Characterisation of the Genomic Landscape of CRLF2‐Rearranged Acute Lymphoblastic Leukemia

Characterisation of the Genomic Landscape of CRLF2-

rearranged Acute Lymphoblastic Leukemia

Lisa J Russell1*, Lisa Jones1, Amir Enshaei1, Stefano Tonin1, Sarra L Ryan1, Jeyanthy

Eswaran1 , Sirintra Nakjang2, Elli Papaemmanuil3,4, Jose M C Tubio4, Adele K Fielding5,

Ajay Vora6, Peter J Campbell4, Anthony V Moorman1, and Christine J Harrison1

1 Leukaemia Research Cytogenetics Group, Northern Institute for Cancer Research,

Newcastle University, NewcastleuponTyne, UK

2 Bioinformatics Support Unit, Newcastle University, NewcastleuponTyne, UK

3 Memorial Sloan Kettering Cancer Center, USA

4 Cancer Genome Project, Wellcome Trust Sanger Institute, Hinxton, UK

5 Research Department of Haemaoloty, UCL Cancer Institute, London, UK

6 Department of Haematology, Sheffield Children’s Hospital, Sheffield, UK;

AVM and CJH contributed equally to this study

Running Title – Genomic landscape of CRLF2 rearranged leukemia

Correspondence to: Dr Lisa J Russell, Wolfson Childhood Cancer Research Centre,

Northern Institute for Cancer Research, Newcastle University, Level 6, Herschel Building,

Brewery Lane, Newcastle upon Tyne, NE1 7RU, [email protected].

Acknowledgements

Support by: The Kay Kendall Leukaemia Fund, Leuka, European Haematology Association

and Bloodwise (formerly Leukaemia and Lymphoma Research)

This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an ‘Accepted Article’, doi: 10.1002/gcc.22439

Deregulated expression of the type I cytokine receptor, CRLF2, is observed in 515% of precursor Bcell acute lymphoblastic leukaemia (BALL). We aimed to determine the clinical and genetic landscape of those with IGH-CRLF2 or P2RY8-CRLF2 (CRLF2r) using multiple genomic approaches. Clinical and demographic features of CRLF2r patients were characteristic of BALL. Patients with IGH-CRLF2 were older (14yrs v 4yrs, P<0.001), while the incidence of CRLF2r among Down syndrome patients was high (50/161, 31%).

CRLF2r cooccurred with primary chromosomal rearrangements but the majority (111/161,

69%) had Bother ALL. Copy number alteration (CNA) profiles were similar to Bother

ALL, although CRLF2r patients harboured higher frequencies of IKZF1 (60/138, 43% v

77/1351, 24%) and BTG1 deletions (20/138, 15% v 3/1351, 1%). There were significant differences in CNA profiles between IGH-CRLF2 and P2RY8-CRLF2 patients: IKZF1

(25/35, 71% v 36/108, 33%, P<0.001), BTG1 (11/35, 31% v 10/108, 9%, P =0.004) and

ADD3 deletions (9/19, 47% v 5/38, 13%, P =0.008). A novel gene fusion, USP9X-DDX3X, was discovered in 10/54 (19%) of patients. Pathway analysis of the mutational profile revealed novel involvement for focal adhesion. Although the functional relevance of many of these abnormalities are unknown, they likely activate additional pathways, which may represent novel therapeutic targets.

John Wiley & Sons

INTRODUCTION

Acute lymphoblastic leukaemia (ALL) is defined by primary chromosomal abnormalities that

drive disease progression, with impact on prognosis and treatment stratification.(Moorman

2012) One quarter of patients, known as Bother ALL, lack a known primary

abnormality.(Moorman 2012) A group of Bother patients, known as Phlike/BCR-ABL1like,

constitute 1015% of BALL. Although they lack the BCR-ABL1 fusion, their gene

expression profile is similar to BCR-ABL1 positive ALL.(Den Boer, et al. 2009; Mullighan, et

al. 2009b) They are characterised by high expression of the type I cytokine receptor,

cytokine receptorlike factor 2 (CRLF2), the presence of tyrosine kinase fusion genes and

mutations of genes within the JAK/STAT and RAS signalling pathways.(Roberts, et al. 2014a)

Deregulated expression of CRLF2 (CRLF2d) is observed in 2750% of patients with BCR-

ABL1like disease (515% of BALL).(Moorman, et al. 2012; Roberts, et al. 2014a; Russell,

et al. 2009; Russell, et al. 2014) Deregulation occurs via three genomic rearrangements

(CRLF2r): a cryptic reciprocal translocation with the immunoglobulin heavy chain locus

(IGH); an interstitial deletion within the pseudoautosomal region (PAR1) of chromosomes X

and Y (P2RY8-CRLF2); rare but recurrent CRLF2 mutations. All three CRLF2r result in

overexpression of CRLF2 mRNA and protein; however, alone they are insufficient to cause

overt leukaemia.(Mullighan, et al. 2009a; Russell, et al. 2009) Interestingly, studies

identifying CRLF2d patients by mRNA and protein expression have shown that some

patients do not harbour one of the three known genomic rearrangements.(Yano, et al. 2014)

The cause of this overexpression is currently unknown. The incidence of CRLF2r is high in

patients with Down syndrome ALL (DSALL) (>50%) and intrachromosomal amplification

of chromosome 21 (iAMP21) (25%),(Chen, et al. 2012; Harvey, et al. 2010; Haslam, et al.

2011; Mullighan, et al. 2009a; Russell, et al. 2009) with other established cytogenetic

John Wiley & Sons

abnormalities rarely associated. However, data indicating whether CRLF2r is a primary or secondary event are scarce.(Morak, et al. 2012) It is well documented that deletions of genes involved in Bcell differentiation and cell cycle control are recurrent in these patients.(Buitenkamp, et al. 2012; Moorman, et al. 2012; Russell, et al. 2009; Schwab, et al.

2010) Mutations of the Janus kinase family, in particular JAK2, and mutations of IL7R, are also recurrently observed and together result in IL3 independent growth of mouse BaF3 cells.(Haslam, et al. 2011; Shochat, et al. 2011) Recently, mutations affecting other kinase genes have also been reported in CRLF2d ALL.(Roberts, et al. 2014a; Roberts, et al. 2012)

Both BCR-ABL1like and CRLF2d ALL have been associated with poor outcome and increased risk of relapse.(Den Boer, et al. 2009; Harvey, et al. 2010; Mullighan, et al. 2009b)

Although MRDdirected treatment intensification improves survival,(Roberts, et al. 2014b) outcome for CRLF2d ALL remains less favourable than for patients with good risk cytogenetics. Hence, novel therapeutic strategies are required in order to improve survival and quality of life. In this study, we have explored the clinical and genetic landscape of patients with known CRLF2 rearrangements. The aims of this study were: 1) to identify the clinical and genomic differences that may exist between patients with IGH or P2RY8 driven overexpression of CRLF2; 2) to undertake pathway analysis of whole genome (WGS) and whole exome sequencing (WES) data to highlight additional pathways that may cooperate with rearrangements of CRLF2.

MATERIALS AND METHODS

Patient Samples

We identified 172 patients with CRLF2-r ALL by fluorescence in situ hybridisation

(FISH) and multiplex ligationdependent probe amplification (MLPA) from the following

John Wiley & Sons

trials: UKALL97/99 (n=68), UKALL2003 (n=75), UKALLXI (n=6) and UKALLXII (n=26)

(Supplementary Table 1). The patients included in this study were identified by screening for

CRLF2r (Ensor, et al. 2011; Moorman, et al. 2014; Moorman, et al. 2012; Russell, et al.

2014; Schwab, et al. 2013) and were representative of the trial. Demographic and clinical

details were collected by the Clinical Trial Service Unit (CTSU, Oxford University, UK).

Each contributing centre obtained relevant ethical approval. Informed consent was obtained

in accordance with the Declaration of Helsinki. Diagnostic immunophenotypes were

collected centrally with review of original reports for 50 patients (Supplementary Table 2).

Cytogenetics and Fluorescence In Situ Hybridisation

For details on genetic testing, see Supplementary Figure 1. Karyotype data were collected

from UK cytogenetics laboratories (Supplementary Table 1). Cytogenetic analysis and FISH

were carried out on the same diagnostic patient samples. The involvement of IGH was

determined using the LSI IGH Dual Color BreakApart Rearrangement Probe (Abbott

Molecular, Green Oaks, IL).(Jeffries, et al. 2014; Russell, et al. 2014) Additional FISH

probes used in this study are shown in Supplementary Table 3. Five control slides of fixed

cells from normal individuals were hybridised with all probe combinations (Russell, et al.

2009) (Supplementary Table 3) to determine the cutoff percentages for false positive results

(+/ 3 x standard deviations). A minimum of 100 nuclei were scored by eye for each FISH

test by two independent analysts. When combining three or more florophores, capture and

scoring was carried out using an automated Olympus BX61 8bay stage florescence

microscope. Images were analysed using the CytoVision 7.1 SPOT counting system (Leica

Microsystems, Gateshead, UK).

Multiplex Ligation-Dependent Probe Amplification

John Wiley & Sons

Copy number alterations (CNA) were investigated (n=154) by MLPA using the

SALSA MLPA kit P335 (MRC Holland, Amsterdam, Netherlands) according to manufacturer’s guidelines as previously reported.(Schwab, et al. 2010)

Affymetrix Genome-Wide Human SNP6.0 Array

Sufficient material was available from 26 (representitive for cohort) CRLF2r patients

(15 with matched germline sample) for Affymetrix GenomeWide Human SNP6.0 analysis, performed by AROS Applied Biotechnology A/S (Aarhus, Denmark). Copy number alterations were analysed using Genotyping Console (Affymetrix software) with additional manual curation (GEO accession number GSE83272).

Low Depth Paired-End and Whole Exome Sequencing

Sufficient diagnostic DNA was available from 11 CRLF2r patients (representitive of cohort and all patients have SNP analysis completed), which was prepared for library construction (300500 bp), flow cell preparation and cluster formation using the Illumina no

PCR library protocol (Illumina Inc, San Diego, CA), AND50 bp reads were performed using the Illumina Genome Analyzer IIx instrument following the manufactures guidelines.

Structural variants were selected as previously reported.(Papaemmanuil, et al. 2014)

Sufficient diagnostic and germline DNA from the same 11 patients was prepared for

Illumina pairedend sequencing with subsequent exome enrichment using the Agilent

SureSelect Human All Exon 50MB kit (Agilent Technologies LTD, Berkshire, UK).

Guidelines for the Illumina Genome Analyzer IIx instrument were followed for flowcell preparation, cluster generation and pairedend sequencing of 75bp reads.(Li and Durbin

2010; Papaemmanuil, et al. 2014) Whole genome and exome sequencing data are available using EGA accession numbers EGAD00001002007 and EGAD00001002008, respectively.

Structural Variant Detection and Validation

John Wiley & Sons

Sequencing reads were mapped to the human genome (Hg19) with a minimum and mean fold

coverage of 5.61 and 8.46, respectively. The algorithm BRASS (NikZainal, et al. 2012) was

used to identify groups of ≥2 discordantly mapped (distance or orientation) pairedend reads.

Rearrangements observed in 5 or more pairedend reads were validated (excluding those

where both reads were in the same intron or outside the coding regions) by conventional PCR

and Sanger sequencing using diagnostic and remission DNA. If a rearrangement failed to

validate using two sets of primers, repeated twice over a temperature gradient, it was

regarded as a fail. Breakpoints within immunoglobulin loci were not validated. MLPA and

SNP data were also used to validate CNA. A total of 476 SV were identified from WGS of 11

patient with CRLF2d ALL (average 43 SV/patient, range 2290), including 416

intrachromosomal and 57 interchromosomal rearrangements.

Mutation and in/del Detection and Validation

A total of 458 SNVs and in/dels were identified from the same 11 patients. A

minimum sequencing coverage of 30fold was required for each sample. Default setting of

BWA (Li and Durbin 2010) and CaVEMan was used to align the reads and detect somatically

acquired single nucleotide substitutions as previously reported (Papaemmanuil, et al. 2014).

The algorithm PINDEL (Raine, et al. 2015) was used to detect insertion/deletion (in/del)

(Papaemmanuil, et al. 2014). Conventional PCR was used to validate the substitutions, with

subsequent 454 pyrosequencing for confirmation (Papaemmanuil, et al. 2014). Conventional

PCR validated the in/dels, with subsequent sequencing using the ABI terminator Cycle

Sequencing Kit (Applied Biosystems) to confirm each in/del (Papaemmanuil, et al. 2014).

Targeted JAK Mutation Screening

Primers were used to amplify exon 14 of the JAK2 and JAK1 genes only(Kearney, et

al. 2009) and Sanger sequencing confirmed the presence of the mutation. As far as we are

John Wiley & Sons

aware CRLF2 mutations have not been reported in patients with IGH-CRLF2 or P2RY8-

CRLF2, therefore screening for these mutations was not carried out.

Statistical Analysis

The distribution of categorical variables was examined using Fisher’s exact test. Due to the investigative nature of this analysis, we did not apply stringent multiple comparisons adjustment (all tests were conducted at the 5% significance level). All analyses were performed using Intercooled Stata 14.1 for Windows (Stata Corporation, College Station,

TX).

Pathway Analysis

Pathway mapping was performed on a defective gene list identified for each sample.

A gene was considered to be defective if: 1) it contained at least one nonsilent mutation, 2) was located at the break point junction of the identified structural variants and 3) was located within a defective regions (detected either from SNP6 or WGS) of no more than 1MB in size.

Gene lists from the defective regions were retrieved from Human reference genome hg19 via biomart (Durinck, et al. 2009) and defective gene lists were mapped to KEGG pathways(Kanehisa and Goto 2000) using R/Bioconductor package KEGGREST

(Tenenbaum D. KEGGREST: Clientside REST access to KEGG. R package version 1.11.0).

Pathway enrichment analysis was determined using hypergeometric test. The test is based on the probability of observing x number of genes from a given pathway as being defective, given a process of sampling without replacement of all proteincoding genes (20805) annotated in the human genome (GRCh37.p13, INSDC Assembly GCA_000001405.14, Feb

2009). This gene list is considered as a representative gene set that are mutated among

CRLF2r cases. The basic assumption for the analysis is that mutations among CRLF2r cases arise randomly, so the enrichment test is used as a statistical method to test whether there is any selective pressure that makes mutations occur in particular pathways more often 8

John Wiley & Sons

than expect by chance. Enrichment tests were performed with the defective gene lists from all

samples as well as for each subtype separately.

RESULTS

The Clinical and Demographic Features of CRLF2-r Patients are Characteristic of B-

ALL

All patients with CRLF2r were BALL (n=172): IGH-CRLF2 (n=47) and P2RY8-

CRLF2 (n=125), median age 5 years (range 160yrs), male predominance (59%), 70% had

WBC <50x106/l (Supplementary Table 4; Fig 1 A). The age distribution was similar to B

ALL overall, with the majority <10 years (71%)(Moorman, et al. 2014). Median age (4yrs v

14yrs, P<0.001), WBC (25% v 43% with WBC >50x106/L, P =0.016) and percentage NCI

high risk (38% v 77%, P <0.001) differed significantly between P2RY8-CRLF2 and IGH-

CRLF2, respectively (Supplementary Table 4; Fig 1 A). We confirmed the high frequency of

DSALL among CRLF2r ALL (31%, 50/161) (DS status not available for 11 patients), with

more DSALL patients harbouring the P2RY8-CRLF2 fusion (P2RY8-CRLF2, n=41 v IGH-

CRLF2 n=9, 35% v 20%, respectively, P=0.087) (Supplementary Table 4; Fig 1 B).

Cytogenetic analysis was successful in 160 CRLF2r patients. Normal karyotype was

observed in 51 (36%) patients. The majority, including those with DSALL, were classified

as Bother ALL (Fig 1 B and C); however, primary, established chromosomal abnormalities

cooccurred in 22% (Supplementary Table 1): ETV6-RUNX1 (n=3), BCR-ABL1 (n=5), high

hyperdiploidy (n=12), and iAMP21 (n=17). All but one of these patients had P2RY8-CRLF2

(n=36) (Fig 1 B). No patients had t(1;19)(q23;p13), KMT2A (MLL) rearrangements or ABL

class fusions involving ABL1, ABL2, PDGFRB and CSF1R(David O’Connor ; Roberts, et al.

2014a; Schwab, et al. 2016).

John Wiley & Sons

Additional Chromosomal Abnormalities in CRLF2-r Patients

Recurrent somatic structural and numerical aberrations were present in 109 patients

(Supplementary Fig 2), including gains of chromosomes X (37/83, 45%), 21 (13/83, 16%), 17

(7/83, 8%) and 9 (4/83, 5%), in patients with and without DS. The gain of chromosome X was significantly enriched in CRLF2-r patients, particularly among DSALL, when compared to a cohort of Bother patients, where only 5 of 1019 (5%) patients had gain of X

(Supplementary Table 5; Fig 1 C).

Copy number alterations (CNA) were detected among patients with CRLF2r ALL by

MLPA (n=154) and SNP6.0 arrays (n=26) (Table 1; Supplementary Table 1 and 67; Fig 1

B). Deletions of IKZF1, CDKN2A/B, PAX5 and BTG1 were present in 43% (n=60), 38%

(n=52), 30% (n=41) and 14% (n=20) of cases, respectively. Deletions of IKZF1 and BTG1 occurred at higher incidences than seen in Bother ALL at 23% and 2%, respectively(Schwab, et al. 2013). Deletions of IKZF1 (71% v 33% P<0.001) and BTG1

(31% v 9%, P=0.004) were more frequent in IGH-CRLF2 than P2RY8-CRLF2 patients, respectively (Fig 1 B). There was a lower incidence of PAX5 and IKZF1 deletions in patients with DSassociated CRLF2r ALL compared to those without DS (18% v 35% P <0.047 and

23% v 53%, P =0.003, respectively) (Fig 1 C, Supplementary Table 5). In fact, CRLF2r DS patients were more likely to have none of these deletions (48% v 15%, P <0.001), with 89%

(39/44) having fewer than three gene deletions.

Other recurrent CNA observed from SNP6.0 arrays included: the histone cluster at

6p22.2 (n=7), VPREB1 (n=6), ADD3 (n=5), BTLA (n=4), SLX4IP (n=3), SERP2 and

TSC22D1 (n=3) and PBX3 (n=2). Publically available SNP6.0 data (Mullighan, et al. 2007) showed these deletions to be present in other ALL subtypes: ADD3, n=9 (4.69%), SLX4IP, n=9 (4.69%), BTLA, n=13 (6.77%). To verify their frequency in CRLF2r ALL, we screened additional samples by FISH, as fixed cells were the most abundant source of patient material, 10

John Wiley & Sons

that also allowed detection of low level populations. However, the resolution of FISH

restricted accurate detection of deletions <40 kb. Combined FISH and SNP6.0 data generated

incidences of; ADD3 (14/57, 25%), SLX4IP (13/44, 30%), SERP2 and TSC22D1 (7/55, 13%)

and PBX3 (16/56, 29%), with no difference in the prevalence between DS and nonDS

CRLF2r ALL. IGH-CRLF2 patients had a higher incidence of ADD3 deletions (46% v 13%,

IGH v P2RY8, P=0.008) (Supplementary Table 6; Fig 1 B).

A Novel Fusion Between USP9X and DDX3X

An interstitial deletion of chromosome subband Xp11.4, fusing USP9X to DDX3X

(Supplementary Fig 3 A), was observed in 2/26 cases by SNP6.0 arrays and 7/24 cases by

FISH, including one DS patient, giving an incidence of 19% (Supplementary Fig 3 B). No

cases were identified among the publically available SNP6.0 data(Mullighan, et al. 2007).

FISH revealed that the fusion was present in both minor and major clones (891% of nuclei)

in both male (n=4) and female patients (n=5). All male patients had either an additional copy

of normal chromosome X or derived X involved in the CRLF2r. It was identified in patients

with both IGH and P2RY8 involvement (4 v 5, respectively). Realtime PCR confirmed that

the fusion was inframe and was expressed at the mRNA level (Supplementary Fig 3 C).

Sanger sequencing verified fusion of USP9X exon 31 to exon 2 of DDX3X (Supplementary

Fig 3 D). The DNA breakpoint sequence from three patients consistently fell within intron 31

of USP9X (covering a 3.5 kb region) and intron 1 of DDX3X (covering a 2.1kb region).

Somatically Acquired Structural Variants are Rare, while the Incidence of Kinase and

JAK Mutations is High in CRLF2-r ALL

The somatic nature of 137 structural variants (SV) (6 tandem duplication, 104

deletion, 14 inversion and 13 translocationtype rearrangements) were validated, providing

an average of 12.7 SV per patient, irrespective of DS status (Fig 2; Supplementary Table 8;

Supplementary Fig 4). No novel recurrent rearrangements or fusion genes typical of Bother 11

John Wiley & Sons

ALL were identified in these 11 patients. There was no difference in the number of SV between patients with IGH- and P2RY8-CRLF2 and also between patients with and without

DS.

WES from the same 11 patients detected 218 mutations, 187 point mutations and 31 in/dels events. Among the point mutations, 122 were predicted as possibly disease causing by

PolyPhen2 and Mutation Taster (Fig 3; Supplementary Table 9; Supplementary Fig 4). The average number of mutations was 19.8 (point mutations alone: 17) per patient, with no difference between IGH- and P2RY8-CRLF2 (P=0.85) or those with or without DS (P=0.41).

In the majority of patients, at least half of the mutations were at variant allele frequency

(VAF) higher than 30%; only one patient (#11706) had a higher number of mutations at a

VAF of <20%. Recurrent mutations were identified in CACNA1D, IKZF1, JAK2, IL7RA,

NRAS and USH2A (n=2 each). Ten patients had missense or nonsense point mutations in genes with protein kinase functions (Table 1), with six patients harbouring either a mutation or CNA in two or more kinase genes.

Targeted screening for JAK2 (n=75) and JAK1 (n=36) mutations identified an incidence of 35% and 14%, respectively. There was no difference in the number of JAK1 or

JAK2 mutations between IGH- and P2RY8-CRLF2 (17% v 19%, P=0.46) or DS and nonDS patients (JAK2 Ex14, 44% v 35%, P=0.613; JAK1 Ex14, 17% v 11%, P=1) (Supplementary

Table 5; Fig 1 B and C). Due to selective screening of only exon 14 in the majority of patients, these numbers may represent an underestimate of the true incidence of JAK1 and

JAK2 mutations in CRLF2r ALL.

Involvement of Cell Adhesion Mutations in CRLF2-r Patients

WES data identified ≥1 somatic point mutation in a gene(s) involved in cell adhesion in eight patients including; NPNT, ITGB7, COL3A1, ITGA7, ITGBL1, DST, LAMC2, PTPRT,

John Wiley & Sons

MAPK10, CCND3, CTNNA2, CTNND2 and LAMA1 in single patients and USH2A in two

patients (Table 1).

Pathway Analysis Reveals Deregulation in Known and Novel Pathways

Pathway analysis revealed those pathways likely to be deregulated due to the presence

of mutations (not including silent mutations), in/dels and focal SV <1 Mb in size. The top ten

pathways in which defective genes were most frequently identified are depicted in Figure 3.

Unsurprisingly, JAK-STAT5 involvement was seen in all patients. Other pathways included

those involved in cancer, cytokinecytokine interaction, haematopoietic cell lineage and

MAPK signalling. Interestingly, the focal adhesion pathway was also recurrently involved.

DISCUSSION

In this study investigating the genomic landscape of CRLF2r ALL, we have

confirmed the high incidence of CRLF2r in DSALL, demonstrated its coexistence with

other primary chromosomal rearrangements and enrichment of specific chromosomal gains

and deletions of IKZF1, BTG1, ADD3, SERP2, TSC22D1, SLX4IP and PBX3. There were

significant differences in CNA profiles between P2RY8-CRLF2 and IGH-CRLF2 patients

with an increased incidence of IKZF1, BTG1 and ADD3 deletions and a higher age at

diagnosis being observed in the latter. These disparities correlate with reported differences in

outcome, where for example older age and IKZF1 status drive the inferior prognosis observed

in adult IGH-CRLF2.(Moorman, et al. 2012) A fifth of CRLF2r patients harbour a primary

chromosomal abnormality with all but one being P2RY8-CRLF2, suggesting a cooperating

role for CRLF2 deregulation. Interestingly, the sole patient with IGH-CRLF2 and a primary

abnormality had the BCR-ABL1 fusion in a separate clone.(Jeffries, et al. 2014) Collectively,

these data do not imply that IGH and P2RY8 are driving distinct subgroups but rather that

CRLF2d may play a dual role as both a primary and cooperating driver in ALL, with the

John Wiley & Sons

latter being more prominent among P2RY8-CRLF2 patients. This model is akin the BCR-

ABL1 fusion, which although predominatly a primary driver, has also been reported as a secondary abnormality.(Jeffries, et al. 2014; Miura, et al. 1994) Independent pathway analysis of the aberration profile of IGH-CRLF2 and P2RY8-CRLF2 patients found enrichment of all top ten pathways in the P2RY8-CRLF2 patients and only a subset of pathways in IGH-CRLF2 patients. Previous studies have reported the involvement of MAPK signaling in CRLF2r ALL.(Tasian, et al. 2012) This pathway was not significantly enriched in our IGH-CRLF2 patients; however, this observation was based on only four patients and thus requires further validation. WES identified a frequency of 20 mutations per patient, similar to iAMP21ALL,(Ryan, et al. 2016) but higher than other subgroups,(Andersson, et al. 2015; Holmfeldt, et al. 2013; Papaemmanuil, et al. 2014; Paulsson, et al. 2015). The high

VAF of kinase mutations suggested that they were clonal and were likely acquired early in disease development. Mutations in ERBB4, TTBK1 and STK38L occurred within the catalytic domain with potential for constitutive activation. These mutations may activate STAT5

(ERBB4), deregulate alternate pathways including, NFKB and chromosome alignment pathways (TTBK1), or regulate the Hippo signalling pathway (STK38L) by binding MOB kinase activators, which have tumour suppressor roles. Taken together, these data imply that

CRLF2r may define a distinct subgroup of Bother ALL.

For the first time, we have implicated a role for USP9X and DDX3X in CRLF2r ALL.

