UC Berkeley UC Berkeley Electronic Theses and Dissertations

Title Genetic variation as a tool for identifying novel transducers of itch

Permalink https://escholarship.org/uc/item/8j23t054

Author Morita, Takeshi

Publication Date 2016

Peer reviewed|Thesis/dissertation

eScholarship.org Powered by the California Digital Library University of California

Genetic variation as a tool for identifying novel transducers of itch

By

Takeshi Morita

A dissertation submitted in partial satisfaction of the requirements for the degree of

Doctor of Philosophy

in

Molecular and Cell Biology

in the

Graduate Division

of the

University of California, Berkeley

Committee in charge: Professor Diana M. Bautista, Co-Chair Professor Rachel B. Brem, Co-Chair Professor John Ngai Professor Kristin Scott Professor Michael W. Nachman

Summer 2016

Abstract

Genetic variation as a tool for identifying novel transducers of itch

by

Takeshi Morita

Doctor of Philosophy in Molecular and Cell Biology

University of California, Berkeley

Professor Diana M. Bautista, Co-Chair Professor Rachel B. Brem, Co-Chair

The mammalian somatosensory system mediates itch, the irritating sensation that elicits a desire to scratch. Millions of people worldwide suffer from chronic itch that fails to respond to current drugs and therapies. Even though recent studies have begun to elucidate the basic characteristics of the itch circuitry, we have little understanding about the molecules and signaling mechanisms that underlie detection and transduction of itch sensation, especially during chronic itch conditions. We have taken a genomic approach by harnessing natural variation in itch-evoked scratching behaviors in mice to identify novel molecular players that are involved in itch signal transduction at the level of primary sensory neurons. From our analysis, we identified numerous candidate itch genes, and further identified a serotonin receptor, HTR7 as a key transducer that is required for both development and maintenance of chronic itch. We further investigated the genetic basis of variation in itch, and identified a set of genes and regulatory pathways that may be involved in controlling itch behaviors. Our work illustrates the power of genomic studies in identifying genes and regulatory pathways involved in somatosensory behaviors, further providing resources and molecular insights into possible treatment options for chronic itch conditions.

1

Table of Contents

Acknowledgments ii

Chapter 1: Introduction to the somatosensory system and itch 1

Chapter 2: HTR7 mediates acute and chronic itch 15 Introduction 15 Materials and Methods 16 Results 19 Discussion 25 Figures and Tables 29

Chapter 3: Genetic mapping of novel molecular players in itch 44 Introduction 44 Materials and Methods 45 Results 48 Discussion 51 Figures and Tables 54

References 60

i

Acknowledgements

I would like to thank my mentors, Dr. Diana Bautista and Dr. Rachel Brem for their guidance and support, as well as my thesis committee members, Dr. Kristin Scott, Dr. John Ngai, and Dr. Michael Nachman who provided numerous suggestions and advice over the course of my graduate studies.

ii

Chapter 1: Introduction to the somatosensory system and itch

Itch is as an irritating sensation that elicits the desire to scratch. Itch is thought to serve as an important protective function that helps us avoid potentially harmful stimuli. While acute itch is mostly innocuous and can easily be treated with various treatment options, the condition can become devastating during chronic itch conditions. Millions of people worldwide suffer from chronic itch that fails to respond to current drugs and therapies. Chronic itch is seen in patients with atopic dermatitis (AD), peripheral neuropathy, shingles, and various systemic disorders such as liver and kidney failure1. While many forms of itch are mediated by histamine signaling, most acute and chronic itch conditions are insensitive to antihistamine treatment and targets for therapeutic treatment have yet to be identified2-7. While recent studies have begun to identify key molecular players and neurons that make up the itch circuit, we still know little about the molecular and cellular mechanisms underlying detection, propagation, and modulation of itch signals, especially during chronic itch conditions8,9. Molecular analyses of itch is particularly challenging due to the diversity and diffuse localization of afferents, and a lack of molecular markers for subsets of somatosensory neurons. Only a handful of studies have identified molecular and cellular mechanisms that drive chronic itch pathogenesis. Thus, a key goal in itch biology is the identify the transducers, cells and circuits that drive chronic itch pathogenesis.

Molecular mechanisms of itch signal transduction at the periphery The somatosensory system detects different sensations, including mechanical force, temperature, pain and itch. These unique sensations are detected by sensory neurons with distinct molecular profiles that innervate the skin (Figure 1A). The somatosensory neuronal fibers originate as a cluster of cell bodies that are located along the spinal cord called the dorsal root ganglia (DRG) and at the base of the skull called the trigeminal ganglia. When these neuronal fibers are either physically or chemically stimulated, the pseudounipolar morphology of these sensory neurons allows the propagation of electrical signals from the periphery to the central nervous system9-11. Somatosensory neurons are a heterogeneous population of neurons that are classified based on their morphological, physiological and molecular characteristics. Here, I will focus on small diameter nociceptors that mediate both itch and pain signal transduction.

Itch and pain sensation is mediated through distinct neuronal circuits Even though itch and pain are thought to be detected through a similar subset of peripheral neurons, recent studies have shown that these sensations are mediated through different neuronal populations and molecular pathways (Figure 1B). Approximately 5–20% of primary afferent nociceptors are activated by endogenous itch-producing compounds released by non-neuronal cells in the skin (e.g. mast cells, platelets, keratinocytes), as well as various exogenous pruritogens1,8,9,12 (Figure 1B). Specifically, chloroquine sensitive Mrgpra3

1

expressing neurons are required for mediating both acute and chronic itch in mice, as ablation of this specific neuronal population caused reduction in itch behaviors in response to various pruritogens and chronic itch models without affecting pain behaviors13. Specific activation of Mrgpra3+ population caused itch without eliciting pain behavior, further demonstrating that itch and pain are mediated through distinct primary neuronal populations13.

Molecular mechanism of histamine mediated itch Itch neuronal population is further divided into histamine-sensitive and histamine- insensitive primary afferent fibers that are organized into distinct circuits9,12. The histamine dependent pathway detects histamine release from allergic reaction and bug bites that are consistent with acute forms of itch. Histamine signaling is mediated through the neuronal population expressing the histamine receptor, H1R. Activation of H1R leads to neuronal excitation and itch behavior through activation of TRPV1 through a PLCβ pathway. TRPV1 is required for histamine mediated itch behavior, as both neuronal excitation and itch behavior was abolished in TRPV1 knockout animals14 (Figure 1, Top).

Molecular mechanism of histamine-independent itch Most forms of itch are insensitive to antihistamine treatment and are mediated through a separate neuronal population that is often associated with chronic itch conditions (Figure 1B, Top). These were first identified through the application of cowhage spicules on human subjects, which elicited itch response that were not alleviated through antihistamine treatment15,16. Since then, many histamine- independent pruritogens were identified, both endogenous compounds, such as BAM8-22, serotonin, bile acids, and proteases, as well as various exogenous pruritogens, such as chloroquine, imiquimod, and bacterial components1,17,18. Recent studies have begun to elucidate the molecular mechanisms underlying histamine-independent itch. Chloroquine activates 10-20% of sensory neurons through the Mas-related GPCR, MRGPRA3, which signals to the wasabi/irritant receptor TRPA1 for neuronal excitation and itch behaviors through Gβγ signaling19. As mentioned above, neuronal ablation of this MRGPRA3+ population causes reduction of both acute and chronic itch behavior while specific activation elicits itch behaviors, suggesting a clear role of this neuronal population in specifically transducing itch signals from the skin.

MRGPRA3+ neuronal afferents can be further divided based on functional properties (Figure 1B, Top). BAM8-22, a peptide that is released by mast cells activates neuronal afferents that express MRGPRC11. MRGPRC11 signals to the wasabi/irritant receptor TRPA1 for neuronal excitation through PLCβ19. Proteases, such as trypsin and cathepsin S activate neuronal afferents expressing PAR2, which signals to TRPA1 though an unknown mechanism. Another subpopulation within the MRGPRA3+ neuronal afferents is the neurons that express the high-affinity serotonin receptor HTR7 that detect low levels of serotonin in the skin to mediate itch behavior. HTR7 signals to TRPA1 through both Gβγ and adenylate cyclase pathway20.

2

A recent study has revealed a novel subpopulation of histamine-independent itch neurons that are activated by the keratinocyte-derived cytokine, thymic stromal lymphopoietin (TSLP)21 (Figure 1B, Top). This population is distinct from other histamine-insensitive neuronal populations, as these neurons do not overlap functionally with other pruritogen receptors. This neuronal population expresses the TSLP receptor complex (TSLPR), which composed of CRLF2 and IL7R. When activated by TSLP, TSLPR signals to TRPA1 through PLC signaling for neuronal excitation and itch behavior. This population is similar to other histamine-independent itch neurons, as it also requires TRPA1 for neuronal excitation and itch behavior.

Itch signal transduction at the primary afferent central terminals Even though histamine-dependent and -independent forms of itch are mediated through distinct molecular pathways and neuronal populations, both types of itch are mediated through primary sensory neurons that express and release specific neurotransmitters during itch signal propagation at central terminals. The first itch specific neurotransmitter was gastrin releasing peptide (GRP). When the authors conducted neuronal ablation targeting GRPR+ spinal cord neurons, mice displayed reduction in scratching behaviors to both histamine-dependent and - independent pruritogens without affecting pain behaviors22,23. Furthermore, direct injection of GRP was sufficient to cause robust scratching behavior without inducing pain. In addition to GRP, a recent study that utilized an unbiased transcriptomic screen has identified the neuropeptide, naturietic polypeptide B (NPPB) also as an itch specific neurotransmitter24. Nppb knockout mice displayed complete loss of itch sensation with normal pain behaviors. The authors further ablated the NPPB receptor (NRPA) expressing neuronal population and saw diminished itch response. Surprisingly, these NRPA+ neuronal ablated animals displayed itch response to intrathecal injection of GRP, further suggesting a model where GRP/GRPR signaling occurs downstream of NPPB/NRPA signaling. Even though there is still a debate in the mechanistic model of itch neurotransmission, both GRP and NPPB signaling is required for itch signal transmission from the periphery to the central nervous system and provides a potential mechanism of how distinct itch information is converged at the spinal cord level.

Molecular identities of endogenously released pruritogens In addition to molecular mechanisms underlying pruritogen detection in the primary sensory fibers, not much is known about the molecular mechanisms underlying cell types, as well as the identities of the endogenous pruritogens that are released from these cell types.

Pruritogens released by keratinocytes Skin is a highly complex organ, mainly composed of keratinocytes that are interspersed with a variety of cell types, including various skin resident immune

3

cells, such as mast cells, macrophages, dendritic cells, innate lymphoid cells (ILCs), γδ T cells and αβ T cells25. Keratinocytes can be activated by proteases such as tryptase, cathepsin S and mucanain through activation of PAR2 and PAR4, and can also be activated by histamine through H1R and H4R. Activated keratinocytes can then release TSLP, CXCL9, CXCL10, CXCL11, CCL20, tumor necrosis factor (TNF), IL-1α and IL-1β, IL-6, IL-10, IL-18 and IL-3326,27. Even though keratinocytes release vast number of cytokines and potential pruriotgens, whether any of these molecules, except TSLP are sufficient to drive itch behavior is yet to be determined.

Pruritogens released by mast cells One of the major skin resident immune cells that play a significant role in itch is mast cell. Mast cells release various small molecules including histamine, serotonin, protease, TNF, IL-1, and IL-6 upon degranulation28. Mast cells can be activated directly through Toll-like receptors (TLRs) or indirect interactions through IgE and the complement pathway. In addition to the traditional mechanisms of mast cell degranulation, a recent study explored a novel degranulation pathway that was mediated through one of the Mas-related GPCRs, MRGPRB2. The authors demonstrated that previously known pruritogens, compound 48/80 and substance P acted through activation of MRGPRB2 on mast cells in an IgE-independent mechanism. MRGPRB2 is required for degranulation in response to 48/80 and substance P and was also required for mouse model of allergic type-reactions. Even though this study did not directly look at the role of MRGPRB2 in itch behaviors, future studies will tell us the potential mechanisms underlying pruritogen release and the identities of these endogenous molecules.

Central modulation of itch signal propagation Itch signal propagation in the spinal cord is mediated through distinct circuits that are under tonic modulation by other somatosensory modalities. As mentioned above, itch primary afferents release NPPB and signals to the second order interneurons that specifically express NRPA in lamina 1 and 2 of the dorsal horn. This interneuron population then signals to projection neurons that propagate itch signals further up into the central nervous system.

