DOCSLIB.ORG

The BTB-ZF Family of Transcription Factors: Key Regulators of Lineage

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The BTB-ZF Family of Transcription Factors: Key Regulators of Lineage The BTB-ZF Family of Transcription Factors: Key Regulators of Lineage Commitment and Effector Function Development in the Immune System This information is current as of September 27, 2021. Aimee M. Beaulieu and Derek B. Sant'Angelo J Immunol 2011; 187:2841-2847; ; doi: 10.4049/jimmunol.1004006 http://www.jimmunol.org/content/187/6/2841 Downloaded from References This article cites 103 articles, 44 of which you can access for free at: http://www.jimmunol.org/content/187/6/2841.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 27, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2011 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The BTB-ZF Family of Transcription Factors: Key Regulators of Lineage Commitment and Effector Function Development in the Immune System Aimee M. Beaulieu* and Derek B. Sant’Angelo*,†,‡ Successful immunity depends upon the activity of mul- 1, -2, -4, -5, and -7 (1–11). Although most of these interac- tiple cell types. Commitment of pluripotent precursor tions were described in nonhematopoietic cells or transformed cells to specific lineages, such as T or B cells, is obviously cell lines, BTB-ZF proteins likely regulate gene expression in fundamental to this process. However, it is also becom- primary lymphocytes via a similar mechanism. For example, ing clear that continued differentiation and specializa- the BTB-ZF protein PLZP has been shown to associate with HDAC-2 in Th2-skewed CD4+ and CD8+ T cells, and these tion of lymphoid cells is equally important for immune Downloaded from system integrity. Several members of the BTB-ZF family two proteins colocalize at regulatory elements in the IL-13 gene have emerged as critical factors that control development where they likely act in concert to modulate transcription (12). of specific lineages and also of specific effector subsets In addition to corepressor recruitment, the BTB domain, within these lineages. For example, BTB-ZF genes have and in some cases the ZF domain, also facilitate hetero- been shown to control T cell versus B cell commitment dimerization and homodimerization among the different gene family members. For example, the BTB-ZF protein Bcl-6 can andCD4versusCD8lineagecommitment.Others, http://www.jimmunol.org/ exist as a homodimer (13) but may also form heterodimers such as PLZF for NKT cells and Bcl-6 for T follicular with other BTB-ZF proteins, including NAC-1, PLZF, LRF, helper cells, are necessary for the acquisition of effec- BAZF, and Miz-1 (14–18). Similarly, overexpression and tor functions. In this review, we summarize current find- cotransfection systems have demonstrated an interaction be- ings concerning the BTB-ZF family members with a tween PLZF and PLZP, although PLZF can also exist as reported role in the immune system. The Journal of a homodimer (1, 19, 20). Like the cofactor studies, nearly Immunology, 2011, 187: 2841–2847. all of this work has been done in nonhematopoietic cells or cell lines; nevertheless, the finding that Miz-1 and Bcl-6 physically interact in primary germinal center B cells (18) by guest on September 27, 2021 road complex, tramtrack, bric-a-brac, and zinc finger suggests that heterodimerization may be physiologically rele- (BTB-ZF) proteins are an evolutionarily conserved vant to BTB-ZF protein function in primary cells of the B family of transcriptional regulators. Members of this immune system, and further studies are needed to shed light group, of which there are .45 in human and mice, are char- on this topic. acterized as having one or more C-terminal C2H2 Kru¨ppel- type zinc finger DNA binding domains in combination with BTB-ZF proteins control lineage commitment, development, and an N-terminal BTB domain that mediates protein–protein function in lymphocytes interactions. Transcriptional regulation, most often repres- As powerful regulators of gene expression, BTB-ZF proteins sion, is achieved by sequence-specific binding by the ZF do- are critical players in a wide variety of biological processes, main to regulatory regions in target genes, coupled with the re- including developmental events such as gastrulation and limb cruitment of cofactors involved in chromatin remodeling and formation, control of DNA damage and cell cycle progression transcriptional silencing/activation. in normal and oncogenic tissues, maintenance of the stem cell Cofactor complex formation is largely mediated by the BTB pool, and gamete formation (21). Moreover, recent studies domain, which has been shown to interact directly with core- have highlighted a fundamental and nonredundant role for pressors and histone