This USP9X-DDX3X fusion removes the ubiquitin carboxylterminal hydrolase domain of

USP9X, the promoter of DDX3X, multiple regulatory elements, MIR76412 and noncoding

RNAs. The involvement of USP9X and DDX3X in cancer is known(Brandimarte, et al. 2014;

Cox, et al. 2014; Ojha, et al. 2015; Oosterkamp, et al. 2014; Robinson, et al. 2012; Schmitz, et al. 2012; Yan, et al. 2014) and another translocation involving USP9X have been reported in a BCR-ABL1like ALL patient without CRLF2r.(Roberts, et al. 2014a) In keeping with 14

John Wiley & Sons

the emerging functions of USP9X, its overexpression has been reported in BALL, suggesting

an oncogenic role.(Zhou, et al. 2015) Knockdown of USP9X sensitises both prednisolone

sensitive and resistant cell lines to glucocorticoid (GC)induced apoptosis, suggesting that

reduced levels of USP9X may sensitise them to prednisolone treatment.(Zhou, et al. 2015)

With the success of targeted approaches using tyrosine kinase inhibitors (TKI) in

BCR-ABL1-positive disease, there is clear rational to apply similar targeted approaches to

other ALL subtypes. CRLF2r activate targetable pathways, including JAK-STAT, PI3K and

MAPK signalling, and many groups are now assessing the efficacy of inhibitors to these

pathways. The first inhibitor to be tested in CRLF2r ALL was the JAK1/2 inhibitor,

Ruxolitinb.(Maude, et al. 2012) Whilst this study showed a response in vivo, greater effect

was observed in JAKactivated, nonCRLF2r ALL. Evidence of resistance to type I

inhibitors in model systems of BALL is already driving the development of type II JAK

inhibitors.(Wu, et al. 2015) Targeting of mulitple pathways was an approach taken by

Suryani et al, (2015) in assessing the JAK inhibitor, AZD1480, alone and in combination

with the MEK inhibitor, Selumetinib. Whilst this study showed a strong antileukaemic effect

in vitro, only modest effects were seen in vivo, an important consideration for future

preclinical testing, which highlights the need to identify other common targets to provide

further options for more patients. In addition to JAK-STAT, we have identified several

deregulated pathways in CRLF2r ALL, for example, focal adhesion signalling, one which

has not previously been implicated in this subtype of ALL and was enriched in patients with

both IGH and P2RY8-CRLF2 ALL.

Mutations within genes controlling cell adhesion would seem to be more relevant in

solid tumours, where such lesions would provide cells with a migratory and metastatic

advantage. However, the presence of such mutations within the primary site may be

advantageous, where small amounts of local movement can alter tumour growth and 15

John Wiley & Sons

dispersal. In our study, 8 patients (72%) had one or more focal adhesion gene mutations; an incidence much higher than reported in other ALL subtypes (ETV6-RUNX1,

12%(Papaemmanuil, et al. 2014), Phlike nonCRLF2r, 15%(Roberts, et al. 2014a), low hypodiploidy, 5% (Holmfeldt, et al. 2013), high hyperdiploidy, 9.8% (Paulsson, et al. 2015),

KTM2A-rearranged infant ALL, 4.5%(Andersson, et al. 2015)). Mutated genes were specifically located within the lamininintegrinMAPK cell signalling axis. The laminins

(LAMA1 and LAMC2) and their receptor integrins (ITGA7, ITIBL1 and ITGB7) play a central role in cell proliferation and tumour cell invasiveness through their critical role in basement membrane adhesion.(Belkin and Stepp 2000) Although the functional consequence of these mutations in CRLF2d ALL remains to be determined, when laminin binding integrin signalling is altered, it activates downstream signalling kinases, such as FAK (focal adhesion kinase) and JUN (MAPK10)FOS, which impacts on cell proliferation and migration in various cancers.(Kim and Gumbiner 2015; Tafolla, et al. 2005) In a recent study, the presence of the Ikaros isoform 6 (IK6), IKZF1 haploinsuficiency or mutations in BCR-ABL1positive disease have been shown to increase expression of adhesion molecules and increased transcription of FAK, rendering these cells insensitive to tyrosine kinase inhibition.(Churchman, et al. 2015b) The application of inhibitors to FAK in patients with

BCR-ABL1positive ALL resulted in the same abrogation of adhesion and self renewal programmes.(Churchman, et al. 2015a) Interestingly, all 11 patients with sequencing data either showed mutation/CNA of IKZF1 or a mutation within a focal adhesion gene. Our data along with emerging literature in leukaemia highlight a role for the focal adhesion pathway in

CRLF2r ALL.

In summary, we show clear clinical and genomic differences between patients with

IGH- and P2RY8-CRLF2. We describe these rearrangements in the presence of other established cytogenetic abnormalities, suggesting a secondary role for CRLF2r in some 16

John Wiley & Sons

patients, akin to BCR-ABL1 positive disease. However, due to low patient numbers, we were

unable to ascertain any impact of P2RY8-CRLF2 on the prognosis of these patients. This co

occurrence needs to be further assessed in a larger patient cohort. The treatment of patients

across four independent trails precluded meaningful survival analysis between patients IGH

and P2RY8CRLF2. It is clear from our data that CRLF2r ALL is heterogeneous, requiring a

combination of genetic abnormalities in functionally relevant genes to cooperate with

deregulated expression of CRLF2. Although the functional relevance of some of the deletions

and mutations presented in this descriptive study are currently unknown, there are pointers to

activation of additional targetable pathways. There is a clear requirement for studies

addressing the biological effect of these aberrations, which together with the identification of

mutations in cell adhesion genes and a high incidence of IKZF1 deletions provide interesting

targets for preclinical testing. Inhibitors to the focal adhesion pathway, as one example, may

provide an insight into a new realistic therapeutic approach to improve outcome in CRLF2r

ALL.

ACKNOWLEDGEMENTS

The authors would like to thank member laboratories of the United Kingdom Cancer

Cytogenetic Group (UKCCG) for providing cytogenetic data and material. We are grateful to

all the members of the NCRI Haematological Oncology Adult ALL Subgroup and the NCRI

Childhood Cancer and Leukaemia Group (CCLG) Leukaemia Subgroup. Primary childhood

leukaemia samples used in this study were provided by the Bloodwise Childhood Leukaemia

Cell Bank working with the laboratory teams in the Bristol Genetics Laboratory, Southmead

Hospital, Bristol: Molecular Biology Laboratory, Royal Hospital for Sick Children, Glasgow:

Molecular Haematology Laboratory, Royal London Hospital, London: Molecular Genetics

Service and Sheffield Children’s Hospital, Sheffield. We also thank the Central England

HaematoOncology Research Biobank and the Newcastle Haematology Biobank for 17

John Wiley & Sons

providing material used in this study. Lisa J Russell has a John Goldman Fellowship from

Leuka and Elli Papaemmanuil has an EHA fellowship. Finally, we thank all the clinicians who entered patients into the trial and the patients and families who agreed to take part.

REFERENCES

Andersson AK, Ma J, Wang J, Chen X, Gedman AL, Dang J, Nakitandwe J, Holmfeldt L, Parker M, Easton J, Huether R, Kriwacki R, Rusch M, Wu G, Li Y, Mulder H, Raimondi S, Pounds S, Kang G, Shi L, Becksfort J, Gupta P, Payne-Turner D, Vadodaria B, Boggs K, Yergeau D, Manne J,

John Wiley & Sons

Song G, Edmonson M, Nagahawatte P, Wei L, Cheng C, Pei D, Sutton R, Venn NC, Chetcuti A, Rush A, Catchpoole D, Heldrup J, Fioretos T, Lu C, Ding L, Pui CH, Shurtleff S, Mullighan CG, Mardis ER, Wilson RK, Gruber TA, Zhang J, Downing JR, St. Jude Children's Research Hospital- Washington University Pediatric Cancer Genome P. 2015. The landscape of somatic mutations in infant MLL-rearranged acute lymphoblastic leukemias. Nat Genet 47(4):330- 337. Belkin AM, Stepp MA. 2000. Integrins as receptors for laminins. Microsc Res Tech 51(3):280-301. Brandimarte L, La Starza R, Gianfelici V, Barba G, Pierini V, Di Giacomo D, Cools J, Elia L, Vitale A, Luciano L, Bardi A, Chiaretti S, Matteucci C, Specchia G, Mecucci C. 2014. DDX3X-MLLT10 fusion in adults with NOTCH1 positive T-cell acute lymphoblastic leukemia. Haematologica 99(5):64-66. Buitenkamp TD, Pieters R, Gallimore NE, van der Veer A, Meijerink JPP, Beverloo HB, Zimmermann M, de Haas V, Richards SM, Vora AJ, Mitchell CD, Russell LJ, Schwab C, Harrison CJ, Moorman AV, van den Heuvel-Eibrink MM, den Boer ML, Zwaan CM. 2012. Outcome in children with Down's syndrome and acute lymphoblastic leukemia: role of IKZF1 deletions and CRLF2 aberrations. Leukemia 26(10):2204-2211. Chen I-M, Harvey RC, Mullighan CG, Gastier-Foster J, Wharton W, Kang H, Borowitz MJ, Camitta BM, Carroll AJ, Devidas M, Pullen DJ, Payne-Turner D, Tasian SK, Reshmi S, Cottrell CE, Reaman GH, Bowman WP, Carroll WL, Loh ML, Winick NJ, Hunger SP, Willman CL. 2012. Outcome modeling with CRLF2, IKZF1, JAK, and minimal residual disease in pediatric acute lymphoblastic leukemia: a Children's Oncology Group Study. Blood 119(15):3512-3522. Churchman ML, Jones L, Evans K, Richmond J, Shapiro IM, Pachter JA, Weaver DT, Houghton PJ, Smith MA, Lock RB, Mullighan CG. 2015a. Efficacy of Focal Adhesion Kinase Inhibition in Combination with Dasatinib in BCR-ABL1 Acute Lymphoblastic Leukemia. Blood 126(23):3766-3766. Churchman Michelle L, Low J, Qu C, Paietta Elisabeth M, Kasper Lawryn H, Chang Y, Payne-Turner D, Althoff Mark J, Song G, Chen S-C, Ma J, Rusch M, McGoldrick D, Edmonson M, Gupta P, Wang Y-D, Caufield W, Freeman B, Li L, Panetta John C, Baker S, Yang Y-L, Roberts Kathryn G, McCastlain K, Iacobucci I, Peters Jennifer L, Centonze Victoria E, Notta F, Dobson Stephanie M, Zandi S, Dick John E, Janke L, Peng J, Kodali K, Pagala V, Min J, Mayasundari A, Williams Richard T, Willman Cheryl L, Rowe J, Luger S, Dickins Ross A, Guy RK, Chen T, Mullighan Charles G. 2015b. Efficacy of Retinoids in IKZF1-Mutated BCR-ABL1 Acute Lymphoblastic Leukemia. Cancer Cell 28(3):343-356. Cox JL, Wilder PJ, Wuebben EL, Ouellette MM, Hollingsworth MA, Rizzino A. 2014. Context- dependent function of the deubiquitinating enzyme USP9X in pancreatic ductal adenocarcinoma. Cancer Biol Ther 15(8):1042-1052. David O’Connor AVM, Rachel Wade, Jeremy Hancock, Ronald MR Tan, Jack Bartram, John Moppett, Claire Schwab, Katharine Patrick, Christine J Harrison, Rachael Hough, Nick Goulden, Ajay Vora, Sujith Samarasinghe. Use of minimal residual disease assessment to redefine induction failure in pediatric acute lymphoblastic leukemia. Journal of Clinical Oncology Submitted. Den Boer ML, van Slegtenhorst M, De Menezes RX, Cheok MH, Buijs-Gladdines JG, Peters ST, Van Zutven LJCM, Beverloo HB, Van der Spek PJ, Escherich G, Horstmann MA, Janka-Schaub GE, Kamps WA, Evans WE, Pieters R. 2009. A subtype of childhood acute lymphoblastic leukaemia with poor treatment outcome: a genome-wide classification study. The Lancet Oncology 10(2):125-134. Durinck S, Spellman PT, Birney E, Huber W. 2009. Mapping identifiers for the integration of genomic datasets with the R/Bioconductor package biomaRt. Nat Protoc 4(8):1184-1191. Ensor HM, Schwab C, Russell LJ, Richards SM, Morrison H, Masic D, Jones L, Kinsey SE, Vora AJ, Mitchell CD, Harrison CJ, Moorman AV. 2011. Demographic, clinical, and outcome features of children with acute lymphoblastic leukemia and CRLF2 deregulation: results from the MRC ALL97 clinical trial. Blood 117(7):2129-2136. 19

John Wiley & Sons

Harvey RC, Mullighan CG, Chen I-M, Wharton W, Mikhail FM, Carroll AJ, Kang H, Liu W, Dobbin KK, Smith MA, Carroll WL, Devidas M, Bowman WP, Camitta BM, Reaman GH, Hunger SP, Downing JR, Willman CL. 2010. Rearrangement of CRLF2 is associated with mutation of JAK kinases, alteration of IKZF1, Hispanic/Latino ethnicity, and a poor outcome in pediatric B- progenitor acute lymphoblastic leukemia. Blood 115(26):5312-5321. Haslam K, Kelly J, Morris T, Connaghan G, Gilligan O, Browne P, Langabeer SE. 2011. Screening for CRLF2 overexpression in adult acute lymphoblastic leukemia. International Journal of Laboratory Hematology 33(6):e17-e19. Holmfeldt L, Wei L, Diaz-Flores E, Walsh M, Zhang J, Ding L, Payne-Turner D, Churchman M, Andersson A, Chen SC, McCastlain K, Becksfort J, Ma J, Wu G, Patel SN, Heatley SL, Phillips LA, Song G, Easton J, Parker M, Chen X, Rusch M, Boggs K, Vadodaria B, Hedlund E, Drenberg C, Baker S, Pei D, Cheng C, Huether R, Lu C, Fulton RS, Fulton LL, Tabib Y, Dooling DJ, Ochoa K, Minden M, Lewis ID, To LB, Marlton P, Roberts AW, Raca G, Stock W, Neale G, Drexler HG, Dickins RA, Ellison DW, Shurtleff SA, Pui CH, Ribeiro RC, Devidas M, Carroll AJ, Heerema NA, Wood B, Borowitz MJ, Gastier-Foster JM, Raimondi SC, Mardis ER, Wilson RK, Downing JR, Hunger SP, Loh ML, Mullighan CG. 2013. The genomic landscape of hypodiploid acute lymphoblastic leukemia. Nat Genet 45(3):242-252. Jeffries SJ, Jones L, Harrison CJ, Russell LJ. 2014. IGH@ translocations co-exist with other primary rearrangements in B-cell precursor acute lymphoblastic leukemia. Haematologica 99(8):1334-1342. Kanehisa M, Goto S. 2000. KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res 28(1):27-30. Kearney L, Gonzalez De Castro D, Yeung J, Procter J, Horsley SW, Eguchi-Ishimae M, Bateman CM, Anderson K, Chaplin T, Young BD, Harrison CJ, Kempski H, So CW, Ford AM, Greaves M. 2009. Specific JAK2 mutation (JAK2R683) and multiple gene deletions in Down syndrome acute lymphoblastic leukemia. Blood 113(3):646-648. Kim NG, Gumbiner BM. 2015. Adhesion to fibronectin regulates Hippo signaling via the FAK-Src-PI3K pathway. J Cell Biol 210(3):503-515. Li H, Durbin R. 2010. Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformatics 26(5):589-595. Maude SL, Tasian SK, Vincent T, Hall JW, Sheen C, Roberts KG, Seif AE, Barrett DM, Chen IM, Collins JR, Mullighan CG, Hunger SP, Harvey RC, Willman CL, Fridman JS, Loh ML, Grupp SA, Teachey DT. 2012. Targeting JAK1/2 and mTOR in murine xenograft models of Ph-like acute lymphoblastic leukemia. Blood 120(17):3510-3518. Miura I, Takatsu H, Yamaguchi A, Hashimoto K, Nimura T, Nishinari T, Niitsu H, Miura AB. 1994. Standard Ph chromosome, t(9;22)(q34;q11), as an additional change in a patient with acute myelomonocytic leukemia (M4Eo) associated with inv(16)(p13q22). Am J Hematol 45(1):94- 96. Moorman AV. 2012. The clinical relevance of chromosomal and genomic abnormalities in B-cell precursor acute lymphoblastic leukaemia. Blood Reviews 26(3):123-135. Moorman AV, Enshaei A, Schwab C, Wade R, Chilton L, Elliott A, Richardson S, Hancock J, Kinsey SE, Mitchell CD, Goulden N, Vora A, Harrison CJ. 2014. A novel integrated cytogenetic and genomic classification refines risk stratification in pediatric acute lymphoblastic leukemia. Blood 124(9):1434-1444. Moorman AV, Schwab C, Ensor HM, Russell LJ, Morrison H, Jones L, Masic D, Patel B, Rowe JM, Tallman M, Goldstone AH, Fielding AK, Harrison CJ. 2012. IGH@ Translocations, CRLF2 Deregulation, and Microdeletions in Adolescents and Adults With Acute Lymphoblastic Leukemia. Journal of Clinical Oncology 30(25):3100-3108. Morak M, Attarbaschi A, Fischer S, Nassimbeni C, Grausenburger R, Bastelberger S, Krentz S, Cario G, Kasper D, Schmitt K, Russell LJ, Pötschger U, Stanulla M, Eckert C, Mann G, Haas OA, Panzer- Grümayer R. 2012. Small sizes and indolent evolutionary dynamics challenge the potential 20

John Wiley & Sons

role of P2RY8-CRLF2–harboring clones as main relapse-driving force in childhood ALL. Blood 120(26):5134-5142. Mullighan CG, Collins-Underwood JR, Phillips LA, Loudin MG, Liu W, Zhang J, Ma J, Coustan-Smith E, Harvey RC, Willman CL, Mikhail FM, Meyer J, Carroll AJ, Williams RT, Cheng J, Heerema NA, Basso G, Pession A, Pui CH, Raimondi SC, Hunger SP, Downing JR, Carroll WL, Rabin KR. 2009a. Rearrangement of CRLF2 in B-progenitor- and Down syndrome-associated acute lymphoblastic leukemia. Nat Genet 41(11):1243-1246. Mullighan CG, Goorha S, Radtke I, Miller CB, Coustan-Smith E, Dalton JD, Girtman K, Mathew S, Ma J, Pounds SB, Su X, Pui C-H, Relling MV, Evans WE, Shurtleff SA, Downing JR. 2007. Genome- wide analysis of genetic alterations in acute lymphoblastic leukaemia. Nature 446(7137):758-764. Mullighan CG, Su X, Zhang J, Radtke I, Phillips LA, Miller CB, Ma J, Liu W, Cheng C, Schulman BA, Harvey RC, Chen IM, Clifford RJ, Carroll WL, Reaman G, Bowman WP, Devidas M, Gerhard DS, Yang W, Relling MV, Shurtleff SA, Campana D, Borowitz MJ, Pui CH, Smith M, Hunger SP, Willman CL, Downing JR. 2009b. Deletion of IKZF1 and prognosis in acute lymphoblastic leukemia. N Engl J Med 360(5):470-480. Nik-Zainal S, Alexandrov LB, Wedge DC, Van Loo P, Greenman CD, Raine K, Jones D, Hinton J, Marshall J, Stebbings LA, Menzies A, Martin S, Leung K, Chen L, Leroy C, Ramakrishna M, Rance R, Lau KW, Mudie LJ, Varela I, McBride DJ, Bignell GR, Cooke SL, Shlien A, Gamble J, Whitmore I, Maddison M, Tarpey PS, Davies HR, Papaemmanuil E, Stephens PJ, McLaren S, Butler AP, Teague JW, Jonsson G, Garber JE, Silver D, Miron P, Fatima A, Boyault S, Langerod A, Tutt A, Martens JW, Aparicio SA, Borg A, Salomon AV, Thomas G, Borresen-Dale AL, Richardson AL, Neuberger MS, Futreal PA, Campbell PJ, Stratton MR. 2012. Mutational processes molding the genomes of 21 breast cancers. Cell 149(5):979-993. Ojha J, Secreto CR, Rabe KG, Van Dyke DL, Kortum KM, Slager SL, Shanafelt TD, Fonseca R, Kay NE, Braggio E. 2015. Identification of recurrent truncated DDX3X mutations in chronic lymphocytic leukaemia. Br J Haematol 169(3):445-448. Oosterkamp H, Hijmans E, Brummelkamp T, Canisius S, Wessels L, Zwart W, Bernards R. 2014. USP9X downregulation renders breast cancer cells resistant to tamoxifen. Cancer Res. 74(14):3810- 3820. Papaemmanuil E, Rapado I, Li Y, Potter N, Wedge D, Tubio J, Alexandrov L, Van LP, Cooke S, Marshall J, Martincorena I, Hinton J, Gundem G, van DF, Nik-Zainal S, Jones D, Ramakrishna M, Titley I, Stebbings L, Leroy C, Menzies A, Gamble J, Robinson B, Mudie L, Raine K, O'Meara S, Teague J, Butler A, Cazzaniga G, Biondi A, Zuna J, Kempski H, Muschen M, Ford A, Stratton M, Greaves M, Campbell P. 2014. RAG-mediated recombination is the predominant driver of oncogenic rearrangement in ETV6-RUNX1 acute lymphoblastic leukemia. Nat Genet. 46(2):116-125. Paulsson K, Lilljebjorn H, Biloglav A, Olsson L, Rissler M, Castor A, Barbany G, Fogelstrand L, Nordgren A, Sjogren H, Fioretos T, Johansson B. 2015. The genomic landscape of high hyperdiploid childhood acute lymphoblastic leukemia. Nat Genet 47(6):672-676. Raine KM, Hinton J, Butler AP, Teague JW, Davies H, Tarpey P, Nik-Zainal S, Campbell PJ. 2015. cgpPindel: Identifying Somatically Acquired Insertion and Deletion Events from Paired End Sequencing. Curr Protoc Bioinformatics 52:15 17 11-12. Roberts KG, Li Y, Payne-Turner D, Harvey RC, Yang YL, Pei D, McCastlain K, Ding L, Lu C, Song G, Ma J, Becksfort J, Rusch M, Chen SC, Easton J, Cheng J, Boggs K, Santiago-Morales N, Iacobucci I, Fulton RS, Wen J, Valentine M, Cheng C, Paugh SW, Devidas M, Chen IM, Reshmi S, Smith A, Hedlund E, Gupta P, Nagahawatte P, Wu G, Chen X, Yergeau D, Vadodaria B, Mulder H, Winick NJ, Larsen EC, Carroll WL, Heerema NA, Carroll AJ, Grayson G, Tasian SK, Moore AS, Keller F, Frei-Jones M, Whitlock JA, Raetz EA, White DL, Hughes TP, Guidry Auvil JM, Smith MA, Marcucci G, Bloomfield CD, Mrozek K, Kohlschmidt J, Stock W, Kornblau SM, Konopleva M, Paietta E, Pui CH, Jeha S, Relling MV, Evans WE, Gerhard DS, Gastier-Foster JM, Mardis E, 21

John Wiley & Sons

Wilson RK, Loh ML, Downing JR, Hunger SP, Willman CL, Zhang J, Mullighan CG. 2014a. Targetable kinase-activating lesions in Ph-like acute lymphoblastic leukemia. N Engl J Med 371(11):1005-1015. Roberts Kathryn G, Morin Ryan D, Zhang J, Hirst M, Zhao Y, Su X, Chen S-C, Payne-Turner D, Churchman ML, Harvey Richard C, Chen X, Kasap C, Yan C, Becksfort J, Finney Richard P, Teachey David T, Maude Shannon L, Tse K, Moore R, Jones S, Mungall K, Birol I, Edmonson Michael N, Hu Y, Buetow Kenneth E, Chen IM, Carroll William L, Wei L, Ma J, Kleppe M, Levine Ross L, Garcia-Manero G, Larsen E, Shah Neil P, Devidas M, Reaman G, Smith M, Paugh Steven W, Evans William E, Grupp Stephan A, Jeha S, Pui C-H, Gerhard Daniela S, Downing James R, Willman Cheryl L, Loh M, Hunger Stephen P, Marra Marco A, Mullighan Charles G. 2012. Genetic Alterations Activating Kinase and Cytokine Receptor Signaling in High-Risk Acute Lymphoblastic Leukemia. Cancer Cell 22(2):153-166. Roberts KG, Pei D, Campana D, Payne-Turner D, Li Y, Cheng C, Sandlund JT, Jeha S, Easton J, Becksfort J, Zhang J, Coustan-Smith E, Raimondi SC, Leung WH, Relling MV, Evans WE, Downing JR, Mullighan CG, Pui CH. 2014b. Outcomes of children with BCR-ABL1-like acute lymphoblastic leukemia treated with risk-directed therapy based on the levels of minimal residual disease. J Clin Oncol 32(27):3012-3020. Robinson G, Parker M, Kranenburg TA, Lu C, Chen X, Ding L, Phoenix TN, Hedlund E, Wei L, Zhu X, Chalhoub N, Baker SJ, Huether R, Kriwacki R, Curley N, Thiruvenkatam R, Wang J, Wu G, Rusch M, Hong X, Becksfort J, Gupta P, Ma J, Easton J, Vadodaria B, Onar-Thomas A, Lin T, Li S, Pounds S, Paugh S, Zhao D, Kawauchi D, Roussel MF, Finkelstein D, Ellison DW, Lau CC, Bouffet E, Hassall T, Gururangan S, Cohn R, Fulton RS, Fulton LL, Dooling DJ, Ochoa K, Gajjar A, Mardis ER, Wilson RK, Downing JR, Zhang J, Gilbertson RJ. 2012. Novel mutations target distinct subgroups of medulloblastoma. Nature 488(7409):43-48. Russell LJ, Capasso M, Vater I, Akasaka T, Bernard OA, Calasanz MJ, Chandrasekaran T, Chapiro E, Gesk S, Griffiths M, Guttery DS, Haferlach C, Harder L, Heidenreich O, Irving J, Kearney L, Nguyen-Khac F, Machado L, Minto L, Majid A, Moorman AV, Morrison H, Rand V, Strefford JC, Schwab C, Tonnies H, Dyer MJS, Siebert R, Harrison CJ. 2009. Deregulated expression of cytokine receptor gene, CRLF2, is involved in lymphoid transformation in B-cell precursor acute lymphoblastic leukemia. Blood 114(13):2688-2698. Russell LJ, Enshaei A, Jones L, Erhorn A, Masic D, Bentley H, Laczko KS, Fielding AK, Goldstone AH, Goulden N, Mitchell CD, Wade R, Vora A, Moorman AV, Harrison CJ. 2014. IGH@ Translocations Are Prevalent in Teenagers and Young Adults With Acute Lymphoblastic Leukemia and Are Associated With a Poor Outcome. Journal of Clinical Oncology 32(14):1453-1462. Ryan SL, Matheson E, Grossmann V, Sinclair P, Bashton M, Schwab C, Towers W, Partington M, Elliott A, Minto L, Richardson S, Rahman T, Keavney B, Skinner R, Bown N, Haferlach T, Vandenberghe P, Haferlach C, Santibanez-Koref M, Moorman AV, Kohlmann A, Irving JA, Harrison CJ. 2016. The role of the RAS pathway in iAMP21-ALL. Leukemia. Schmitz R, Young RM, Ceribelli M, Jhavar S, Xiao W, Zhang M, Wright G, Shaffer AL, Hodson DJ, Buras E, Liu X, Powell J, Yang Y, Xu W, Zhao H, Kohlhammer H, Rosenwald A, Kluin P, Muller- Hermelink HK, Ott G, Gascoyne RD, Connors JM, Rimsza LM, Campo E, Jaffe ES, Delabie J, Smeland EB, Ogwang MD, Reynolds SJ, Fisher RI, Braziel RM, Tubbs RR, Cook JR, Weisenburger DD, Chan WC, Pittaluga S, Wilson W, Waldmann TA, Rowe M, Mbulaiteye SM, Rickinson AB, Staudt LM. 2012. Burkitt lymphoma pathogenesis and therapeutic targets from structural and functional genomics. Nature 490(7418):116-120. Schwab C, Ryan SL, Chilton L, Elliott A, Murray J, Richardson S, Wragg C, Moppett J, Cummins M, Tunstall O, Parker CA, Saha V, Goulden N, Vora A, Moorman AV, Harrison CJ. 2016. EBF1- PDGFRB fusion in pediatric B-cell precursor acute lymphoblastic leukemia (BCP-ALL): genetic profile and clinical implications. Blood 127(18):2214-2218.