Itch modulation at the primary afferent central terminal Itch and pain has long been known to have an antagonistic relationship. One key study that demonstrated this was by genetically ablating Vglut2, a glutamate transporter that is specifically expressed in nociceptor central terminals. By ablating Vglut2, the authors saw reduction in pain signal transduction as well as towards an array of pain behavioral assays. However, they also noticed that these mice developed spontaneous and enhanced scratching behavior in response to pruritogen injections29,30. This work was the first molecular and cellular demonstration that pain and itch are in close antagonistic relationship and constant modulation from multiple sensory modalities. Furthermore, the

4

antagonistic relationship between pain and itch has also been proposed due to severe side effects from administration analgesics, such as opioids that enhance itch behaviors in patients1,31,32. The molecular and cellular site of action has remained a mystery. Through a series of experiments, Liu et. al. demonstrated that unique µ-opioid receptor (MOR) isoforms, MOR1 and MOR1D are expressed in non-overlapping population of lamina 1 interneurons in the dorsal horn. They further demonstrated that MOR1D was coexpressed with GRPR and form a heterodimer for transmission of itch, while MOR1 signaling was required for inhibiting pain transmission.

Inhibitory modulation of itch through the pain pathway The spinal itch circuit is under constant modulation by a separate and distinct circuit that transmits pain signals (Figure 2). Pain sensory neurons form synapses with the Bhlhb5+ lineage of inhibitory interneurons that reside in lamina 1 and 2 of the dorsal horn to modulate the itch signal propagation. When these Bhlhb5 expressing neurons (B5-I) were genetically ablated, these mice developed spontaneous itch behavior, while specific activation of these inhibitory interneurons lead to decreased itch behavior33,34. Subsequent experiments showed that B5-I negatively modulated the spinal itch circuit through the release of a kappa-opioid, dynorphin onto the downstream spinal neurons expressing kappa-opioid receptor (KOR). In addition, pharmacological activation using nalfurafine, a KOR agonist decreased, while KOR antagonist enhanced itch behaviors35.

Mechanical inhibition of Itch pathway Itch is also under constant inhibitory modulation through the activity of neuropeptide Y (NPY)-expressing interneurons (Figure 2). Spinal inhibitory interneurons expressing neuropeptide Y (NPY), which resides in lamina 3 of the dorsal horn, was shown to negatively modulate the itch signal transmission. These authors demonstrated that inhibition or neuronal ablation NPY-expressing neurons caused normally innocuous mechanical stimuli to elicit robust scratching behavior. Mechanical-itch is “unmasked” when the tonic inhibitory activity by the NPY+ inhibitory interneurons are released. This inhibitory modulation seems to be independent of the B5-I mediated itch modulation, as chemically induced itch was not affected in NPY ablated mice. These data suggest a novel itch circuit that is distinct from propagating chemically induced itch36. The molecular and cellular identities of these mechanical itch interneurons and the interactions between chemical and mechanical induced itch modalities are of future study of interest.

Top-down modulation of itch signal propagation Itch circuit is modulated by not just at the peripheral and the spinal cord level but also from the higher brain area based on the internal states of the animal. For example, a recent study has demonstrated that descending serotonergic modulation from the brainstem raphe nuclei facilitates scratching behavior37. Itch behavior was significantly impaired in mice lacking Lmx1b, a transcription factor

5

that is required for normal development of all central 5-HT neurons were specifically ablated in the raphe nuclei. They further demonstrated that this process involved heterodimer complex involving a serotonin receptor, HTR1A and GRPR expressed at the central terminal of DRG neurons. These data demonstrated that the itch circuit is under constant serotonergic modulation. The modulation was mediated through serotonin release onto the central terminal of dorsal root ganglia, activating the HTR1A/GRPR heterodimer complex to enhance itch signal transduction.

These works demonstrate the diversity of cell types and molecular mechanisms underlying itch modulation at the spinal circuit level. Even though these are examples of showing the itch modulation at the spinal circuit level, this is just a beginning where there are other molecules and neuronal cell types that are waiting to be discovered.

Genetic and molecular basis of chronic itch conditions The condition of chronic itch is surprisingly common as it affects roughly 20% of the population. Chronic itch, like chronic pain, can occur in the absence of disease or injury, has no endpoint and significantly decreases quality of life. Chronic itch can also result from a number of skin diseases and systemic conditions, such as eczema, kidney failure, cirrhosis and some cancers, as well as a variety of neurological disorders, including multiple sclerosis, diabetes, post- herpetic neuralgia and shingles. In contrast to the prevalence this debilitating condition, not much is known regarding molecular and cellular mechanisms underlying the development and maintenance of chronic itch.

Genetic and molecular contributions underlying human atopic dermatitis One of the most commonly seen chronic itch conditions is eczema, also known as atopic dermatitis (AD). Onset of AD is usually early in life, affecting around 10% of infants and children38. The hallmark characteristics of AD are development of skin lesions, skin thickening, immune cell recruitment, neuronal hyperinnervation and hyperexcitability as well as severe itch. Even though AD improves with age, many children end up developing additional symptoms, such as food allergies, rhinitis, and severe forms of asthma, and this gradual progression through these atopic diseases is called the “atopic march”. AD is thought to be the trigger for development of atopic march, but the underlying molecular mechanism of how AD is triggered has not yet been determined38.

There are strong genetic contributions underlying human AD. Filaggrin (FLG) is the most well characterized gene that has the potential role in triggering AD. Null mutations in FLG were first identified through linkage mapping studies in affected families, while follow up studies further increased the number of null mutation, further demonstrating that variation in FLG is much more common than previous estimates39. FLG is a key structural protein that is required for normal development of an epithelial layer called the cornified envelope, which functions

6

as a protective barrier to achieve normal skin microenvironment, such as pH, defense against pathogenic infections and prevention of water loss. Loss of FLG function leads to disruption in skin barrier formation, and thought to be the key step in triggering AD. Even though FLG mutation and skin barrier disruption has been linked to higher risk of developing AD, the exact molecular switch and events that trigger AD has yet to be determined40-42.

Immune cell infiltration and neuro-immune interactions further exacerbate skin inflammation that facilitates development of AD. The skin of AD patients shows enrichment of CD11c+ dendritic cells, CD3+ T cells, and CD4+ T cells43-45 along with upregulation of various cytokines such as TSLP, IL-1β, TNFα, IL-4, IL-13 and IL-31 that are released from these infiltrated immune cells21,46-49. Sensory neurons can further interact with resident immune cells for further immune cell infiltration through release of neuropeptides, such as CGRP, substance P, NGF, and NPY are all upregulated in AD patients50,51. These recruited immune cells in combination with resident immune cells further contribute to release of various small molecules and peptides. For example, histamine, serotonin, and various proteases are all upregulated in skin of AD patients52,53. Further studies using AD mouse models are required to further understand the series of events and cell- cell interactions underlying development of AD.

Mouse model of atopic dermatitis AD has been difficult to study due to lack of appropriate mouse models. Ideal AD mouse models should recapitulate the human AD condition with induction of severe skin lesions, upregulation of molecular mediators in the skin, and development of scratching behavior. One of the most widely used AD models is the epicutaneous sensitization using allergens exposure such as ovalbumin (OVA)54. Mice are sensitized to OVA after physical disruption of skin barrier using the tape stripping method. Multiple exposures (1 week treatment x 3 sessions) to OVA results in development of increased scratching behavior, skin lesions characterized by epidermal and dermal thickening, infiltration of CD4+ T cells and eosinophils, and upregulation of IL-4, IL-5, and IL-13, all hallmark characteristics of AD43,54,55. Even though the OVA model has been used widely and successfully revealed many molecular and immune cell interactions driving cytokine expression and skin lesion formation recapitulating human AD conditions, the process which takes ~4 weeks for complete induction limits the ability for large scale studies involving knockout animals and pharmacological studies.

In addition to epicutaneous sensitization assays described above, genetic models of AD have also been reported to recapitulate many of the human AD conditions. One genetic model that has been widely used is the Nc/Nga mouse strain. Nc/Nga strain emerged as an AD model through spontaneous development of skin lesion and scratching behavior under conventional housing conditions as a result of exposure to environmental allergens, which is not seen if kept in specific-pathogen free (SPF) conditions56. Linkage mapping studies have narrowed down the causal DNA sequence variation to chromosome 9, but the

7

exact genes that are affected, and the molecular and cellular mechanisms underlying this AD model are currently unknown57. This mouse strain first develops scratching behavior at 6 weeks, followed by reddening and swelling of skin near the face, ears, neck, and back which result in hyperparakeratosis and hyperplasia at week 17. Immune cell infiltrations are seen as eosinophils, mast cells, and T cells accumulate at the skin57,58. IL-4, IL-5, CCL17, CCL22, and other Th2 type cytokines in the skin as well as elevated IgE serum concentration makes this a great genetic model for studying the development of AD57,58. However, due to the gradual development of AD-like conditions as well as the genetic background makes this model difficult to conduct large-scale experiments using various genetic knockout mouse strains.

In order to overcome the slow development of AD-like conditions and limitations with usage of genetic knockout mouse strains, TSLP overexpression mouse models has been used and modified for rapid development and examination of human AD-like conditions. TSLP is a cytokine that is expressed and released by keratinocytes that are upregulated in human AD skin. TSLP can directly activate sensory neurons to elicit itch behaviors, but also cause immune cell recruitment that further exacerbate inflammation21. TSLP overexpression in keratinocytes is sufficient to drive AD-like skin phenotype as well as asthma59,60, and from these observations, TSLP is thought to be the master regulator of AD. Utilizing the critical role for TSLP in AD, TSLP upregulation can be induced by topical application of the Vitamin D analog, MC903. TSLP is under transcriptional regulation under the repressor complex VDR/RXR in keratinocytes. MC903 binding to VDR causes derepression of the repressor complex, allowing transcription and overexpression of TSLP in the skin. MC903 treatment induced scratching behavior at day 3 of treatment, with development of skin lesion, immune cell infiltration and release of proinflammatory cytokines by day 8. This process was dependent on TSLP as TSLP knockout mice failed to develop AD like phenotype using the MC903 model. Due to the rapid development of AD-like conditions that can be induced in any mouse strains, MC903 mouse model of AD can be utilized as a great tool for investigating the molecular and cellular mechanisms underlying development of AD.

Role of TRPA1 in atopic dermatitis In addition, TRPA1 has also emerged as key molecular player involved in mediating chronic itch conditions. As mentioned above, TRPA1 has been shown to mediate histamine-independent acute itch, however, whether TRPA1 is required for chronic itch has not been investigated. Using the dry-skin model of chronic itch, Wilson et. al. demonstrated that TRPA1 knockout mice displayed diminished scratching behavior as well as significant reduction in skin lesion formation and hyperplasia. TRPA1 was also required for gene expressional changes that accompanied the dry-skin phenotype61. In addition, TRPA1 has also been shown to be required for development of skin inflammation, lesion formation and scratching behavior in a mouse model of allergic contact dermatitis (ACD). ACD induced proinflammatory cytokine release was dependent on

8

TRPA1, where IL-4, IL-6, CXCL-2, substance P, NGF, and 5-HT release were significantly decreased in TRPA1 knockout animals62. Studies using a keratinocyte specific inducible IL-13 model of AD, the authors demonstrated that this mouse model leads to upregulation TSLP expression in the skin, various chemokines, and mast cell mediators that lead to recruitment of mast cells that accompanied skin lesion formation63. This process involved TRPA1, as pharmacological blockage using a TRPA1 antagonist leads to significant reduction in mast cell recruitment, skin lesion formation as well as scratching behaviors in the IL-13 AD model. They further demonstrated that TRPA1 was upregulated in both mast cells and nerve terminals innervating the dermis in human AD patients, suggesting a model that TRPA1 is upregulated and induced in normally non-TRPA1 expressing cell types during chronic itch conditions. These results suggest the critical role of TRPA1 in not only transducing acute itch, but also functioning as a key modulator of various chronic itch conditions, including AD64.

Genomic approaches to understand the somatosensory system Genomic approaches have enabled researchers to identify genes and mutations underlying various phenotypic traits. However, this approach has not been widely adapted to study the somatosensory system.

Natural variation as a tool for identifying causal genes One approach that has been used to understand the somatosensory system is by utilizing natural variation between genetically distinct individuals. By looking at naturally occurring differences in somatosensory behaviors, one can identify underlying genes and DNA sequence variations that may mediate behavioral traits. Earlier studies have looked at panels of F2 recombinant inbred (RI) mouse strains to identify genomic regions showing strong linkage to various pain behavioral assays, including opioid induced analgesia and thermal nociception65. Subsequent fine mapping and functional studies demonstrated that Oprm and Htr1b were causal genes mediating analgesia, while Oprd1, had significant contribution for thermal pain66,67. This approach has further been applied to map genes underlying additional pain behaviors, including chemical pain, and mechanical allodynia68-70. Recently, a new mapping approach has been developed using a panel of advanced intercross mouse strains that were generated using eight founder strains. This approach offers a panel of recombinant mouse strains with increased genetic heterozygosity and allelic diversity compared to the traditional RI strains, allowing higher resolution mapping of quantitative trait loci linking to various behavioral traits. Using this approach, a recent mapping study identified Hydin as a potential gene contributing to thermal pain behavior71. These examples demonstrate the power of natural variation in identifying causal genetic variations underlying complex behavioral traits. Interestingly, genetic mapping has not yet been utilized to investigate itch behaviors.