modification enzymes, including SMRT, many BTB-ZF factors in the development and function of ETO,N-Cor,B-Cor, CtBP,Sin3A, DRAL/FHL2,andHDAC- cells in the immune system. This review will summarize *Immunology Program, Sloan-Kettering Institute, Memorial Sloan-Kettering Cancer Abbreviations used in this article: BAZF, Bcl-6–associated zinc finger; BTB-ZF, broad Center, New York, NY 10065; †Louis V. Gerstner Jr. Graduate School of Biomedical complex, tramtrack, bric-a-brac, and zinc finger; CSR, class switch recombination; GC, Sciences, Memorial Sloan-Kettering Cancer Center, New York, NY 10065; and ‡Weill germinal center; iNKT, invariant NKT; LRF, leukemia/lymphoma related factor; Cornell Graduate School of Medical Sciences, Cornell University, New York, NY, MAZR, Myc-associated zinc-finger protein-related factor; Miz-1, Myc-interacting zinc 10065 finger protein-1; PLZF, promyelocytic leukemia zinc finger; PLZP, PLZF-like zinc finger protein; SHM, somatic hypermutation; Tfh, T follicular helper; ThPOK, Th- Received for publication May 13, 2011. Accepted for publication June 22, 2011. inducing POZ/Kru¨ppel-like factor. This work was supported by the National Institute of Allergy and Infectious Diseases (Grants R01 AI083988 and R01 AI059739). A.M.B. was supported by a National Copyright Ó 2011 by The American Association of Immunologists, Inc. 0022-1767/11/$16.00 Institutes of Health National Service Research award (Grant T32 CA009149). Address correspondence and reprint requests to Dr. Derek B. Sant’Angelo, Immunology Program, Memorial Sloan-Kettering Cancer Center, Box 492, 1275 York Avenue, New York, NY 10021. E-mail address: [email protected] www.jimmunol.org/cgi/doi/10.4049/jimmunol.1004006 2842 BRIEF REVIEWS: BTB-ZF GENES IN THE IMMUNE SYSTEM current findings on the eight family members with known cellular senescence in response to RAG-induced DNA lesions. roles in orchestrating lymphocyte development: Bcl-6, PLZF, Consequently, Bcl-6–deficient mice have an immature B cell Th inducing POZ/Kru¨ppel-like factor (ThPOK), PLZP, pool that is reduced in both size and clonal diversity (34). MAZR, BAZF, LRF, and Miz-1 (Fig. 1). Hints at a role for Bcl-6 in T cell function originated from Bcl-6. The BTB-ZF protein Bcl-6 was first identified as an early studies in which Bcl-6–deficient mice were found to oncogene in diffuse large B cell lymphoma, the most com- develop spontaneous Th2 inflammation, characterized by mon form of non-Hodgkin’s lymphoma. The transformative enhanced IgE production and severe eosinophilia (27, 28). properties of Bcl-6 stem largely from its ability to repress Upon stimulation in vitro, T cells from Bcl-6–deficient mice transcription of tumor suppressor and cell cycle arrest genes, produce elevated levels of IL-4, IL-5, and IL-13, a phenotype including p53, ATR, CHEK1, and CDKN1A/p21 (18, that has been linked to direct binding by Bcl-6 in regulatory 22–26). Bcl-6 is normally expressed at high levels in ger- regions of genes for IL-5, Ig«, and IL-4 (27, 35, 36). minal center (GC) B cells. Early studies showed that mice More recently, Bcl-6 was shown to be necessary and suf- lacking Bcl-6 were unable to form GCs after immunization ficient for the development of CD4+ T follicular helper (Tfh) with T cell-dependent Ags. Moreover, Ag-specific B cells in cells, which provide critical help to GC B cells undergoing these mice were impaired for affinity maturation and class SHM and CSR (37–39). Constitutive Bcl-6 expression in switch recombination (CSR) to IgG subtypes (27, 28). Re- CD4+ T cells in vivo drives nearly complete commitment to constitution of RAG1-knockout mice with Bcl-6–deficient the Tfh lineage, and these helper cells are highly effective bone marrow showed that Bcl-6 was required in the hema- inducers of GC formation and Ab production by B cells. Downloaded from topoietic compartment for GC formation and somatic Conversely, Bcl-6 deficiency abrogates Tfh cell differentia- hypermutation (SHM) but not for primary IgG responses tion, and CD4+ T cells from these mice fail to mediate GC (29, 30). Bcl-6 also represses expression of Blimp-1, a formation (38, 39). At a mechanistic level, Bcl-6 is induced in transcription factor that promotes plasma cell differentiation CD4+ T cells by IL-6 and IL-21, although neither cytokine is (31, 32). Given that Blimp-1 represses Bcl-6, the reciprocal independently required for Tfh cell differentiation (40). Bcl-6 antagonism of these two genes has been proposed to serve as drives expression of molecules involved in Tfh cell homing http://www.jimmunol.org/ a bimodal “switch,” by which B cell fate, as either a GC B cell and function, including CXCR5, CXCR4, IL-21R, IL-6R, or an Ab-secreting plasma cell, is established and maintained PD-1, and IL-21, and is required to maintain Tfh identity (33).
