Downloaded from Webqtl (
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Unravelling the Cellular Origin and Clinical Prognostic Markers of Infant
Published Ahead of Print on January 24, 2019, as doi:10.3324/haematol.2018.206375. Copyright 2019 Ferrata Storti Foundation. Unravelling the cellular origin and clinical prognostic markers of infant B-cell acute lymphoblastic leukemia using genome-wide analysis by Antonio Agraz-Doblas, Clara Bueno, Rachael Bashford-Rogers, Anindita Roy, Pauline Schneider, Michela Bardini, Paola Ballerini, Gianni Cazzaniga, Thaidy Moreno, Carlos Revilla, Marta Gut, Maria G Valsecchi, Irene Roberts, Rob Pieters, Paola De Lorenzo, Ignacio Varela, Pablo Menendez, and Ronald W Stam Haematologica 2019 [Epub ahead of print] Citation: Antonio Agraz-Doblas, Clara Bueno, Rachael Bashford-Rogers, Anindita Roy, Pauline Schneider, Michela Bardini, Paola Ballerini, Gianni Cazzaniga, Thaidy Moreno, Carlos Revilla, Marta Gut, Maria G Valsecchi, Irene Roberts, Rob Pieters, Paola De Lorenzo, Ignacio Varela, Pablo Menendez, and Ronald W Stam. Unravelling the cellular origin and clinical prognostic markers of infant B-cell acute lymphoblastic leukemia using genome-wide analysis Haematologica. 2019; 104:xxx doi:10.3324/haematol.2018.206375 Publisher's Disclaimer. E-publishing ahead of print is increasingly important for the rapid dissemination of science. Haematologica is, therefore, E-publishing PDF files of an early version of manuscripts that have completed a regular peer review and have been accepted for publication. E-publishing of this PDF file has been approved by the authors. After having E-published Ahead of Print, manuscripts will then undergo technical and English editing, typesetting, proof correction and be presented for the authors' final approval; the final version of the manuscript will then appear in print on a regular issue of the journal. All legal disclaimers that apply to the journal also pertain to this production process. -
Download Validation Data
PrimePCR™Assay Validation Report Gene Information Gene Name FAST kinase domain-containing protein 1 Gene Symbol Fastkd1 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. NM_001191738 UniGene ID Rn.226110 Ensembl Gene ID ENSRNOG00000024335 Entrez Gene ID 311112 Assay Information Unique Assay ID qRnoCEP0034063 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000036585 Amplicon Context Sequence AAAAAAAAAAACTACAGTCATGATCTGCCTGCTCCAAATATCTGTTCTCTCAGGTA GTCCATCCGTGTATCCTTCGTTGACATTGCCATGGAGTTCCA Amplicon Length (bp) 68 Chromosome Location 3:62537455-62537552 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 97 R2 0.9997 cDNA Cq 23.19 cDNA Tm (Celsius) 79 gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Fastkd1, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org. -
Independent Apoptotic Pathways
An Sp1 transcription factor coordinates caspase- dependent and -independent apoptotic pathways The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Hirose, Takashi, and H. Robert Horvitz. “An Sp1 Transcription Factor Coordinates Caspase-Dependent and -Independent Apoptotic Pathways.” Nature 500, no. 7462 (July 14, 2013): 354–358. As Published http://dx.doi.org/10.1038/nature12329 Publisher Nature Publishing Group Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/85566 Terms of Use Article is made available in accordance with the publisher's policy and may be subject to US copyright law. Please refer to the publisher's site for terms of use. Published as: Nature. 2013 August 15; 500(7462): 354–358. HHMI Author Manuscript HHMI Author Manuscript HHMI Author Manuscript An Sp1 transcription factor coordinates caspase-dependent and -independent apoptotic pathways Takashi Hirose and H. Robert Horvitz Howard Hughes Medical Institute, Department of Biology, 68-425, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, MA 02139, USA Abstract During animal development, the proper regulation of apoptosis requires the precise spatial and temporal execution of cell-death programs, which can include both caspase-dependent and caspase-independent pathways1, 2. While the mechanisms of caspase-dependent and caspase- independent cell killing have been examined extensively, how these pathways are coordinated within a single cell that is fated to die is unknown. Here we show that the C. elegans Sp1 transcription factor SPTF-3 specifies the programmed cell deaths of at least two cells, the sisters of the pharyngeal M4 motor neuron and of the AQR sensory neuron, by transcriptionally activating both caspase-dependent and caspase-independent apoptotic pathways. -