9

Powerful resources for studying the diverse population of sensory neurons Molecular analysis in the somatosensory system is particularly challenging due to the diversity, diffuse localization, and lack of molecular markers that make up the somatosensory system. To overcome this problem, recent studies have adapted the sequencing technology to look at gene expression profiles of somatosensory neurons at a finer resolution. One approach that has been developed is sequencing a population of somatosensory neurons based on reporter expression. Using a TRPV1 reporter mouse, Goswami and colleagues sorted out the TRPV1-positive neuronal population to look for genes specifically enriched in this nociceptive neuronal population72. A similar approach was taken by another group, which sorted DRG neurons based on Parvalbumin expression, which they further separated this population based on IB4 expression and looked for genes specifically enriched in each population of sorted cells73. Furthermore, Usoskin and colleagues took an unbiased approach by sequencing the transcriptome from individually sorted DRG neurons. They further clustered the sequenced cells based on each of their transcriptome profiles and categorized the cells based on known molecular markers into finer subclasses of somatosensory neuronal populations74. Even though there are technical issues in cell sorting as well as signal detection of low coverage single cell RNAseq datasets, these resources provide additional information regarding the diverse set of cells that make up the somatosensory neuronal population.

These findings illustrate the power of using genome-wide approaches in elucidating the molecular and cellular players underlying the somatosensory system. What is interesting is that although these approaches have been used for making seminal discoveries regarding molecular players involved in pain and mechanosensation, genome-wide approaches looking for genes and expression profiles affecting itch have not yet been investigated.

Open questions in itch biology Even though recent studies have begun to elucidate the basic molecular players and neuronal circuits involved in detection, propagation, and modulation of acute itch, there is much more to learn about the molecules, cell types, and cascade of events that are involved in itch signal transduction, especially during chronic itch conditions. What cell types are involved in development of chronic itch? What itch/signaling molecules do these cell types release? How do these cell types communicate with each other to trigger chronic itch? In addition, even though there are strong genetic associations with development of chronic itch, we do not know the genetic signatures underlying development of these disease conditions.

In the subsequent two chapters of this thesis, I harnessed natural variation in itch behavior to dissect the genetic, molecular, and cellular mechanisms underlying itch signal transduction. First, using a panel of mouse strains that displayed variation in itch, I looked for genes with expression patterns that correlated with itch behavior. Second, I took a statistical genetics approach in looking at potential

10

DNA sequence variation that dictated itch behavior, and also looked at gene regulatory networks underlying expression profiles in somatosensory neurons. By understanding the genetic and cellular mechanisms underlying itch signal transduction, these findings can provide better treatment options for patients suffering from chronic itch conditions.

11

Figure 1. Schematic representation of itch signal transduction. (A) Itch is detected by a subset of sensory neurons that are distinct from pain. Itch is detected by small diameter sensory neurons that innervate the epidermal skin layer. These primary sensory neurons send projections to the dorsal horn of the spinal cord. (B) Sensory neurons that process itch signals can be further divided into three subpopulations based on immunohistological and functional properties. Histamine is detected by neurons expressing H1R, which signals to TRPV1 for neuronal excitation. Histamine-independent itch compounds, such as serotonin (5-HT), chloroquine, BAM8-22, and various proteases activate their corresponding receptors that further signal through TRPA1 for neuronal excitation. These neuronal afferents express the chloroquine receptor, MRGPRA3. TSLP is detected by a unique subpopulation of sensory neurons that signals through TRPA1 for neuronal excitation. Pain is processed in distinct

12

neuronal populations that are directly activated by noxious stimuli and tissue damage, as well as mechanical forces. These neurons can be sensitized during neurogenic inflammation through detection of neuromodulators, such as bradykinin and endothelin acting through both TRPV1 and TRPA1. PLC, Phospolipase C; AC, adenylate cyclase.

13

Figure 2. Itch modulation at the spinal cord. Itch signal propagation is under constant modulation at dorsal horn by other somatosensory modalities. Chemically induced itch is detected by sensory neurons that release NPPB to the second order interneurons that express NPRA. NPRA+ interneurons co-express GRP and release this neurotransmitter to downstream interneurons that further signals to projection neurons that transmit itch signals to the brain. Chemical itch is under inhibitory modulation by the pain pathway through the BHLHB5+ interneurons that release dynorphin (kappa-opioid) along with GABA and glycine. Itch signal propagation is dampened by activation of kappa-opioid receptor expressed on NRPA+/GRPR+ interneurons. Itch is also under constant inhibitory modulation through the activity of neuropeptide Y (NPY)-expressing interneurons. Mechanical-itch is “unmasked” when the tonic inhibitory activity by the NPY+ inhibitory interneurons are released, causing normally innocuous mechanical stimuli to cause robust itch behavior. Surprisingly, this mechanical- induced itch mediated through a distinct itch circuitry than the chemical-induced itch pathway. Identities of interneurons, projection neurons and released neurotransmitter are currently unknown for mechanically induced itch circuit. Likewise, the interaction between chemical- and mechanical-induced itch pathway, and whether these itch signals ever converge is not well understood. Filled triangles indicate excitatory synaptic connections, while open triangles indicate inhibitory synaptic connections. DYN, dynorphin; GABA, γ-Aminobutyric acid; Glu, glutamate; Gly, glycine.

14

Chapter 2: HTR7 Mediates Serotonergic Acute and Chronic itch

Previously published as: Morita T, McClain SP, Batia LM, Pellegrino M, Wilson SR, Kienzler MA, Lyman K, Olsen AS, Wong JF, Stucky CL, Brem RB, Bautista DM. HTR7 Mediates Serotonergic Acute and Chronic Itch. Neuron. 2015 Jul 1;87(1):124-38

INTRODUCTION

Chronic itch is a debilitating disorder that results from of a number of skin diseases such as atopic dermatitis, as well as systemic conditions including kidney failure, cirrhosis and some cancers. Although itch from allergy or bug bites is often treatable with antihistamines, most forms of chronic itch are resistant to antihistamine treatment75. Further, an estimated 10-20% of the population will suffer from chronic itch at some point in their lifetime76,77. Consequently, understanding the molecular basis of chronic itch is of significant clinical interest. Itch signals are transduced via a subset of primary afferent sensory neurons that innervate the skin. A number of studies have identified cells and receptors that transduce acute itch signals8,9,75,78. However, the molecular mechanisms underlying the development, maintenance, and transmission of chronic itch signals remain largely unknown. Likewise, a number of unanswered questions about acute itch transduction persist, including the peripheral mechanisms by which itch is induced by the pruritogen serotonin.

Peripheral serotonin, or 5-hydroxytryptamine (5-HT), is a component of the “inflammatory soup” and has been identified as a potent inducer of itch9,12 and pain10,79-81. Indeed, in humans, aberrant 5-HT signaling in the skin is linked to itch in atopic dermatitis82,83, as well as in other disorders including allergy62,84, uremia85, cholestasis86, and psoriasis87. Although numerous studies have highlighted the importance of 5-HT in acute and chronic itch13,14,24,62,82, the 5-HT receptor subtypes that transduce serotonergic itch signals have remained enigmatic.

Here, we examined itch behaviors and sensory neuron gene expression across genetically distinct mouse strains. We observed a correlation between acute itch behavior and expression of the 5-HT receptor, HTR7. This first clue to the function of HTR7 in the periphery served as motivation for an extensive characterization of its role in serotonergic and chronic itch. We found that HTR7 is expressed in a subset of primary afferent sensory neurons that innervate the skin and promote acute itch but not pain behaviors. HTR7 is functionally coupled to the irritant receptor TRPA1, and together they trigger neuronal excitation and mediate acute serotonergic- and SSRI-evoked itch. We also established that HTR7 and TRPA1 are key mediators of chronic itch in a mouse model of atopic dermatitis. Our finding is the first demonstration of a 5-HT receptor that mediates both acute and chronic itch in the periphery.

15

MATERIALS AND METHODS

RNA extraction and library preparation DRG neurons from one animal of each BXD progeny strain (see Figure 1B, bottom, for strains used) were removed and homogenized in Trizol (Life Technologies). Total RNA was extracted according to the manufacturer’s protocol and genomic DNA was removed with Turbo DNase I (Life Technologies). Libraries were prepared using TruSeq RNA Sample Prep kit v2 (Illumina) and sequenced on Illumina HiSeq 2000 machines with 50bp single-end reads to obtain 30-40 million reads per sample.

RNA-seq analysis To map reads from DRG RNA-seq libraries from BXD mice, we first generated a DBA/2J reference genome by amending the C57BL/6J genome (www.ensembl.org, release NCBIM37) with DBA/2J SNPs and indels (http://www.sanger.ac.uk, release ‘REL-1211-SNPs_Indels’), using only those with a genotype quality Phred score of 99. We then mapped each RNA-seq read set to this DBA/2J reference and, separately, to the C57BL/6J reference, using Tophat88 in each case. We retained for analysis only those reads in each mapping run that mapped uniquely with no mismatches. For a given read that met this criterion for each of the two references, we eliminated it from further analysis if the position to which it mapped was not orthologous between the two. HTSeq89 was used to sum the total read counts per gene. Read counts were normalized with the EDASeq package in R90 using the upper-quartile method. Gene ontology enrichment analysis was performed using the topGO package in R91.

Histology For immunohistochemistry, caudal back skin tissue was harvested from mice and flash frozen in OCT (Tissue-Tek). Tissue was cryosectioned at 14 - 20 µm and mounted on glass coverslips for staining. Histology was carried out as previously described92. Antibodies: sheep anti-TRPA1 100 µg/ml (Abcam), rabbit anti-HTR7 1:5000 (Abcam), Alexa 488 goat anti-rabbit 1:5000 (Life Technologies), and Alexa 568 donkey anti-sheep 1:5000 (Life Technologies). Skin sections were counterstained with DAPI (Life Technologies). For in situ hybridization, DRG were harvested and sectioned as described for immunohistochemistry. Htr7 probes (Panomics) were used following the Quantigene protocol (Panomics). Images were taken using a Zeiss LSM710 confocal microscope at the Biological Imaging Facility, UC Berkeley.

Cell culture Preparation of neurons and ratiometric Ca2+ imaging were carried out as previously described19. Briefly, neurons from sensory ganglia were dissected and incubated for 10 min in 1.4 mg ml−1 Collagenase P (Roche) in Hanks calcium- free balanced salt solution, followed by incubation in 0.25% standard trypsin (vol/vol) STV versene-EDTA solution for 3 min with gentle agitation. Cells were

16

then triturated , plated onto glass coverslips and used within 20 h. (media: MEM Eagle's with Earle's BSS medium, supplemented with 10% horse serum (vol/vol), MEM vitamins, penicillin/streptomycin and L-glutamine). For retrograde labeling of cutaneous afferent neurons, cholera toxin subunit B, Alexa Fluor 594 conjugate (Life Technologies) was intradermally injected (4mg/ml in PBS, 10 µl), and after 24 h, sensory neurons were dissected and cultured as described above. HEK293 cells (ATCC) were transfected with 500 ng of GFP tagged human HTR7 plasmid (Origene) either alone or with 50 ng of human TRPA1 using Lipofectamine 2000 (Life Technologies) per the manufacturer’s instructions. Cells were plated on glass coverslips and used within 24 h for calcium imaging and whole cell recordings. Mouse primary keratinocytes (Yale Dermatology Cell Culture Facility) were plated on glass coverslips and used within 24 h for calcium imaging. All media and cell culture supplements were from the UCSF Cell Culture Facility.

Electrophysiology Whole cell recordings in transfected cells were performed using the Port-a-patch system93 (Nanion Technologies). All solutions used were provided by the manufacturer. Briefly, whole cell configuration was achieved with a high calcium external solution (in mM: 80 NaCl, 3 KCl, 10 MgCl2, 35 CaCl2, 10 HEPES, pH 7.4) which was replaced with a conventional external solution (in mM: 140 NaCl, 4 KCl, 1 MgCl2, 2 CaCl2, 5 d-Glucose monohydrate, 10 HEPES, pH 7.4) prior to recording. The internal solution consisted of (in mM) 50 KCl, 10 NaCl, 60 KF, 20 EGTA, 10 HEPES, pH 7.2. Cells were held at -80 mV and ramped every second from -100 mV to 100 mV over 300 ms. Inward currents were determined at -100 mV and plotted as a function of time. Sensory neuron recordings were collected at 5 kHz and filtered at 2 kHz using an Axopatch 200B and PClamp software. Electrode resistances were 2–6 MΩ. Stimulation protocol: 10 ms step to −80 mV, 150 ms ramp from −80 mV to +80 mV. Current clamp internal solution (in mM): 140 KCl, 5 EGTA, and 10 HEPES (pH 7.4 with KOH). Series resistance of all cells were <30 MΩ. Cells were perfused with external solution containing either 100 µM LP-44 (Sigma Aldrich) or 100 µM AITC (Sigma Aldrich). Cells were defined to be responsive to LP-44 if there was at least a 190% increase in current (chosen based on an average increase of 184% in the HTR7-TRPA1 co- transfected cells).