Load more

Recommended publications
  • Impact of ZBTB7A Hypomethylation and Expression Patterns on Treatment Response to Hydroxyurea Vasiliki Chondrou1†, Eleana F
    Chondrou et al. Human Genomics (2018) 12:45 https://doi.org/10.1186/s40246-018-0177-z PRIMARY RESEARCH Open Access Impact of ZBTB7A hypomethylation and expression patterns on treatment response to hydroxyurea Vasiliki Chondrou1†, Eleana F. Stavrou1†, Georgios Markopoulos2, Alexandra Kouraklis-Symeonidis3, Vasilios Fotopoulos4, Argiris Symeonidis5, Efthymia Vlachaki6, Panagiota Chalkia7, George P. Patrinos8, Adamantia Papachatzopoulou9 and Argyro Sgourou1* Abstract Background: We aimed to clarify the emerging epigenetic landscape in a group of genes classified as “modifier genes” of the β-type globin genes (HBB cluster), known to operate in trans to accomplish the two natural developmental switches in globin expression, from embryonic to fetal during the first trimester of conception and from fetal to adult around the time of birth. The epigenetic alterations were determined in adult sickle cell anemia (SCA) homozygotes and SCA/β-thalassemia compound heterozygotes of Greek origin, who are under hydroxyurea (HU) treatment. Patients were distinguished in HU responders and HU non-responders (those not benefited from the HU) and both, and in vivo and in vitro approaches were implemented. Results: We examined the CpG islands’ DNA methylation profile of BCL11A, KLF1, MYB, MAP3K5, SIN3A, ZBTB7A,andGATA2, along with γ-globin and LRF/ZBTB7A expression levels. In vitro treatment of hematopoietic stem cells (HSCs) with HU induced a significant DNA hypomethylation pattern in ZBTB7A (p*, 0.04) and GATA2 (p*, 0.03) CpGs exclusively in the HU non-responders. Also, this group of patients exhibited significantly elevated baseline methylation patterns in ZBTB7A, before the HU treatment, compared to HU responders (p*, 0.019) and to control group of healthy individuals (p*, 0.021) , which resembles a potential epigenetic barrier for the γ-globin expression.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Variable Clinical Expression in Patients with a Germline MEN1 Disease Gene Mutation: Clues to a Genotype–Phenotype Correlation
    CLINICS 2012;67(S1):49-56 DOI:10.6061/clinics/2012(Sup01)10 REVIEW Variable clinical expression in patients with a germline MEN1 disease gene mutation: clues to a genotype–phenotype correlation Cornelis J. Lips,I Koen M. Dreijerink,I Jo W. Ho¨ ppenerII I University Medical Center Utrecht, Department of Internal Medicine & Endocrinology, Utrecht, The Netherlands. II University Medical Center Utrecht, Department of Metabolic & Endocrine Diseases, Utrecht, The Netherlands. Multiple endocrine neoplasia type 1 is an inherited endocrine tumor syndrome, predominantly characterized by tumors of the parathyroid glands, gastroenteropancreatic tumors, pituitary adenomas, adrenal adenomas, and neuroendocrine tumors of the thymus, lungs or stomach. Multiple endocrine neoplasia type 1 is caused by germline mutations of the multiple endocrine neoplasia type 1 tumor suppressor gene. The initial germline mutation, loss of the wild-type allele, and modifying genetic and possibly epigenetic and environmental events eventually result in multiple endocrine neoplasia type 1 tumors. Our understanding of the function of the multiple endocrine neoplasia type 1 gene product, menin, has increased significantly over the years. However, to date, no clear genotype– phenotype correlation has been established. In this review we discuss reports on exceptional clinical presentations of multiple endocrine neoplasia type 1, which may provide more insight into the pathogenesis of this disorder and offer clues for a possible genotype–phenotype correlation. KEYWORDS: Multiple Endocrine Neoplasia type 1; MEN1; Menin; Genotype–Phenotype Correlation; Clinical Expression. Lips CJ, Dreijerink KM, Ho¨ ppener JW. Variable clinical expression in patients with a germline MEN1 disease gene mutation: clues to a genotype– phenotype correlation. Clinics. 2012;67(S1):49-56.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • An Evolutionary Conserved Region (ECR) in the Human Dopamine Receptor D4 Gene Supports Reporter Gene Expression in Primary Cultu