Greg's Awesome Thesis
Analysis of alignment error and sitewise constraint in mammalian comparative genomics Gregory Jordan European Bioinformatics Institute University of Cambridge A dissertation submitted for the degree of Doctor of Philosophy November 30, 2011 To my parents, who kept us thinking and playing This dissertation is the result of my own work and includes nothing which is the out- come of work done in collaboration except where specifically indicated in the text and acknowledgements. This dissertation is not substantially the same as any I have submitted for a degree, diploma or other qualification at any other university, and no part has already been, or is currently being submitted for any degree, diploma or other qualification. This dissertation does not exceed the specified length limit of 60,000 words as defined by the Biology Degree Committee. November 30, 2011 Gregory Jordan ii Analysis of alignment error and sitewise constraint in mammalian comparative genomics Summary Gregory Jordan November 30, 2011 Darwin College Insight into the evolution of protein-coding genes can be gained from the use of phylogenetic codon models. Recently sequenced mammalian genomes and powerful analysis methods developed over the past decade provide the potential to globally measure the impact of natural selection on pro- tein sequences at a fine scale. The detection of positive selection in particular is of great interest, with relevance to the study of host-parasite conflicts, immune system evolution and adaptive dif- ferences between species. This thesis examines the performance of methods for detecting positive selection first with a series of simulation experiments, and then with two empirical studies in mammals and primates. -
Network Pharmacology Interpretation of Fuzheng–Jiedu Decoction Against Colorectal Cancer
Hindawi Evidence-Based Complementary and Alternative Medicine Volume 2021, Article ID 4652492, 16 pages https://doi.org/10.1155/2021/4652492 Research Article Network Pharmacology Interpretation of Fuzheng–Jiedu Decoction against Colorectal Cancer Hongshuo Shi ,1 Sisheng Tian,2 and Hu Tian 3 1College of Traditional Chinese Medicine, Shandong University of Traditional Chinese Medicine, Jinan, Shandong, China 2School of Management, Shandong University of Traditional Chinese Medicine, Jinan, Shandong, China 3College of Traditional Chinese Medicine, Shandong University of Traditional Chinese Medicine, Jinan, Shandong, China Correspondence should be addressed to Hu Tian; [email protected] Received 7 April 2020; Revised 3 January 2021; Accepted 21 January 2021; Published 20 February 2021 Academic Editor: George B. Lenon Copyright © 2021 Hongshuo Shi et al. ,is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Introduction. Traditional Chinese medicine (TCM) believes that the pathogenic factors of colorectal cancer (CRC) are “deficiency, dampness, stasis, and toxin,” and Fuzheng–Jiedu Decoction (FJD) can resist these factors. In this study, we want to find out the potential targets and pathways of FJD in the treatment of CRC and also explain from a scientific point of view that FJD multidrug combination can resist “deficiency, dampness, stasis, and toxin.” Methods. We get the composition of FJD from the TCMSP database and get its potential target. We also get the potential target of colorectal cancer according to the OMIM Database, TTD Database, GeneCards Database, CTD Database, DrugBank Database, and DisGeNET Database. -
Genetic Variation As a Tool for Identifying Novel Transducers of Itch