Calcium imaging Ca2+ imaging experiments were carried out as previously described19. Cells were loaded for 30 min at room temperature with Fura-2AM, 10 µM for neuronal culture, and 2 µM for keratinocytes and HEK293 cells, supplemented with 0.01% Pluronic F-127 (wt/vol, Life Technologies), in a physiological Ringer’s solution containing (in mM) 140 NaCl, 5 KCl, 10 HEPES, 2 CaCl2, 2 MgCl2 and 10 D-(+)- glucose, pH 7.4. All chemicals were purchased from Sigma. Acquired images were displayed as the ratio of 340 nm to 380 nm. Cells were identified as neurons by eliciting depolarization with high potassium solution (75 mM) at the end of each experiment. Neurons were deemed to be sensitive to an agonist if

17

the peak response was ≥10% above baseline. Image analysis and statistics were performed using custom routines in Igor Pro (WaveMetrics). All graphs displaying Fura-2 ratios were normalized to the baseline ratio F340/F380 = (Ratio)/(Ratio t = 0).

PCR cDNA was synthesized using SuperScript III reverse transcriptase (Life Technologies). Samples were diluted 1:10 and used as template for PCR experiments. The following primer pairs were used: mouse Htr7 (forward, 5’- GCCATCTCCGCTCTCTCATC-3’; reverse, 5’-CCATAGTTGATCTGCTCCCCG- 3’), mouse Gapdh (forward, 5’-CCGTAGACAAAATGGTGAAGGT-3’; reverse, 5’- GGGCTAAGCAGTTGGTGGT-3’), human Htr7 (forward, 5’- CCCAGAGCAGTGTTTGTTTCA-3’; reverse, 5’-AGACCCTTCAGAGCACGAGA- 3’), human Gapdh (forward, 5’-CCACTCCTCCACCTTTGAC-3’; reverse, 5’- ACCCTGTTGCTGTAGCC-3’).

Behavioral studies Htr7-/- mice were obtained from Jackson Laboratory94, Trpv1-/- and Trpa1-/- mice were described previously95,96, and K14-Cre;Trpa1fl/fl mice were provided by Cheryl Stucky (Zappia et al., in preparation). Mice (20–35 g) were housed in 12 h light-dark cycle at 21°C. Itch behavioral measurements were performed as previously described (Wilson et al., 2011). Compounds injected: 2 mM LP44 (Santa Cruz), 100 µM or 1 mM 5-HT (Sigma), 40 mM chloroquine (Sigma), 3.5 mM BAM8-22 (Tocris), 4 mM compound 48/80 (Sigma), 15 nM TSLP (R&D Systems), 100 µM sertraline (Tocris), and 27 mM histamine (Tocris) in PBS. For all behavioral experiments, pruritogens were injected using both the neck model (50 µl), and the cheek model (20 µl) of itch, as previously described19; all differences observed between wild type and knockout animals did not vary by injection site. For the neuronal ablation experiment, resiniferatoxin (1 µg/ml in 0.05% ascorbic acid and 7 % tween 80) was injected to the cheek two days prior to pruritogen injection. For AITC behavior, 5 µl 10% AITC (Sigma) in mineral oil was applied to the right hind paw. Radiant heat paw withdrawal latencies, before and after injection with LP44 or 5-HT were performed as previously described97. All mice were acclimated behavioral chambers on 2 subsequent days prior to treatment. Mice were injected with 20 µl LP44 (2 mM) or 5-HT (10 µM) into the hind paw, and their paw withdrawal latencies were measured 15 min pre- and 15 min and 30 min post-injection. Behavioral scoring was performed while blind to experimental condition and mouse genotype. All experiments were performed under the policies and recommendations of the International Association for the Study of Pain and approved by the University of California, Berkeley Animal Care and Use Committee.

Vitamin D model of Atopic Dermatitis Mice were singly housed and cheek hair was shaved one week prior to the start of the assay. 200 µM (in 20 µl EtOH) MC903 (R&D Systems) was applied to the cheek once per day, for 7 days. Behavior was recorded for 30 minutes on days 3,

18

5, 7 (ongoing treatment) and days 8, 10 and 12 (post-treatment) and the time spent scratching was quantified. Character of lesion scoring (COL) was adapted from62,98,99. Lesion severity was scored for redness (erythema), dryness (xerosis), and scabbing (excoriation) based on a 0-3 scale as follows: 0 = none, 1 = mild, 2 = moderate, 3 = severe. Behavioral and lesion scoring was performed while blind to genotype, treatment, and treatment duration.

Serotonin measurements Cheek skin was homogenized in 0.2 N HClO4 (10 µl/mg of tissue) and neutralized with equal volume of 1 M borate buffer (pH 9.5). 5-HT levels were measured using the serotonin ELISA kit (Beckman Coulter).

Statistical analysis Values are reported as the mean ± s.e.m. For comparison between two groups, Student’s t-test was used. For single-point comparison between >2 groups, a one-way ANOVA followed by a Tukey-Kramer post hoc test was used. For the time course comparison between >2 groups, ANOVA for multivariate linear models was used. Significance was labeled as: ns, not significant, p ≥ 0.05; *p < 0.05; **p < 0.01; ***p < 0.001.

RESULTS

Examining natural variation in itch behaviors and gene expression Previous studies have shown that genetically distinct inbred mouse strains display variable somatosensory behaviors such as pain and itch100,101. We set out to identify transcripts that were co-regulated with itch behaviors across such mouse strains. We first surveyed the effects of a battery of pruritogens in BL6 and DBA mice (Figure 1A). As itch is mediated by both histamine-dependent and -independent itch circuits, we examined a number of pruritogens that target each pathway. Because we sought to compare responses to a single pruritogen across strains, rather than between pruritogens, we chose concentrations for each pruritogen that elicited reliable scratching behaviors in the literature19,21,100,102-104. All histamine-independent compounds tested—the anti- malarial drug chloroquine, compound 48/80, and the endogenous pruritogens 5- HT, thymic stromal lymphopoietin (TSLP), and bovine adrenal medulla peptide 8- 22 (BAM 8-22)—evoked more avid scratching in the DBA strain than in BL6 (Figure 1A). In contrast, histamine-evoked itch was more avid in the BL6 strain than in DBA (Figure 1A; 100).

To ask if these parental itch phenotypes were heritable, we next assayed itch behaviors in a panel of inbred progeny strains from a cross between BL6 and DBA105 (BXD; Figure 1A). We were particularly interested in histamine- independent itch responses because most forms of chronic itch are histamine- independent. We chose to use the itch response to chloroquine as a representative of all histamine-independent pruritogens, for a number of reasons.

19

First, chloroquine evokes histamine-independent itch in both mice and humans100. Second, the subpopulation of neurons that express the chloroquine receptor MrgprA3 mediate multiple forms of histamine-independent acute and chronic itch, and selective activation of these neurons triggers itch but not pain behaviors13. Finally, given that the DBA parental strain exhibited stronger itch behaviors to all non-histaminergic pruritogens tested (even those known to signal via distinct cellular pathways; Figure 1A), we hypothesized that this strain harbors one or more alleles that promote multiple forms of histamine- independent itch, for which chloroquine could serve as a proxy. We observed a wide range of itch responses in progeny strains from the BXD cross upon chloroquine injection (Figure 1B), far beyond the spread attributable to measurement error alone (broad-sense heritability = 0.65), reflecting a quantitative relationship between genetic background and this complex somatosensory behavior.

We considered that the DNA variation across strains that drove itch behaviors would also perturb expression of many genes, including some involved in distinct itch pathways. This expectation was based on the principle that a naturally occurring DNA sequence variant underlying a given phenotype (e.g., disease or behavior) often affects the expression of hundreds of genes of related but distinct function106,107. Indeed, it is axiomatic that genes of many subtypes, though of broadly similar biological function, can be co-regulated transcriptionally. For example, nutrient restriction upregulates genes that are protective for starvation as well as those dispensable for this behavior but required for other related stress responses108. We thus hypothesized that there could be transducers in any of a multitude of itch pathways among the transcripts co-regulated with chloroquine itch across mouse strains. To identify such transcripts, we transcriptionally profiled dorsal root ganglia (DRG), which contain the neurons responsible for detecting itch, touch and pain stimuli, in each BXD progeny strain. We identified 72 genes whose expression correlated positively across strains with itch behavior, and 37 negatively correlated with itch (|r| > 0.55; Figure 1B and Table S1); this set of transcriptional correlates of itch was enriched in a number of somatosensory and cell signaling categories, including 5-HT signaling (Table S2).

HTR7 is a candidate itch transducer Among the top transcriptional correlates of chloroquine itch, we noted two 5-HT receptors, HTR7 and HTR1d. 5-HT has long been linked to chronic itch and pain9,10,12,79,81, and somatosensory neurons express ten distinct subtypes of 5-HT receptors79,109 with the exact role of each subtype in somatosensation yet to be defined. We thus singled out for functional characterization HTR7, the receptor whose expression was most highly correlated with itch behavior (Figure 1B). Htr7 expression was 2-fold higher in the most sensitive progeny strain than in the least responsive progeny (Figure 2A), and 1.3-fold higher in the more itch-prone DBA parental strain than in BL6 (BL6 = 1031.67 ± 78.19 reads, DBA = 1305.00 ± 18.19 reads; p < 0.05; n = 3 mice/strain).

20

HTR7 is expressed and functional in sensory neurons that innervate the skin Somatosensory ganglia contain an array of neurons that mediate itch, touch and pain. We expected that, if HTR7 played a role in itch transduction, we should observe expression in a subset of the small diameter DRG neurons that detect noxious stimuli and innervate the skin. In validation of our RNA-seq measurements, we detected Htr7 transcripts in human and mouse DRG with RT- PCR (Figure 2B). Using in situ hybridization, we detected the Htr7 transcript in 11.2% of DRG neurons, the majority of which were small-diameter neurons (average size = 17.7 µm; Figure 2C). Next, we probed hairy skin using antibodies against HTR7 and TRPA1, and found that HTR7 protein was expressed in 23.6 ± 6.9% of TRPA1-positive fibers that innervate the skin (Figure 2D). Although we also observed HTR7 immunoreactivity in the epidermis, such staining was non- specific, as it manifested in both wild-type and HTR7 knockout mice (Figure S1A). We next used ratiometric calcium imaging to investigate whether HTR7 was functional in cutaneous primary afferent sensory neurons. We first labeled cutaneous afferents via intradermal injection of the retrograde tracer cholera toxin-B-594 (CTB-594) and cultured dissociated sensory neurons 24 hours post- injection. Application of the HTR7-selective agonist, 4-[2-(Methylthio)phenyl]-N- (1,2,3,4-tetrahydro-1-naphthalenyl)-1-iperazinehexanamide hydrochloride (LP44), to cultured DRG neurons triggered a rise in intracellular calcium in 8.3 ± 0.76% of labeled cutaneous afferents (37.9± 5.2% of all neurons were labeled red), suggesting that HTR7 is functional in neurons that innervate the skin (Figure 2E).

The LP44-evoked neuronal response was dose-dependent with an EC50 at 85.7 ± 3.0 µM (Figure S1B). In contrast, LP44 failed to elicit a rise in intracellular calcium in primary mouse keratinocytes (Figure 2F), suggesting that HTR7 is not functional in keratinocytes. Overall, these data show that HTR7 is expressed and functional in a subset of small-diameter sensory neurons that innervate the skin and mediate itch and/or pain.

Previous studies have shown that neurons that transduce itch and pain signal via the TRPA1 and TRPV1 ion channels14,19,24,61,110. We found that all LP44-sensitive neurons were responsive to the TRPA1 agonist allyl isothiocyanate (AITC), and to the TRPV1 agonist capsaicin (Figure 3A-3C). LP44-positive neurons were also sensitive to other pruritogens, including 5-HT (100%), chloroquine (63.6%), histamine (27.3%), and BAM8-22 (13.6%), but not TSLP (Figure 3C). These data show that HTR7 is functionally expressed in a heterogeneous subpopulation of serotonergic neurons that may subserve distinct roles in itch or inflammation. LP44 also evoked membrane depolarization and action potential firing in DRG neurons (Figure 3D). Thus, HTR7 activation induces neuronal excitability in a subset of TRPV1- and TRPA1-positive neurons. To determine whether HTR7, TRPA1, and TRPV1 are required for LP44-evoked excitation, we evaluated responses in neurons isolated from mice lacking these receptors. LP44-evoked calcium responses were significantly attenuated in DRG neurons isolated from

21

Htr7-/- and Trpa1-/- mice, but not in Trpv1-/- neurons (Figure 3E). Similar results were observed in trigeminal ganglia (TG; data not shown). These results suggest that HTR7 is functionally coupled to TRPA1, and that the two receptors work together to mediate LP44-evoked excitation in a subset of itch and/or pain neurons.

