as an aspiring research scientist. His lessons will carry on with me as I pursue future research in graduate school and beyond. I would like to thank both current and former members of the Motor Neuron Disease Laboratory: Sambee Kanda, Kyle Hinkle, and Andrew Connell. Sambee and Andrew patiently taught me many of the techniques I utilized in my project, and without them it would not be what it is today.
    [Show full text]