Genetic variation as a tool for identifying novel transducers of itch By Takeshi Morita A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Molecular and Cell Biology in the Graduate Division of the University of California, Berkeley Committee in charge: Professor Diana M. Bautista, Co-Chair Professor Rachel B. Brem, Co-Chair Professor John Ngai Professor Kristin Scott Professor Michael W. Nachman Summer 2016 Abstract Genetic variation as a tool for identifying novel transducers of itch by Takeshi Morita Doctor of Philosophy in Molecular and Cell Biology University of California, Berkeley Professor Diana M. Bautista, Co-Chair Professor Rachel B. Brem, Co-Chair The mammalian somatosensory system mediates itch, the irritating sensation that elicits a desire to scratch. Millions of people worldwide suffer from chronic itch that fails to respond to current drugs and therapies. Even though recent studies have begun to elucidate the basic characteristics of the itch circuitry, we have little understanding about the molecules and signaling mechanisms that underlie detection and transduction of itch sensation, especially during chronic itch conditions. We have taken a genomic approach by harnessing natural variation in itch-evoked scratching behaviors in mice to identify novel molecular players that are involved in itch signal transduction at the level of primary sensory neurons. From our analysis, we identified numerous candidate itch genes, and further identified a serotonin receptor, HTR7 as a key transducer that is required for both development and maintenance of chronic itch. We further investigated the genetic basis of variation in itch, and identified a set of genes and regulatory pathways that may be involved in controlling itch behaviors. -
Genomics of Inherited Bone Marrow Failure and Myelodysplasia Michael
Genomics of inherited bone marrow failure and myelodysplasia Michael Yu Zhang A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington 2015 Reading Committee: Mary-Claire King, Chair Akiko Shimamura Marshall Horwitz Program Authorized to Offer Degree: Molecular and Cellular Biology 1 ©Copyright 2015 Michael Yu Zhang 2 University of Washington ABSTRACT Genomics of inherited bone marrow failure and myelodysplasia Michael Yu Zhang Chair of the Supervisory Committee: Professor Mary-Claire King Department of Medicine (Medical Genetics) and Genome Sciences Bone marrow failure and myelodysplastic syndromes (BMF/MDS) are disorders of impaired blood cell production with increased leukemia risk. BMF/MDS may be acquired or inherited, a distinction critical for treatment selection. Currently, diagnosis of these inherited syndromes is based on clinical history, family history, and laboratory studies, which directs the ordering of genetic tests on a gene-by-gene basis. However, despite extensive clinical workup and serial genetic testing, many cases remain unexplained. We sought to define the genetic etiology and pathophysiology of unclassified bone marrow failure and myelodysplastic syndromes. First, to determine the extent to which patients remained undiagnosed due to atypical or cryptic presentations of known inherited BMF/MDS, we developed a massively-parallel, next- generation DNA sequencing assay to simultaneously screen for mutations in 85 BMF/MDS genes. Querying 71 pediatric and adult patients with unclassified BMF/MDS using this assay revealed 8 (11%) patients with constitutional, pathogenic mutations in GATA2 , RUNX1 , DKC1 , or LIG4 . All eight patients lacked classic features or laboratory findings for their syndromes. -
Exploring the Pharmacological Mechanism of Quercetin-Resveratrol Combination for Polycystic Ovary Syndrome
www.nature.com/scientificreports Corrected: Publisher Correction OPEN Exploring the Pharmacological Mechanism of Quercetin- Resveratrol Combination for Polycystic Ovary Syndrome: A Systematic Pharmacological Strategy-Based Research Kailin Yang1,2,6, Liuting Zeng 3,6*, Tingting Bao3,4,6, Zhiyong Long5 & Bing Jin3* Resveratrol and quercetin have efects on polycystic ovary syndrome (PCOS). Hence, resveratrol combined with quercetin may have better efects on it. However, because of the limitations in animal and human experiments, the pharmacological and molecular mechanism of quercetin-resveratrol combination (QRC) remains to be clarifed. In this research, a