HTR7 activates TRPA1 via adenylate cyclase signaling HTR7 is a Gs-coupled GPCR that activates adenylate cyclase (AC) via both Gα and Gβγ in a variety of cell types111-113. Previous studies have also shown that both AC and Gβγ signaling activate the ion channel TRPA119,114. In sensory neurons, we found that inhibition of AC and Gβγ signaling with 2',3'- dideoxyadenosine and gallein, respectively, attenuated LP44-evoked calcium signals, whereas U-73122, an inhibitor of PLC signaling, had no effect (Figure 3F). We next asked whether HTR7 could activate heterologous TRPA1 channels expressed in HEK293 cells. LP44-evoked currents were observed in HEK293 cells transfected with both hHTR7 and hTRPA1, but not in cells expressing hHTR7 alone (Figure 3G – 3I); AITC triggered a similar current of larger magnitude in cells expressing both hHTR7 and hTRPA1 (Figure 3G and 3H). Likewise, LP44 evoked significant increases in intracellular calcium in HEK293 cells expressing both HTR7 and TRPA1, but not in cells expressing either receptor alone (Figure 3J). HTR7 and TRPA1 together, but neither alone, also conferred 5-HT sensitivity to HEK293 cells (Figure 3K). Thus, HTR7 and TRPA1 receptors are functionally coupled and mediate response to both LP44 and 5-HT.

HTR7 activation causes itch but not pain Somatosensory neurons are a diverse population that mediate acute and chronic itch and pain8,9. Likewise, 5-HT signaling in the somatosensory system has been linked to both itch and pain. Previous reports have investigated the role of HTR7 in pain behaviors with mixed results: several studies have found no role for HTR7 in promoting acute pain115,116, others found that systemic application of an HTR7 agonist had a modest attenuating effect on inflammatory pain117,118, and most recently, injection of an HTR7 agonist into the anterior cingulate cortex attenuated mechanical hypersensitivity119. To investigate whether specific activation of peripheral HTR7 by LP44 triggered itch and/or pain behaviors, we used the mouse cheek model of itch, in which pruritic agents elicit scratching with the hindlimb, and nociceptive agents cause wiping with the forepaw120. Injection of LP44 into the cheek of wild-type mice evoked scratching behaviors that were not observed following vehicle injection (Figure 4A). HTR7 is the sole mediator of LP44-evoked scratching as pharmacological inhibition (SB-269970; Figure 4A, gray) or genetic ablation (Figure 4B, red) of HTR7 significantly attenuated LP44- evoked scratching to levels similar to vehicle. We also observed significantly more scratching in the DBA mouse strain than in BL6 (Figure S1C), mirroring the higher Htr7 expression in DBA sensory ganglia. Given the requirement of TRPA1 for LP44-evoked signaling in neurons (Figure 3E), we hypothesized that TRPA1 would likewise be required for LP44-evoked behaviors. Indeed, animals lacking Trpa1, but not Trpv1, exhibited attenuated LP44-evoked scratching (Figure 4C

22

and D). Echoing our finding of differences between DBA and BL6 mice, we observed some variation in LP44 response across distinct wild-type strains (compare wild-type mice in Figure 4B-D); analysis of any one mutant strain was thus carried out with respect to its isogenic wild-type. Htr7 and Trpa1 were required for LP44-evoked itch in both the cheek and neck itch models in line with the requirement of these receptors in LP44-evoked excitability in both TG and DRG neurons. Taken together, these data show that both HTR7 and TRPA1 are required for LP44-evoked itch behaviors.

Does LP44 act on HTR7 and TRPA1 receptors that are expressed on sensory neurons, or on-non-neuronal cells in the skin to induce itch behaviors? We first asked if sensory are required for LP44-evoked itch. To address this question we used the TRPV1 agonist, resiniferatoxin (RTX), which when injected results in defunctionalization of TRPV1- and TRPV1/TRPA1-positive neurons24,61,110. LP44- evoked scratching was significantly decreased in RTX-treated mice, to levels observed in vehicle-treated mice (Figure 4E). These findings show that LP44 induces itch via TRPV1+ sensory neurons, but do not reveal the site of transduction. Previous studies suggest that HTR7 and TRPA1 may be expressed in mast cells64,121, which release a variety of compounds that can activate sensory neurons and trigger itch. Thus, we next asked if HTR7-evoked itch is mast cell-dependent. We compared HTR7-evoked itch behaviors in a mouse strain lacking mast cells (KitW-sh) to wild-type controls (Figure 4F). LP44 triggered considerable scratching in both strains, suggesting that HTR7-mediated responses do not require mast cells, or pruritogens/cytokines released by mast cells, to trigger itch behaviors. TRPA1 has also been proposed to be expressed in keratinocytes; though whether it is expressed and functional in mouse keratinocytes remains to be determined. However, LP44-evoked itch behaviors in K14-Cre;Trpa1fl/fl mice and Trpa1fl/fl mice were indistinguishable (Figure 4G), indicating that TRPA1 in keratinocytes does not underlie this phenotype; these findings are consistent with our observation that keratinocytes exhibited no calcium response to LP44 (Figure 2F). Overall these data show that neither mast cells nor TRPA1-mediated signaling in keratinocytes are required for acute itch triggered by HTR7 activation, and suggest that HTR7 in sensory neurons may mediate LP44-evoked itch.

We next sought to establish whether activation of HTR7 could elicit pain. Unlike 5-HT, which has been shown to trigger both itch-evoked scratching and nocifensive wiping behaviors17, we observed no wiping in LP44-injected animals (Figure 4H). Likewise, injection of LP44 into the hindpaw did not cause thermal hypersensitivity, in stark contrast to 5-HT injection, which induced a significant decrease in the thermal withdrawal latency (Figure 4I). Overall, these data make clear that acute activation of HTR7 by LP44 evokes itch but not pain behaviors.

HTR7 mediates serotonergic itch We next set out to evaluate the role of HTR7 in serotonergic itch. Most studies measuring 5-HT–evoked itch and pain behaviors have used relatively high doses

23

(1-94 mM17,81,103,122). Yet the elevated 5-HT levels in chronic itch patients and in mouse models have been measured to be in the micromolar range62,83-85. To test for distinctions between these two 5-HT dose regimes, we evaluated the behavioral effects of each in mice. Upon injection of 1 mM 5-HT in wild-type animals, we observed both scratching and wiping behaviors (Figure 5A and 5B), consistent with previous reports17. By contrast, injection of 100 µM 5-HT in wild- type mice elicited robust scratching but little wiping (Figure 5A and 5B). Together, these data show that 5-HT has distinct physiological effects at different concentrations, and that 100 µM 5-HT preferentially activates itch pathways. HTR7 does not mediate behavioral responses to high 5-HT levels, as 1mM 5-HT evoked itch and pain behaviors in Htr7-/- mice indistinguishable from those of wild-type animals (Figure 5C, red). However, the itch-specific effects of 100µM 5-HT were mediated by HTR7: Htr7-/-animals exhibited a significant decrease in itch behavior, to levels on par with vehicle injection (Figure 5D, red versus white). Given that both HTR7 and TRPA1 were required for LP44-evoked signaling in neurons and HEK293 cells (Figure 3E and 3J-K), we hypothesized that TRPA1 would likewise be necessary for serotonergic itch. Indeed, Trpa1-/- animals displayed significantly decreased itch behaviors as compared to wild type littermates, in response to 100 µM 5-HT (Figure 5E, blue).

Previous studies have shown that SSRIs increase 5-HT levels123 and that elevated 5-HT levels promote itch sensations and scratching in humans124,125. Some studies have shown that SSRIs can alleviate certain forms of chronic itch and pain126-128, while others have reported that SSRIs can induce severe itch and rash124,129,130. We thus asked if intradermal injection of SSRIs increased local 5- HT levels to trigger itch behaviors in mice. Injection of the SSRI sertraline induced a rapid increase in skin 5-HT (Figure 5F) and induced itch-evoked scratching in wild-type animals (Figure 5G). Mirroring the results of 100µM 5-HT injection (Figure 5D and E), we observed a significant attenuation of SSRI- evoked scratching in Htr7-/- and Trpa1-/- mice as compared to wild type littermates (Figure 5H; no significant differences in behavior were observed between Htr7+/+ and Trpa1+/+ mice). Thus, HTR7 and TRPA1 together mediate some forms of serotonergic and SSRI-mediated itch.

We also examined the contribution of HTR7 to itch behaviors to a number of non- serotonergic pruritogens. Histamine, compound 48/80 and chloroquine all induced comparable itch behaviors in Htr7-/- and wild-type mice (Figure 5I). Htr7-/- mice also exhibited normal radiant heat- and AITC-evoked pain behaviors (Figure 5J and 5K). Overall, our findings make clear that HTR7 is a mediator of serotonergic itch, but not other forms of itch or pain.

HTR7 and TRPA1 are required for the development of chronic itch Altered 5-HT signaling is associated with a variety of chronic itch conditions in humans, including atopic dermatitis82,83. We next asked whether HTR7 plays a role in chronic itch in vivo, using a mouse model of atopic dermatitis. Previous studies have shown that topical treatment with a vitamin D analog, MC903,

24

induces an atopic dermatitis-like phenotype that includes secretion of the atopic dermatitis cytokine, TSLP, immune cell infiltration, skin hyperplasia, and the development of eczematous lesions59. However, several additional hallmarks of human atopic dermatitis (AD), including high 5-HT levels in the skin and intense itch-evoked scratching, have yet to be quantified in this mouse model. To further validate this mouse model of human atopic dermatitis, we used a treatment course of 7 consecutive days of topical application of MC903 to the mouse cheek, and monitored itch behaviors for a total of 12 days; we also measured 5- HT levels and skin lesion severity immediately following the final treatment.

Consistent with previous reports59, we found that wild-type mice treated with MC903 developed eczematous-like lesions that worsened over time in redness (erythema), dryness (xerosis) and scabbing (excoriation; Figure 6A and 6B). As is true for human atopic dermatitis patients, we found that MC903-treated mice displayed high levels of 5-HT in eczematous skin (Figure 6C), concomitant with scratching behaviors that began on the third day of treatment and increased in intensity, even after the seven-day treatment period (Figure 6D). These data show for the first time that the itch behaviors and 5-HT levels associated with human atopic dermatitis are recapitulated in this atopic dermatitis model.

Htr7-/- mice treated with MC903 exhibited less severe lesions and scratched significantly less than the wild-type strain across the entire 12-day experiment (Figure 6B and 6D; red). Consistent with the requirement for TRPA1 in HTR7- evoked acute itch (Figure 3H), lesion severity and scratching were also significantly reduced in Trpa1-/- mice (Figure 6B and 6D; blue). No significant differences in itch behavior or lesion severity were observed between Htr7+/+ and Trpa1+/+ wild-type animals of each strain and thus we combined all data for comparison to knockout animals. Previous studies have implicated HTR7 in immune cell signaling121 which may contribute to 5-HT release in the skin; in the AD model, we found that 5-HT levels in eczematous skin isolated from Htr7-/- and Trpa1-/- mice were indistinguishable from those of wild-type mice (Figure 6C, red). Thus, HTR7 and TRPA1 are not required for the release of 5-HT in atopic dermatitis skin. Taken together, our data identify HTR7 and TRPA1 as key molecular determinants of atopic dermatitis (Figure 7).

DISCUSSION

In this work, we have taken advantage of natural variation in itch behavior in mice and gene expression to identify novel molecular determinants of itch in primary afferent sensory neurons. Many of the genes that we have found to be co- regulated with itch behavior have already been implicated in somatosensation, including Htr1d131,132, Scn8a133, and Ano1134. However, a number of novel genes were also identified, many of which may represent new candidate itch transducers. We focused on the 5-HT receptor, HTR7, and established its role as a key transducer of serotonergic acute and chronic itch.