John Wiley & Sons

Schwab CJ, Chilton L, Morrison H, Jones L, Al-Shehhi H, Erhorn A, Russell LJ, Moorman AV, Harrison CJ. 2013. Genes commonly deleted in childhood B-cell precursor acute lymphoblastic leukemia: association with cytogenetics and clinical features. Haematologica 98(7):1081- 1088. Schwab CJ, Jones LR, Morrison H, Ryan SL, Yigittop H, Schouten JP, Harrison CJ. 2010. Evaluation of multiplex ligation-dependent probe amplification as a method for the detection of copy number abnormalities in B-cell precursor acute lymphoblastic leukemia. Genes Chromosomes Cancer 49(12):1104-1113. Shochat C, Tal N, Bandapalli OR, Palmi C, Ganmore I, te Kronnie G, Cario G, Cazzaniga G, Kulozik AE, Stanulla M, Schrappe M, Biondi A, Basso G, Bercovich D, Muckenthaler MU, Izraeli S. 2011. Gain-of-function mutations in interleukin-7 receptor-α (IL7R) in childhood acute lymphoblastic leukemias. The Journal of Experimental Medicine 208(5):901-908. Tafolla E, Wang S, Wong B, Leong J, Kapila YL. 2005. JNK1 and JNK2 oppositely regulate p53 in signaling linked to apoptosis triggered by an altered fibronectin matrix: JNK links FAK and p53. J Biol Chem 280(20):19992-19999. Tasian SK, Doral MY, Borowitz MJ, Wood BL, Chen I-M, Harvey RC, Gastier-Foster JM, Willman CL, Hunger SP, Mullighan CG, Loh ML. 2012. Aberrant STAT5 and PI3K/mTOR pathway signaling occurs in human CRLF2-rearranged B-precursor acute lymphoblastic leukemia. Blood 120(4):833-842. Wu SC, Li LS, Kopp N, Montero J, Chapuy B, Yoda A, Christie AL, Liu H, Christodoulou A, van Bodegom D, van der Zwet J, Layer JV, Tivey T, Lane AA, Ryan JA, Ng SY, DeAngelo DJ, Stone RM, Steensma D, Wadleigh M, Harris M, Mandon E, Ebel N, Andraos R, Romanet V, Dolemeyer A, Sterker D, Zender M, Rodig SJ, Murakami M, Hofmann F, Kuo F, Eck MJ, Silverman LB, Sallan SE, Letai A, Baffert F, Vangrevelinghe E, Radimerski T, Gaul C, Weinstock DM. 2015. Activity of the Type II JAK2 Inhibitor CHZ868 in B Cell Acute Lymphoblastic Leukemia. Cancer Cell 28(1):29-41. Yan J, Zhong N, Liu G, Chen K, Liu X, Su L, Singhal S. 2014. Usp9x- and Noxa-mediated Mcl-1 downregulation contributes to pemetrexed-induced apoptosis in human non-small-cell lung cancer cells. Cell Death Dis. 5:e1316. . Yano M, Imamura T, Asai D, Moriya-Saito A, Suenobu S, Hasegawa D, Deguchi T, Hashii Y, Kawasaki H, Hori H, Kosaka Y, Kato K, Horibe K, Yumura-Yagi K, Hara J, Matsumoto K, Kiyokawa N, Oda M, Sato A. 2014. An overall characterization of pediatric acute lymphoblastic leukemia with CRLF2 overexpression. Genes Chromosomes Cancer 53(10):815-823. Zhou M, Wang T, Lai H, Zhao X, Yu Q, Zhou J, Yang Y. 2015. Targeting of the deubiquitinase USP9X attenuates B-cell acute lymphoblastic leukemia cell survival and overcomes glucocorticoid resistance. Biochem Biophys Res Commun 459(2):333-339.

John Wiley & Sons

Figure legends

Figure 1. Comparative Histograms of recurrent genetic abnormalities in patients with CRLF2 r ALL. (A) Comparison of clinical data between patients with IGH-CRLF2 (grey bars) and

P2RY8-CRLF2 (black bars). (B) Comparison of genetic data between patients with IGH-

CRLF2 (grey bars) and P2RY8-CRLF2 (black bars). (C) Comparison between CRLF2r DS

ALL (grey bars) and CRLF2r non DSALL patients (black bars). * denotes those abnormalities where the incidence between the two groups is statistically significant.

Figure 2. Acquired mutations and structural variations in CRLF2r ALL. (A) Histogram representing the distribution of structural variants (SV) in 11 patients with CRLF2r ALL (x axis, solid grey box depicts patients with P2RY8-CRLF2 and the dashed grey box, patients with IGH-CRLF2), detected by pairedend sequencing and validated by FISH, MLPA, SNP arrays and/or PCR and subsequent Sanger sequencing for breakpoint locations. Each patient is represented by a bar with the height of each bar being representative of the number of aberrations present in that patients sample. Different colours denote the different types of SV that were detected. (B) Histogram representing the distribution of coding mutations in same

11 patients with CRLF2r ALL (xaxis, solid grey box depicts patients with P2RY8-CRLF2 and the dashed grey box, IGH-CRLF2 patients), detected by whole exome sequencing. Each patient is represented by a bar with the height of each bar being representative of the number of aberrations present in that patients sample. Different colours denote the different types of coding mutations that were detected.

Figure 3. Heatmap showing the frequency distribution of defective genes. The top ten pathways in which defective genes are most frequently identified across 11 patients with

CRLF2r ALL are shown. The number in each cell represents numbers of defective genes

John Wiley & Sons

identified for particular pathways and patients, ranging from 0 (white) to 4 (dark grey). Total

numbers of defective genes for each patient are summarized in the bar chart on the top panel

of the heatmap. Note that genes which are members of two or more pathways were counted

only once. Bar chart on the right panel summarises the total number of defective genes

identified across the 11 patients for a given pathway (KEGG pathways, with additional

manually annotated genes underlined). # significantly enriched (hypergeometric test Pvalue

< 0.05) in patients with P2RY8-CRLF2; ~ significantly enriched in patients with IGH-

CRLF2; * CNA of IKZF1; ^ IKZF1 point mutation.

John Wiley & Sons

Figure 1

19x43mm (600 x 600 DPI)

John Wiley & Sons

Figure 2a

7x4mm (600 x 600 DPI)

John Wiley & Sons

Figure 2b

7x5mm (600 x 600 DPI)

John Wiley & Sons

Figure 3

11x6mm (600 x 600 DPI)

John Wiley & Sons

TABLE 1. Focal Aberrations Identified by SNP, Paired-End and Exome Sequencing

Patient B-cell Cell cycle Kinase RAS Cell adhesion TP53 Other interesting genes ID differentiation P2RY8-CRLF2 P2RY8-CRLF2, JAK2, BTG1, CDKN2AB NRAS LAMA1 CDKN2AB NFATC4, NCOA3 9534 IL7R P2RY8-CRLF2, MAST4, CRIPAK, KDM4A, SKIL, CCDC88C, 11538 ETV6, IKZF1, PAX5 CDKN2AB, FOXN3 NRAS ITGBL1, USH2A CDKN2AB STK38L, RPS6KA5 SMEK1, FBLN5, CYP4A11

P2RY8-CRLF2, CKMT1A, 11706 ETV6 PTPRT CREBBP, GLI1 SPHKAP, NBEA, PTPRT

P2RY8-CRLF2, ACVRL1, MLLT3, TUSC1, TOPORS, DDX58, 20638 CDKN2AB ITGA7, ANK2 CDKN2AB IL7R APTX 20753 IKZF1, PAX5 CDKN2A P2RY8-CRLF2, MAPK10 USH2A CDKN2A PPP2R3B, ZEDB1, IL9R IKZF1, PAX5, 21819 CDKN2AB, MCC P2RY8-CRLF2, INSRR NF1 CDKN2AB DDX6, CASZ1 VPREB1 ARID5A, SEMA4C, BTLA, TBL1XR1, 21991 ETV6, VPREB1 CDKN2AB, CCND3 P2RY8-CRLF2 CD38, NPNT CDKN2AB FHIT, PAXIP1 IGH-CRLF2

11543 EBF1, IKZF1 BTG1 IGH-CRLF2, JAK2, TTBK1 NOX4, CHORDC1

TOP3A, CREB5, TRL4, CHN2, MPLKIP, 19599 IKZF1, VPREB1 CDK13 IGH-CRLF2, JAK2, CDK13 DST INHBA, GLI3, TSC22D1 EBF1, ETV6, IKZF1, ABRA, BTLA, AFF1, MEF2C, ADD3, 21245 RB1, CDK6 IGH-CRLF2, JAK2, ERBB4 CTNNA2 RB1 PAX5, VPREB1 RUNX1 ITGB7, LAMC2, ETV6, IKZF1, IGH-CRLF2 , CRLF2, PTPN11 COL3A1, MIR181B1, MIR181A1, CADM1 21470 VPREB1 PTPN11, RHBDL2 CTTNBP2

John Wiley & Sons

50 51 52 53 54 55 56 57 58 59 60 Genes, Chromosomes & Cancer Page 32 of 147

Supplementary Table 1. Clinicial, cytogenentic, FISH, MLPA and JAK mutation data for 172 CRLF2 -r ALL patients.

RegId Age Gender WBC Trial~ Karyotype#

1829 21 Female 99 UKALLXII 48,XX,+21,+21[25] 2326 13 Male 89.4 UKALLXI 46,XY[30] 2909 53 Female 485 UKALLXII Failed

3141 10 Male 13.2 ALL97 46,XY[20]

3657 23 Female 1.4 UKALLXII Failed 3789 16 Female 22 ALL97 47,XX,+21c[10] 3836 6 Female 139.7 ALL97 47,XX,+X[13] 3963 8 Female 14.9 ALL97 46,XX[20] 4001 6 Male 8.8 ALL97 46,XY[30] 4457 19 Male 104 UKALLXII 46,XY[4] 4681 36 Female 4.1 UKALLXII 46,XX,del(9)(p13p21)[4] 48,Y,t(X;14)(p22;q32),+der(X)t(X;14),del(15)(q11.2q15), 4958 4 Male 6.4 ALL97 +21c[2] 4964 5 Female 649 ALL97 46,XX,?t(8;20)(q2?3;q1?3.1),del(14)(q11q1?3)[10] 7114 19 Male 341.9 UKALLXIIR 46,XY,del(9)(q32q34),del(20)(q1)[20] 7116 6 Male 10.9 ALL2003 47,XY,+21[3]

7243 14 Male 1.4 ALL2003 47,XY,+X,der(17)t(9;17)(p1?2;p1?3) 7311 10 Male 116 ALL2003 46,XY[20] 8367 30 Female 72.8 UKALLXIIR 46,XX[22]

8765 5 Male 39.6 ALL2003 47,XY,+X[6]/ 46,XY[6] 8953 5 Male 1.2 ALL2003 46,X,der(X)t(X;Y)(p?2;p11)?c[18] 9100 46 Male 5 UKALLXIIR Failed 10692 3 Male 12.2 ALL2003 49,XY,+X,+17,+21[5]/ 46,XY[4] 11543 4 Male 50.8 ALL2003 47,XY,t(11;14;?)(q13;q32;?),+21[6]

12177 60 Male 188.8 UKALLXIIR 45,XY,der(8;15)(q10;q10)[14]

12882 57 Male 35.8 UKALLXIIR 46,XY,t(?;14)(?;q32)[10] 19599 18 Female 4.2 ALL2003 47,XX,+21c[13] 20033 3 Female UK UKALLR1 46,XX,+21c[2]/46,XX,+21c,+mar[2] 20984 6 Male 95.7 ALL2003 46,XY[18] 21245 17 Female 81 ALL2003 46,XX[25]

John Wiley & Sons

21470 18 Male 11.9 ALL2003 47,XY,+X,inc[3]/46,XY[7]

22011 14 Male 63.2 ALL2003 46,XY[8]

22570 18 Female 21.2 ALL2003 48,X,?t(X;14)(p2;q32),+der(X)t(X;14)(p2;q32),+21c[7]

22767 3 Female 17.2 ALL2003 47,XX,+21[3]/48~49,idem,+14,+17[cp5] 23853 12 Female 86 ALL2003 48,XXXc,+21c[20] 24061 4 Female 6.9 ALL2003 47,XX,+21c[20] 46,XY,add(2)(q3?2),add(9)(p1?3),t(12;13)(p11?2;q14),add(17) 24066 21 Male 72.6 ALL2003 (p11?2)[10] 24520 6 Male 139.7 ALL2003 46,XY[20]

2668 8 Male 3.4 ALL97 46,XY,r(20)(p1?q1?)[11]

2693 16 Female 21.7 ALL97 48,XX,+21c,+21[4]

3737 22 Female 2.1 UKALLXII 46,XX,t(9;22)(q34;q11),add(14)(q12)[4]

46,XY,del(3)(p?21),inv(9)(p11q12)c[7]/ 48,idem,+marx2[2]/ 7108 48 Male 25.8 UKALLXIIR 50,idem,+marx4[1]/ 46,XY, inv(9)(p11q12)c[2]

7389 16 Female 105 UKALLXIIR 46~48,XX,+X,?del(6)(q?12q?15),del(9)(p1?3),+21 [cp12]

11687 42 Male 280 UKALLXIIR 46,XY,add(10)(q2?4)[6]

11857 19 Male 164.9 ALL2003 46,XY[5]

21572 10 Female 34.3 ALL2003 46,XX,inc[20]

22452 16 Male 40 ALL2003 46,XY,t(9;11)(p?13;?p12),del(12)(p13)[7]/47,idem, +21[2]

24390 3 Male 4.3 ALL2003 51,XY,+X,+11,+14,+21,+21c[7]

322 4 Male UK UKALLXI 48,XY,+X,+21c[5]/ 49,idem,+17[4] 1655 2 Male 9.3 UKALLXI 48,XY,+21c,+21,i(21)(q10)[3]/ 47,XY,+21c[7] 1672 7 Female 70 UKALLXI 47,XX,+21c[20] 2017 1 Female 54 UKALLXI 47,XX,i(9)(q10),+21c[5]/ 47,,idem,?del(6)(q13q15)[3]

2650 5 Male 40 ALL97 46,XY[30] 2682 4 Male 7.9 ALL97 47,XY,+X,add(12)(p1?2),i(17)(q10)[14]

John Wiley & Sons

2788 54 Male 27.4 UKALLXII 46,XY,?r(17)(p?,q?)[3]/ 47,idem,+?r(17)(p?q?)[5]

2836 8 Female 245 ALL97 46,XX,add(9)(q34)[14]

2880 7 Male 197.1 ALL97 46,XY[5]

2964 4 Male 7.4 ALL97 47,XY,+17[5]

47-48,XX,?(9)(p),+?17,del(20)(?p/q),+21,+mars,inc[cp9]/ 2966 3 Female 62.9 ALL97 46,XX,del(7)(p11)[8]

2977 12 Female 2 ALL97 51,XX,+X,+X,+4,+21,+21[20] 57,XX,+X,add(1)(q31q32),+2,+4,+5,+8,+9,+14, 3036 10 Female 1 ALL97 add(17)(p11),+18,+20,+21,+22[cp3]

3037 2 Male 6.9 ALL97 46,XY,der(14;21)(q10;q10)c,+21c[18]

3051 2 Female 33.7 ALL97 46,XX[7]

3173 3 Male 5 ALL97 50,XY,+X,+9,+14,+21[14]

3234 2 Male 1.9 ALL97 48,XY,+X,+21c[2]

3263 9 Male 39.5 ALL97 48,XY,+X?c,+21c[3]/ 46,XY,-4,-7,+21c,+mar[6]

3368 20 Male 5.8 UKALLXII 46,XY,del(7)(p1?5),t(8;22)(q1?1;q13),dup(21?)(q)[17]

3396 6 Female 3.2 ALL97 46,XX,der(2)t(X;2)(q;q35),i(7)(q10)[3] 47,XY,del(9)(p1?3p2?),+21c[10]/ 3410 5 Male 53.1 ALL97 53,idem,+X,+?4,+?8,+9,+18,+22[2] 3450 2 Male 32 ALL97 45,XY,dic(9;20)(p11~13;q11)[13]

3553 3 Female 9.5 ALL97 47,XX,+21c[6]/ 48,idem,+X,inc[7] 3572 3 Male 102.2 ALL97 48,XY,+X,t(7;17)(p11;q25),+21c[11]/ 47,XY,+21c[9] 3719 5 Male 25.3 ALL97 46,XY,t(9;15)(p13;q24)[18] 4002 1 Female 309 ALL97 46,XX[10]

4073 2 Female 58 ALL97 47,XX,+21c[10]/ 48,idem,+X?c[10]

4074 5 Female 8.3 ALL97 54,XX,+X,+X,+4,+8,+14,+17,+18,+21[4]/ 55,idem,+mar[6] 4174 2 Male 32.4 ALL97 47,XY,+21c[18]/ 46,XY[2]

John Wiley & Sons

4184 7 Male 135 ALL97 25<1n>,XY,+21[9]/ 50,XY,+X,+Y,+21,+21[3]

4247 4 Female 30.6 ALL97 46,XX,add(21)(q22)[23]

4316 5 Female 21.8 ALL97 46,XX[24]

4318 6 Male 47.7 ALL97 47,XY,del(9)(p22p24),+21c[20]

4360 3 Female 27 ALL97 47,XX,+X[1]/ 48,idem,+21[2]/ 49,idem,+21,+21[7] 4363 2 Male 14.8 ALL97 47,XY,+X[21] 4422 3 Female 119 ALL97 Failed

4451 2 Female 22.3 ALL97 45,XX,dic(9;20)(p1;q1),del(16)(q22)

4478 4 Male 9.7 ALL97 47,XY,+9,der(9;16)(q10;p10),+21c[12]

4561 9 Male 4 ALL97 Failed

4578 4 Female 4.1 ALL97 47,XX,+14[3]

4580 3 Male 34 ALL97 48,XY,+X,+21[cp6]

4623 6 Female 13.9 ALL97 46,XX,dup(21)(q?)[11]/ 47,idem,+X[1] 55-56,XY,+X,+4,+8,+10,+14,+?add(18)(q23),+19,+21, 4640 3 Male 5.5 ALL97 +21,+?21[cp4] 4661 5 Female 19 ALL97 48,XX,+X,+21c[7]

4761 7 Female 52.5 ALL97 46,XX[23]

4777 5 Male 2.2 ALL97 47,XY,+21c[22]

4785 4 Female 113.8 ALL97 49,XX,+X,+X,+21[7]

4792 3 Female 6.4 ALL97 47,XX,+X[3]/ 46,XX[17]

4850 21 Female 22.8 UKALLXII 46,XX,t(9;22)(q34;q11),+17[6]/ 46,XX[4]

4898 3 Male 47.2 ALL97 47,XY,+21c[10]

4954 4 Female 26.4 ALL97 47,XX,+21

4965 3 Female 60 ALL97 46,XX[19] 47,XY,der(11)t(X;11)(q?2;q2),+21c[4]/ 47,idem,del(6)(q)[4]/ 5067 3 Male 19.4 ALL97 47,XY,+21c[2]

John Wiley & Sons

5612 6 Male 22 ALL97 52-53,XY,+X,+4,+8,+14,+17,+18,idic(21)(p11),inc[cp5]

5618 2 Female 8.3 ALL97 45,XX,dic(9;20)(p11;q11)[11] 56~58,XX,+X,dup(1)(q1q2?5),+4,+6,+10,+11,+14,+18,+21,+21, 5626 3 Female 19.7 ALL97 +22,+mar[cp3] 46,XX,del(1)(q4?),del(6)(q1?5),del(7)(q2?2q3?1), 5655 8 Female 54.7 ALL97 dup(21)(q)[3]/ 46,idem,add(6)(q2?)[12] 5666 7 Female 21.2 ALL97 45,XX,der(7)t(7;9)(q3?;q3?),-9[6]

5674 6 Male 55.1 ALL97 47,XY,+X,dup(21)(q)[7]

5762 5 Male 3.1 ALL97 47,XY,+21c[20]

5817 6 Male 69 ALL97 47,XY,+21c[20] 6042 2 Male 1.6 MRD PILOT 48,XY,+Y,+21c[6]/ 47,XY,+21c[14] 6119 3 Male 9.2 MRD PILOT 50,XY,+X,+Y,+21c,+21[17]/ 47,XY,+21c[3] 6814 1 Male 29 MRD PILOT 46,XY[20] 6915 8 Female 16 MRD PILOT 47,XX,+X[7]/ 46,XX[6] 6937 6 Female 84.7 MRD PILOT 46,XX,dup(21)(q?)[10]

7015 2 Female 24 ALL2003 47,XX,+X,t(2;14)(p1?1;q11),-7,i(21)(q10)x2,+mar 7104 35 Male 20.1 UKALLXIIR 47,XY,+X,t(9;15)(p?1;q?1)[20] 7191 8 Male 89.1 ALL2003 47,XY,+21c

7219 15 Male 1.6 ALL2003 46,XY,der(21)dup(21)(q?),inc[3]

7550 8 Male 68.8 ALL2003 46,XY,dic(9;20)(p1;q11),+mar[8]

7583 14 Male 3.4 ALL2003 47,XY,+X,der(21)r(21)(q?)dup(21)(q?)[4] 7619 12 Male 2.5 ALL2003 47,XY,+9,der(21)r(21)(q?)dup(21)(q?) 7643 3 Male 85 ALL2003 47,XY,del(12)(p?11.1),+21c[5] 46,XY,der(3)del(3)(p?)t(3;9)(q2;q3),t(4;10)(q3;q24), 7735 3 Male 27.5 ALL2003 der(9)t(3;9)(q2;q3)[8] 7761 3 Male 48.8 ALL2003 47,XY,+21c[20] 53,XY,+2,+4,+5,+8,t(9;22)(q34;q11),+18,+21, 7814 40 Male 18.2 UKALLXIIR +der(22)t(9;22)(q34;q11)[14] 48,XY,+X,inv(1)(p13q?32),ider(21)(q10)dup(21)(q?), +mar[11]/ 7829 10 Male 2.4 ALL2003 46,XY[3] 8274 2 Female 8.4 ALL2003 47,XX,+21c[13]

John Wiley & Sons

8767 10 Female 130 ALL2003 46,XX[3]/ 46,inc[5] 9028 10 Female 6 ALL2003 46,X,add(X)(q26-q28),?7,der(21)dup(21)(q?)[8]

9534 2 Male 65 ALL2003 47,XY,+21c[20]

10278 18 Male 9.1 UKALLXIIR Failed

10326 2 Male 17.3 ALL2003 NA

10607 4 Male 25.2 ALL2003 48,XY,+X,del(1)(q32),+21c[6]/ 48,XY,+X,add(1)(q32),+21c[3]

10841 3 Male 24.8 ALL2003 47,XY,+21c[14] 10924 2 Male 12.6 ALL2003 47,XY,+21c[20] 11101 3 Female 3.9 ALL2003 47,XX,add(19)(p13.3),+21c[8]

11200 6 Female 7.1 ALL2003 47,XX,+X,add(1)(q?31),idic(21)(p11.2)[3]/ 48,idem,+18[2]

11329 33 Male 8 UKALLXIIR 46,XY,del(6)(q1?5q2?5)[21]/ 47,idem,+16[2]

11403 3 Female 37 ALL2003 Failed

51,XY,+?X,+21,+21,+2mar[2]/ 11447 30 Male 1.7 UKALLXIIR 52,XY,+?X,+14,+21,+21,+2mar[3]

11463 3 Female 103 ALL2003 47,XX,+21c[2]

11471 40 Male 87.4 UKALLXIIR NA

11538 8 Male 400 ALL2003 47,XY,-2,?add(14)(q32),+21c,+mar[5]

11564 9 Female 1.7 ALL2003 46,XX[45]

11680 3 Male 37.4 ALL2003 46,XY[20]

11706 5 Male 5.8 ALL2003 Failed

11734 8 Female 11.5 ALL2003 47,XX,+21c[20]

11888 2 Female 14 ALL2003 Failed

12200 3 Male 95.7 ALL2003 49,XY,+X,+9,?add(12)(p1),+21c[12]

12477 7 Male 2.2 ALL2003 46,XY,add(5)(q3?1),der(12)t(5;12)(q3?4;p1?3)[4]

19992 5 Male 29.2 ALL2003 47,XY,+X,-14,-16,add(17)(p1),+2mar,inc[4]

John Wiley & Sons

20389 8 Male 5 ALL2003 Failed

20449 4 Male 29.5 ALL2003 47,XY,+21c[25]

20638 4 Female 5.1 ALL2003 47,XX,+21c[20]

20684 8 Male 2.8 ALL2003 44~46,XY,-2,-5,-7,-9,-10,-12,add(12)(q2?),-21,+4~6 mar[cp8]

20753 3 Male 8.4 ALL2003 47,XY,+X[17]

21342 4 Male 13.5 ALL2003 47,Y,add(X)(q2?8),+21c

21567 8 Female 4.9 ALL2003 52,XX,+9,-12,-21,+7mar[cp4]

21808 2 Female 3.9 ALL2003 49,XX,+X,+17,+21[6]

21819 1 Male 76.8 ALL2003 45,XY,dic(9;20)(p11-13;q11),t(7;9)(q?22;q?32)[8]

21869 3 Male 57.9 ALL2003 47,XY,+21c[21]

21918 5 Male 17.8 ALL2003 51~54,XY,+X,+Y,+5,+14,+17,+21,inc[cp5] 46,XY,add(6)(q1),?t(12;21)(p13;q22)[4]/46,XY, 21991 8 Male 7.9 ALL2003 ?t(12;21)(p13;q22)[6] 22009 2 Female 127.9 ALL2003 46,XX,del(11)(q2?3)inc[16]

22243 3 Female 30 ALL2003 47,XX,+X[6]/47,idem,i(17)(q10)[2]

22465 3 Female 11.1 ALL2003 45,XX,dic(9;20)(p11;q11)[6]

22585 3 Male 6.3 ALL2003 47,XX,+X,i(21)(q10)c,inc[2]/46,XY,i(21)(q10)c,inc[18]

22599 5 Male 4.5 ALL2003 49,XY,+X,del(11)(q22q25),+17,+21c[10]

22789 21 Male 17.5 ALL2003 46,XY,+21c[20] 23139 4 Male 3.2 ALL2003 47,XY,+21c[20] 23964 5 Male 13 ALL2003 47,XY,+21c[20]

24470 24 Female 46 ALL2003 46,XX[20] 24660 1 Male 174 ALL2003 45,XY,dic(9;20)(p11-3;q11)[5]

WBC; White blood cell count

John Wiley & Sons

# Karyotypes are described according to ISCN (20??). Normal clones have been ommited from abnormal karyotypes * MLPA data only ^ novel mutation ND, Not done ~ Between April 1997 and June 2002, 1725 children and adolescents, aged 1-18 years at diagnosis, were treated on UKALL97/99 trial. Between October 2003 and June 2011, 3182 children and adolescents, aged 1-24 years at diagnosis, were treated on the UKALL2003 trial. Between September 1990 and April 1997, 2090 children and adolescents, aged 1-18 years, were treated on UKALLXI. Between January 1993 and November 2008, 1380 adolescents and adults, aged 15-55 years, were treated on UKALLXII. $ abnormal FISH pattern given ∞ Interpretation of MLPA results dependent upon copy number of probesto IL3RA, CSF2RA and CRLF2 in relation to control probes. ⌂ IGH-CRLF2 was associated with a concomittent deletion within the PAR1 region of the rearranged sex chromosome in ten patients.