systematic pharmacological approach comprising multiple compound target collection, multiple potential target prediction, and network analysis was used for comparing the characteristic of resveratrol, quercetin and QRC, and exploring the mechanism of QRC. After that, four networks were constructed and analyzed: (1) compound-compound target network; (2) compound-potential target network; (3) QRC-PCOS PPI network; (4) QRC-PCOS- other human proteins (protein-protein interaction) PPI network. Through GO and pathway enrichment analysis, it can be found that three compounds focus on diferent biological processes and pathways; and it seems that QRC combines the characteristics of resveratrol and quercetin. The in-depth study of QRC further showed more PCOS-related biological processes and pathways. Hence, this research not only ofers clues to the researcher who is interested in comparing the diferences among resveratrol, quercetin and QRC, but also provides hints for the researcher who wants to explore QRC’s various synergies and its pharmacological and molecular mechanism. Polycystic ovary syndrome (PCOS) is one of the most common female endocrine diseases characterized by hyperandrogenism, menstrual disorders and infertility. -
C6orf203 Controls OXPHOS Function Through Modulation of Mitochondrial Protein Biosynthesis
bioRxiv preprint doi: https://doi.org/10.1101/704403; this version posted July 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. C6orf203 controls OXPHOS function through modulation of mitochondrial protein biosynthesis number of characters excluding Materials and Methods: 40,651 Sara Palacios-Zambrano1,2, Luis Vázquez-Fonseca1,2, Cristina González-Páramos1,2, Laura Mamblona1,2, Laura Sánchez-Caballero3, Leo Nijtmans3, Rafael Garesse1,2 and Miguel Angel Fernández-Moreno1,2,* 1 Departamento de Bioquímica, Instituto de Investigaciones Biomédicas “Alberto Sols” UAM CSIC and Centro de Investigación Biomédica en Red en Enfermedades Raras (CIBERER). Facultad de Medicina, Universidad Autónoma de Madrid. Madrid 28029, Spain. 2 Instituto de Investigación Sanitaria Hospital 12 de Octubre (imas12), Madrid 28041, Spain. 3 Department of Pediatrics, Radboud Center for Mitochondrial Medicine, Radboud University Medical Center, Nijmegen, The Netherlands. * To whom correspondence should be addressed. Tel:+34 91 497 31 29; Email: [email protected] Running title “C6orf203 controls mt-proteins synthesis” bioRxiv preprint doi: https://doi.org/10.1101/704403; this version posted July 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. ABSTRACT Mitochondria are essential organelles present in the vast majority of eukaryotic cells. Their central function is to produce cellular energy through the OXPHOS system, and functional alterations provoke so-called mitochondrial OXPHOS diseases. It is estimated that several hundred mitochondrial proteins have unknown functions. Very recently, C6orf203 was described to participate in mitochondrial transcription under induced mitochondrial DNA depletion stress conditions. -
And Brain-Specific Expression of KLHL Family Genes
International Journal of Molecular Sciences Article Epigenetics of Muscle- and Brain-Specific Expression of KLHL Family Genes Kenneth C. Ehrlich 1, Carl Baribault 2 and Melanie Ehrlich 3,* 1 Center for Biomedical Informatics and Genomics, Tulane University Health Sciences Center, New Orleans, LA 70112, USA; [email protected] 2 Center for Research and Scientific Computing (CRSC), Tulane University Information Technology, Tulane University, New Orleans, LA 70112, USA; [email protected] 3 Center for Biomedical Informatics and Genomics, Tulane Cancer Center, Hayward Genetics Program, Tulane University Health Sciences Center, New Orleans, LA 70112, USA * Correspondence: [email protected]; Tel.: +1-504-939-0916 Received: 16 October 2020; Accepted: 6 November 2020; Published: 9 November 2020 Abstract: KLHL and the related KBTBD genes encode components of the Cullin-E3 ubiquitin ligase complex and typically target tissue-specific proteins for degradation, thereby affecting differentiation, homeostasis, metabolism, cell signaling, and the oxidative stress