25

In the periphery, 5-HT can act as an algogen to trigger acute pain or pain hypersensitivity10,79-81, a pruritogen to trigger itch-evoked scratching, rash or wheal14,122,135, or in some cases, both itch and pain17. A variety of 5-HT receptor subtypes are expressed in primary afferent sensory neurons, with HTR1-3 being the best studied. Pharmacological and genetic ablation studies have shown that HTR1a, HTR1b, HTR2a, HTR2b and HTR3a mediate some forms of acute and inflammatory pain transmission80,81,122,136-138. Pharmacological studies have also implicated peripheral HTR2a, HTR2b and HTR3 receptors, and central HTR1a receptors in itch14,37,62,139,140, but to date there has been no genetic evidence for any 5-HT receptor in transducing serotonergic itch signals in primary afferent neurons. We have used genetic and pharmacological tools to show that HTR7 plays a selective role in acute serotonergic and atopic dermatitis itch, but not pain. Our results augment the previous characterization of HTR7 in the CNS in circadian rhythm function112,141, central thermoregulation94, neuroendocrine function142,143, migraine144 and antinociception79,119.

HTR7 mediates acute serotonergic itch Our data implicate HTR7 as a key component of the 5-HT itch pathway. In designing methods to assay 5-HT-evoked itch, we found that different concentrations of 5-HT evoked distinct behaviors. Micromolar 5-HT concentrations triggered itch but not pain behaviors, while millimolar concentrations triggered both itch and pain. Most experimental analyses of 5-HT- evoked behavior have used millimolar concentrations (1-94 mM17,81,103,122), which are significantly higher than the 5-HT levels measured in chronic itch conditions62,83-85 and thus may not target physiologically relevant sites and 5-HT receptor subtypes. Our results make clear that HTR7 is required for itch behaviors evoked by 5-HT at 100µM, but not for itch and pain at 1mM concentrations. These findings suggest that HTR7 may be preferentially activated by low 5-HT levels, which dovetail with studies showing that HTR7 has the highest affinity for 5-HT among HTR family members145. A role for HTR7 in only a subset of 5-HT-evoked behaviors under particular conditions, rather than all 5-HT responses, is not surprising given that many 5-HT receptors are expressed in sensory neurons79,109 and that HTR7 is expressed in only ~35% of the 5-HT-positive neuronal population. The emerging picture is thus one of specific physiological responses to different doses of 5-HT that are mediated by distinct molecular and cellular mechanisms, with HTR7 mediating itch at 5-HT levels comparable to those measured in chronic itch skin.

HTR7 mediates acute SSRI-evoked itch In analyzing the role of HTR7 in serotonergic itch, we also examined itch behaviors in response to injection of the SSRI sertraline in the cheek model of itch. SSRI induced an increase in local 5-HT levels and a concomitant increase in scratching behaviors in mice; HTR7 was required for SSRI-evoked itch behaviors. An estimated 2-4% of human patients report itch, rash and other related skin conditions as a side effect of taking SSRIs124,129. As HTR7 is also

26

expressed in human primary afferent neurons (Figure 2B), it is tempting to speculate that antagonists may attenuate SSRI-evoked itch in humans. Paradoxically, SSRIs can also partially alleviate some forms of chronic itch126-128. The mechanisms underlying this dual role for SSRIs in alleviating and causing itch in humans are unknown; it will be interesting to determine whether they involve different 5-HT signaling molecules between normal and chronic itch patients, or differential targeting of peripheral versus central targets127.

HTR7 couples to the irritant receptor TRPA1 Previous studies showed that serotonergic itch is mediated by a subset of TRPV1-expressing neurons, though functional TRPV1 ion channels were dispensable for itch behaviors14. Thus the receptors and downstream signaling pathways responsible for 5-HT itch transduction were unknown. Our results establish TRPA1 as the transduction channel required for HTR7-mediated acute serotonergic and SSRI-evoked itch behaviors, echoing the known role for TRPA1 in other forms of non-histaminergic itch19,21,61,62,64,146. Furthermore, we found that HTR7 activation of TRPA1 required functional adenylate cyclase (Figure 3), consistent with previous studies showing that HTR7 is a Gas-coupled GPCR that stimulates adenylate cyclase and cAMP production and that TRPA1 activity is regulated by AC and cAMP in sensory neurons114. Interestingly, TRPA1 does not couple to all HTRs, as activation of HTR2 by a-methyl 5-HT triggers itch and pain behaviors independent of TRPA119,62,114. Overall, our data further highlight the importance of TRPA1 in mediating non-histaminergic itch.

Do HTR7 and TRPA1 receptors act in neurons to mediate itch behaviors? HTR7 and TRPA1 expression have been reported in a variety of neurons in the central nervous system and non-neuronal cells in the skin121,147,148. Our study provides several lines of evidence that HTR7 in somatosensory neurons mediates itch behaviors. First, we found that HTR7 activation in mast cell- deficient mice evokes a normal itch response. Second, primary mouse and human keratinocytes do not express functional HTR7 receptors. Third, K14- Cre;Trpa1fl/fl mice and Trpa1fl/fl mice displayed similar HTR7-evoked itch responses. Fourth, neuronal ablation of TRPV1-expressing neurons resulted in a dramatic decrease in itch response evoked by HTR7 activation. Finally, HTR7 functions in the subset of the MrgprA3 population of neurons (Figure 2) that have proven to be indispensable in itch but not pain13. However, 5-HT is well known to play important roles in modulating itch and pain signal transmission at multiple levels in the CNS. Indeed, pharmacological activation of HTR7 in the forebrain has been recently shown to reduce neuropathic mechanical pain119. Also, 5-HT acts on a variety of immune and other non-neuronal cells to modulate itch and inflammation83,121. Thus, our findings using the global HTR7 knockout do not exclude a role for HTR7 outside primary afferent neurons. Future studies using tissue-specific knockout mice will determine the contributions of sensory neurons and other cell types to acute and chronic itch.

27

HTR7 and TRPA1 are both required for development of atopic dermatitis In addition to our study of acute serotonergic itch, we also examined the role of HTR7 and TRPA1 in a mouse model of atopic dermatitis, motivated by the well- known links between 5-HT and itch in this condition82,83. Our results revealed for first time that the MC903 induced mouse model of atopic dermatitis recapitulates the dysregulation of 5-HT in the skin, and the itch behaviors, characteristic of the human disorder82. In addition, our mouse model is the first in which spontaneous itch behaviors manifest in the absence of a daily skin treatment: we observed itch behaviors that persisted five days after the last skin treatment, establishing this paradigm as a model of chronic rather than acute itch. We found that HTR7- and TRPA1-deficient mice both displayed less severe skin lesions and scratched significantly less than wild-type mice (Figure 6D). However, these mutant animals displayed elevated levels of 5-HT in atopic dermatitis skin, similar to levels observed in wild type (Figure 6C). Thus, HTR7 and TRPA1 are required for the detection, rather than the release of 5-HT under atopic dermatitis-like conditions.

When considered in light of previous studies, our data support a dual role for TRPA1 in atopic dermatitis. First, when co-expressed with the TSLP receptor, TRPA1 acts as a transducer of TSLP-evoked itch and inflammation21. Second, when co-expressed with HTR7, TRPA1 acts as a transducer of 5-HT-evoked itch. We also highlight the importance of 5-HT signaling in the pathology of atopic dermatitis. Patients with severe atopic dermatitis eventually progress to develop asthma and allergic rhinitis, in a process known as the “atopic march”38. It is notable that elevated 5-HT levels are also linked to asthma147, and future studies will elucidate how TRPA1-expressing neuronal subtypes orchestrates the progression of atopic diseases.

Animals lacking Htr7 and Trpa1 still exhibited a residual degree of eczematous skin lesions and itch behaviors in the atopic dermatitis model. Thus an important question is the identity of the other molecular players required for the complete development and/or maintenance of atopic dermatitis. Such determinants likely include TSLP, given its upregulation in the human disease and the atopic dermatitis mouse model59, and its activity in sensory neurons that promotes itch behaviors21. Interestingly, another 5-HT receptor co-regulated with itch, Htr1d (Figure 1B), has been previously implicated in inflammatory pain131,132, and is also a compelling candidate mediator of atopic dermatitis and itch. Moreover, numerous inflammatory mediators are released in atopic dermatitis in addition to 5-HT and TSLP149 whose mechanisms have yet to be revealed.

Despite these complexities, our data clearly show that HTR7 and TRPA1 are key mediators of serotonergic acute and chronic itch. Aside from AD, a variety of human chronic itch disorders are linked to 5-HT. It is likely, therefore, that HTR7 antagonists may prove to be useful for the selective attenuation of itch that results from these pathological conditions.

28

FIGURES AND TABLES

Figure 1. A survey of mouse natural variation reveals Htr7 as a candidate itch transducer in DRG neurons. (A) The mouse strains C57BL/6J and DBA/2J display differential scratching behavior to various pruritogens: TSLP, thymic stromal lymphopoietin (15 nM); 5-HT, 5-hydroxytryptamine (1 mM); BAM, bovine adrenal medulla peptide 8-22 (3.5 mM); CQ, chloroquine (40 mM); 48/80, compound 48/80 (4 mM); HIS, histamine (27 mM). Student’s t-test; *p < 0.05; **p < 0.01; n = 4-8/strain. Error bars represent SEM. At bottom, schematic representation of the BXD recombinant inbred strains from a cross between C57BL/6J and DBA/2J mouse strains. (B) Heatmap visualization of the 20 genes whose expression in dorsal root ganglia (DRG) neurons correlates most highly with itch behavior (time spent scratching, 30 min) across BXD mouse strains; each row reports normalized gene expression from one strain (white, low relative to gene median; dark blue, high) ordered based on CQ itch sensitivity (bottom). Black box highlights Htr7. See also Tables S1, and S2.

29

Figure 2. HTR7 is expressed in sensory neurons that innervate the skin. (A) Htr7 expression in DRG neurons correlates strongly with CQ itch across BXD strains. Each point represents one BXD strain. (B) PCR amplification of Htr7 transcripts shows expression in mouse and human DRG. (C) Left, in situ hybridization of an Htr7 probe in mouse DRG. Scale bar, 100 µm. Middle, a

30

higher magnification of the region encased by the yellow box in the left panel. Htr7-positive cell bodies are highlighted in yellow, Htr7-negative cell bodies in white. Scale bar, 50 µm. Right, Htr7 is expressed mostly in small diameter cells (n = 5 sections, 642 cells). (D) Immunostaining of hairy skin shows expression of HTR7 in a subset of TRPA1-positive sensory neuronal fibers. Left, Immunostaining of hairy skin with antibodies against HTR7 and TRPA1, counter stained with DAPI. Right, a higher magnification of region encased by the yellow box in the left panel. Arrowheads mark HTR7- and TRPA1-positive neuronal fibers, the arrow marks an HTR7-negative, TRPA1-positive neuronal fiber. Dotted line demarcates dermal-epidermal boundary based on DAPI staining. Scale bar, 10 µm. (E) Left, Retrogradely labeled cutaneous afferents with cholera toxin subunit B (CTB) were cultured and LP44 (100 µM) responses were assayed using calcium imaging. Scale bar, 100 µm. Right, LP44 promotes calcium influx in labeled cutaneous afferent 1, but not 2. (F) LP44 does not activate primary mouse keratinocytes; quantification of peak LP44-evoked Ca2+ responses in mouse primary keratinocytes to vehicle (VEH), LP44 and thapsigargin (THAP). One-way ANOVA, Tukey-Kramer post hoc test; ns, p ≥ 0.05; ***p < 0.001. Error bars represent SEM. See also Figure S1.

31

Figure 3. HTR7 signals through Gβγ, adenylate cyclase, and TRPA1 to promote neuronal excitation. (A) Fura-2 loaded DRG neurons treated with LP44 (100 µM) and KCl (75 mM). Arrowhead depicts an LP44-responsive neuron. Pseudocolor bar represents Fura-2 ratio. (B) Representative trace shows

32

a neuron that responds to LP44 (100 µM), 5-HT (100 µM), and allyl isothiocyanate (AITC; 100 µM). (C) Left, LP44-responsive neurons are all sensitive to 5-HT (100 µM), AITC (100 µM), and capsaicin (1 µM). Right, the majority of these neurons overlap with the population of chloroquine-sensitive neurons (64%), and smaller subsets overlap with chloroquine/BAM8-22-sensitive (6%) or histamine-sensitive neurons (27%). No overlap is observed in the CQ- insensitive, TSLP-positive population. (D) Current-clamp recording showing action potential firing evoked by LP44 (100 µM) in a representative DRG neuron. Inset, single action potential. (E) Percentage of calcium responders to LP44 (100 µM) is reduced in neurons from Htr7-/- and Trpa1-/- mice, but not Trpv1-/- mice, relative to wild-type (WT). (F) Percentage of calcium responders to LP44 (100 µM) is reduced in neurons pretreated with the adenylate cyclase blocker 2’,3’- dideoxyadenosine (DDA, 50 µM) or the Gβγ blocker gallein (GAL, 100 µM), but not the PLC blocker, U73122 (U7, 1 µM), relative to vehicle treatment (VEH). One-way ANOVA, Tukey-Kramer post hoc test; ns, p ≥ 0.05; **p < 0.01; n = 3 mice/genotype or treatment, n ≥ 200 cells/genotype or treatment. (G) An inward current is evoked by LP44 (100 µM) in HEK293 cells transfected with HTR7 and TRPA1 but not with HTR7 alone using voltage clamp recording. (H) Representative current-voltage trace of HEK293 cell transfected with HTR7 and TRPA1 in the absence (background, BKG) or presence of LP44 (100 µM) or AITC (100 µM). (I) HTR7 and TRPA1 are both required for LP44-evoked currents in transfected HEK cells; Quantification of LP44-induced peak currents (normalized to vehicle treatment) in HEK293 cells transfected as in panel (G). Each point represents one cell. Fisher’s exact test; *p < 0.05; n = 16 cells/transfection. (J) HTR7 and TRPA1 are both required for LP44-evoked calcium influx in transfected HEK cells; Quantification of peak LP44-evoked Ca2+ response in HEK293 cells transfected with pcDNA3 (CON), HTR7 and/or TRPA1. (K) HTR7 and TRPA1 are both required for 5-HT-evoked calcium influx in transfected HEK cells; Quantification of peak 5-HT-evoked (100 µM) Ca2+ response in HEK293 cells transfected with pcDNA3 (CON), HTR7 and/or TRPA1. One-way ANOVA, Tukey-Kramer post hoc test; ns, p ≥ 0.05; **p < 0.01; n = 3-5 transfections. Error bars represent SEM.