John Wiley & Sons

-r ALL patients. Established cytogenetic CRLF2 IGH FISH$ CRLF2 FISH$ MLPA PAR1∞ rearrangement rearrangement IGH-CRLF2 2R 1G 0F [92%] 1R 1G 1F [61%] Normal 1R 1G 1F [29%], IGH-CRLF2 1R 1G 1F [35%] Normal 0R 0G 2F [70% IGH-CRLF2 1R 1G 1F [62%] 1R 1G 1F [65%] ND 1R 1G 1F [66%], IGH-CRLF2 1R 0G 1F [7%], 2R 1R 1G 1F [80%] Normal 1G 0F [6%] IGH-CRLF2 1R 1G 1F [58%] 1R 1G 1F [72%] ND 1R 1G 1F [70%], IGH-CRLF2 1R 1G 1F [84%] Normal 1R 2G 1F [15%] IGH-CRLF2 1R 1G 1F [71%] 1R 1G 2F [85%] Normal IGH-CRLF2 1R 1G 1F [90%] 1R 1G 1F [93%] Normal IGH-CRLF2 1R 1G 1F [79%] 1R 1G 1F [89%] Normal IGH-CRLF2 1R 1G 1F [55%] 1R 1G 1F [54%] ND IGH-CRLF2 1R 1G 1F [83%] 1R 1G 1F [79%] ND IGH-CRLF2 1R 2G 1F [60%] 1R 2G 1F [54%] Normal

IGH-CRLF2 2R 1G 0F [95%] 1R 1G 2F [79%] Normal IGH-CRLF2 1R 1G 1F [85%] 1R 1G 1F [82%] Normal 1R 1G 1F [48%], IGH-CRLF2 1R 1G 1F [84%] Normal 1R 0G 1F [27%] 1R 2G 1F [76%], IGH-CRLF2 1R 2G 1F [82%] Normal 1R 1G 1F [9%] IGH-CRLF2 1R 1G 1F [60%] 1R 1G 1F [76%] Normal IGH-CRLF2 1R 1G 1F [94%] 1R 1G 1F [86%] Normal 1R 2G 1F [56%], IGH-CRLF2 1R 2G 1F [51%] Normal 2R 2G 0F [25%] IGH-CRLF2 1R 1G 1F [62%] 1R 1G 1F [66%] ND IGH-CRLF2 1R 1G 1F [13%] 1R 1G 1F [8%] ND IGH-CRLF2 1R 1G 1F [72%] 1R 0G 2F [69%] ND 1R 1G 2F [71%] IGH-CRLF2 1R 1G 1F [75%] Normal 1R 1G 1F [9%] 2R 1G 0F [59%], IGH-CRLF2 1R 1G 1F [70%] Normal 1R 1G 1F [6%] IGH-CRLF2 1R 1G 1F [73%] 1R 1G 1F [80%] Normal IGH-CRLF2 1R 1G 1F [94%] 1R 1G 1F [87%] Normal IGH-CRLF2 NA 1R 1G 1F [93%] Normal IGH-CRLF2 1R 1G 1F [31%] 1R 1G 1F [42%] Normal IGH-CRLF2 1R 1G 1F [85%] 1R 1G 1F [92%] Normal

John Wiley & Sons

1R 2G 1F [79%], IGH-CRLF2 1R 2G 1F [94%] ND 2R 2G 0F [12%] 1R 1G 1F [55%], IGH-CRLF2 1R 1G 1F [57%] ND 1R 0G 1F [14%] 1R 2G 1F [42%], 1R 2G 1F [64%], IGH-CRLF2 1R 1G 1F [19%], Normal 1R 1G 1F [19%] 1R 1G 2F [11%] IGH-CRLF2 1R 1G 1F [90%] 1R 1G 1F [84%] ND IGH-CRLF2 1R 1G 1F [76%] 1R 1G 2F [69%] Normal 1R 1G 1F [73%], IGH-CRLF2 1R 1G 1F [31%] Normal 1R 1G 2F [20%] 1R 1G 1F [70%], IGH-CRLF2 1R 1G 1F [78%] ND 2R 1G 1F [9%], IGH-CRLF2 1R 1G 1F [20%] 1R 1G 1F [38%] Normal 1R 0G 1F [65%], Gene IGH-CRLF2 ⌂ 1R 1G 1F [57%] 1R 0G 2F [5%], 2R rearrangement 0G 1F [5%] Gene IGH-CRLF2 ⌂ 1R 1G 1F [94%] 1R 0G 1F [71%] rearrangement BCR-ABL1 [12%] - Gene IGH-CRLF2 ⌂ 1R 1G 1F [76%] Failed* Independent clones rearrangement 1R 1G 1F [72%], IGH-CRLF2 ⌂ 1R 0G 1F [84%] ND 2R 1G 0F [8%] 1R 1G 0F [81%], Gene IGH-CRLF2 ⌂ 1R 0G 2F [80%] 1R 1G 1F [12%] rearrangement IGH-CRLF2 ⌂ 1R 1G 1F [66%] 1R 0G 1F [84%] ND 1R 0G 1F [78%], Gene IGH-CRLF2 ⌂ 1R 1G 1F [75%] 2R 0G 1F [8%] rearrangement 1R 0G 1F [63%], Gene IGH-CRLF2 ⌂ 1R 1G 1F [76%] 1R 1G 1F [16%] rearrangement 1R 0G 1F [79%], Gene IGH-CRLF2 ⌂ 1R 1G 1F [69%] 1R 1G 1F [1%] rearrangement 2R 2G 0F [28%], 1R 0G 2F [45%], IGH-CRLF2 ⌂ Normal 1R 1G 1F [11%] 1R 2G 1F [15%] 1R 0G 1F [67%], Gene P2RY8-CRLF2 0R 0G 2F [99%] 1R 0G 2F [22%] rearrangement P2RY8-CRLF2 ND 1R 0G 1F [78%] ND P2RY8-CRLF2 ND 1R 0G 1F [70%] ND Gene P2RY8-CRLF2 0R 0G 2F [97%] 1R 0G 1F [23%] rearrangement Gene BCR-ABL1 [9%] P2RY8-CRLF2 ND ND* rearrangement P2RY8-CRLF2 0R 0G 2F [98%] 1R 0G 2F [58%] ND

John Wiley & Sons

1R 0G 1F [45%], 1R 0G 1F [75%], Gene P2RY8-CRLF2 2R 0G 0F [11%], 1R 1G 1F [15%], rearrangement 1R 1G 1F [8%] 1R 0G 2F [9%], Gene P2RY8-CRLF2 ND ND* rearrangement Gene ETV6-RUNX1 [UK] P2RY8-CRLF2 ND ND* rearrangement Gene P2RY8-CRLF2 0R 0G 2F [100%] 1R 0G 1F [90%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [99%] 1R 0G 1F [94%] rearrangement 1R 0G 3F [89%], Gene HeH [~88%] P2RY8-CRLF2 0R 0G 2F [93%] 1R 0G 2F [5%] rearrangement 0R 0G 3F [83%], Gene HeH [~73%] P2RY8-CRLF2 1R 0G 2F [96%] 0R 0G 2F [11%] rearrangement 1R 1G 1F [1%], 0R P2RY8-CRLF2 1G 1F [0%], 0R 0G 2R 0G 1F [68%] ND 2F [97%] Gene P2RY8-CRLF2 0R 0G 2F [100%] 1R 0G 1F [89%] rearrangement 0R 0G 3F [55%], Gene P2RY8-CRLF2 2R 0G 1F [65%] 0R 0G 2F [39%] rearrangement Gene P2RY8-CRLF2 ND ND* rearrangement Gene P2RY8-CRLF2 0R 0G 2F [100%] ND* rearrangement Gene iAMP21 [~100%] P2RY8-CRLF2 0R 0G 2F [99%] 1R 0G 1F [95%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [93%] 1R 0G 1F [90%] rearrangement HeH [UK]. Independent Gene P2RY8-CRLF2 0R 0G 2F [100%] 1R 0G 1F [75%] clones rearrangement Gene P2RY8-CRLF2 0R 0G 2F [99%] 1R 0G 1F [49%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [94%] 2R 0G 1F [23%] rearrangement P2RY8-CRLF2 0R 0G 2F [96%] 2R 0G 1F [63%] ND P2RY8-CRLF2 0R 0G 2F [98%] 1R 0G 1F [42%] ND Gene P2RY8-CRLF2 0R 0G 2F [98%] 1R 0G 1F [84%] rearrangement Gene P2RY8-CRLF2 ND Faileded* rearrangement 0R 0G 3F [92%], Gene HeH P2RY8-CRLF2 1R 0G 3F [94%] 0R 0G 2F [7%] rearrangement P2RY8-CRLF2 ND 2R 0G 1F [88%] ND

John Wiley & Sons

0R 0G 1F [68%], 1R 0G 1F [81%], Gene P2RY8-CRLF2 0R 0G 2F [29%] 2R 0G 2F [9%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [93%] 1R 0G 1F [96%] rearrangement 1R 0G 1F [43%], Gene iAMP21 [51%] P2RY8-CRLF2 0R 0G 2F [93%] 2R 0G 1F [7%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [83%] 1R 0G 1F [92%] rearrangement 2R 0G 1F [48%], P2RY8-CRLF2 0R 0G 2F [98%] ND 1R 0G 1F [22%] P2RY8-CRLF2 0R 0G 2F [96%] 1R 0G 2F [77%] Gene P2RY8-CRLF2 0R 0G 2F [97%] 2R 0G 1F [37%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [96%] 1R 0G 1F [95%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [93%] 1R 0G 1F [99%] rearrangement Gene iAMP21 [UK] P2RY8-CRLF2 0R 0G 2F [93%] 2R 0G 2F [92%] rearrangement Gene P2RY8-CRLF2 ND ND* rearrangement 2R 0G 1F [56%], Gene P2RY8-CRLF2 0R 0G 2F [100%] 1R 0G 1F [39%] rearrangement Gene iAMP21 [UK] P2RY8-CRLF2 0R 0G 2F [93%] 1R 0G 1F [86%] rearrangement 0R 0G 3F [86%], Gene HeH P2RY8-CRLF2 2R 0G 3F [72%] 0R 0G 2F [11%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [100%] 2R 0G 1F [59%] rearrangement Gene P2RY8-CRLF2 ND ND* rearrangement 1R 0G 2F [75%], Gene P2RY8-CRLF2 0R 0G 2F [99%] 1R 0G 1F [9%] rearrangement 2R 0G 2F [81%], Gene P2RY8-CRLF2 0R 0G 2F [92%] 1R 0G 2F [14%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [96%] 2R 0G 1F [76%] rearrangement Gene BCR-ABL1 [62%] P2RY8-CRLF2 0R 0G 2F [98%] ND rearrangement Gene P2RY8-CRLF2 0R 0G 2F [92%] 1R 0G 1F [84%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [94%] 1R 0G 1F [91%] rearrangement 1R 0G 1F [33%], Gene P2RY8-CRLF2 1R 0G 1F [66%] 0R 0G 2F [57%] rearrangement P2RY8-CRLF2 0R 0G 2F [90%] 1R 0G 1F [94%] ND

John Wiley & Sons

0R 0G 3F [85%], Gene HeH P2RY8-CRLF2 1R 0G 2F [82%] 0R 0G 2F [14%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [100%] ND* rearrangement Gene HeH P2RY8-CRLF2 0R 1G 3F [87%] 1R 0G 2F [73%] rearrangement Gene iAMP21 [UK] P2RY8-CRLF2 0R 0G 2F [97%] 1R 0G 1F [95%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [99%] 1R 0G 1F [87%] rearrangement Gene iAMP21 [UK] P2RY8-CRLF2 0R 0G 2F [98%] 2R 0G 1F [84%] rearrangement Low level gene P2RY8-CRLF2 0R 0G 2F [98%] 1R 0G 1F [39%] rearrangement 1R 0G 1F [59%], Gene P2RY8-CRLF2 0R 0G 2F [91%] 2R 0G 1F [14%] rearrangement P2RY8-CRLF2 0R 0G 2F [99%] 2R 0G 1F [74%] ND P2RY8-CRLF2 0R 0G 2F [97%] 2R 0G 2F [71%] ND Gene P2RY8-CRLF2 0R 0G 2F [98%] 1R 0G 1F [83%] rearrangement P2RY8-CRLF2 0R 0G 2F [98%] 1R 0G 2F [70%] ND Gene iAMP21 P2RY8-CRLF2 0R 0G 2F [99%] 1R 0G 1F [100%] rearrangement 2R 0G 1F [80%], Gene P2RY8-CRLF2 0R 0G 2F [99%] 1R 0G 1F [11%] rearrangement P2RY8-CRLF2 0R 0G 2F [95%] 1R 0G 2F [87%] Normal Gene P2RY8-CRLF2 0R 0G 2F [95%] 1R 0G 1F [89%] rearrangement Gene iAMP21 P2RY8-CRLF2 0R 0G 2F [92%] 1R 0G 1F [49%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [99%] 1R 0G 1F [88%] rearrangement Gene iAMP21 P2RY8-CRLF2 0R 0G 2F [98%] 1R 0G 2F [95%] rearrangement iAMP21 [75%] P2RY8-CRLF2 ND 1R 0G 1F [72%] ND Gene P2RY8-CRLF2 0R 0G 2F [96%] 1R 0G 1F [69%] rearrangement 2R 0G 1F [74%], Gene P2RY8-CRLF2 0R 0G 2F [99%] 1R 0G 1F [16%] rearrangement 2R 0G 1F [83%], Gene P2RY8-CRLF2 0R 0G 2F [100%] 1R 0G 1F [12%] rearrangement BCR-ABL1 [93%] and Gene P2RY8-CRLF2 0R 0G 2F [99%] ND HeH [UK] rearrangement iAMP21 [70%] P2RY8-CRLF2 0R 0G 2F [96%] 1R 0G 2F [77%] ND Gene P2RY8-CRLF2 0R 0G 2F [99%] 1R 0G 1F [83%] rearrangement

John Wiley & Sons

iAMP21 [95%] P2RY8-CRLF2 0R 0G 2F [99%] 1R 0G 1F [94%] ND Gene iAMP21 [97%] P2RY8-CRLF2 0R 0G 2F [99%] 1R 0G 2F [84%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [96%] 1R 0G 1F [96%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [98%] Faileded rearrangement Gene P2RY8-CRLF2 ND ND* rearrangement Gene P2RY8-CRLF2 0R 0G 2F [96%] 2R 0G 1F [74%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [100%] 1R 0G 1F [89%] rearrangement P2RY8-CRLF2 0R 0G 2F [99%] 1R 0G 2F [79%] Normal 1R 0G 1F [71%], Gene P2RY8-CRLF2 0R 0G 2F [99%] 1R 0G 2F [12%] rearrangement 2R 0G 1F [79%], Gene P2RY8-CRLF2 0R 0G 2F [98%] 1R 0G 1F [7%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [100%] 1R 0G 1F [42%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [98%] 1R 0G 1F [35%] rearrangement 1R 0G 3F [65%], 0R 0G 3F [77%], Gene HeH P2RY8-CRLF2 0R 0G 3F [13%], 0R 0G 2F [27%] rearrangement 1R 1G 2F [8%] Gene P2RY8-CRLF2 0R 0G 2F [95%] 1R 0G 1F [46%] rearrangement 1R 0G 1F [48%], P2RY8-CRLF2 0R 0G 2F [97%] ND 2R 0G 1F [32%] Gene P2RY8-CRLF2 0R 0G 2F [99%] 1R 0G 1F [91%] rearrangement Gene iAMP21 [83%] P2RY8-CRLF2 0R 0G 2F [100%] 1R 0G 1F [72%] rearrangement Gene ETV6-RUNX1 [73%] P2RY8-CRLF2 ND Failed* rearrangement Gene iAMP21 [99%] P2RY8-CRLF2 0R 0G 2F [99%] 1R 0G 1F [43%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [100%] 1R 0G 1F [31%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [99%] 1R 0G 1F [40%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [100%] 1R 0G 2F [72%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [99%] 1R 0G 1F [18%] rearrangement 2R 0G 1F [75%], Gene P2RY8-CRLF2 1R 1G 1F [11%] 1R 0G 1F [11%] rearrangement

John Wiley & Sons

1R 0G 1F [20%], Gene P2RY8-CRLF2 1R 1G 1F [6%], 0R 1R 0G 1F [71%] rearrangement 0G 2F [72%] Gene P2RY8-CRLF2 0R 0G 2F [96%] 1R 0G 1F [90%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [100%] 1R 0G 1F [47%] rearrangement iAMP21 [80%] P2RY8-CRLF2 0R 0G 2F [97%] 1R 0G 1F [75%] ND 0R 0G 3F [5%], 0R 2R 0G 1F [59%], Gene P2RY8-CRLF2 0G 2F [94%] 1R 0G 1F [11%] rearrangement 0R 0G 2F [92%], Gene P2RY8-CRLF2 1R 0G 1F [59%] 0R 0G 3F [7%] rearrangement 2R 0G 1F [30%], 1R 0G 2F [9%], 0R Gene HeH and iAMP21 [70%] P2RY8-CRLF2 2R 0G 1F [65%] 0G 3F [6%], 0R 0G rearrangement 2F [50%] 0R 1G 2F [6%], 0R 2R 0G 1F [72%], Gene P2RY8-CRLF2 0G 2F [86%] 1R 0G 1F [10%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [100%] 1R 0G 1F [60%] rearrangement Gene P2RY8-CRLF2 ND ND* rearrangement 0R 0G 3F [52%], 2R 0G 2F [61%], Gene HeH [60%] P2RY8-CRLF2 0R 0G 2F [44%] 1R 0G 2F [6%] rearrangement Gene ETV6-RUNX1 [92%] P2RY8-CRLF2 0R 0G 2F [99%] 1R 0G 1F [85%] rearrangement Gene P2RY8-CRLF2 0R 0G 2F [96%] 1R 0G 1F [84%] rearrangement 2R 0G 1F [14%], Gene P2RY8-CRLF2 0R 0G 2F [98%] 1R 0G 1F [13%] rearrangement Gene P2RY8-CRLF2 ND ND* rearrangement 2R 0G 1F [9%], 1R Gene P2RY8-CRLF2 0R 0G 2F [97%] 0G 2F [5%] rearrangement Gene P2RY8-CRLF2 ND ND* rearrangement 1R 0G 1F [89%], Gene P2RY8-CRLF2 0R 0G 2F [86%] 2R 0G 1F [6%] rearrangement P2RY8-CRLF2 0R 0G 2F [99%] 2R 0G 1F [79%] Normal Gene P2RY8-CRLF2 0R 0G 2F [98%] 1R 0G 1F [60%] rearrangement 1R 0G 1F [52%], Gene P2RY8-CRLF2 1R 0G 1F [79%] 1R 1G 1F [9%] rearrangement P2RY8-CRLF2 0R 0G 2F [94%] 1R 0G 1F [82%] ND

John Wiley & Sons

# Karyotypes are described according to ISCN (20??). Normal clones have been ommited from abnormal karyotypes

~ Between April 1997 and June 2002, 1725 children and adolescents, aged 1-18 years at diagnosis, were treated on UKALL97/99 trial. Between October 2003 and June 2011, 3182 children and adolescents, aged 1-24 years at diagnosis, were treated on the UKALL2003 trial. Between September 1990 and April 1997, 2090 children and adolescents, aged 1-18 years, were treated on UKALLXI. Between January 1993 and November 2008, 1380 adolescents and adults, aged 15-55 years, were treated on UKALLXII.

Interpretation of MLPA results dependent upon copy number of probesto IL3RA, CSF2RA and CRLF2 in relation to control probes. was associated with a concomittent deletion within the PAR1 region of the rearranged sex chromosome in ten patients.

John Wiley & Sons

JAK2 mutation (other JAK Other gene deletions by MLPA CRLF2 mutation mutation if identified) BTG1; ETV6; IKZF1 Negative ND BTG1; ETV6; IKZF1 Negative (JAK1 - V658F) Negative ND ND ND

IKZF1 Failed ND

ND ND ND ETV6; IKZF1 Negative ND NONE Negative ND IKZF1; PAX5 ND ND EBF1; IKZF1; PAX5 ND ND ND ND ND ND ND ND NONE R683G ND

CDKN2A; CDKN2B; IKZF1; PAX5 ND ND BTG1; CDKN2A; IKZF1; PAX5 ND ND NONE Negative ND

CDKN2A; CDKN2B; IKZF1 F694L ND EBF1; IKZF1 R683S ND BTG1; CDKN2A; IKZF1; PAX5; RB1 ND ND

CDKN2A; CDKN2B; IKZF1 Negative ND ND ND ND ND ND ND ND ND ND BTG1; EBF1; IKZF1 Negative Negative

CDKN2A; CDKN2B; IKZF1; PAX5 ND ND BTG1; CDKN2A; CDKN2B; IKZF1; Negative Negative PAX5 IKZF1 R867Q Negative CDKN2A; CDKN2B; IKZF1 Negative (JAK1- R643R) ND BTG1; EBF1; IKZF1 ND ND ETV6; IKZF1; PAX5; RB1 Negative Negative

John Wiley & Sons

ND Negative Negative

ND ND ND

NONE Negative ND

ND ND ND NONE ND ND NONE ND ND

ND ND ND CDKN2B; IKZF1 ND ND

BTG1; CDKN2B; IKZF1 ND ND

NONE Negative ND

BTG1; ETV6; IKZF1 ND ND

ND ND ND

BTG1; RB1 Negative Negative

ND Negative Negative

IKZF1 ND ND

BTG1; IKZF1; PAX5; RB1 ND ND

ETV6; IKZF1 Negative ND

NONE ND ND

CDKN2B Negative Negative ND ND ND ND ND ND CDKN2A; CDKN2B; PAX5 R683G Negative

CDKN2A; CDKN2B; PAX5 ND ND ND ND ND

John Wiley & Sons

IKZF1; RB1; RCBTB2 ND ND

CDKN2A; CDKN2B ND ND

BTG1; IKZF1; PAX5; RB1 ND ND

CDKN2B; PAX5 ND ND

CDKN2A; CDKN2B; PAX5; IKZF1 Negative ND

CDKN2A; CDKN2B; IKZF1 ND ND

NONE ND ND

ND R683G ND

CDKN2A; CDKN2B; PAX5 Negative ND

ETV6; IKZF1 Negative ND

NONE ND ND

IKZF1 Negative ND

IKZF1 Negative ND BTG1; CDKN2A; CDKN2B; IKZF1; R683G ND PAX5 CDKN2A; CDKN2B; PAX5 R683G ND

NONE R683G ND ND ND ND ND Negative ND CDKN2A; CDKN2B; PAX5 ND ND

NONE ND ND

CDKN2A; CDKN2B; PAX5 Negative ND ND ND ND

John Wiley & Sons

NONE Negative ND

EBF1; IKZF1; PAX5 R683G ND

PAX5 ND ND

CDKN2A; CDKN2B; IKZF1; PAX5 R683G Negative

ND ND ND NONE Negative ND EBF1; IKZF1; PAX5 R683G Aand L680L ND

CDKN2A; CDKN2B; IKZF1; PAX5 Negative ND

PAX5 R683G ND

EBF1; IKZF1 ND ND

PAX5 ND ND

IKZF1 ND ND

EBF1; RB1 Negative ND

NONE Negative ND

NONE ND ND

IKZF1 ND ND

PAX5 Negative ND

CDKN2A; CDKN2B InsAF(GCGTTC)683 ND

PAX5 F694L ND

IKZF1 ND ND

NONE ND ND

CDKN2A; CDKN2B; IKZF1 ND ND

CDKN2A; CDKN2B ND ND

ND ND ND

John Wiley & Sons

IKZF1 R683S ND

CDKN2A; CDKN2B; PAX5 ND ND

NONE ND ND

NONE ND ND CDKN2A; CDKN2B; ETV6; IKZF1; Negative ND PAX5 NONE ND ND

NONE Negative ND

BTG1; EBF1; IKZF1; RB1 ND ND ND ND ND ND ND ND ND Positive ND ND ND ND ND ND ND

CDKN2A; CDKN2B; PAX5 Positive ND CDKN2A; CDKN2B; PAX5; RB1 ND ND EBF1; IKZF1 Negative Negative

BTG1; IKZF1; RB1 ND ND

CDKN2A; CDKN2B; PAX5 Negative ND

CDKN2A; CDKN2B Negative ND ND ND ND ETV6 ND ND

BTG1; ETV6 ND ND

CDKN2B; IKZF1; PAX5 Negative Negative

BTG1 ND ND

ND ND ND

NONE Negative ND

John Wiley & Sons

ND Positive Negative ETV6; RB1 ND ND

BTG1; CDKN2A; CDKN2B Negative Negative

BTG1; CDKN2A; CDKN2B; IKZF1 ND ND

NONE ND ND

CDKN2A; CDKN2B; IKZF1; PAX5 ND ND IKZF1 Negative ND NONE Negative Negative

BTG1; CDKN2A; CDKN2B ND ND

CDKN2A ND ND

NONE ND ND

CDKN2B; CRLF2; PAX5 Positive Negative

ND ND ND CDKN2A; CDKN2B; ETV6; IKZF1; Negative ND PAX5 IKZF1; PAX5 ND ND

PAX5 ND ND

ETV6 Negative ND

NONE ND ND

CDKN2A; CDKN2B; PAX5 Negative ND

CDKN2A; CDKN2B Positive Negative CDKN2A; CDKN2B; IKZF1; PAX5; ND ND RB1 IKZF1 R683S ND

John Wiley & Sons

PAX5; RB1 Negative ND

IKZF1 Negative (JAK1 positive) ND

CDKN2A; CDKN2B Negative Negative

ND ND ND

CDKN2A; IKZF1; PAX5 Negative Negative

NONE R683G ND

ETV6 ND ND

NONE Negative ND

CDKN2A; CDKN2B; IKZF1; PAX5 Negative Negative

CDKN2A; CDKN2B; ETV6; PAX5 ND ND

IKZF1 Negative ND

CDKN2A; CDKN2B; ETV6 Negative Negative

NONE Negative ND

NONE R683A^ ND

CDKN2A; CDKN2B; IKZF1 ND ND

IKZF1 R683G ND

NONE ND ND

BTG1; IKZF1; RB1 ND ND CDKN2A; CDKN2B ND ND NONE ND ND

CDKN2A; CDKN2B; ETV6 ND ND ND ND ND

John Wiley & Sons

Arose together

John Wiley & Sons

Supplementary Table 2. Immunophenotype data collected from 50 patients with CRLF2 -r ALL. RegId Blast count CD34 CD10 CD19 CD20 cIGM CD2 CD3 322 99 0 94 81 23 4 2326 97 22 91 75 10 2 0 2668 90 85 84 85 4 2977 95 77 78 53 0 3396 99 63 17 53 7 34 3410 100 29 96 93 14 3 3450 100 1 66 69 81 28 3836 100 89 92 2 8 3963 99 96 75 2 4002 92 64 65 37 2 4184 92 68 73 71 0 4316 91 11 85 81 0 4 4318 96 72 82 79 16 1 4561 95 88 88 15 5 4623 95 92 92 94 83 1 0 4777 89 35 73 74 71 0 4792 95 81 88 92 0 0 4850 100 80 80 82 4898 99 30 50 4965 91 11 62 66 64 19 5067 90 25 74 83 5626 95 78 77 79 5 0 7015 99 75 89 92 10 0 7108 90 85 83 86 78 0 7114 95 87 63 81 6 0 7583 90 77 90 0 59 0 7643 93 19 92 92 56 0 8274 84 1 72 72 0 0 8367 97 90 76 96 1 8 0 8765 91 85 88 88 43 3 0 8767 97 46 93 72 53 5 9534 96 7 90 90 56 7 0 10326 100 70 95 90 1 0 10924 87 84 85 85 9 0 11403 98 11 91 89 11543 96 74 77 77 15 0 11564 95 20 55 59 17 19 0 11734 99 93 0 93 0 12477 98 58 80 81 45 5 2 19599 91 82 82 76 1 2 0 20449 62 42 43 47 12 4 20638 99 69 0 0 21342 95 87 86 8 21869 95 76 92 91 94 3 0 22011 95 19 93 92 11 0 22465 95 86 95 95 48 2 0

John Wiley & Sons

23853 95 67 94 44 0 23964 98 88 94 94 0 24066 96 13 94 95 0 24520 98 97 98 98 94 0

Shades of grey mark increasing positivity for antigen staining. White - negative staining observed in <20% of blasts. Light grey through dark grey depicting increasing percentage of blasts staining positive for the antigen tested.