response. Despite their importance in cell function and disease (especially, KLHL40, KLHL41, KBTBD13, KEAP1, and ENC1), previous studies of epigenetic factors that affect transcription were predominantly limited to promoter DNA methylation. Using diverse tissue and cell culture whole-genome profiles, we examined 17 KLHL or KBTBD genes preferentially expressed in skeletal muscle or brain to identify tissue-specific enhancer and promoter chromatin, open chromatin (DNaseI hypersensitivity), and DNA hypomethylation. Sixteen of the 17 genes displayed muscle- or brain-specific enhancer chromatin in their gene bodies, and most exhibited specific intergenic enhancer chromatin as well. Seven genes were embedded in super-enhancers (particularly strong, tissue-specific clusters of enhancers). The enhancer chromatin regions typically displayed foci of DNA hypomethylation at peaks of open chromatin. -
Control of the Physical and Antimicrobial Skin Barrier by an IL-31–IL-1 Signaling Network
The Journal of Immunology Control of the Physical and Antimicrobial Skin Barrier by an IL-31–IL-1 Signaling Network Kai H. Ha¨nel,*,†,1,2 Carolina M. Pfaff,*,†,1 Christian Cornelissen,*,†,3 Philipp M. Amann,*,4 Yvonne Marquardt,* Katharina Czaja,* Arianna Kim,‡ Bernhard Luscher,€ †,5 and Jens M. Baron*,5 Atopic dermatitis, a chronic inflammatory skin disease with increasing prevalence, is closely associated with skin barrier defects. A cy- tokine related to disease severity and inhibition of keratinocyte differentiation is IL-31. To identify its molecular targets, IL-31–dependent gene expression was determined in three-dimensional organotypic skin models. IL-31–regulated genes are involved in the formation of an intact physical skin barrier. Many of these genes were poorly induced during differentiation as a consequence of IL-31 treatment, resulting in increased penetrability to allergens and irritants. Furthermore, studies employing cell-sorted skin equivalents in SCID/NOD mice demonstrated enhanced transepidermal water loss following s.c. administration of IL-31. We identified the IL-1 cytokine network as a downstream effector of IL-31 signaling. Anakinra, an IL-1R antagonist, blocked the IL-31 effects on skin differentiation. In addition to the effects on the physical barrier, IL-31 stimulated the expression of antimicrobial peptides, thereby inhibiting bacterial growth on the three-dimensional organotypic skin models. This was evident already at low doses of IL-31, insufficient to interfere with the physical barrier. Together, these findings demonstrate that IL-31 affects keratinocyte differentiation in multiple ways and that the IL-1 cytokine network is a major downstream effector of IL-31 signaling in deregulating the physical skin barrier. -
High-Throughput Sirna Screening Reveals Functional Interactions and Redundancies Of
bioRxiv preprint doi: https://doi.org/10.1101/2020.08.05.238006; this version posted August 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. High-throughput siRNA screening reveals functional interactions and redundancies of human processive exoribonucleases Anna Hojka-Osinska1,2, ‡, Aleksander Chlebowski2,‡, Ewelina P. Owczarek2, Kamila Afek2, Kamila Kłosowska2, Roman J. Szczesny2#, Andrzej Dziembowski1,2,3# 1 International Institute of Molecular and Cell Biology, 02-109, Warsaw, Poland 2 Institute of Biochemistry and Biophysics Polish Academy of Sciences, 02-106, Warsaw, Poland 3Department of Genetics and Biotechnology, Faculty of Biology, University of Warsaw, 02- 096, Warsaw, Poland ‡These authors contributed equally to this work *Corresponding author 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.08.05.238006; this version posted August 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. ABSTRACT Processive exoribonucleases, the executors of RNA decay, participate in multiple physical and functional interactions. Unlike physical ones, functional relationships have not been investigated in human cells. Here we have screened cells deficient in DIS3, XRN2, EXOSC10, DIS3L, and DIS3L2 with a custom siRNA library and determined their functional interactions with diverse pathways of RNA metabolism.