33

Figure 4. HTR7 triggers robust acute itch behaviors, but not pain. (A) LP44 (2 mM), but not vehicle (VEH; 20 µL, 2% DMSO in PBS) injection induces scratching behaviors in the cheek model of itch. This response is blocked by the pre-injection of HTR7 antagonist SB-269970 (SB, 5 mM). (B) Scratching evoked by LP44 injection is attenuated in Htr7-/- mice relative to Htr7+/+ wild-type mice (WT). (C) Scratching evoked by LP44 injection is attenuated in Trpa1-/- mice relative to Trpa1+/+ wild-type mice (WT). (D) LP44-evoked itch behavior is similar in Trpv1+/+ (WT) and Trpv1-/- mice. (E) TRPV1-positive neuronal ablation by resiniferatoxin (RTX) eliminates LP44-evoked scratching. (F) LP44-evoked itch

34

behaviors are similar in mast cell deficient mice (KitW-sh) and wild-type control mice (WT). (G) LP44-evoked itch behaviors are similar in K14-Cre;Trpa1fl/fl mice and Trpa1fl/fl control mice. (H) LP44 (2 mM) does not evoke wiping behavior, while 1 mM 5-HT causes robust wiping. VEH, vehicle (I) Thermal hypersensitivity in mice injected with 5-HT (10 µM) and LP44 (2 mM). One-way ANOVA, Tukey- Kramer post hoc test; ns, p ≥ 0.05; *p < 0.05; **p < 0.01; ***p < 0.001; n = 5-9 mice/genotype/behavior. Error bars represent SEM. See also Figure S1.

35

Figure 5. HTR7 is required for the detection of 5-HT dependent acute itch. (A) 5-HT (100 µM and 1 mM) but not vehicle injection (VEH; 20 µL, PBS) causes robust scratching in the cheek model of itch. (B) Injection of 1 mM, but not 100

36

µM 5-HT evokes wiping behaviors. (C) Scratching behaviors evoked by 1 mM 5- HT are similar between Htr7+/+ (WT) and Htr7-/- mice. (D) Scratching behaviors evoked by 100 µM 5-HT are significantly attenuated in Htr7-/- versus Htr7+/+ (WT) mice. VEH; 20 µL, PBS. (E) Scratching behaviors evoked by 100 µM 5-HT are reduced in Trpa1-/- compared to Trpa1+/+ (WT) mice. (F) Skin 5-HT levels increase after injection with the selective serotonin reuptake inhibitor (SSRI), sertraline (100 µM). One-way ANOVA, ***p < 0.001 (G) Time course of cumulative scratching behavior to sertraline (100 µM) follows the time-dependent increase in skin 5-HT levels following sertraline injection, as shown in (F). (H) Htr7-/- and Trpa1-/- mice show significant decreases in scratching behaviors compared to wild-type (WT) mice following sertraline injection (100 µM). (I) Chloroquine (CQ, 40 mM), compound 48/80 (48/80, 4 mM), and histamine (HIS, 27 mM) injection evokes similar itch behaviors in both Htr7+/+ (WT) and Htr7-/- mice. (J) There is no difference in acute heat sensitivity between Htr7+/+ (WT) and Htr7-/- mice. (K) AITC application (10% in mineral oil) evokes similar nocifensive behaviors in Htr7+/+ (WT) and Htr7-/- mice. One-way ANOVA, Tukey- Kramer post hoc test; ns, p ≥ 0.05; *p < 0.05; **p < 0.01; ***p < 0.001; n = 5-9 mice/genotype/behavior. Error bars represent SEM.

37

Figure 6. HTR7 is required for the development of chronic itch in a model of atopic dermatitis. (A) Representative images of skin isolated from wild-type (WT), Htr7-/-, and Trpa1-/- mice treated topically with vehicle control (CON; 20 µl 100% ethanol) or the vitamin D analog, MC903 for the induction of atopic

38

dermatitis (AD; 200 µM). (B) Atopic dermatitis lesion severity scores in mice treated with MC903 or vehicle (as described in panel A). (C) The AD model triggers and increases in the concentration of 5-HT treated skin isolated from WT, Htr7-/-, and Trpa1-/- mice. One-way ANOVA, Tukey-Kramer post hoc test; ns, p ≥ 0.05; *p < 0.05; **p < 0.01; ***p < 0.001; n = 5/genotype/treatment. (D) Scratching behavior during and after VITD treatment is attenuated in Htr7-/- and Trpa1-/- mice. ANOVA for multivariate linear models; ***p < 0.001; n = 10/genotype. Error bars represent SEM.

39

Figure 7. Schematic diagram depicting the putative roles of HTR7 and TRPA1 signaling in acute and chronic itch. Model by which increased 5-HT levels in the skin, triggered by direct injection of 5-HT, SSRI administration or atopic dermatitis activates the 5-HT receptor, HTR7. HTR7 in turn signals to adenylate cyclase via Gα and Gβγ, to open TRPA1 ion channels, neuronal depolarization, action potential firing and ultimately trigger itch-evoked scratching.

40

Figure S1. LP44 activates a subset of sensory neurons that express HTR7. (A) Validation of HTR7 antibody. Immunohistochemistry of hairy skin sections with an antibody against HTR7 shows neuronal staining in WT (top) but not in Htr7-/- (bottom). Scale bar, 50 µm. (B) Dose-response curve of LP44 on primary DRG culture assayed by calcium imaging, n = 50-100 cells/concentration. (C) LP44 evokes differential itch response between BL6 and DBA. Student's t-test, **p < 0.01, n = 7/genotype. Error bars represent SEM.

41

Table S1, Related to Figure 1. Top candidate itch genes. List of candidate genes displaying strong correlation between DRG gene expression and CQ-evoked itch behavior (|r| > 0.55).

Positive genes Negative genes r Gene symbol r Gene symbol r Gene symbol 0.704 Ppig 0.582 Kcnc3 -0.670 Gm14399 0.680 Gm15535 0.582 Flt3 -0.634 4931406C07Rik 0.674 Spsb4 0.581 Endod1 -0.630 Rqcd1 0.666 Arl4c 0.580 Fam184b -0.617 BC030867 0.650 Ppargc1a 0.579 Faim2 -0.612 Gm14326 0.649 Htr7 0.578 Agl -0.610 Atp1b3 0.645 Slc35d3 0.578 Scn8a -0.604 Tmem176a 0.638 Inhbb 0.577 Mtap2 -0.599 BC048355 0.638 Phkb 0.577 Cbln2 -0.598 2210404O09Rik 0.632 Unc80 0.576 Ano1 -0.593 Ada 0.629 Zfp940 0.573 1700040D17Rik -0.588 Med22 0.626 2610528B01Rik 0.572 Gm10676 -0.583 Tmem176b 0.625 Tmem47 0.572 Shh -0.581 Pla2g16 0.617 Gm17638 0.571 2510049J12Rik -0.580 Gm14325 0.616 Htr1d 0.570 Phospho1 -0.578 Sh3gl1 0.615 Hapln4 0.569 Rasa1 -0.576 Mrps6 0.614 Myh14 0.568 Atp2b2 -0.575 Gm14305 0.613 Onecut1 0.565 D630023F18Rik -0.572 Cdkn1a 0.611 Cabp7 0.564 Kcnq4 -0.572 Api5 0.611 Cnnm1 0.562 Ppp1r12b -0.569 Sertad1 0.610 Cpsf6 0.559 Cables2 -0.569 Casp1 0.607 Gm17111 0.558 Ogdhl -0.568 Gm6543 0.607 Esrrg 0.558 Cnnm4 -0.568 Wtap 0.604 Wipf2 0.557 Kcnh7 -0.565 0610040B10Rik 0.604 Cntnap2 0.556 Epb4.1l1 -0.565 Rnh1 0.602 Rtbdn 0.555 Papd5 -0.564 Rxrg 0.602 Sh3rf3 0.555 Scrt2 -0.564 Bcl10 0.601 1700007I08Rik 0.554 Ube3b -0.563 Cd9 0.601 Dynll2 0.553 Gm17443 -0.563 Setd6 0.596 Pcdh8 0.553 Cds1 -0.561 Ctnna1 0.595 Kcnc1 0.553 Scrt1 -0.559 Trp53i13 0.591 Heatr5a 0.551 A930033H14Rik -0.558 Insc 0.591 9630001P10Rik 0.551 Hhatl -0.558 Dok1 0.590 Chgb 0.550 Myrip -0.557 Zfp119b 0.589 Clstn2 0.550 Gm17456 -0.556 Gm7325 0.585 Strbp -0.556 Hmgcl 0.583 Bcl2 -0.552 Tssc4

42

Table S2, Related to Figure 1. Gene ontology (GO) enrichment of top candidate itch genes. List of GO terms that are enriched in top candidate genes displaying strong correlation between DRG gene expression and CQ-evoked itch behavior (r > 0.55).

GO ID Term p-value GO:0022843 voltage-gated cation channel activity 0.00011 GO:0005251 delayed rectifier potassium channel activity 0.00019 GO:0005249 voltage-gated potassium channel activity 0.0002 GO:0005516 calmodulin binding 0.00027 GO:0015267 channel activity 0.00035 GO:0022803 passive transmembrane transporter activity 0.00035 GO:0005244 voltage-gated ion channel activity 0.00041 GO:0022832 voltage-gated channel activity 0.00041 GO:0022836 gated channel activity 0.00046 GO:0022839 ion gated channel activity 0.00046 GO:0005267 potassium channel activity 0.00075 GO:0004993 serotonin receptor activity 0.00111 GO:0015079 potassium ion transmembrane transporter activity 0.00119 GO:0046873 metal ion transmembrane transporter activity 0.00144 GO:0005216 ion channel activity 0.00174 GO:0022838 substrate-specific channel activity 0.00182 GO:0005261 cation channel activity 0.00206 GO:0001948 glycoprotein binding 0.00276 GO:0015077 monovalent inorganic cation transmembr... 0.00292 GO:0022890 inorganic cation transmembrane transport... 0.0032

43

Chapter 3: Genetic Mapping of Novel Molecular Players in Itch

INTRODUCTION

Itch, the unpleasant sensation that evokes a desire to scratch, is a common yet largely unsolved problem in the clinic. Millions of people worldwide suffer from chronic itch that fails to respond to current drugs and therapies. A central question in the field is how and why particular individuals are genetically predisposed to develop itch disorders; as we identify the determinants of itch susceptibility in human populations, the emerging molecules can serve as key drug targets and diagnostics, and can shed light on the evolutionary origin of disease. Landmark studies have identified natural genetic variants across human populations that associate with atopic dermatitis and other chronic itch and atopy conditions150-155. However, owing to the time and expense of molecular validation studies in human systems, experimental validation of the associating loci has been a challenge. As a consequence, the molecular genetics of natural variation in itch susceptibility remains poorly understood.

We set out to fill this analysis gap and dissect wild DNA sequence variants that govern itch susceptibility in a system, the laboratory mouse, in which experimental validation of mapped hits would be within reach. We reasoned that we could maximize our capacity to infer mechanisms by which variant loci influence itch, by combining analysis of itch behavior with that of gene expression156. Years of work have established the power of this two-pronged approach for the study of mouse behavioral traits, such as circadian rhythm, alcohol preference, stress response, novelty responsiveness, and nicotine preference157-160. For example, by taking a genome-wide expression profiling approach using a panel of outbred mouse strains, Hovatta et al. identified the detoxification enzyme, Glo1 as the key determinant for anxiety behaviors161. They found strong correlation between Glo1 expression patterns in various brain structures and severity of anxiety, and further demonstrated that Glo1 copy number variation was the underlying cause mediating the anxiety behavioral variation162. To date, this strategy has not been applied to somatosensation.