John Wiley & Sons

-r ALL. CD7 CD33 CD13 5 1 0 4 4 3 5 2 1 2 32 10 25 2 8 2 4 0 19 0 1 8 1 0 4 10 4 2 6 2 1 9 0 0 76 12 8 16 1 3 5 3 3 9 0 0 0 5 6 1

17 0 0 6 0 2 6 12 3 10 3 2 3 27 2 7 3 2 0 0 0 0 0 0 0 1 1 1 3 6 43 0 0 6 1 1 2 1 1 2 3 2

12 39 6 1 1 2 5 1 44 0 0 0 0 9 0 3 10 4 1 9 6 7 0 0 1 1 1

John Wiley & Sons

0 15 0 0 0 0 12 0 0 0

John Wiley & Sons

Supplementary Table 7 – Somatic CNA identified by SNP 6.0 array Copy Sample Loss/Gain Chr Start End Size (kb) Number P2RY8-CRLF2 5674^ 1 Loss 1 q31.3 q31.3 73 0 Loss 7 q34 q34 155 1 Loss 14 q32.33 q32.33 376 1 Loss 21 q11.2 q21.2 11663 3 Gain 21 q21.2 q22.11 6814 4 Gain 21 q22.11 q22.11 356 3 Gain 21 q22.11 q22.11 872 4 Gain 21 q22.11 q22.2 6539 3 Gain 21 q22.2 q22.3 1306 1 Loss 21 q22.3 q22.3 5435 2 Gain X p22.33 q28 1 Loss X p22.33 p22.33 185 9534

1 Loss 7 p14.1 p14.1 58

3 Gain 8 q24.21 q24.21 144 0 Loss 9 p21.3 p21.3 70 1 Loss 12 q21.33 q21.33 265 0/1 Loss 14 q11.2 q11.2 140

1 Loss 14 q32.33 q32.33 141

1 Loss 14 q32.33 q32.33 651 1 Loss 20 q13.12 q13.12 207 1 Loss X p22.33 p22.33 185 10924^ 3 Gain 3 q29 q29 93 4 Gain 6 p21.32 p21.32 62 1 Loss 7 p14.1 p14.1 121 3 Gain 7 p14.1 p14.1 69 1 Loss 7 p12.2 p12.2 47 1 Loss 10 q21.3 q22.1 62 3 Gain 14 q32.2 q32.2 116 1 Loss 14 q32.33 q32.33 189 3 Gain 14 q32.33 q32.33 229 0 Loss 16 q23.1 q23.1 9 3 Gain 17 p13.3 q25.3 1 Loss 20 q12 q12 52 11200^ 3 Gain 1 p34.3 p34.3 38 1 Loss 1 q41 q44 33818

3 Gain 3 p12.3 p12.3 453

John Wiley & Sons

3 Gain 3 q21.2 q21.2 185 1 Loss 4 q22.3 q22.3 73 1 Loss 7 p14.1 p14.1 66 3 Gain 8 p23.1 p23.1 689 1 Loss 9 p21.3 p21.3 721 1 Loss 12 q24.11 q24.11 45 3 Gain 13 q11 q11 291 1 Loss 14 q11.2 q11.2 96 1 Loss 14 q24.2 q24.2 59 3 Gain 14 q24.3 q24.3 55 1 Loss 14 q32.33 q32.33 85

0 Loss 14 q32.33 q32.33 116

1 Loss 16 p12.2 p12.2 139 1 Loss 17 q21.31 q21.31 53 3 Gain 17 q22 q22 29788 3 Gain 19 p12 p12 57 3 Gain 21 p11.2 q11.2 3 Gain X p22.33 p22.33 1 Loss X p22.33 p22.33 185 11403^ 4 Gain 1 q43 q43 64 1 Loss 2 q21.1 q21.1 60 3 Gain 6 q26 q26 103 1 Loss 7 q31.2 q31.2 34 1 Loss 14 q11.2 q11.2 64

1 Loss 14 q32.33 q32.33 101

1 Loss 14 q32.33 q32.33 219 1 Loss 17 q21.31 q21.31 59 1 Loss 20 q11.21 q11.21 29 4 Gain 21 p11.1 q11.2 1 Loss X p22.33 p22.33 429 11538 1 Loss 5 q33.1 q33.1 4 1 Loss 6 p22.2 p22.2 33

1 Loss 7 p14.1 p14.1 70

0 Loss 7 q34 q34 155 1 Loss 7 p12.2 p12.2 48 1 Loss 9 p21.3 p21.3 1190 0 loss 9 p21.3 p21.3 29 1 Loss 9 p13.2 p13.2 298 1 Loss 12 p13.2 p13.2 758 0 Loss 12 p13.2 p13.2 21 0 Loss 14 q11.2 q11.2 104 1 Loss 14 q31.3 q32.11 368 1 Loss 14 q32.11 q32.11 567

John Wiley & Sons

1 Loss 14 q32.11 q32.12 1136 1 Loss 14 q32.33 q32.33 205 0 Loss 22 q11.22 q11.22 77

1 Loss 22 q11.22 q11.22 93

1 Loss X p22.33 p22.33 185 11564 1 Loss 3 p23 p23 71 1 Loss 3 q13.11 q13.13 2691 1 Loss 3 q13.2 q13.2 156 1 Loss 5 q11.2 q11.2 2006

1 Loss 7 p14.1 p14.1 83

1 Loss 7 p12.2 p12.2 102 0 Loss 7 q34 q34 448 1 Loss 9 p13.2 p13.2 75 1 Loss 12 p13.2 p13.2 74 1 Loss 14 q11.2 q11.2 86

3 Gain 14 q32.33 q32.33 99

1 Loss 18 q12.3 q12.3 70 1 Loss 19 q13.3 q13.3 34

1 Loss 21 q21.1 q21.1 2733

4 Gain 21 q21.1 q21.2 709 3 Gain 21 q21.2 q21.2 226 4 Gain 21 q21.2 q22.3 19561 1 Loss X p22.33 p22.33 429 11706

1 Loss 7 p14.1 p14.1 59

1 Loss 7 q34 q34 162 1 Loss 12 p13.2 p13.2 88 1 Loss 12 p13.2 p13.2 58 1 Loss 12 p13.2 p13.2 259 1 Loss 12 p13.1 p13.1 68 1 Loss 14 q32.33 q32.33 222 3 Gain 14 q32.33 q32.33 80 1 Loss 14 q11.2 q11.2 28 3 Gain 21 q11.2 q21.1 4955 3 Gain 21 q21.1 q21.1 98 3 Gain 21 q21.1 q21.1 230 3 Gain 21 q21.1 q21.1 62 3 Gain 21 q21.1 q21.1 53 4 Gain 21 q21.1 q21.1 351

3 Gain 21 q21.1 q21.1 891

3 Gain 21 q21.1 q21.11 7884

John Wiley & Sons

4 Gain 21 q22.11 q22.3 14290 1 Loss 21 q22.3 q22.3 2169 20638 1 Loss 6 p22.2 p22.2 141 1 Loss 9 p22.3 p22.2 1369

1 Loss 9 p21.3 p21.2 6040

1 Loss 9 p21.1 p21.1 1861

1 Loss 13 q21.2 q21.2 702 1 Loss X p22.33 p22.33 170 1 Loss X p21.1 p21.1 455 20753

0 Loss 2 p11.2 p11.2 64

0 Loss 2 p11.2 p11.2 177 1 Loss 6 p22.2 p22.2 241 1 Loss 7 p12.2 p12.2 66 1 Loss 9 p13.2 p13.2 101 1 Loss 14 q11.2 q11.2 87 1 Loss 14 q32.33 q32.33 381 1 Loss 14 q32.33 q32.33 163 1 Loss 22 q11.22 q11.22 141 3 Gain X p22.33 q28 1 Loss X p22.33 p22.33 185 21567 3 Gain 4 q13.2 q13.2 79 3 Gain 5 p15.33 q35.3

1 Loss 7 p14.1 p14.1 67

1 Loss 7 q34 q34 295 3 Gain 9 q24.3 q34.3 3 Gain 10 p15.3 q26.3 1 Loss 12 p13.31 p13.31 67 1 Loss 12 p13.2 p13.2 100 1 Loss 12 p13.2 p13.2 185 1 Loss 12 p12.1 p12.1 72 1 Loss 12 q23.3 q23.3 177 3 Gain 14 q11.2 q32.33 0 Loss 14 q11.2 q11.2 1 Loss 14 q32.33 q32.33 290 1 Loss 14 q32.33 q32.33 317 3 Gain 17 p13.3 q25.3 1 Loss 17 q23.3 q24.1 78

3 Gain 21 q21.1 q21.1 2343

1 Loss 21 q21.1 q21.1 1222

John Wiley & Sons

1 Gain 21 q21.1 q21.1 1750

1 Loss 21 q21.1 q22.3 20410 1 Loss 21 q22.3 q22.3 4053 3 Gain X p22.33 q28 1 Loss X p22.33 p22.33 185 21819

1 Loss 7 p14.1 p14.1 81

1 Loss 7 p12.2 p12.2 46 1 Loss 9 p24.3 p21.3 21690 0 Loss 9 p21.3 p21.3 164 1 Loss 13 q14.11 q14.11 158 1 Loss 14 q11.2 q11.2 68 1 Loss 17 q11.2 q11.2 93 1 Loss 20 q11.21 q13.13 15485 1 Loss 22 q11.22 q11.22 36 1 Loss X p22.33 p22.33 415 21991 1 Loss 3 p14.2 p14.2 1290 1 Loss 3 q13.2 q13.2 168 1 Loss 3 q26.32 q26.32 436 1 Loss 6 q14.1 q15 9552

1 Loss 7 p14.1 p14.1 81

0 Loss 7 q34 q34 132

1 Loss 7 q36.2 q36.3 406 1 Loss 7 p14.1 p14.1 38 1 Loss 9 p21.3 p21.3 56 1 Loss 12 p13.2 p13.2 70 3 Gain 12 q14.2 q14.2 125

3 Gain 13 q31.1 q34 33603

0 Loss 14 q11.2 q11.2 67 1 Loss 14 q24.2 q24.2 143 0 Loss 14 q32.33 q32.33 160

1 Loss 14 q32.33 q32.33 68

0 Loss 14 q32.33 q32.33 171

1 Loss 22 q11.22 q11.22 221

3 Gain 22 q11.22 q11.22 175 1 Loss X p22.33 p22.33 185 0 Loss X p22.2 p22.2 205

2 Gain X q25 q28 29223

John Wiley & Sons

21918 1 Loss 1 q43 q42 329 3 Gain 3 p26.3 q29

1 Loss 7 p14.1 p14.1 80

1 Loss 7 p12.2 p12.2 135 3 Gain 14 q11.2 q32.33 1 Loss 14 q11.2 q11.2 119 1 Loss 14 q32.33 q32.33 233 3 Gain 17 p13.3 q25.3 1 Loss 17 q22 q22 122 3 Gain 21 p11.2 q22.3 2 Loss X p22.33 p22.33 168 22452 1 Loss 3 q21.3 q21.3 66 1 Loss 5 q23.1 q23.1 62 1 Loss 7 q34 q34 144 1 Loss 7 p14.1 p14.1 38 1 Loss 7 p12.2 p12.1 100 1 Loss 12 p13.2 p13.2 218 1 Loss 14 q11.2 q11.2 178 1 Loss 14 q32.33 q32.33 145 IGH-CRLF2 2326^ 1 Loss 1 p34.2 p34.2 68 1 Loss 1 q25.1 q25.1 187 1 Loss 1 q32.1 q32.1 149 1 Loss 2 q32.2 q32.2 67 1 Loss 4 q12 q12 215 1 Loss 6 p25.3 p25.3 65 1 Loss 6 p22.2 p22.2 146 1 Loss 7 p14.1 p14.1 92 1 Loss 7 p12.2 p12.2 126 3 Gain 9 q33.1 q33.1 50 1 Loss 9 q33.3 q33.3 50 1 Loss 12 p13.2 p13.2 56 1 Loss 12 q21.33 q21.33 273 1 Loss 14 q11.2 q11.2 913 0 Loss 14 q11.2 q11.2 64

1 Loss 14 q32.33 q32.33 141

0 Loss 14 q32.33 q32.33 110

0 Loss 14 q32.33 q32.33 58

0 Loss 14 q32.33 q32.33 181

1 Loss 22 q11.22 q11.22 70

John Wiley & Sons

7311^ 1 Loss 1 p35.3 p35.3 50 1 Loss 1 p31.1 p31.1 56 1 Loss 3 p22.3 p22.3 84 1 Loss 3 p21.31 p21.31 70 1 Loss 4 p14 p14 64 3 Gain 5 q11.2 q11.2 83 1 Loss 5 q33.3 q33.3 540 1 Loss 6 q22.31 q22.31 169 0 Loss 7 p14.1 p14.1 87 1 Loss 7 p12.2 p12.2 132 4 Gain 7 q11.23 q11.23 55 1 Loss 7 q34 q34 120 1 Loss 8 p11.21 p11.21 58 1 Loss 9 q33.3 q33.3 50 1 Loss 9 q33.3 q33.3 101 3 Gain 9 q34.2 q34.2 124 1 Loss 10 p11.22 p11.22 59 4 Gain 10 q11.22 q11.22 188 1 Loss 11 q13.4 q13.4 58 1 Loss 11 q22.1 q22.1 47 1 Loss 12 p13.2 p13.2 50 1 Loss 12 q12 q13.11 454 1 Loss 12 q24.12 q24.12 92 3 Gain 14 q21.2 q21.2 58

0 Loss 14 q32.33 q32.33 159

0 Loss 14 q32.33 q32.33 61

0 Loss 14 q32.33 q32.33 191

0 Loss 14 q32.33 q32.33 96

1 Loss 14 q13.1 q13.1 40 3 Gain 15 q11.2 q11.2 333 3 Gain 15 q11.2 q11.2 82 3 Gain 16 p13.3 p13.3 53 1 Loss 17 q11.2 q11.2 63 1 Loss 17 q12 q12 40 1 Loss 17 q25.3 q25.3 43 3 Gain 18 q21.1 q21.1 69 1 Loss 18 q21.3 q21.3 33 1 Loss 19 p13.3 p13.3 29 3 Gain 22 q13.2 q13.2 53 1 Loss 22 q13.2 q13.2 54 11543

John Wiley & Sons

1 Loss 5 q33.3 q33.3 582 1 Loss 7 p12.2 p12.1 97 1 Loss 11 q14.3 q14.3 428 1 Loss 12 q21.33 q21.33 258

1 Loss 14 q32.33 q32.33 71

1 Loss 14 q11.2 q11.2 27 3 Gain 21 p11.2 q22.3 2 Gain X q21.33 q28 60209 19599 1 Loss 3 q13.2 q13.2 75 1 Loss 7 p15.1 p14.3 1501

0 Loss 7 p14.1 p14.1 2707

1 Loss 7 p14.1 p12.1 8085 0 Loss 7 q34 q34 131 1 Loss 7 p22.3 p22.3 41 1 Loss 13 q12.3 q12.3 66 1 Loss 13 q14.11 q14.11 160 1 Loss 14 q11.2 q11.2 65

0 Loss 14 q32.33 q32.33 129

0 Loss 14 q32.33 q32.33 101 1 Loss 19 q13.12 q13.12 21 1 Loss 22 q11.22 q11.22 33 20033^ 1 Loss 1 p13.3 p13.3 7 1 Loss 3 p24.3 p24.3 51 1 Loss 3 q13.12 q13.12 303 3 Gain 4 q13.2 q13.2 114 0 Loss 5 q35.3 q35.3 41 1 Loss 6 p22.2 p22.2 116

1 Loss 6 p22.1 p22.1 81

3 Gain 6 q27 q27 257 1 Loss 8 p11.22 p11.22 153 0 Loss 9 p21.3 p21.3 113 1 Loss 9 p13.2 p13.2 22 1 Loss 10 q25.1 q25.1 103 1 Loss 14 q11.2 q11.2 621

1 Loss 14 q32.33 q32.33 90

1 Loss 14 q32.33 q32.33 101

3 Gain 17 q21.31 q21.31 163

3 Gain 19 q13.41 q13.41 6

John Wiley & Sons

1 Loss 19 p13.3 p13.3 43 1 Loss 19 q13.41 q13.41 40 1 Loss X p21.1 p21.1 716 20984^ 1 Loss 1 q44 q44 61 3 Gain 4 p16.2 p16.2 31 1 Loss 5 q33.3 q33.3 334 1 Loss 5 q14.3 q14.3 22 1 Loss 7 p12.2 p12.2 107

7 Loss 7 p14.1 p14.1 48

1 Loss 10 q25.1 q25.1 89 1 Loss 12 q21.33 q21.33 258 1 Loss 14 q11.2 q11.2 86 1 Loss 14 q11.2 q11.2 35 1 Loss 20 p12.2 p12.2 42 3 Gain 22 q11.23 q12.1 250 1 Loss 22 q12.2 q12.2 192 0 Loss X p22.31 p22.31 178 21245 1 Loss 2 p11.2 p11.2 98 1 Loss 3 q13.2 q13.2 169 1 Loss 4 q21.3 q21.3 64 1 Loss 5 q14.3 q14.3 53 1 Loss 5 q33.3 q33.3 82 1 Loss 6 p22.2 p22.2 84 1 Loss 6 q23.3 q23.3 64 1 Loss 7 p14.1 p14.1 108 1 Loss 7 p12.2 p12.2 81 1 Loss 7 q21.2 q21.2 150

1 Loss 7 q34 q34 139

1 Loss 9 p13.2 p13.2 94 1 Loss 10 q25.1 q25.1 99 1 Loss 11 q12.1 q12.1 65 1 Loss 12 p13.2 p13.2 38 1 Loss 13 q14.11 q14.11 194 1 Loss 13 q14.2 q14.2 90

0 Loss 14 q32.33 q32.33 177

0 Loss 14 q11.2 q11.2 89 1 Loss 15 q21.3 q21.3 304 1 Loss 21 q22.12 q22.12 339

1 Loss 22 q11.22 q11.22 146

1 Loss 22 q11.22 q11.22 400

John Wiley & Sons

1 Loss X p11.4 p11.4 125 21470 1 Loss 1 q32.1 q32.1 267 1 Loss 6 p22.2 p22.2 241 1 Loss 6 p22.1 p22.1 100 1 Loss 7 p12.2 p12.2 119 1 Loss 7 p14.1 p14.1 38 1 Loss 12 p13.2 p13.2 158 1 Loss 13 q12.3 q12.3 350 0 Loss 14 q11.2 q11.2 86 0 Loss 14 q32.33 q32.33 104 0 Loss 14 q32.33 q32.33 67 1 Loss 15 q26.1 q26.1 82 1 Loss 20 p12.2 p12.2 36 1 Loss 22 q11.22 q11.22 471

3 Gain X p22.33 q28

21572^ 1 Loss 2 p21 p21 166 1 Loss 4 q31.21 q31.21 306 1 Loss 5 q31.3 q31.3 268 1 Loss 6 p22.2 p22.2 161 1 Loss 6 q22.31 q22.31 365 1 Loss 6 q25.1 q25.1 205 0 Loss 7 p14.1 p14.1 93 1 Loss 7 p12.2 p12.2 108 0 Loss 7 q34 q34 152 1 Loss 9 p13.2 p13.2 118 1 Loss 10 q25.1 q25.1 97 1 Loss 11 q12.1 q12.1 50 3 Gain 12 p11.21 p11.21 174 1 Loss 12 q21.33 q21.33 255 1 Loss 12 q23.3 q23.3 110 1 Loss 12 q14.3 q14.3 47 1 Loss 13 q14.2 q14.2 78 0 Loss 14 q11.2 q11.2 332 0 Loss 14 q32.33 q32.33 224 1 Loss 16 q22.2 q22.2 69 0 Loss 20 p12.2 p12.2 41 1 Loss X p22.33 p22.33 429 1 Loss X p11.4 p11.4 131 22570 3 Gain 1 p32.2 p32.2 215 1 Loss 1 q32.1 q32.1 73 3 Gain 2 q14.3 q14.3 82 3 Gain 3 p14.2 p14.2 111 1 Loss 3 q25.1 q25.1 95 1 Loss 3 q25.31 q25.31 59

John Wiley & Sons

1 Loss 3 q29 q29 53 1 Loss 3 q27.1 q27.1 48 1 Loss 5 q31.1 q31.1 124

1 Loss 6 p21.32 p21.32 154

1 Loss 6 p21.1 p21.1 110 1 Loss 6 p21.1 p21.1 54 3 Gain 6 q26 q26 60

1 Loss 7 p14.1 p14.1 58

3 Gain 7 p11.2 p11.2 289 0 Loss 7 q34 q34 146 3 Gain 7 q33 q33 66 3 Gain 8 p11.21 p11.21 356 1 Loss 8 q24.3 q24.3 108 3 Gain 9 q31.2 q31.2 176 3 Gain 9 q33.1 q33.1 61 1 Loss 9 q33.3 q33.3 246 3 Gain 10 q22.2 q22.2 142 3 Gain 10 q25.1 q25.1 112 3 Gain 11 q25 q25 112 0 Loss 11 p12 p12 41 3 Gain 12 q24.21 q24.21 162 1 Loss 14 q21.3 q21.3 52 3 Gain 18 q12.2 q12.2 469

1 Loss 22 q11.22 q11.22 51

3 Gain X p22.33 q28

24390^ 1 Loss 1 q44 q44 61 1 Loss 1 p13.3 p13.3 8

1 Loss 7 p14.1 p14.1 54

1 Loss 10 p12.1 p12.1 95

3 Gain 11 p15.5 q25

3 Gain 12 p11.21 p11.21 174

3 Gain 14 q11.2 q32.33

1 Loss 14 q11.2 q11.2 65 19 Loss 19 q13.41 q13.41 6 4 Gain 21 p11.2 q22.3 3 Gain 22 q11.21 q11.21 131 3 Gain X p22.33 q28

In those with a matched sample, germline variants were identified and excluded. In those patients without remission DNA, four remission arrays from other CRLF2 -d patients were used to remove as many germline variants as possible.

John Wiley & Sons

* If >10 genes present only the first and last genes in the region are listed. ^ Patients without a matched remission sample.