    Paredes et al. BMC Neuroscience 2011, 12:46 http://www.biomedcentral.com/1471-2202/12/46 RESEARCHARTICLE Open Access An evolutionary conserved region (ECR) in the human dopamine receptor D4 gene supports reporter gene expression in primary cultures derived from the rat cortex Ursula M Paredes1,2, Vivien J Bubb1, Kate Haddley1, Gabriele A Macho1,3 and John P Quinn1* Abstract Background: Detecting functional variants contributing to diversity of behaviour is crucial for dissecting genetics of complex behaviours. At a molecular level, characterisation of variation in exons has been studied as they are easily identified in the current genome annotation although the functional consequences are less well understood; however, it has been difficult to prioritise regions of non-coding DNA in which genetic variation could also have significant functional consequences. Comparison of multiple vertebrate genomes has allowed the identification of non-coding evolutionary conserved regions (ECRs), in which the degree of conservation can be comparable with exonic regions suggesting functional significance. Results: We identified ECRs at the dopamine receptor D4 gene locus, an important gene for human behaviours. The most conserved non-coding ECR (D4ECR1) supported high reporter gene expression in primary cultures derived from neonate rat frontal cortex. Computer aided analysis of the sequence of the D4ECR1 indicated the potential transcription factors that could modulate its function. D4ECR1 contained multiple consensus sequences for binding the transcription factor Sp1, a factor previously implicated in DRD4 expression. Co-transfection experiments demonstrated that overexpression of Sp1 significantly decreased the activity of the D4ECR1 in vitro. Conclusion: Bioinformatic analysis complemented by functional analysis of the DRD4 gene locus has identified a) a strong enhancer that functions in neurons and b) a transcription factor that may modulate the function of that enhancer.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • SUPPLEMENTARY NOTE Co-Activation of GR and NFKB
    SUPPLEMENTARY NOTE Co-activation of GR and NFKB alters the repertoire of their binding sites and target genes. Nagesha A.S. Rao1*, Melysia T. McCalman1,*, Panagiotis Moulos2,4, Kees-Jan Francoijs1, 2 2 3 3,5 Aristotelis Chatziioannou , Fragiskos N. Kolisis , Michael N. Alexis , Dimitra J. Mitsiou and 1,5 Hendrik G. Stunnenberg 1Department of Molecular Biology, Radboud University Nijmegen, the Netherlands 2Metabolic Engineering and Bioinformatics Group, Institute of Biological Research and Biotechnology, National Hellenic Research Foundation, Athens, Greece 3Molecular Endocrinology Programme, Institute of Biological Research and Biotechnology, National Hellenic Research Foundation, Greece 4These authors contributed equally to this work 5 Corresponding authors E-MAIL: [email protected] ; TEL: +31-24-3610524; FAX: +31-24-3610520 E-MAIL: [email protected] ; TEL: +30-210-7273741; FAX: +30-210-7273677 Running title: Global GR and NFKB crosstalk Keywords: GR, p65, genome-wide, binding sites, crosstalk SUPPLEMENTARY FIGURES/FIGURE LEGENDS AND SUPPLEMENTARY TABLES 1 Rao118042_Supplementary Fig. 1 A Primary transcript Mature mRNA TNF/DMSO TNF/DMSO 8 12 r=0.74, p< 0.001 r=0.61, p< 0.001 ) 2 ) 10 2 6 8 4 6 4 2 2 0 Fold change (mRNA) (log Fold change (primRNA) (log 0 −2 −2 −2 0 2 4 −2 0 2 4 Fold change (RNAPII) (log2) Fold change (RNAPII) (log2) B chr5: chrX: 56 _ 104 _ DMSO DMSO 1 _ 1 _ 56 _ 104 _ TA TA 1 _ 1 _ 56 _ 104 _ TNF TNF Cluster 1 1 _ Cluster 2 1 _ 56 _ 104 _ TA+TNF TA+TNF 1 _ 1 _ CCNB1 TSC22D3 chr20: chr17: 25 _ 33 _ DMSO DMSO 1 _ 1 _ 25 _ 33 _ TA TA 1 _ 1 _ 25 _ 33 _ TNF TNF Cluster 3 1 _ Cluster 4 1 _ 25 _ 33 _ TA+TNF TA+TNF 1 _ 1 _ GPCPD1 CCL2 chr6: chr22: 77 _ 35 _ DMSO DMSO 1 _ 77 _ 1 _ 35 _ TA TA 1 _ 1 _ 77 _ 35 _ TNF Cluster 5 Cluster 6 TNF 1 _ 1 _ 77 _ 35 _ TA+TNF TA+TNF 1 _ 1 _ TNFAIP3 DGCR6 2 Supplementary Figure 1.