John Wiley & Sons

Start End Genes Involved Position Position

CFHR4 196823305 196895835 MTRNR2L6, PRSS1 142331340 142486033 IGHV6-1, IGHV2-26 106401664 106777331 C21orf15……..NCRNA00158 15099272 26761788 NCRNA00158……..NCRNA00159 26763360 33577048 C21orf25……..C21orf63 33577048 33932917 TCP10L……..IFNGR2 33932917 34804635 IFNGR2……..PCP4 34804635 41343689 DSCAM……..BACE2 41343689 42649740 FAM3B……..PRMT2 (Telomere) 42662222 48096945 WHOLE CHROMOSOME 0 155270560 CSF2RA, IL3RA, ASMTL, P2RY8 1455800 1640371

TRGJP2, TRGC1, TARP, TRGJ1, TRGJP, TRGJP, 38294089 38352227 TRGJP1, TRGV11, TRGV10 CCDC26 130570088 130714155 MTAP, CDKN2A, CDKN2B, DMRTA1 21811533 22939234 BTG1 92278448 92543185 TRDV1……..TRAJ29 22564247 22983223

IGHV6-1, ADAM6, IGHV1-2, IGHV1-2, IGHV1- 106401664 106542265 3, IGHV4-4, IGHV2-5, IGHV3-7, IGHV1-8

IGHV3-9……..IGHV2-70 106547495 107198332 ZMYND8, NCOA3 45933132 46139821 IL3RA, ASMTL, P2RY8 (P2RY8-CRLF2) 1455800 1640371

SDHAP2, MIR570, MU20, MUC4 195383130 195476085 HLADRB5 32456671 32518757 TRGC2……..TRGV3 38280224 38400945 POU6F2 39216717 39285717 IKZF1 EX4-7 50411804 50458546 CCAR1, STOX1 70539586 70601149 BCL11B 99612404 99728888 IGHV1-2……..IGHV3-16 106450487 106639463 IGHV4-39……..IGHV4-61 106872050 107100597 WWOX 78372041 78381291 WHOLE CHROMOSOME 0 81195210 PTPRT 41205911 41257630

STK40 36818553 36856658 KCTD3……..PGBD2 215432121 249250620 FAM86DP, MIR1324, FRG2C, MIR4273, 75441235 75894520 ZNF717

John Wiley & Sons

MIR548I1 125424460 125608962 BMPR1B 95763607 95836848 TRGV10, TRGV9, TRGV8, TRGV5, TRGV4 38332294 38398047 EXT1……..MTSS1 11881847 12570377 MLLT3, U4, KIAA1797 20039441 20760073 CORO1C 109047885 109093010 BTG1 19135279 19426562 IGHD, IGHJ 22864313 22959826 MED6, AK093892, TTC9 71058974 71118273 HEATR4, ACOT1, ACOT2, ACOT4 74001111 74056519 IGHG4, IGHG2, ELK2AP 106082577 106167475 IGHV4-31, IGHV3-33, IGHV4-34, IGHV3-35, 106802027 106918096 IGHV3-38, IGHV4-39 LOC653786, MIR548D2 22587453 22726214 ARL17A, NSFP1, NSF 44653385 44705963 KIF2B……..FLJ43681 51406705 81195210 ZNF492 22799267 22856567 WHOLE CHROMOSOME 0 48129895 WHOLE CHROMOSOME 0 155270560 CSF2RA, IL3RA, ASMTL, P2RY8 1455800 1640371

LOC731275 243163830 243228135 INO80D 131486187 131546541 HLA-DR 161026187 161128947 CFTR 117157489 117191536 TRDD1……..TRAJ48 22895875 22959925 IGHV1-3, IGHV4-4, IGHV2-5, IGHV3-7, IGHV1- 106460890 106561429 8, IGHV3-9 IGHV4-31……..IGHV3-49 106802041 107020886 NSFP1, NSF 44647131 44705963 TPX2 30363571 30392457 WHOLE CHROMOSOME 0 48129895 CSF2RA, IL3RA, ASMTL, P2RY8 1211508 1640371

DCTN4, C5orf62 150121420 150159991 BTN3A1, BTN2A3 26407115 26440084 TRGV11, TRGV10, TRGV9, TRGV8, TRGV5, 38331207 38400945 TRGV4, TRGV3 MTRNR2L6, PRSS1 142331340 142486033 IKZF1 Ex4-6 50411786 50459916 IFNW1……..UBA52P6 21091240 22280929 CDKN2A, CDKN2B 21976845 22005387 PAX5, MELK 36598289 36896425 ETV6, BCL2L14, LRP6, MANSC1 11751425 12509314 ETV6 12039506 12060981 TRDV2……..TRAJ48 22855683 22959826 FOXN3 89461346 89829598 FOXN3, PRO1768, C14orf143 89834123 90401490

John Wiley & Sons

RPS6KA5…….. FBLN5 91298236 92434463 ADAM6 106401664 106606843 IGLV8-61 22386434 22462979

IGLV4-60, IGLV6-57, IGLV11-55, IGLV10-54 22502838 22596313

IL3RA, ASMTL, P2RY8 (P2RY8-CRLF2) 1455800 1640371

STTB3 31579687 31650811 CBLB……..MYH15 105452593 108143738 CD200, BTLA 112055596 112211801 DHX29……..GPBP1 54591428 56597243 TRGV11, TRGV10, TRGV9, TRV8, TRGV5, 38317558 38400945 TRGV4, TRGV3 IKZF1 50355207 50457188 MTRNR2L6, PRSS1 142014445 142462572 PAX5 36946136 37020988 ETV6 11878118 11952424 TRCAD 22892461 22978775 IGHV3-11, IGHV3-13, IGHV3-15, IGHV3-16, 106567088 106666128 IGHV1-18 LOC647946 37296926 37366632 ZNF570 37962477 37996089 LINC00320, NCAM2, LINC00317, 20822916 23556002 LOC101927843 NO GENES (iAMP21 region) 23558063 24267266 NO GENES (iAMP21 region) 24274679 24500841 LINC00158……..PDE9A (iAMP21 region) 24528709 44089863 CSF2RA, IL3RA, ASMTL, P2RY8 1211508 1640371

TRGC1, TARP, TRGJ1, TRGJP, TRGJP, TRGJP1, 38297823 38357133 TRGV11, TRGV10, TRGV9 MTRNR2L6, PRSS1, PRSS2, TRY6 142331340 142493638 ETV6 11844691 11932298 ETV6 11977745 12035664 BLC2L14, LRP6 12059452 12318911 GRIN2B 13942295 14010070 IGHV6-1, IGHV3-13 106377902 106600135 IGHV3-73, IGHV3-74, IGHV7-81 107205722 107285437 TRDV2, TRDD1, TRDD2, TRDD3 22889735 22918194 MIR3156-3……..TMPRSS15 14716617 19671647 NO GENES (iAMP21 region) 20278820 20376884 NO GENES (iAMP21 region) 21150384 21380574 NO GENES (iAMP21 region) 21621171 21682852 NO GENES (iAMP21 region) 21716987 21769694 LINC00320 21846633 22197502 NCAM2, LINC00317, LINC01425, 22790919 23682234 LOC101927843, LINC00308 D21S2088E……..CLDN17 23684657 31568760

John Wiley & Sons

KRTAP19-1……..TSPEAR 31628784 45918553 TSPEAR……..PRMT2 45928055 48096945

HIST1H2BC……..HIST1H2BH 26121153 26262006 C9orf93, BNC2, CNTLN 15541933 16911091 MLLT3……..CDKN2A, CDKN2BAS, 20356527 26396765 CDKN2B……..TUSC1 ACO1, DDX58, TOPORS, NDUFB6, TMEM215, 30252858 33022000 APTX TDRD3 60861459 61563542 IL3RA, ASMTL, P2RY8 (P2RY8-CRLF2) 1455800 1626271 DMD 33281199 33736589

IGKV2D-26, IGKV2D-24, IGKV6D-21, IGKV3D- 90023468 90087106 20 IGKV6D-41……..IGKV1D-8 90090523 90267074 HIST1H2AB……..HIST1H2BI 26033828 26274498 IKZF1 Ex4-8 50411762 50477888 PAX5 36930536 37031876 TRDV2……..TRAJ59 22858966 22946380 IGHV6-1……..IGHV4-28 106401664 106783032 IGHV3-43……..IGHV1-58 106918096 107081339 IGLV4-69, IGLV8-61, IGLV4-60 22382096 22523271 WHOLE CHROMOSOME 0 155270560 IL3RA, ASMTL, P2RY8 (P2RY8-CRLF2) 1455800 1640371

UGT2B28 70114455 WHOLE CHROMOSOME 0 TRGV11, TRGV10, TRGV9, TRGV8, TRGV5, 38331207 TRGV4 MTRNR2L6, PRSS1 142198814 WHOLE CHROMOSOME 0 WHOLE CHROMOSOME 0 ANO2 5923633 KLRAP1, MAGOHB 10655595 PRH1, PRR4 11152029 ABCC9 21997874 CHST11 104864883 WHOLE CHROMOSOME 0 TRDD1……..TRAJ48 22864313 IGHV1-3……..LINC00226 106460890 IGHV3-43……..IGHV3-74 106918036 WHOLE CHROMOSOME 0 SMURF2 62590575 LINC01549, CXADR, BTG3, C21orf91, CHODL, 18328191 TMPRSS15, LOC101927797 NO GENES (iAMP21 region) 20678357

John Wiley & Sons

LINC00320, NCAM2, LINC00317, LINC01425, 21900893 LOC101927843, LINC00308 NCRNA00158...... PDE9A 23666987 PDE9A……..PRMT2 44077237 WHOLE CHROMOSOME 0 IL3RA, ASMTL, P2RY8 (P2RY8-CRLF2) 1455800

TRGJP, TRGV11, TRGV10, TRGV9, TRGV8, 38311098 38392024 TRGV5 IKZF1 Ex4-7 50412048 50458503 WASH1……..PAX5 [dic(9;20)] 192129 36932342 MTAP, C9orf53, CDKN2A 21829139 21993390 SERP2, TSC22D1 44849912 45007697 TRDD1……..TRAJ48 22892461 22960820 NF1 29545141 29638540 C20orf112……..PCMTD2 [dic(9;20)] 31031755 62956141 IGLV10-54, VPREB1 22569186 22604780 IL3RA, ASMTL, P2RY8 (P2RY8-CRLF2) 1211508 1626271

FHIT 60066610 61356478 CD200, BTLA 112053246 112220798 TBL1XR1 176914481 177350384 FAM46A……..PDCD2 82036764 170982522 TARP, TRGJP, TRGV11, TRGV10, TRGV9, 38311098 38392024 TRGV8, TRGV5 MTRNTRBV24-1; MTRNR2L6; TRBV25-1; TRBV27; TRBV28; TRVB29-1; PRSS1; 142354519 142486033 PRSS3P2 PAXIP1, HTR5A, INSIG1 154762322 155168020 TRGV11, TRGV10 38317346 38355358 CDKN2A/B 21949749 22005382 ETV6 Ex1 11734168 11803844 DPY19L2 63919488 64044048 115108385 SLITRK1……..ZNF828 (Telomere) 81504843

TRDD1……..TRAJ48 22892461 22959826 DPF3 73213814 73357254 IGHV6-1……..IGHV3-9 106401664 106561429

IGHV4-34, IGHV3-35, IGHV3-38, IGHV4-39 106828125 106896603

IGHV3-43…….IGHV4-59 106918036 107089472 IGLV4-69, IGLV8-61, IGLV4-60, IGLV6-57, 22382096 22602691 IGLV11-55, IGLV10-54, VPREB1 BMS1P20……..IGLV1-40 22602778 22778147 IL3RA, ASMTL, P2RY8 (P2RY8-CRLF2) 1455800 1640371 FAM9C 13009825 13214451 12604699 155270560 STAG2……..IL9R (Telomere) 0

John Wiley & Sons

RGS7, FH, KMO, OPN3, CHML, WDR64 241447459 241886487 WHOLE CHROMOSOME 0 198022430 TRGV11, TRGV10, TRGV9, TRGV8, TRGV5, 38317679 38397980 TRGV4 IKZF1 50347238 50482012 WHOLE CHROMOSOME 0 107349540 TRDV2……..TRAJ10 22883939 23003305 IGHV2-5……..IGHV3-21 106482116 106715489 WHOLE CHROMOSOME 0 81195210 MSI2 55355599 55477357 WHOLE CHROMOSOME 0 48129895 IL3RA, CSF2RA, P2RY8 1457073 1625201

KBTBD12 127689620 127755667 SEMA6A 115833067 115894579 MTRNR2L6, PRSS1, 142331340 142474939 TRGV11, TRGV10 38317346 38355358 IKZF1 Ex4-8 50411038 50510800 U7, ETV6 ……..CDKN1B, APOLD1 11592125 12923530 TRDV2……..TRAJ10 22824952 23003305 IGHV3-49……..IGHV3-65 107000658 107145552

ZNF643, ZNF642 40898732 40966574 TNFSF18, TNFSF4 172986874 173173969 MIR181B1, MIR181A1 198749674 198898429 GLS 191741736 191808709 SCFD2, FIP1L1 54070949 54285517 DUSP22 249798 315197 HIST1H2AC……..HIST1H2BI 26128446 26274498 CDK13 39982229 40074559 IKZF1 50350267 50476139 PAPPA 118880011 118930313 ADD3 129619875 129670028 ETV6 11743280 12060955 BTG1 92278448 92551343 TOX4……..TRAV41 21967109 22880443 TRDD1……..TRAJ48 22895875 22959826 IGHV6-1, ADAM6, IGHV1-2, IGHV1-3, IGHV4- 106401664 106542265 4, IGHV2-5, IGHV3-7, IGHV1-8 IGHV3-11, IGHV3-13, IGHV3-15, IGHV3-16, 106569451 106679068 IGHV1-18, IGHV3-20 IGHV3-23, IGHV1-24, LINC00226 106692892 106750868 IGHV3-43, LINC00221, IGHV1-45, IGHV1-46, IGHV3-48, IGHV3-49, IGHV5-51, IGHV3-53, 106900636 107081339 IGHV1-58 IGLV6-57, IGLV11-55, IGLV10-54 22518611 22588632

John Wiley & Sons

SMPDL3B, XKR8, EYA3 28274984 28325000 ANKRD13C, HHLA3 70764992 70821307 ARPP21 35678194 35762564 SETD2 47133680 47203553 RFC1 39327928 39391940 ARL15 53374824 53457656 EBF1 157980099 158520589 HEY2 125906736 126075313 TARP, TRGV4 38311098 38398047 IKZF1 EX2-8 50350267 50482012 SRRM3 75819432 75874632 MTRNR2L6, PRSS1 142354519 142474939 MYST3 41828465 41886317 PSMB7 127118386 127168831 PBX3 128511025 128612292 RXRA 137248079 137371846 EPC1 32548483 32607359 PTPN20B 48714571 48902364 MRPL48, CHCHD8 73543485 73601159 TRPC6 101393745 101440518 MANSC1, LOH12CR1 12486693 12536700 ARID, SRSF2IP, SLC38A1 46126078 46579641 CLIP1 111916281 112008413 LINC00871 46809270 46867489

IGHV3-15, IGHV3-16, IGHV1-18, IGHV3-20, 106592200 106750868 IGHV3-21, IGHV3-23, IGHV1-24, LINC00226

IGHV4-34, IGHV3-35, IGHV3-38, IGHV4-39 106820732 106881340

IGHV3-43, LINC00221, IGHV1-45, IGHV1-46, IGHV3-48, IGHV3-49, IGHV5-51, IGHV3-53, 106890796 107081339 IGHV1-58

IGHV3-64, IGHV3-66, IGHV1-69, IGHV2-70 107102223 107198332

IGBP1P1 35379556 35419331 PWRN1 24475194 24808624 CHRFAM7A 25417446 25499916 MGC3771, ZNF205, ZNF213 3147750 3200660 CPD 28730196 28793317 MED1 37575271 37615713 NARF 80431829 80475011 MBD1 47789152 47858553 NEDD4L 55952379 55985078 VAV1 6804937 6834154 SERLH, RRP7A 42897270 42950479 SERHL2, RRP7B, POLDIP3 42955776 43009817

John Wiley & Sons

EBF1 157942696 158524505 IKZF1 Ex4-7 50411762 50508578 GRM5…….. B3GAT1 (telomere) 88373718 134944770 BTG1 92278448 92536826 IGHV2-26, IGHV4-28, IGHV3-30, IGHV4-31, 106756846 106828125 IGHV3-33 TRDD1, TRDD2, TRDD3, TRGJ1 22892673 22919523 WHOLE CHROMOSOME 0 48129895 LOC643486……..IL9R 93725775 153934926

BTLA 112121325 112196075 CREB5, CPVL, CHN2, PRR15, TMSB4XP3 28291325 29792670 NCRNA00265, U6, CDC2L5, C7orf11, 39831052 42538173 C7orf10, INHBA, GLI3 C7orf25…….IKZF1, FIGNL1, DDC 42541073 50625898 TRBV20-1……..PRSS1 142331340 142462572 ELFN1 1738184 1778908 UBL3 30346188 30412337 SERP2, TSC22D1 44847430 45007697 TRDD3……..TRAJ32 22913994 22978775 IGHV6-1, ADAM6, IGHV1-2, IGHV1-3, IGHV4- 106401664 106530675 4, IGHV2-5, IGHV3-7 IGHV3-13……..IGHV2-70 106577580 107188715 ZNF260 37000906 37021641 IGLV10-54, VPREB1 22569438 22602787

GSTM2, GSTM1 110232965 110240164 UBE2E2 23369932 23420686 BBX 107153088 107456224 UGT2B17, UGT2B15 69373834 69487418 BTNL3 180377341 180418019 HFE……..RPS10P1 26086437 26202899 HIST1H2BPS2, HIST1H2AL, HIST1H1B, HIST1H3I, HIST1H4L, HIST1H3J, HIST1H2AM, 27813647 27894196 HIST1H2BO, U7, OR2B2 MLLT4, KIF25, FRMD1 168339983 168597347 ADAM5P, ADAM3A 39235591 39388287 CDKN2A/B 21920649 22034100 PAX5 EX7 36910714 36933188 ADD3 111768910 111871808 TRAV13-2……..TRAJ25 22367538 22988571 IGHV2-26, IGHV4-28, IGHV3-30, IGHV4-31, 106756846 106846441 IGHV3-33, IGHV4-34, IGHV3-35 IGHV3-64, IGHV3-66, IGHV1-69, IGHV2-70, 107100266 107200888 IGHV3-72 LRRC37A, ARL17B, C17orf88, LRRC37A2, 44201376 44364158 ARL17A SIGLEC14 52142154 52148573

John Wiley & Sons

SAFB2, SAFB 5596556 5639444 ZNF880, ZNF528 52884117 52924348 DMD 33112143 33827766

OR2T10, OR2T11, OR2T35 248749182 248810646 EVC 5,733,013 5,764,470 EBF1 158186228 158520589 MEF2C 88,104,356 88,126,133 IKZF1 EX2-7 50350267 50457188 TARP, TRGJP, TRGJPO1, TRGV11, TRGV10, 38310103 38357633 TRGV9 ADD3 111772044 111861054 BTG1 92278629 92536826 TRDD1……..TRAJ32 22892461 22978775 DHRS4L2 24445447 24480833 SLX4IP 10416871 10458894 IGLL3P, LRP5L, CRYBB2P1 25668784 25918709 DRG1, EIF4ENIF1, SFIL1 31743711 31935627 HDHD1, STS, VCX, PNPLA4, MIR651, 6467902 8135645

RMND5A 86855854 86953842 CD200, BTLA 112055596 112224228 AFF1 87857591 87921241 MEF2C 88121188 88173694 EBF1 158440860 158523167 HIST1H1PS1……..HIST1H2BI 26194080 26277900 HBS1L 135368331 135432530 TRGJP2……..TRGV 38294089 38402496 IKZF1 EX4-8 50411762 50492586 CDK6 92313377 92463876

TRBV24-1; MTRNR2L6; TRBV25-1; TRBV27; 142354519 142493638 TRBV28; TRVB29-1; PRSS1; PRSS3P2

PAX5 36930536 37024122 ADD3 111768910 111868232 GLYATL2 58598012 58662543 EVT6 EX1 11767814 11805813 SERP2, TSC22D1 44813521 45007697 RB1, LPAR6 48984706 49075113

IGHV4-39, IGHV3-43, LINC0021, IGHV1-45, 106868274 107045260 IGHV1-46, IGHV3-48, IGHV3-49, IGHV5-51

TRDD3……..TRAJ10 22914154 23002980 TCF12 57293511 57597280 CLIC6, RUNX1 36081448 36420376 IGKV4-60, IGKV6-57, IGLV11-55, IGLV10-54, 22453684 22599537 VPREB1 IGLV5-45……..IGLV3-12 22724707 23124509

John Wiley & Sons

USP9X, DDX3X 41064184 41189413

MIR181B1, MIR181A1 198816853 199084043 HIST1H2AB……..HIST1H2BI 26033781 26274498 HIST1H2BN……..OR2B2 27804020 27903586 IKZF1 EX2-8 50350267 50469367 TRGV11, TRGV10 38316148 38354159 ETV6 (EX2 BI AND 3-5 MONO) 11866063 12023941 KATNAL1, LOC100188949, HMGB1 30692807 31042311 TRDD1, TRAJ32 22892461 22978775 IGHV4-31……..IGHV5-51 106796013 107045260 IGHV3-64, IGHV3-66 107100266 107167695 CHD2 93376794 93458314 SLX4IP 10417282 10453642 IGLV1-40……..IGLV3-1 22752668 23223233 155270560 WHOLE CHROMOSOME 0

PRKCE 45864578 46030241 USP38, GAB1 143936903 144242978 NR3C1 142797392 143065534 HFE…….. HIST1H3E 26068566 26229148 HDDC2 125603912 125968698 PLEKHG1 150925615 151131081 TRGJP2……..TRGV8 38294089 38386800 IKZF1 EX4-8 50364626 50472161 MTRNR2L6, PRSS1 142331340 142483421 PAX5 36915044 37033147 ADD3 111771105 111867962 STX3 59518443 59568514 DDX1, FAM60A 31232958 31407111 BTG1 92282168 92536826 RIC8B, C12orf23 107248143 107358298 LEMD3 65576386 65622993 RB1, LPAR6 48984803 49062990 TRAV29DV5……..TRAJ48 22627486 22959826 IGHV3-43……..IGHV3-64 106893261 107116773 AP1G1 71764082 71833332 SLX4IP 10417235 10458584 IL3RA, ASMTL, P2RY8 (P2RY8-CRLF2) 1211508 1640371 USP9X, DDX3X 41064184 41195273

DAB1 57453025 57668279 DYRK3, MAPKAPK2 206798728 206871784 CNTNAP5 125246092 125327640 CADPS 62346284 62457030 MBNL1 151883726 151978559 CCNL1 156872232 156931032

John Wiley & Sons

UBXN7 196092661 196145207 ABCC5 183703907 183751575 RAPGEF6 130831365 130955462

HLA-DRB1, HLA-DQA1, HLA-DQB1, MTCO3P1 32527272 32681645

SUPT3H 45061790 45171362 RUNX2 45260777 45315206 PARK2 161853324 161913437 TRGJP2, TRGC1, TARP, TRGJ1, TRGJP, 38294089 38352227 TRGJP1, TRGV11, TRGV10 MIR-3147, ZNF716 57271107 57560158 MTRNR2L6, PRSS1 142331340 142476921 DGK1 137472918 137538892 SFRP1 40845113 41201248 PTK2 141877416 141985401 KLF4 110206569 110382117 PAPPA, ASTN2, TLR4, DBC1, 118708693 123074384 PBX3 128501097 128746715 NCRNA00245, ZNF503 77059657 77201603 SORCS3 106596529 106708297 NTM……..GLB1L2 131010587 134930689 RAG1, RAG2, Corf1174 36598607 36639425 TBX3 115115139 115277304 SOS2, L2HGDH 50676947 50729250 CELF4 34790062 35259006 IGLV4-60, IGLV6-57, IGLV11-55, IGLV10-54, 22503511 22602703 VPREB1 15527056 WHOLE CHROMOSOME 0 0

OR2T10, OR2T11, OR2T35 248749182 248810646 GSTM1 110232914 110240573 TRGC1, TARP, TRGJ1, TRGJP, TRGJP1, 38297823 38352227 TRGV11, TRGV10 PTCHD3 27607185 27702509 13500651 WHOLE CHROMOSOME 0 6 DDX11 31232958 31407111 10734954 WHOLE CHROMOSOME 0 0 TRDV2, TRDD1, TRDD2 22853047 22917633 SIGLEC14 52142088 52148380 WHOLE CHROMOSOME 0 48129895 PRODH, DGCR5, DGCR9 18876416 19006984 WHOLE CHROMOSOME 0 155270560

-d patients were used to remove as many germline variants as possible.

John Wiley & Sons

Supplementary Table 8. Validated whole genome sequencing results from 11 CRLF2-r patients. Rearrangeme Stran Stran Chr Start Stop Chr Start Stop nt Type d d

Deletion 2 89428953 89429053 +ve 2 89442127 89442227 -ve Deletion 2 89459100 89459200 +ve 2 89495516 89495616 -ve Amplification 8 130523181 130523281 -ve 8 130718253 130718353 +ve

Deletion 9 21808038 21808138 +ve 9 22941407 22941507 -ve

Deletion 9 36911701 36911801 +ve 9 36927969 36928069 -ve Deletion 12 92278103 92278203 +ve 12 92538012 92538112 -ve Deletion 14 22564840 22564940 +ve 14 22981783 22981883 -ve Deletion 14 22631697 22631797 +ve 14 22924213 22924313 -ve Deletion 14 106329399 106329499 +ve 14 107034705 107034805 -ve Deletion 14 106347742 106347842 +ve 14 107218652 107218752 -ve Deletion 20 45933082 45933182 +ve 20 46130142 46130242 -ve Deletion 22 22385811 22385911 +ve 22 22522449 22522549 -ve

Deletion X 1335020 1335537 +ve X 1655365 1655629 -ve

Inversion 2 89441856 89441956 +ve 2 178257253 178257353 +ve Deletion 2 114164288 114164388 +ve 2 114195426 114195526 -ve Deletion 5 150143110 150143210 +ve 5 150161811 150161911 -ve Deletion 6 26410885 26410985 +ve 6 26440988 26441088 -ve

Deletion 7 50412825 50412925 +ve 7 50463627 50463727 -ve Deletion 9 21025269 21025369 +ve 9 21041953 21042053 -ve Deletion 9 21973575 21973675 +ve 9 22008281 22008381 -ve

Deletion 9 36590620 36590720 +ve 9 36896498 36896598 -ve

Deletion 12 11743585 11743685 +ve 12 12509772 12509872 -ve Inversion 14 89390330 89390430 +ve 14 92457821 92457921 +ve Translocation 14 92442754 92443151 -ve 9 22292613 22292873 -ve

Deletion 22 22385783 22385883 +ve 22 22522443 22522543 -ve Deletion 22 22385797 22385897 +ve 22 22599630 22599730 -ve Deletion X 1335004 1335636 +ve X 1655143 1655582 -ve

John Wiley & Sons

Deletion 5 157943589 157943689 +ve 5 158527960 158528060 -ve

Deletion 7 50412806 50412906 +ve 7 50518186 50518286 -ve

Translocation 11 91640446 91640769 -ve X 93703884 93704263 -ve

Deletion 12 92278133 92278233 +ve 12 92538030 92538130 -ve

Translocation +ve +ve 14 106330402 106330729 X 1347508 1347915

Inversion 12 11191900 11192000 +ve 12 17300773 17300873 +ve Inversion 12 16998390 16998490 -ve 12 20978137 20978237 -ve Deletion 12 110909702 110909802 +ve 12 111779120 111779220 -ve Inversion 12 111441508 111441608 -ve 12 111936301 111936401 -ve Inversion 12 111743377 111743477 +ve 12 111825345 111825445 +ve

Amplification 21 21837536 21837636 -ve 21 22198634 22198734 +ve Deletion 21 22205844 22205944 +ve 21 22655689 22655789 -ve Inversion 21 22655432 22655532 +ve 21 22661120 22661220 +ve Inversion 21 22789112 22789212 -ve 21 22794648 22794748 -ve Amplification 21 22790448 22790548 -ve 21 22797286 22797386 +ve Deletion 21 23009726 23009826 +ve 21 23738344 23738444 -ve Inversion 21 28901871 28901971 +ve 21 41589707 41589807 +ve Deletion 21 31568531 31568631 +ve 21 41761624 41761724 -ve

Translocation 21 39811038 39811614 -ve 8 129140419 129140927 -ve

Translocation 21 39811264 39811831 +ve 8 129140688 129141174 +ve

Deletion 22 22385799 22385899 +ve 22 22522459 22522559 -ve

Deletion 3 112129391 112129491 +ve 3 112218446 112218546 -ve Amplification 7 29792819 29792919 -ve 7 50122789 50122889 +ve Inversion 7 50118382 50118482 -ve 7 50628514 50628614 -ve Inversion 12 65564432 65564532 -ve 12 65626186 65626286 -ve Inversion 12 65564603 65564703 +ve 12 65626355 65626455 +ve Deletion 13 30345662 30345762 +ve 13 30421819 30421919 -ve Deletion 13 44848663 44848763 +ve 13 45010443 45010543 -ve Translocation 14 106330395 106330666 +ve X 1351069 1351373 +ve

John Wiley & Sons

Deletion 19 36980120 36980220 +ve 19 37019921 37020021 -ve Deletion 22 22569572 22569672 +ve 22 22600221 22600321 -ve

Deletion 6 26126474 26126574 +ve 6 26261015 26261115 -ve

Deletion 6 26135602 26135702 +ve 6 26187819 26187919 -ve Deletion 9 15529167 15529267 +ve 9 26410314 26410414 -ve Amplification 9 17325691 17325791 -ve 9 20356401 20356501 +ve Inversion 9 17326347 17326447 +ve 9 30255006 30255106 +ve Deletion 13 60859178 60859278 +ve 13 61567768 61567868 -ve Deletion 17 6939017 6939117 +ve 17 6941726 6941826 -ve +ve -ve Deletion X 1334989 1335415 X 1655117 1655580 Deletion X 33280819 33280919 +ve X 33736847 33736947 -ve

Deletion 3 112053600 112053700 +ve 3 112218449 112218549 -ve Deletion 4 87858236 87858336 +ve 4 87927857 87927957 -ve Deletion 5 88119209 88119309 +ve 5 88174967 88175067 -ve Deletion 5 158437915 158438015 +ve 5 158527966 158528066 -ve

Deletion 6 26206656 26206756 +ve 6 26241328 26241428 -ve

Deletion 6 135366046 135366146 +ve 6 135437621 135437721 -ve Deletion 7 50412787 50412887 +ve 7 50518265 50518365 -ve Deletion 7 92313733 92313833 +ve 7 92466499 92466599 -ve Deletion 9 36929001 36929101 +ve 9 37030716 37030816 -ve Deletion 10 111768499 111768599 +ve 10 111868778 111868878 -ve Deletion 11 58597494 58597594 +ve 11 58665891 58665991 -ve Deletion 12 11771723 11771823 +ve 12 11803918 11804018 -ve Deletion 13 44811850 44811950 +ve 13 45010412 45010512 -ve Deletion 13 48984482 48984582 +ve 13 49075035 49075135 -ve Translocation 14 106329380 106329752 +ve X 1347347 1347648 +ve

Translocation 14 106370268 106370633 -ve X 1347048 1347470 -ve Deletion 15 57294740 57294840 +ve 15 57598618 57598718 -ve Deletion 21 36080305 36080405 +ve 21 36418426 36418526 -ve Deletion 21 36080398 36080498 +ve 21 36421164 36421264 -ve

Deletion 22 22453555 22453655 +ve 22 22600046 22600146 -ve

Deletion X 41063964 41064064 +ve X 41194437 41194537 -ve

John Wiley & Sons

Deletion 6 26142736 26142836 +ve 6 26236995 26237095 -ve Deletion 7 50347309 50347409 +ve 7 50463593 50463693 -ve Deletion 12 11858202 11858302 +ve 12 11970457 11970557 -ve Deletion 12 11865878 11865978 +ve 12 12027139 12027239 -ve Deletion 13 30693727 30693827 +ve 13 31038889 31038989 -ve Deletion 15 93375803 93375903 +ve 15 93458713 93458813 -ve Deletion 20 10415594 10415694 +ve 20 10456217 10456317 -ve Translocation 14 106329400 106329662 +ve X 1337059 1337419 +ve

Translocation 14 106372891 106373137 -ve X 1336849 1337197 -ve

Deletion 7 50412829 50412929 +ve 7 50463609 50463709 -ve

Deletion 9 21825479 21825579 +ve 9 21993829 21993929 -ve

Translocation 9 36933753 36934188 -ve 20 31042503 31042884 +ve

Translocation 9 102962821 102963098 +ve 7 91461947 91462294 -ve

Translocation 9 102962990 102963406 -ve 7 91462318 91462732 +ve Deletion 13 44848601 44848701 +ve 13 45010416 45010516 -ve Deletion 17 29546625 29546725 +ve 17 29639233 29639333 -ve Deletion 22 22385804 22385904 +ve 22 22396551 22396651 -ve

Deletion X 1333665 1333910 +ve X 1654381 1654785 -ve

Deletion 6 26034694 26034794 +ve 6 26279052 26279152 -ve Deletion 6 26156803 26156903 +ve 6 26241089 26241189 -ve Deletion 7 50412800 50412900 +ve 7 50478285 50478385 -ve Amplification 9 21921371 21921471 -ve 9 21953863 21953963 +ve Deletion 9 21921962 21922062 +ve 9 21979724 21979824 -ve Deletion 9 36876897 36876997 +ve 9 36888096 36888196 -ve Deletion 9 36928976 36929076 +ve 9 37030652 37030752 -ve Deletion 14 22859066 22859166 +ve 14 22946697 22946797 -ve Deletion 14 22891975 22892075 +ve 14 22918068 22918168 -ve Deletion 14 106330338 106330438 +ve 14 106926142 106926242 -ve Deletion 22 22385814 22385914 +ve 22 22522470 22522570 -ve

John Wiley & Sons

Deletion X 1334992 1335380 +ve X 1655061 1655416 -ve

Deletion 1 81213629 81213729 +ve 1 81771956 81772056 -ve Deletion 1 198858295 198858395 +ve 1 198904898 198904998 -ve Deletion 2 90078165 90078265 +ve 2 90109046 90109146 -ve Deletion 2 114164391 114164491 +ve 2 114188400 114188500 -ve Deletion 3 60064812 60064912 +ve 3 61357055 61357155 -ve Deletion 3 112053609 112053709 +ve 3 112218439 112218539 -ve Deletion 3 176914016 176914116 +ve 3 177351668 177351768 -ve

Deletion 7 142353890 142353990 +ve 7 142494036 142494136 -ve

Deletion 7 154765281 154765381 +ve 7 155163803 155163903 -ve Deletion 9 21943868 21943968 +ve 9 21993778 21993878 -ve Deletion 9 21982503 21982603 +ve 9 22008269 22008369 -ve Inversion 12 11734566 11734666 +ve 12 11804773 11804873 +ve

Deletion 14 22891932 22892032 +ve 14 22982874 22982974 -ve

Deletion 14 73218878 73218978 +ve 14 73359044 73359144 -ve Deletion 14 106347753 106347853 +ve 14 106962889 106962989 -ve Deletion 14 106993752 106993852 +ve 14 107169924 107170024 -ve Translocation 21 36418823 36419139 -ve 12 12025780 12026054 -ve

Translocation 21 36418883 36419190 +ve 12 12025938 12026294 +ve

Deletion 22 22385811 22385911 +ve 22 22522448 22522548 -ve Deletion 22 22516995 22517095 +ve 22 22600598 22600698 -ve Deletion X 1368670 1369020 +ve X 1654442 1654783 -ve Deletion X 12992779 12992879 +ve X 13316101 13316201 -ve Translocation X 123123198 123123525 +ve 6 79703006 79703367 -ve

Abbreviations: ^ low SNP coverage; * If >10 genes present only the first and last genes in the region are listed

John Wiley & Sons

Supplementary Table 8. Validated whole genome sequencing results from 11 CRLF2-r patients. Number of Validation Genes affected Outcome Reads method 9534 IGKV2-18; IGKV3-20 5 SNP Somatic IGKV6-21; IGKV2-24 9 SNP Somatic CCDC26 12 SNP Somatic MTAP;C9orf53;CDKN2A;CD KN2B- 17 FISH, MLPA, SNP Somatic AS;CDKN2B;UBA52P6;DMR TA1 PAX5 17 SNP Somatic BTG1 13 MLPA, SNP Somatic TRDV1……..TRAJ3 22 SNP Somatic TRAV29DV5……..TRDJ4 10 SNP Somatic IGHJ6……..IGHV5-5 10 SNP Somatic IGHD5-24……..IGHV3-7 6 SNP Somatic ZMYND8; RPL35AP 13 SNP Somatic IGLV4-69; IGLV8-61; IGLV4- 8 SNP Somatic 60

CRLF2; P2RY8 6 FISH, MLPA, SNP Somatic

11538 IGK; NFE2L2 9 PCR Chr2: 89,442,054-178,256,961 CBWD2 9 PCR Chr2: 114,195,402-114,164,446 SMIM3 24 SNP, PCR Chr5: 150,143,163-150,161,860 BTN3A1;BTN2A3;BTN2A3;B 20 SNP, PCR Chr6: 26,410,938-26,441,038 TN3A3 IKZF1 22 MLPA, SNP, PCR Chr7: 50,412,892-50,463,635 PTPLAD2 20 SNP Somatic MTAP;CDKN2A;CDKN2B- 23 MLPA, SNP, PCR Chr9: 21,973,625-22,008,319 AS;CDKN2B MELK;PAX5 21 MLPA, SNP, PCR Chr9: 36,590,677-36,896,537 ETV6;BCL2L14;LRP6;MANSC 17 MLPA, SNP, PCR Chr12: 11,743,677-12,509,797 1;LOH12CR2 TRIP11 16 PCR Chr9: 89,390,381-92,457,621 Chr14: 92,443,100; Chr9: TRIP11 14 PCR 22,292,800 PRAMEL……..FAM108A6P 20 SNP Somatic PRAMEL……..VPREB1 18 SNP, PCR Chr22:22,385,865-22599662 CRLF2; P2RY8 5 FISH, SNP Somatic 11543

John Wiley & Sons

EBF1 20 MLPA, SNP, PCR chr5: 157,943,646-158,528,008

IKZF1;FIGNL1 11 MLPA, SNP, PCR Ch7: 50,412,870-50,518,235 Chr11: 91,280,356; ChrX: - 12 Karyotype, PCR 93,590,857 C12orf79;BTG1 19 MLPA, SNP, PCR Chr12: 92,278,186-92,538,076 ChrX: 1,347,580; Chr14: IGHJ4; CRLF2~ 11 FISH, PCR 106,330,464 11706 TAS2R14 6 PCR Chr12:11,192,108-17,300,511 SLCO1B3 5 PCR Chr12:20,978,174-16,998,656 FAM216A……..CUX2 13 PCR Chr12: 110,909,797-111,779,126 ATXN2 8 PCR Chr12:111,441,832-111,936,237 CUX2 8 PCR Chr12: 111,7434,449-111,825,057

C21orf131 17 SNP Somatic NCAM2 12 PCR Chr21: 22,205,898-22,655,741 NCAM2 13 PCR Chr21:22,655,476-22,660,850 NCAM2 15 PCR Chr21:22,789,338-22,794,674 NCAM2 17 SNP Somatic C21orf117;C21orf74 11 PCR Chr21: 23,009,796- 23,738,294 DSCAM 27 PCR Chr21:28,901,946-41,589,571 CLDN8...... RUNX1……..ERG 21 PCR Chr21:31,568,581-41,761,683 ……..ETS……..DSCAM Chr8: 12,9140,839; ERG 5 PCR Chr21:39,810,955 Chr8: 129,140,839; ERG 5 PCR Chr21:39,810,955 IGLV4-69; IGLV8-61; IGLV4- 14 SNP Somatic 60 19599 BTLA 6 SNP, PCR Chr3: 112,129,470-112,218,477 WIPF3……..ZPBP 15 PCR Chr7:29,793,028-50,122,673 ZPBP;DDC 12 PCR Chr7:50,628,513-50,118,579 LEMD3 11 PCR Chr12: 65,564,674-65,626,089 LEMD3 12 PCR Chr12: 65,564,674-65,626,089 UBL3 18 SNP Somatic SERP2;TSC22D1 12 FISH, SNP, PCR Chr13: 44,848,741-45,010,461 ChrX: 1,351,123;Chr14: IGHJ4; CRLF2~ 14 FISH, PCR 106,330,468

John Wiley & Sons

ZNF566;ZNF260 12 SNP, PCR Chr19: 36,980,197-37,019,972 VPREB1 14 SNP, PCR Chr22: 22,569,658-22,600,265 20638

HIST1H2AC……..HIST1H2BH 13 SNP Somatic HIST1H2AC;HIST1H1E;HIST1 14 SNP Somatic H2BD; HIST1H2BE C9orf93……..TUSC1 7 MLPA, SNP Somatic CNTLN……..MLLT3 11 PCR Chr9: 17,326,011-20,356,227 CNTLN 9 PCR Chr9: 30,254,876-17,326,405 TDRD3;EIF4A1P6 9 SNP Somatic SLC16A13 17 PCR Chr17: 6,939,060-6,941,779 FISH, MLPA, SNP Somatic CRLF2~; P2RY8 3 DMD 17 SNP Somatic 21245

CD200;RP11-231E6.1;BTLA 8 FISH, SNP Somatic AFF1 10 SNP Somatic MEF2C 7 SNP Somatic EBF1 14 MLPA, SNP Somatic HIST1H2BG;HIST1H2AE;HIS T1H3E;HIST1H2APS3;HIST1 18 SNP Somatic H1D;HIST1H4F HBS1L 14 SNP Somatic IKZF1;FIGNL1 6 FISH, SNP Somatic CDK6 9 SNP Somatic PAX5 9 FISH, MLPA, SNP Somatic ADD3 13 FISH, SNP Somatic GLYATL2 6 SNP Somatic ETV6 9 SNP Somatic SERP2;TSC22D1 9 FISH, SNP Somatic RB1;LPAR6;RCBTB2 8 MLPA, SNP Somatic Chr14:106,329,478, IGHJ6; CRLF2~ 13 FISH, PCR ChrX:1,347,404 Chr14:106,370,541, IGHD3-10; IGHD3-9; CRLF2 7 FISH, PCR ChrX:1,347,398 TCF12 10 SNP Somatic CLIC6;RUNX1 7 SNP Somatic CLIC6;RUNX1 5 SNP Somatic IGLV8-61; IGLV4-60; IGLV6- 57; IGLV11-55; IGLV10-54; 9 SNP Somatic VPREB1 USP9X;DDX3X 9 FISH, SNP, PCR Chr X: 41,064,036-41,194,468

John Wiley & Sons

21470 HIST1H1E……..HIST1H1D 10 SNP Somatic IKZF1 18 FISH, SNP Somatic ETV6 13 SNP Somatic ETV6 9 SNP Somatic KATNAL1;UBE2L5P;HMGB1 5 SNP Somatic CHD2 10 SNP Somatic SLX4IP 16 FISH, SNP Somatic Chr14:106,329,455, IGHJ6; CRLF2~ 6 FISH, PCR ChrX:1,337,125 Chr14:106,373,070, IGHD2-8; CRLF2~ 10 FISH, PCR ChrX:1,337,126 21819

IKZF1 10 MLPA, SNP, PCR Chr7: 50,412,892-50,463,635 FISH, MLPA, SNP, MTAP;C9orf53;CDKN2A 9 Chr9: 21,825,540-21,993,853 PCR Karyotype, Chr9: 36,934,085; Chr20: PAX5;C20orf112 11 MLPA, SNP, PCR 31,042,591 Chr9: 102,963,098; INVS;MERF 12 Karyotype PCR Chr7:91,462,628 Chr9: 102,963,098; INVS;MERF 17 Karyotype, PCR Chr7:91,462,628 SERP;TSC22D1 10 FISH, SNP, PCR Chr13: 44,848,737-45,010,460 NF1;OMG;EVI2B 14 SNP, PCR Chr17: 29,546,673-29,639,264 IGLV4-69 9 SNP Somatic FISH, MLPA, SNP, CRLF2; P2RY8 9 ChrX: 1,333,765-1,654,734 PCR 20753

HIST1H2BB……..HIST1H2BI 15 SNP Somatic HIST1H1E……..HIST1H4F 10 SNP Somatic IKZF1 15 MLPA, SNP Somatic MTAP 5 PCR Chr9:21,921,721-21,953,724 MTAP;C9orf53;CDKN2A 9 MLPA, SNP Somatic PAX5 10 MLPA, SNP Somatic PAX5 7 MLPA, SNP Somatic TRDV2……..TRAJ58 11 SNP Somatic - 12 SNP Somatic - 11 SNP Somatic IGLV4-69; IGLV8-61; IGLV4- 11 60 SNP Somatic

John Wiley & Sons

CRLF2; P2RY8 5 FISH, MLPA, SNP ChrX: 133,506-1,655,366 21991 LPHN 10 SNP Somatic MIR181A1HG 9 SNP Somatic IGKV3D-20; IGKV6D-41 11 SNP Somatic CBWD2 6 SNP* Somatic FHIT 12 SNP Somatic CD200;BTLA 7 FISH, SNP Somatic TBL1XR1 8 SNP Somatic TRBV24-1; MTRNR2L6; TRBV25-1; TRBV27; 10 SNP Somatic TRBV28; TRVB29-1; PRSS1; PRSS3P2 PAXIP1;HTR5A; 10 SNP Somatic INSIG1;BLACE MTAP;C9orf53;CDKN2A 10 MLPA, SNP Somatic MTAP;CDKN2A;CDKN2B- 12 MLPA, SNP Somatic AS;CDKN2B ETV6 exon 1 7 PCR Chr12: 11,734,627-11,804,610 TRBV24-1; MTRNR2L6; TRBV25-1; TRBV27; 6 SNP Somatic TRBV28; TRVB29-1; PRSS1; PRSS3P2 DPF3 9 SNP Somatic IGHD5-24……..IGHV1-4 8 SNP Somatic IGHV3-48……..IGHV1-6 17 SNP Somatic Karyotype, FISH, RUNX1;ETV6 12 Somatic PCR Karyotype, FISH, RUNX1; ETV6 17 Somatic PCR IGLV4-69; IGLV8-61; IGLV4- 15 SNP, PCR Chr22:22,522,493-22,385,869 60 VPREB1 14 SNP Somatic CRLF2; P2RY8 13 FISH, MLPA, SNP Somatic TMSB4X;FAM9C 14 SNP, PCR ChrX:12,992,679-13,316,066 ChrX:123,123,445; Chr6: STAG2;PHIP 5 PCR 79,703,055

Abbreviations: ^ low SNP coverage; * If >10 genes present only the first and last genes in the region are listed

John Wiley & Sons

Supplementary Table 9. Validated whole exome sequencing results from 11 CRLF2-r patients.

Patient ID Position Mutation Type

14_24839409 Missense 9_109689931 Missense 17_40057949 Missense 2_73115466 Missense 19_49684669 Missense 6_144869982 Nonsense 7_29980331 Missense 7_65548107 Missense 9534 3_36526485 Missense 9_5078360 Missense 5_35873597 Missense 1_115258748 Missense 18_7009266 Missense 18_50589679 Silent chr6:43307791-chr6:43307792 In/Del^ chr20:61452882-chr20:61452883 In/Del^ chr21:46032380-chr21:46032426 In/Del^ 4_1389588 Missense 19_51274069 Missense 5_66389987 Missense/Intronic 8_110457862 Missense 12_27467982 Missense 11_27679922 Missense 8_110412344 Missense 1_3672067 Silent 1_44133513 Missense 3_170108191 Missense 11_22364814 Missense 2_227876916 Silent 1_205555174 Missense 9_33221070 Missense 2_37439122 Silent 10_13534652 Missense 1_15627738 Missense 11538 7_30087447 Missense/Intronic 11_93399889 Missense 13_102227868 Missense 1_47395833 Missense 21_47421937 Silent 7_11485911 Silent 1_115258747 Missense 5_5146289 Silent

John Wiley & Sons

17_40369256 Silent 1_216538383 Missense 9_84608344 Missense 19_58017922 Silent 11_117061432 Missense 4_62849199 Silent 21_41505848 Silent 8_121706031 Missense chr1:117156681-chr1:117156685 In/Del^ 6_43220489 Missense 9_136328611 Missense 2_220429990 Missense 19_3982347 Missense 9_5078360 Missense 18_61308113 Missense 8_24167700 Silent 11543 7_117227843 Missense 9_35397709 Missense 20_10286817 Missense 19_1083279 Missense 1_248128826 Silent chr11:71238736-chr11:71238762 In/Del^ chr14:90650493-chr14:90650494 In/Del^ 15_43990234 Missense 11_5969256 Missense 3_53756342 Nonsense 13_35806663 Missense 5_141035200 Silent 6_88853707 Silent 16_3801809 Essential Splice 2_228996763 Missense 2_207638989 Missense 20_40710646 Missense 16_67265090 Essential Splice 1_247695143 Missense 11706 14_74424917 Silent 2_121736076 Missense 22_24039424 Missense 19_42558483 Missense 3_44598888 Missense 11_48239183 Silent 1_12908051 Missense X_1712423 Missense chr2:70315146-chr2:70315147 In/Del^ chr3:75786315-chr3:75786323 In/Del^

John Wiley & Sons

chr12:111885158-chr12:111885159 In/Del^ chr22:22385866-chr22:22385872 In/Del^ 19_19369597 Silent 7_100696657 Nonsense 6_56765386 Nonsense 7_50468288 Missense 17_54428145 Missense 5_79032302 Missense 7_50468251 Missense 15_91496755 Missense 6_55739273 Missense 16_67858656 Missense 19599 17_18188597 Missense 9_5089702 Missense 9_5078360 Missense 5_173491306 Silent 4_156752998 Silent 1_1737952 Missense chr5:37049278-chr5:37049279 In/Del^ chr5:131822509-chr5:131822510 In/Del^ chr8:145689659-chr8:145689659 In/Del^ chr14:107169916-chr14:107169947 In/Del^ 4_119158240 Silent 12_52307498 Missense 12_56092582 Missense 4_114279297 Missense 9_130674921 Silent 5_13753557 Missense 11_124829790 Missense 20638 8_119938851 Silent 12_43846407 Nonsense 6_146755477 Missense 19_15067421 Missense 17_47375982 Silent 16_30376880 Missense chr5:35874562-chr5:35874575 In/Del^ chr5:135276203-chr5:135276206 In/Del^ 22_25435946 Missense 19_46202123 Missense 10_75561245 Missense 3_53834366 Nonsense 3_194159672 Silent 4_140272737 Nonsense 20753 1_215813951 Missense 4_86988952 Missense 11_64525754 Missense

John Wiley & Sons

22_19164660 Missense 2_55433409 Missense chr14:107169929-chr14:107169933 In/Del^ chr22:29885387-chr22:29885423 In/Del^ 9_37020768 Missense 14_102912178 Missense 7_117375072 Silent 5_140866629 Missense 18_44157825 Silent 11_62562441 Missense 1_196684872 Missense 9_5078360 Missense 10_118357594 Missense 3_151012594 Missense 21245 12_102572530 Missense 2_212286798 Missense 8_107782327 Missense X_18622766 Silent 14_57672632 UTR 3 Prime 16_82101900 Missense X_152083309 Missense X_153593530 Silent 18_28934829 Silent 20_25442251 Silent chr8:77763852-chr8:77763852 In/Del^ X_83128090 Missense 7_50455120 Missense 9_141010123 Silent 10_27389033 Missense 5_140774369 Silent 12_108603925 Silent 17_7404262 Missense 17_10404508 Missense 19_49601898 Essential Splice 7_150939268 Silent 12_112940045 Missense 1_39381255 Nonsense 21470 1_183212354 Missense 2_189871110 Missense 19_40276380 Missense 12_53594064 Missense 15_45050835 Missense X_1196852 Missense 11_46332703 Missense 3_141304932 Silent 12_64521884 Silent

John Wiley & Sons

3_119373432 Silent chr5:11110989-chr5:11110991 In/Del^ chr9:36882049-chr9:36882050 In/Del^ chr14:107131030-chr14:107131043 In/Del^ 5_112478937 Missense 11_118635931 Missense 16_27786318 Silent 1_156816469 Missense 10_7768984 Silent 1_226109968 Missense 21819 7_100843572 Silent 1_11577534 Silent 17_10432167 Missense 5_89977229 Silent chr1:10713528-chr1:10713529 In/Del^ chr17:39334341-chr17:39334385 In/Del^ 17_39140476 Missense 1_178494526 Missense 1_237947416 Missense 4_106888420 Missense 9_139878161 Essential Splice 16_84520526 Silent 15_34527489 Missense 10_16955909 Silent 19_55800866 Silent 16_15932017 Silent X_105855571 Silent 17_39150310 Missense 21991 5_153406861 Missense 1_10363407 Missense 17_18029672 Silent 7_117501328 Missense 22_37480346 Silent chr4:15826507-chr4:15826519 In/Del^ chr6:41903745-chr6:41903746 In/Del^ chr9:139996339-chr9:139996340 In/Del^ chr14:107169919-chr14:107169950 In/Del^ chr14:107178811-chr14:107178840 In/Del^ chr19:53668346-chr19:53668683 In/Del^

Abbreviations: ^ validation by capillary sequencing; ~ no 454 validation sequencing due to mutation being observed by capillary sequencing prior to exome sequencing; " mutation that is probably/possibly deleterious (Polyphen 2 and Mutation taster; * novel probably/possibly deleterious mutations; # mutation sufficient to cause JAK-STAT activation in the absence of CRLF2-d.

John Wiley & Sons

Supplementary Table 9. Validated whole exome sequencing results from 11 CRLF2-r patients.