    [Show full text]
  • Single Cell Regulatory Landscape of the Mouse Kidney Highlights Cellular Differentiation Programs and Disease Targets
    ARTICLE https://doi.org/10.1038/s41467-021-22266-1 OPEN Single cell regulatory landscape of the mouse kidney highlights cellular differentiation programs and disease targets Zhen Miao 1,2,3,8, Michael S. Balzer 1,2,8, Ziyuan Ma 1,2,8, Hongbo Liu1,2, Junnan Wu 1,2, Rojesh Shrestha 1,2, Tamas Aranyi1,2, Amy Kwan4, Ayano Kondo 4, Marco Pontoglio 5, Junhyong Kim6, ✉ Mingyao Li 7, Klaus H. Kaestner2,4 & Katalin Susztak 1,2,4 1234567890():,; Determining the epigenetic program that generates unique cell types in the kidney is critical for understanding cell-type heterogeneity during tissue homeostasis and injury response. Here, we profile open chromatin and gene expression in developing and adult mouse kidneys at single cell resolution. We show critical reliance of gene expression on distal regulatory elements (enhancers). We reveal key cell type-specific transcription factors and major gene- regulatory circuits for kidney cells. Dynamic chromatin and expression changes during nephron progenitor differentiation demonstrates that podocyte commitment occurs early and is associated with sustained Foxl1 expression. Renal tubule cells follow a more complex differentiation, where Hfn4a is associated with proximal and Tfap2b with distal fate. Mapping single nucleotide variants associated with human kidney disease implicates critical cell types, developmental stages, genes, and regulatory mechanisms. The single cell multi-omics atlas reveals key chromatin remodeling events and gene expression dynamics associated with kidney development. 1 Renal, Electrolyte, and Hypertension Division, Department of Medicine, University of Pennsylvania, Perelman School of Medicine, Philadelphia, PA, USA. 2 Institute for Diabetes, Obesity, and Metabolism, University of Pennsylvania, Perelman School of Medicine, Philadelphia, PA, USA.
    [Show full text]
  • Expression Pattern of the Class I Homeobox Genes in Ovarian Carcinoma
    J Gynecol Oncol Vol. 21, No. 1:29-37, March 2010 DOI:10.3802/jgo.2010.21.1.29 Original Article Expression pattern of the class I homeobox genes in ovarian carcinoma Jin Hwa Hong1, Jae Kwan Lee1, Joong Jean Park2, Nak Woo Lee1, Kyu Wan Lee1, Jung Yeol Na1 Departments of 1Obstetrics and Gynecology, 2Physiology, Korea University College of Medicine, Seoul, Korea Objective: Although some sporadic reports reveal the link between the homeobox (HOX) genes and ovarian carcinoma, there is no comprehensive analysis of the expression pattern of the class I homeobox genes in ovarian carcinoma that determines the candidate genes involved in ovarian carcinogenesis. Methods: The different patterns of expression of 36 HOX genes were analyzed, including 4 ovarian cancer cell lines and 4 normal ovarian tissues. Using a reverse transcription-polymerase chain reaction (RT-PCR) and quantification analysis, the specific gene that showed a significantly higher expression in ovarian cancer cell lines than in normal ovaries was selected, and western blot analysis was performed adding 7 ovarian cancer tissue specimens. Finally, immunohistochemical and immunocytochemical analyses were performed to compare the pattern of expression of the specific HOX gene between ovarian cancer tissue and normal ovaries. Results: Among 36 genes, 11 genes had a different level of mRNA expression between the cancer cell lines and the normal ovarian tissues. Of the 11 genes, only HOXB4 had a significantly higher level of expression in ovarian cancer cell lines than in normal ovaries (p=0.029). Based on western blot, immunohistochemical, and immunocytochemical analyses, HOXB4 was expressed exclusively in the ovarian cancer cell lines or cancer tissue specimens, but not in the normal ovaries.
    [Show full text]
  • Genetic Mechanisms of Pitx1 Action in Murine Hindlimb Development
    1 Genetic mechanisms of Pitx1 action in murine hindlimb development Stephen Nemec, Division of Experimental Medicine, McGill University, Montreal August 2017 A thesis submitted to McGill University in partial fulfillment of the degree of PhD © Stephen Nemec 2017 2 Table of Contents Contents Page Abstract 4 Acknowledgements 8 Abbreviations 9 Preface – Contribution to knowledge 10 Contribution of authors 11 Introduction 13 Figures 1 and 2: Basics of limb anatomy and development 13 Evolutionary origins of the limb 14 Chick embryology and the early study of the limb 16 Molecular limb development 21 Hox genes – Engines of limb development 25 The genetics of forelimb vs. hindlimb development 30 Pitx1: major regulator of HL-specific pattern 30 Tbx4 and Tbx5 – limb-type-specific Tbox paralogs 35 Tbx4, Tbx5 and developmental anomalies in humans 41 Pitx1 Tbx4 42 Purpose and Aims 45 Pitx1 directly modulates the core limb development 46 program to implement hindlimb identity Contributions 47 Abstract 48 Introduction 49 Results 51 Discussion 60 Materials and Methods 65 Figure Legends 69 Figures 74 Interlude A – From Sox9 to signaling 89 Shh signaling influences the 91 phenotype of Pitx1-/- hindlimbs Contributions 92 Abstract 93 Introduction 94 Results 96 Discussion 98 Materials and Methods 100 Figure Legends 102 Figures 104 Interlude B – Regulatory complexity and developmental constraints 110 3 Table of Contents (continued) Contents Page Regulatory integration of Hox factor action with 111 Tbox factors in limb development Contributions 112 Abstract 113 Introduction 114 Results 116 Discussion 124 Materials and Methods 128 Figure Legends 134 Figures 141 Discussion 152 Evolutionary constraints determine the 152 developmental roles of limb-type-specific genes Future Directions 156 References 159 4 Abstract In tetrapods, the forelimbs (FL) and hindlimbs (HL) emerge from the flank of the developing embryo as buds of mesenchyme sheathed in ectoderm.
    [Show full text]
  • Evidence for a Role of Developmental Genes in the Origin of Obesity and Body Fat Distribution
    Evidence for a role of developmental genes in the origin of obesity and body fat distribution Stephane Gesta*, Matthias Blu¨ her†, Yuji Yamamoto*, Andrew W. Norris*, Janin Berndt†, Susan Kralisch†, Jeremie Boucher*, Choy Lewis*, and C. Ronald Kahn*‡ *Joslin Diabetes Center and Harvard Medical School, Boston, MA 02215; and †Department of Internal Medicine III, University of Leipzig, 04103 Leipzig, Germany Contributed by C. Ronald Kahn, March 9, 2006 Obesity, especially central obesity, is a hereditable trait associated In the present study, we have explored the hypothesis that with a high risk for development of diabetes and metabolic patterns of fat distribution and, perhaps, to some degree, obesity disorders. Combined gene expression analysis of adipocyte- and itself may have a developmental genetic origin. Indeed, we find preadipocyte-containing fractions from intraabdominal and sub- major differences in expression of multiple genes involved in cutaneous adipose tissue of mice revealed coordinated depot- embryonic development and pattern specification between adipo- specific differences in expression of multiple genes involved in cytes taken from intraabdominal and s.c. depots in rodents and embryonic development and pattern specification. These differ- humans. We also demonstrate similar differences in the stromo- ences were intrinsic and persisted during in vitro culture and vascular fraction (SVF)-containing preadipocytes and that these differentiation. Similar depot-specific differences in expression of differences persist in culture. Most importantly, we demonstrate developmental genes were observed in human subcutaneous ver- that some of these developmental genes exhibit changes in expres- sus visceral adipose tissue. Furthermore, in humans, several genes sion that are closely correlated with the level of obesity and the exhibited changes in expression that correlated closely with body pattern of fat distribution.
    [Show full text]