Nucleotide change Protein change Gene

c.994C>T* p.R332W NFATC4” c.3738C>A p.S1246R ZNF462 c.1183C>T p.G395R ACLY” c.328G>A p.G110S SPR c.1214G>A* p.R405H TRPM4” c.6802C>T* p.R2268* UTRN" c.766C>T* p.G256S SCRN1” c.392C>T p.T131M ASL c.506G>A* p.R169H STAC” c.2047A>G p.R683G JAK2” c.553A>T* p.S185C IL7R” # c.34C>T* p.G12S NRAS” c.3973A>G* p.S1325P LAMA1” c.990G>A p.P330P DCC C N/A ZNF318 C p.G124fs*44 COL9A3 CATCTGCTGCAAGCCCATCTGCTGTGTGCCTG N/A KARTAP10 c.1289G>A* p.R430H CRIPAK c.212G>A* p.R71H GPR32” c.290A>T p.N97I MAST4” c.5764A>G* p.I1922V PKHD1L1 c.707C>T* p.T236M STK38L” c.436G>A* p.E146K BDNF” c.1052G>A* p.R351H PKHD1L1” c.489G>A* p.S163S CCDC27 c.986A>G* p.Y329C KDM4A” c.1610C>T* p.T537I SKIL" c.361C>G* p.P121A SLC17A6" c.4314C>T p.D1438D COL4A4 c.988G>A* p.A330T MFSD4" c.94C>G p.R32G SPINK4 c.2664T>C p.G888G CEBPZ c.640G>A p.V214I BEND7 c.716G>A* p.R239H FHAD1” c.314-1G>C* PLEKHA8” c.16G>A* p.V6M KIAA1731” c.557T>A* p.I186K ITGBL1” c.1514G>A p.R505H CYP4A11 c.2019C>T p.H673H COL6A1 c.2841G>A p.L947L THSD7A c.35G>T p.G12V NRAS” c.222C>T p.Y74Y ADAMTS16

John Wiley & Sons

c.1302G>A p.S434S STAT5B c.696G>C* p.K232N USH2A" c.2959C>T p.H987Y ENSG00000214929” c.459G>A p.G153G ZNF773 c.1711C>T p.P571S SIDT2” c.3114G>C p.V1038V LPHN3 c.3495G>C p.V1165V DSCAM c.689C>T p.P230L SNTB1 CACC N/A IGSF3 c.121G>A* p.G41R TTBK1” c.128C>T* p.A43V C9orf7” c.2381G>A* p.S794L OBSL1” c.688C>T* p.E230K EEF2” c.2047A>G p.R683G JAK2" c.464G>A* p.T155M SERPINB4” c.252G>A* p.T84T ADAM28” c.1635A>G* p.G545G CFTR” c.3507G>A* p.L1169L UNC13B” c.593G>A* p.R198H SNAP25" c.2882G>A* p.R961H HMHA1” c.193C>A p.R65R OR2AK2 ctgct<17>tcatc p.S133_C141delSSGCGSSCC KARTAP5 A p.I125fs*59 KCNK13 c.899G>A* p.R300H CKMT1A" c.680G>A p.R227Q OR56A3 c.1567C>T* p.R523* CACNA1D” c.5683G>T p.V1895F NBEA” c.4098G>T* p.A1366A ARAP3” c.1287C>T* p.S429S CNR1” c.3699-2A>T* c.3699-2A>T CREBBP” c.71G>A p.P24L SPHKAP c.1295G>A p.R432Q FASTKD2 c.4148C>A* p.G1383V PTPRT” c.2667+1C>A* c.2667+1G>T FHOD1” c.671C>T p.R224Q OR2C3 c.549C>T* p.A183A COQ6” c.1435C>T* p.R479W GLI2” c.1228G>A p.D410N RGL4 c.1045T>C* p.Y349H GRIK5” c.349C>T* p.H117Y ZNF167” c.822G>A* p.T274T OR4B1” c.92G>A p.S31L HNRNPCL1 c.68A>T p.Y23F AKAP17A CC N/A PCBP1 ctacattct p.E818_R820delECR ZNF717

John Wiley & Sons

C N/A SH2B3 GCCCCC N/A PRAMEL c.552C>T* p.A184A HAPLN4” c.13303G>T* p.H508R MUC17” c.250G>A* p.E4435* DST” c.1523A>G* p.R84* IKZF1” c.216G>A p.M72I ANKFN1” c.7714T>C p.S2572P CMYA5 c.1486G>A* p.R131W IKZF1” c.2644G>C* p.G882R UNC45A” c.391G>A* p.G496S BMP5” c.490G>A* p.E164K TSNAXIP1” c.1736A>G* p.M579T TOP3A” c.2600G>A p.R867Q JAK2” c.2047A>G p.R683G JAK2” c.201C>T* p.I67I HMP19” c.1305C>T* p.A435A ASCI5” c.229C>G* p.G77R GNB1” C N/A NIPBL GCCTAGACGGCTC N/A IRF1 c p.A144fs*9 CYHR1 CCTTTCTCCCTC N/A IGHV1-69-001 c.1983C>T* p.T661T NDST3” c.469C>A* p.L157M ACVRL1” c.910G>A* p.R304C ITGA7” c.9523G>A p.V3175M ANK2 c.237C>T* p.V79V ST6GALNAC4” c.10657G>A* p.R3553W DNAH5” c.407A>T* p.N136I CCDC15” c.699G>A p.N233N TNFRSF11B c.1852G>A* p.R618* ADAMTS20” c.3130G>A p.A1044T GRM1 c.1036C>T* p.V346I SLC1A6” c.1614A>G* p.L538L ZNF652” c.992C>T* p.R331Q TBC1D10B” GGCTGTCTGGT N/A IL7R G N/A FBXL21 c.2849G>T* p.R950L KIAA1671” c.851G>A p.R284H QPCTL c.5497G>A p.V1833I KIAA0913 c.5074C>T* p.R1692* CACNA1D” c.1740T>A* p.T580T ATP13A3” c.986T>G* p.L329* NAA15” c.14917C>T* p.V4973M USH2A” c.959G>A p.A320V MAPK10" c.492A>C* p.F164L PYGM"

John Wiley & Sons

c.499C>T* p.G167R SLC25A1” c.1003T>G* p.K335Q C2orf63” C N/A IGHV1-69-001 CCCAGTGAAGGCAGAAGCA N/A NEFH c.77A>C* p.V26G PAX5” c.2969T>A* p.L990H TECPR2” c.3771G>A* p.S1257S CTTNBP2” c.1889C>T* p.T630M PCDHGC4” c.981G>A* p.D327D LOXHD1” c.1543G>A* p.R515W NXF1” c.1669G>T* p.G557C CFH” c.2047A>G p.R683G JAK2” c.730T>C* p.F244L PNLIPRP1” c.440A>T* p.F147Y GPR87” c.923C>G* p.S308C C12orf48” c.2898T>A* p.K966N ERBB4” c.92C>T* p.R31Q ABRA” c.1722G>A* p.P574P CDKL5” r.5073A>T r.5073u>a EXOC5 c.391C>T p.R131C HSD17B2” c.90A>T* p.K30N ZNF185” c.1665C>T* p.T555T FLNA” c.2670G>A p.S890S DSG1” c.3603A>G p.L1201L NINL c (ZFHX4 Coding) p.L1521fs*4 ZFHX4 c.374C>A p.T125K CYLC1 c.667T>C* p.C223R IKZF1” c.5772C>T* p.G1924G CACNA1B” c.223C>G p.D75H ANKRD26 c.1989C>A* p.A663A PCDHGA12” c.525C>T p.F175F WSCD2” c.1885G>A* p.V629M POLR2A" c.3657C>G* p.Q1219H MYH1" c.331-1G>C* c.331-1G>C SNRNP70” c.630G>A* p.I210I SMARCD3” c.1697C>T* p.T566M PTPN11" c.374G>C* p.S125* RHBDL2” c.3401T>A* p.I1134N LAMC2" c.3133G>A* p.A1045T COL3A1" c.112C>T p.R38W LEUTX c.164A>G* p.I55T ITGB7" c.596T>G p.L199R TRIM69 c.695T>G p.F232C CRLF2" c.716C>T p.T239M CREB3L1 c.1818G>C* p.L606L RASA2” c.2784G>A* p.K928K SRGAP1”

John Wiley & Sons

c.520G>A* p.L174L POPDC2” ttc p.K817delK CTNND2 G N/A PAX5 CCGGGG N/A IGHV3-66-001 c.862C>T* p.R288C MCC” c.632C>T* p.R211K DDX6” c.4362C>T* p.D1454D KIAA0556” c.1652G>T* p.P551H INSRR” c.1056C>T* p.N352N ITIH2” c.254A>G* p.D85G PYCR2" c.231G>A p.S77S MOGAT3 c.1764C>T* p.H588H PTCHD2” c.3584G>A* p.A1195V MYH2" c.5622T>C* p.S1874S GPR98” T N/A CASZ1 CACAGCTGGGGCGGCAGCAGGTGGGCTGGC N/A KRTAP4 c.50G>A* p.T17M KRT40” c.379C>T p.R127C C1orf49 c.12398G>A* p.R4133H RYR2” c.1424G>A p.R475H NPNT c.122+1G>A* c.122+1G>A LCNL1” c.669C>T p.S223S KIAA1609 c.3227T>G* p.H1076P SLC12A6” c.7434G>A* p.C2478C CUBN” c.336C>T* p.H112H BRSK1” c.93G>A* p.A31A MYH11” c.261G>T p.V87V CXorf57 c.40C>T* p.G14R KRTAP3-3” c.664G>A p.R222W FAM114A2 c.2164C>T* p.R722C KIF1B” c.3768G>A* p.G1256G MYO15A” c.124G>A* p.R42W CTTNBP2” c.1212G>T* p.I404I TMPRSS6” AAG N/A CD38 G N/A CCND3 CATTCACACTTGCAGGCATGCAGGTCGGTGGTGTT r.? MAN1B1 ACACA tcaca<22>cacgg N/A IGHV1-69-001 AGG N/A IGHV2-70-001 CA N/A ZNF665

John Wiley & Sons

454 sequencing validation Tumour Normal Mutant Calls Allele burden from Average allele ACGTACGT Tumour (%) 454 (%) burden (%) 45 0 119 0 115 0 339 0 1 49 47 45 159 189 2 0 0 451 0 0 46 45 41 0 213 0 177 0 406 0 0 45 43 40 118 0 144 0 0 0 438 0 45 43 34 261 0 303 0 1 0 650 0 46 40 33 0 214 0 185 0 602 0 1 46 40 36 0 205 0 126 0 108 0 0 38 37 17 0 83 0 62 0 57 0 0 43 30 27 84 0 515 1 0 0 690 0 14 21 11 634 0 174 0 990 0 0 0 22 16 20 267 0 0 29 166 0 0 0 10 15 13 1 856 0 51 0 1203 0 0 6 9 8 148 0 11 0 263 0 0 0 7 7 7 11 0 136 0 0 0 79 0 7 7 3 3 13 13 4 4 47 17 0 6 0 0 0 28 0 74 60 52 140 0 163 0 0 0 186 0 46 49 51 128 0 0 109 228 0 0 0 46 48 51 200 0 151 0 327 0 0 0 43 47 46 0 150 0 135 0 208 0 0 47 47 46 0 986 0 885 0 506 0 0 47 47 46 87 0 105 0 0 0 234 0 45 46 45 60 0 70 0 0 0 78 0 46 46 43 320 0 254 0 369 1 1 0 44 44 39 0 167 0 154 0 473 0 0 48 43 42 0 289 216 0 0 503 0 0 43 42 44 154 0 237 0 0 0 384 0 39 42 41 116 1 158 0 0 0 136 0 42 42 39 0 145 108 0 0 211 0 0 43 41 41 213 0 121 0 266 0 0 0 36 39 42 0 92 0 50 0 82 0 0 35 39 39 82 0 145 0 0 0 152 0 36 38 33 0 79 111 0 0 0 343 0 42 37 32 93 0 132 0 0 0 317 0 41 37 36 32 0 0 59 0 0 0 51 35 36 43 0 33 0 10 0 137 0 0 23 33 0 53 0 15 0 29 0 0 22 22 19 0 260 0 82 0 572 0 2 24 21 26 132 769 1 3 0 1120 0 83 15 20 10 0 215 0 35 0 199 0 0 14 12

John Wiley & Sons

11 0 236 0 33 0 237 0 0 12 12 12 0 94 11 0 0 130 0 0 10 11 10 0 99 0 12 0 118 0 0 11 10 8 63 0 480 0 1 0 546 0 12 10 14 0 287 0 10 0 182 0 0 3 9 9 0 21 249 1 0 0 232 0 8 8 7 0 519 36 0 0 624 0 0 6 7 8 12 0 259 0 0 0 269 0 4 6 4 4 54 121 0 146 0 0 0 271 0 45 50 52 0 67 0 58 0 116 0 0 46 49 54 110 0 147 0 0 0 174 0 43 48 49 0 93 0 83 0 118 0 0 47 48 47 ~ 47 41 91 0 82 5 0 0 154 0 53 47 43 72 0 75 0 0 0 133 0 49 46 42 143 0 140 0 604 1 0 0 49 46 29 80 0 62 0 0 0 218 0 56 43 37 368 0 424 0 0 0 1020 0 46 42 38 51 0 83 0 0 0 75 0 38 38 13 5 65 0 0 0 170 0 1 7 10 3 3 27 27 44 73 0 73 0 0 0 224 0 50 47 23 77 0 248 0 0 0 262 0 24 23 22 0 254 0 80 0 316 0 0 24 23 19 1 0 274 80 0 0 253 0 23 21 23 0 0 91 17 0 0 32 0 16 19 18 0 278 0 71 0 448 0 0 20 19 17 32 0 0 167 0 0 0 235 16 17 19 32 0 203 0 0 0 388 0 14 16 15 62 0 310 0 0 0 500 0 17 16 14 47 234 1 0 0 117 0 0 17 15 10 67 390 0 0 0 509 0 0 15 12 16 0 168 0 15 0 191 0 0 8 12 12 0 116 0 12 0 108 0 0 9 11 9 0 255 0 28 0 197 0 0 10 9 9 18 0 218 0 0 0 174 0 8 8 8 275 0 19 0 433 0 1 0 6 7 6 0 171 0 12 0 198 0 0 7 6 6 2 0 324 0 1 0 358 0 1 3 4 4 0 231 0 0 0 234 0 2 3 7 7 10 10 3 3

John Wiley & Sons

11 11 9 9 75 0 95 0 74 0 51 0 0 44 59 56 136 0 174 0 154 0 0 0 56 56 59 0 0 334 280 0 0 483 0 46 52 57 122 0 138 0 0 0 149 0 47 52 53 37 0 45 0 0 0 94 0 45 49 46 0 42 0 57 0 0 0 152 42 44 41 181 0 202 0 0 0 356 0 47 44 42 0 64 79 0 0 0 104 0 45 43 43 133 0 181 0 0 0 156 0 42 43 33 123 0 157 0 0 0 217 0 44 38 26 308 0 154 0 286 0 0 0 33 30 22 38 0 103 0 0 0 214 0 27 24 21 ~ 21 18 0 82 0 19 0 35 0 0 19 18 13 0 192 0 31 0 278 0 0 14 13 12 0 442 77 1 0 974 0 1 15 13 13 13 3 3 3 3 37 37 46 0 206 0 185 0 560 0 0 47 47 52 22 33 0 0 0 3 0 0 40 46 46 72 0 85 0 0 0 190 0 46 46 45 65 0 74 0 0 0 137 0 47 46 45 0 131 1 106 0 89 0 3 45 45 45 72 0 100 0 0 0 155 0 42 43 43 189 0 0 108 589 0 0 0 36 40 41 55 0 95 3 0 0 108 0 37 39 38 63 0 98 0 0 0 102 0 39 39 33 125 0 189 0 2 0 473 0 40 36 38 0 104 0 52 0 181 0 0 33 36 48 63 0 15 0 54 0 0 0 19 34 7 0 348 0 15 0 273 0 0 4 6 10 10 3 3 64 0 0 100 85 0 0 125 0 46 55 52 35 0 52 0 0 0 104 0 40 46 47 163 0 201 0 0 0 558 0 45 46 43 0 147 0 133 0 202 0 0 48 45 45 38 0 0 47 0 0 0 71 45 45 37 0 0 76 69 0 0 0 71 52 45 43 0 151 0 129 0 369 0 0 46 45 39 62 0 91 0 0 0 85 0 41 40 38 15 9 0 0 18 0 0 0 38 38

John Wiley & Sons

35 0 106 1 59 0 82 0 0 36 35 28 0 0 66 93 0 0 0 133 42 35 8 8 3 3 91 37 93 0 0 182 1 0 0 72 81 59 172 0 0 196 0 0 0 454 47 53 52 195 0 201 0 0 0 426 0 49 51 47 0 124 0 126 0 293 0 0 50 49 52 164 0 198 0 0 0 469 0 45 49 42 47 0 40 0 0 0 207 0 54 48 45 0 0 88 78 0 0 283 0 47 46 45 ~ 45 47 0 103 0 140 0 0 0 234 42 45 45 331 0 1 254 845 0 0 0 43 44 48 0 92 60 0 0 185 0 0 39 44 43 179 0 0 227 0 0 0 622 44 44 40 1 129 1 109 0 242 0 0 46 43 41 87 0 111 0 2 0 321 0 44 42 41 57 0 0 40 80 0 0 0 41 41 46 0 632 0 204 0 1106 0 0 24 35 33 215 0 1 78 114 0 0 0 27 30 14 0 263 0 25 0 364 0 0 9 11 11 59 0 504 0 0 0 671 0 10 11 9 369 0 32 0 195 0 0 0 8 8 57 57 99 219 4 0 0 0 167 0 0 98 99 87 0 170 0 14 0 0 0 245 92 90 59 0 174 0 148 0 317 0 1 46 52 53 0 37 40 0 0 81 0 0 52 52 55 61 69 0 0 0 150 0 0 47 51 53 0 271 3 233 0 755 0 1 46 50 43 124 0 121 0 0 0 358 0 51 47 48 0 215 178 0 0 217 0 0 45 47 49 0 92 121 0 0 0 171 0 43 46 41 82 0 83 0 0 0 122 0 50 45 48 0 142 0 105 0 299 0 0 43 45 38 0 136 125 0 0 0 207 0 52 45 42 50 0 0 54 0 0 0 193 48 45 36 183 0 160 0 0 0 568 0 53 45 47 0 173 0 127 0 311 0 0 42 45 43 182 0 141 0 441 0 0 0 44 43 44 0 0 124 172 0 2 0 413 42 43 42 ~ 42 35 0 106 0 86 0 329 0 0 45 40 40 0 24 47 0 0 0 63 0 34 37 13 13 0 180 0 0 0 160 0 7 10

John Wiley & Sons

11 18 0 260 0 0 0 333 0 6 9 3 3 3 3 6 6 43 184 0 170 0 0 0 456 0 52 47 37 0 57 0 73 0 172 0 0 56 47 51 0 96 0 60 0 253 0 0 38 45 36 0 0 122 90 0 0 516 0 42 39 38 0 273 0 142 0 914 0 0 34 36 30 0 93 0 168 0 0 0 227 36 33 39 0 12 0 3 0 4 0 0 20 30 7 0 135 1 11 0 182 0 0 8 7 8 26 0 391 0 0 0 595 0 6 7 4 0 13 0 173 0 0 0 270 7 5 19 19 3 3 55 356 0 380 0 1 0 710 0 48 52 48 0 110 0 118 0 306 0 0 52 50 50 236 0 251 0 0 0 494 0 48 49 53 113 0 136 0 1 0 544 0 45 49 49 53 0 59 0 0 0 42 0 47 48 46 0 114 0 97 0 284 0 0 46 46 40 0 0 119 114 0 0 0 318 51 46 44 67 0 85 0 1 0 266 0 44 44 31 0 88 0 102 0 125 0 0 54 42 43 97 0 136 0 0 0 66 0 42 42 33 0 1 104 57 0 0 579 0 35 34 26 0 113 0 42 0 267 0 2 27 27 31 38 0 180 0 3 0 419 0 17 24 17 0 112 0 33 0 97 0 0 23 20 21 21 0 100 0 0 0 160 0 17 19 17 63 0 345 0 2 0 824 0 15 16 10 0 0 108 11 0 0 94 0 9 10 9 9 4 4 3 3 16 16 4 4 25 25

John Wiley & Sons

Supplementary Table 3: FISH probe combinations, clone details and cut off values used

Target Genes Probe combination Cut off % CTD – 2511A8 (SG) + ADD3 7 10 centromere (SR) Cytocell W12-922N6 (SG) + W12-1320F14 (SG) PBX3 8 + 9 centromere (SR) Cytocell W12-166J21 (SG) + W12-1982K22 (SG) + SERP2-TSC22D1 W12-2958F19 (SG) + RBI (SR) Abbott 7 Molecular RP11-842M22 (SG) + RP11-10K13 (SR) +

USP9X-DDX3X W12-2854F4 (SAq) + W12-894E16 (SAq) + 9*

W12-2762G13 (SAq) SLX4IP W12-516O3 (SG) + RP11-290F20 (SR) 9

Abbreviations: SGd, spectrum gold; SR, spectrum red; SG, spectrum green * When scoring the cut off slides we never observed the signal pattern indicative of the fusion. The abnormal signal patterns observed were always loss or gain of fusions or signals that were broken apart.

John Wiley & Sons

Supplementary Table 4. Clinical data for all patients with CRLF2-r ALL, and a comparison between those with P2RY8 or IGH involvement.

Total P2RY8 IGH p-value

Total 172 125(73) 47(27) Sex 0.862 Female 70(41) 50(40) 20(43)

Male 102(59) 75(60) 27(57) WBC* 0.016 <50 120(70) 94(75) 26(57)

>50 51(30) 31(25) 20(43) Median 22 20 35 Age <0.001 <10 123(71) 106(85) 17(36) Oct-15 20(11) 8(6) 12(26)

18-24 15(8) 5(4) 10(21) 25+ 14(8) 6(5) 8(17) Median 5 4 14 NCI Risk <0.001 SR 88(51) 77(62) 11(23)

HR 84(49) 48(38) 36(77) DS-ALL 0.087 No 111(69) 76(65) 35(80)

Yes 50(31) 41(35) 9(20) MRD # 1 -ve 18(33) 13(33) 5(33)

+ve 36(67) 26(67) 10(67)

Abbreviations: WBC, WBC; * 1 patients WBC is missing; SR, standard risk; HR, high risk; DS-ALL, Down syndrome ALL; # only UKALL2003 patients.

John Wiley & Sons

Supplementary Table 5 – Comparison of clinical and genetic features between patients with CRLF2-r ALL, with and without Down syndrome.

Total* Other DS-ALL p-value

Total 161 111(69) 50(31)

Sex 0.299 Female 66(41) 49(44) 17(34) Male 95(59) 62(56) 33(66) iAMP21 0.003 No 145(90) 95(86) 50(100) Yes 16(10) 16(14) 0(0) +X 0.146 No 106(66) 78(70) 28(57) Yes 54(34) 33(30) 21(43) 21 0.188 No 140(89) 94(86) 46(94) Yes 18(11) 15(14) 3(6) 9 0.588 No 154(97) 107(98) 47(96) Yes 4(3) 2(2) 2(4) 14 1 No 154(97) 106(97) 48(98) Yes 4(3) 3(3) 1(2) 17 0.704 No 150(95) 104(95) 46(94) Yes 8(5) 5(5) 3(6) IL7RA 0.133 No 8(80) 6(100) 2(50) Yes 2(20) 0(0) 2(50) JAK2_Ex14 0.613 No 45(62) 31(65) 14(56) Yes 28(38) 17(35) 11(44) JAK1_Ex14 1 No 31(86) 16(89) 15(83) Yes 5(14) 2(11) 3(17) BTG1 0.118 No 118(86) 77(82) 41(93) Yes 20(14) 17(18) 3(7)

John Wiley & Sons

CDKN2A/B 0.193 No 86(62) 55(59) 31(70) Yes 52(38) 39(41) 13(30) EBF1 0.502 No 128(93) 86(91) 42(95) Yes 10(7) 8(9) 2(5) ETV6 0.425 No 120(87) 80(85) 40(91) Yes 18(13) 14(15) 4(9) RB1 0.225 No 125(91) 83(88) 42(95) Yes 13(9) 11(12) 2(5) IKZF1 0.001 No 78(57) 44(47) 34(77) Yes 60(43) 50(53) 10(23) PAX5 0.047 No 97(70) 61(65) 36(82) Yes 41(30) 33(35) 8(18)

* 11 cases DS-ALL information is unknown

Red text denotes statistical significance where p<0.05

John Wiley & Sons

Supplementary Table 6. Recurrent CNA identified by MLPA and SNP arrays

Total P2RY8 IGH p-value Total 172 125(73) 47(27) CDKN2A/B 0.232 Normal 89(62) 64(59) 25(71) Deleted 54(38) 44(41) 10(29) BTG1 0.004 Normal 122(85) 98(91) 24(69) Deleted 21(15) 10(9) 11(31) EBF1 0.259 Normal 133(93) 102(94) 31(89) Deleted 10(7) 6(6) 4(11) ETV6 0.249 Normal 124(87) 96(89) 28(80) Deleted 19(13) 12(11) 7(20) IKZF1 <0.001 Normal 82(57) 72(67) 10(29) Deleted 61(43) 36(33) 25(71) PAX5 0.295 Normal 99(69) 72(67) 27(77) Altered* 44(31) 36(33) 8(23) RB1 0.746 Normal 129(90) 98(91) 31(89) Deleted 14(10) 10(9) 4(11) USP9X-DDX3X 0.471 Normal 44(81) 29(85) 15(75) Deleted 10(19) 5(15) 5(25) ADD3 0.008 Normal 43(75) 33(87) 10(53) Deleted 14(25) 5(13) 9(47) SERP2 & TSC22D1 0.682 Normal 48(87) 32(89) 16(84) Deleted 7(13) 4(11) 3(16) PBX3 0.752 Normal 40(71) 28(74) 12(67) Deleted 16(29) 10(26) 6(33) SLX4IP 0.309 Normal 31(70) 21(78) 10(59) Deleted 13(30) 6(22) 7(41)

John Wiley & Sons

* PAX5 intragenic amplifications were included with the deletions as they are predicted to be functionally equivalent

John Wiley & Sons

11x6mm (600 x 600 DPI)

John Wiley & Sons

Supplementary Figure 1. Consort diagram

Analysis profile for investigation of the genomic landscape of patients with CRLF2-d ALL. A total of 172 patients were indentified to have either a IGH-CRLF2 (n=47) or a P2RY8-CRLF2

(n=125) rearrangement. Karyotypes were available for 44 and 117 patients, respectively.

Fixed material was available from 46 and 108 patients, respectively. DNA was available from

35 IGH and 108 P2RY8 patients for MLPA, with 11 and 15 of these patients having enough

DNA for SNP arrays, respectively. WGS and WES was performed on 4 patients with IGH and 7 with P2RY8 involvement with a further 16 and 53 patients undergoing targetted sequencing for JAK mutations.

John Wiley & Sons

13x9mm (600 x 600 DPI)

John Wiley & Sons

Supplementary Figure 2. Ideogram of cytogenetic rearrangements reported in the karyotypes of patients with CRLF2-r ALL.

Ideogram of chromosomal abnormalities observed in 83 patients with CRLF2-r (26 patients with had reciprocal translocations only and are therefore not depicted in this figure). Somatic numerical gains of chromosome 9 (n=4), 14 (n=3), 17 (n=7), 21 (n=13) and X (n=37) were recurrent in patients with CRLF2-r ALL [excluding gains involved in high hyperdiploidy and near tetraploid karyotypes]. Aneuploidy of chromosomes 9 was present in patients with

P2RY8-CRLF2 only, although this did not reach statistical significance (7% v 0%, p=0.089).

When investigating different combinations of chromosome aneuploidy, no two specific chromosomes were associated with either IGH-CRLF2 or P2RY8-CRLF2. Interestingly of the seven patients with dic(9;20), all had involvement of P2RY8-CRLF2, however this did not reach statistical significance due to low patient numbers. Deletions involving 6q and 9p and additional material located at 1q were rare, but recurrently observed.

John Wiley & Sons

4x1mm (600 x 600 DPI)

John Wiley & Sons

8x5mm (600 x 600 DPI)

John Wiley & Sons

5x4mm (600 x 600 DPI)

John Wiley & Sons

3x2mm (600 x 600 DPI)

John Wiley & Sons

Supplementary Figure 3. Characterisation of the novel fusion, USP9X-DDX3X. (a) Heat

map generated from SNP 6.0 data using the Affymetrix Genotyping Software to show the

presence of an interstitial deletion leading to the fusion of sequences from USP9X to DDX3X

in 2 patients (one with a matched remission sample). The deletion is present only in the

diagnostic samples. (b) Diagram showing the location and fluorophores for a three colour

FISH probe used to screen additional CRLF2-d patients for the presence of this fusion. Top

panel shows a normal interphase nucleus hybridised with the FISH probe. From left to right:

Two complete three colour fusions and DAPI staining; two complete three colour fusions;

two red and green fluorophores only; two aqua fluorophores only. Bottom Panel shows a

fusion positive nucleus with the far right image showing loss of one aqua probe which lies

over the region of deletion, confirming the presence of the fusion in this cell. Due to the

subclone nature of this rearrangement, this fusion would not be visible by SNP array analysis

in all patients (c) Agarose gel of RT-PCR detection of the fusion products using 2 sets of

primers; (1) USP9X exon 31 and DDX3X exon 6; (2) USP9X exon 31 and DDX3X exon 5.

RNA obtained from patient derived xenograft cells (2 mice, xeno 1 and xeno 2) originating

from a fusion positive patient.. The fusion is expressed in both samples. The bands were cut

out, purified and sent for sequencing. (d) Sequencing results showing the exact breakpoint

within both genes. This fusion results in the juxtaposition of exon 31 of USP9X to exon 2 of

DDX3X.

John Wiley & Sons

19x27mm (600 x 600 DPI)

John Wiley & Sons

Supplementary Figure 4. Circos plot for seven P2RY8-CRLF2 and four IGH-CRLF2

patients.

(a-g) Patient with P2RY8-CRLF2 - 9534, 11538, 20638, 20753, 11706, 21991 and 21819 (h-

k) and patients with IGH-CRLF2 - 11543, 21245, 21470 and 19599. The first (outer) ring

displays the names of gene where point mutations and in/dels were identified by WES. The

colour of the gene name infers the type of mutation detected; red - missense mutation; green -

silent mutation; blue - insertion/deletion; black - nonsense mutation. The variant allele

frequency is noted in parenthesis. The second ring shows chromosomal positions. The third

ring show CNA detected by SNP6.0 arrays. Black shows a normal copy number of 2, red a

copy number loss (copy number 1, shorter line or 0, longer line) and green a copy number

gain (copy number of 3, shorter line or 4, longer line). The thickness of the line reflects the

size of the effected area. The fourth (inner) ring shows the validated SV detected by paired-

end sequencing. The coloured lines depict the following rearrangement types; black –

translocation, orange – deletion, blue – inversion, purple – tandem duplication.

John Wiley & Sons