In analysis of genetically distinct individuals, inheritance at the DNA level can correlate with gene expression and macroscopic traits by a number of mechanisms. One possibility is that genotype at a variant locus is co-inherited with expression of genes encoded nearby, referred to as a cis-acting expression quantitative trait locus (cis-eQTL). In this case the causal variation could lie within promoter/enhancer regions and directly control expression of a gene that modulates the macroscopic trait156,163, or a variant could modify the function of a protein encoded by a gene that governs the trait, which would then regulate its own gene expression via feedback164,165.

44

A second scenario is one in which genotype at a variant locus correlates with the expression of genes encoded at unlinked positions (trans-eQTL) as well as a macroscopic trait. Here further molecular analysis can provide us with several insights into the gene regulatory networks that underlie, or are associated with, the trait. (1) Changes in expression of a linking transcript may mediate the effect of the variant locus on the trait; experiments in which the transcript is perturbed by independent means can test this hypothesis directly156. (2) A transcript may vary in expression in response to a DNA sequence variant without actually being a causal intermediate for the trait of interest. Indeed, a variant can affect expression of a large set of genes, many of which are co-regulated with aspects of the trait and yet not causal for it106; this is our model for the results we reported in Chapter 2, where we found that Htr7 expression was correlated with chloroquine-evoked itch across strains and yet not required for this particular itch phenotype. In any such case, discovery of the master regulators of a set of transcripts can be a key outcome of the analysis of expression variation. (3) Based on the biological functions of the transcripts whose levels correlate with genotype at a variant locus, we can predict which of the genes encoded at the locus is truly causal for the entire suite of expression and macroscopic changes166. Together, these analysis paradigms enable a family of approaches to identify gene regulatory networks that underlie macroscopic traits, based on the discovery of genetic sequence variants controlling gene expression.

In the previous chapter, we identified a panel of candidate genes whose expression in dorsal root ganglia (DRG) correlated with itch behavior. However, our analysis method in that study did not establish how genetic sequence variation influences transcript expression, and furthermore, how such regulatory changes dictate itch behavior. As a separate investigation of the genetics of itch and gene expression in somatosensory neurons, here we undertook a statistical genetics effort utilizing the itch behavior and gene expression measurements described in the previous chapter, from the panel of F2 recombinant inbred strains derived from C57BL6/J (BL6) and DBA2/J (DBA) which we refer to as BXD strains. We utilized a cutting-edge approach for genetic mapping using a combination of multiple related phenotypes to identify DNA sequence variants co-inherited with these behaviors. We also performed eQTL mapping to identify sequence variants linked to gene expression in DRG. By mapping loci to variation in both behavior and gene expression, we were able to shed new light on molecular players and gene regulatory pathways that are compelling candidates for involvement in acute and chronic itch.

MATERIALS AND METHODS

Behavior BXD itch behavior measurements were from our previously published study20. BXD mechanical and thermal pain response behavior datasets were obtained from the mouse phenome database (http://phenome.jax.org).

45

Behavioral QTL mapping Genotypes at 3811 genetic markers were downloaded from WebQTL (www.genenetwork.org/genotypes/BXD.geno). Genome-wide scans for linkage between genotype and itch/pain behavior and genotype at DNA sequence markers used the SMAT analysis package in R167. This analysis pipeline calculates linkage between genotype at each marker in turn and multiple related phenotypes. For our analysis, we used BXD chloroquine itch and tail clip withdrawal latency as inputs into the linkage calculation. The false discovery rate (FDR) was calculated by running SMAT 1000 times with a permuted dataset for each run, and results were inspected for all markers scoring at p-value < 10-5 (FDR < 0.15). Markers exceeding this threshold on chromosome 1 were rs13471817, rs3703813, D1Mit480, rs3162895, rs3022802, rs4137302, rs13475900, gnf01.063.789, and rs13475902; markers exceeding the threshold on chromosome 2 were rs8263080, rs6275559, and rs4223211. eQTL mapping Our RNA-seq from DRG neurons of BXD mouse strains20 was used as input into tests for eQTLs as follows. For cis-eQTL, for each of the 14,075 genes with detectable expression in DRGs, across the BXD panel, we identified the closest genetic marker within 1 Mb from the transcription start site, grouped BXD strains on the basis of inheritance at the marker, and compared expression differences between the two groups using the Wilcoxon rank-sum test. To calculate the false discovery rate (FDR), we permuted expression levels 1000 times and tabulated, across these permutations, the average number nfalse of genes exhibiting apparent cis-eQTL linkage at a given nominal p-value; the FDR at a given nominal p-value was calculated as the ratio of nfalse to the number of loci exhibiting cis-eQTL signal in the real data. Results were inspected for all cases of cis-eQTL linkage scoring at p < 0.001 (FDR < 0.05). For trans-eQTL mapping, we first identified markers on chromosome 2 that showed both linkage to itch and pain behavior according to SMAT and significant cis-eQTL signal. For the two markers that fit these criteria (rs6275559 and rs4223211; see Figure 2C, 3B), we tested each for linkage to each transcript in turn that was not encoded on chromosome 2. Permutation tests and FDR calculations were carried out as above, and results were inspected for all transcripts showing linkage p-value < 0.01 (FDR < 0.2).

Gene Ontology analysis Enrichment of Gene Ontology annotation among transcripts linking to the chromosome 2 locus, relative to the complete set of transcripts for which we detected expression in the DRGs of our BXD strains, was calculated using GOrilla168 (http://cbl-gorilla.cs.technion.ac.il/). GO term categories with FDR < 0.05 were considered significant.

46

NF-κB binding enrichment analysis We assessed enrichment of RELA binding among the human orthologs of mouse transcripts whose expression co-inherited with genotype at the chromosome 2 locus mapped to itch and pain (that is, transcripts showing trans-linkage to chromosome 2) as follows. We first tabulated the subset of mouse transcripts showing trans-linkage to the chromosome 2 locus whose expression levels were positively correlated with itch behavior (Figure 4A). We used the ENSEMBL BioMart database (ensemble.org) to define the human ortholog of the gene encoding each transcript. We downloaded RELA peak calls from a ChIP-seq experiment using immortalized human lymphocyte cell line from the ENCODE Project database (https://www.encodeproject.org/experiments/ENCSR000EAN/); defined a given gene as a RELA target if >1 peak was detected; and tabulated the number of genes from the trans-linking set that met this criterion. To evaluate the significance of the latter, we formulated 10,000 random sets of human genes of the same number as were in the trans-linking set, and tabulated the number of RELA targets in each, to set up the null distribution in Figure 5A; the empirical p- value estimating significance of the RELA target frequency in the trans-linking set was taken as the proportion of null groups with RELA targets numbering as many as, or more than, those from the real trans-linking set. For Figure 5B, this analysis pipeline was repeated for transcripts showing trans-linkage to the chromosome 2 locus whose expression levels were negatively correlated with itch behavior.

Quantitative PCR for allele-specific expression F1 hybrids were generated from a cross between female C57BL6/J and male DBA2/J strains (Jackson Laboratory). Animals were housed in 12 h light-dark cycle at 21°C. DRG neurons from 8 week old F1 mice (n = 4) were removed and homogenized in Trizol (Life Technologies). Total RNA was extracted according to the manufacturer’s protocol and genomic DNA was removed with Turbo DNase I (Life Technologies). For each DRG sample, cDNA was synthesized using SuperScript III reverse transcriptase (Life Technologies). For qPCR, primers were designed to target regions with > 2 SNPs detected between BL6 and DBA such that at least one SNP was located at the most 3’ position in one of the primers, except for Lrp2 which only had 1 SNP. Allele specificity for each primer set was confirmed by qPCR on cDNA isolated from BL6 and DBA purebred parent strains (data not shown). Primer efficiencies were calculated by determining the slope from a standard curve of cDNA isolated from BL6 and DBA purebred parent strains for each primer set, using the formula: efficiency = 10(- 1/slope)-1. Measurements were collected for three technical replicates of qPCR using F1 hybrid RNA as the input, for each primer set in turn and for one targeting Nono as a reference. The fold-change of expression of the BL6 and the (Ct DBA alleles was calculated from qPCR Ct values as primer efficiency BL6 Reference = Ct Target) / primer efficiency DBA(Ct Reference – Ct Target).

47

Primer sets used in this study: Lrp2 forward, BL6 specific: ACTGGCTCCCTTTTACCCTCTC Lrp2 forward, DBA specific: ACTGGCTCCCTTTTACCCTCTT Lrp2 reverse, common: ACACACCGATGTCCATGTTCACAT Fastkd1 forward, BL6 specific; GGATAGGATCGCTTCAGTGGCCA Fastkd1 forward, DBA specific: TGATAGGATCGCTTCAGTGGCCG Fastkd1 reverse, common: AGAATTACAGCATTGGACACACGC Ppig forward, BL6 specific: AGGACGAAAAGACCAGATCCCT Ppig forward, DBA specific: AGGACGAAAAGACCAGATCCCC Ppig reverse, BL6 specific: GAGGTTCAACAGTAAGTCTTAAAAACTGAAA Ppig reverse, DBA specific: GAGGTTCAACAGTAAGTCTTAAAAACTGAAG Nono forward common: CCGACAGCAGGAAGGATTCA Nono reverse common: TGGCATCATAGTGGCAGGTC

Results

To identify novel molecular players involved in itch, we took a statistical genetics approach by looking at natural variation between two laboratory mouse strains, BL6 and DBA. Previous studies have revealed that DBA spends twice as much time scratching as BL6 in response to chloroquine (CQ) injection20,100. We have previously reported that this itch behavior was a heritable and quantitative trait, as the F2 recombinant inbred strains (BXD) that were derived from the initial cross between BL6 and DBA displayed robust but variable scratching behaviors20 (heritability = 0.65).

As a first attempt to identify DNA sequence variants (quantitative trait loci, QTL) that co-inherited with CQ-evoked itch, we tested genotype at each of 3811 genetic markers for linkage to the itch behavior measurement, but this calculation detected no significant QTL after correcting for multiple testing (data not shown). We reasoned that a test approach for genetic linkage using multiple related phenotypes could be a way to boost statistical power of the linkage calculation. Previous studies have reported an antagonistic relationship between the itch and pain pathways, where application of mechanical or painful stimuli can counteract itch1,32,169. Likewise, inhibition of pain by analgesics or genetic ablation of pain circuits can enhance itch behaviors35,170. We thus hypothesized that DNA sequence variants segregating among the BXDs could jointly modulate both itch and pain, and any such joint effect could be detectable in a scheme in which both traits were used together as input into linkage tests. First, to investigate the relationship between itch and pain, we examined publicly available pain behavioral phenotypes across the panel of BXD strains in which we had quantified CQ-evoked itch behaviors. We tabulated the correlation between CQ- evoked itch and various pain models, and found mechanical pain behavior, measured through both tail clip and Von Frey assays, to exhibit the strongest relationship with itch behavior (Figure 1A-E). These data suggested that itch and

48

mechanical pain were involved in a similar converging and/or related neuronal pathway.

We used the mechanical pain threshold measured through the tail clip test, in conjunction with CQ-itch behavior, as input into the SMAT analysis software167 to identify genetic loci at which genotype was correlated with both traits simultaneously. Two loci had significance exceeding FDR < 0.15 (Figure 2A), one on chromosome 1 and the other on chromosome 2. Testing these top- scoring loci for linkage with each trait separately verified the signal (Figure 2B-C). These two genomic sites thus serve as compelling candidates for positions at which DNA sequence variation influences itch and mechanical pain across the BXD lines.

We next set out to examine whether the variant loci we had mapped to behavioral traits also showed linkage to gene expression. Such a site is referred to as an expression quantitative trait locus (eQTL). One key advantage of looking at transcripts with expression levels linking to behavioral QTL is the potential to make inferences about the causal DNA variants underlying behavioral traits and their mechanisms. In analysis of behavioral traits alone, since linkage disequilibrium is far-ranging in the BXD cross and each marker represents a wide stretch of genomic sequence across which inheritance is correlated, it is difficult to narrow down which gene and DNA sequence variation at a given mapped locus influences the behavioral trait. By focusing at QTL linking to both behavior and gene expression variation, we can gain insight into which genes are affected by the DNA sequence variation within the large genomic region. If a DNA sequence variant is located near the genes to whose expression it links, it is referred to as a cis-eQTL. Any such locus likely contains DNA variants in promoters, enhancers, UTRs, or splice junctions that control gene expression, or variants within the coding region that alter protein functions and feed back on expression of the transcript156. On the other hand, a variant located far from the genes to whose expression it links is referred to as a trans-eQTL, which likely encodes a trans-acting regulator of expression levels of downstream genes156,166. The latter can shed light on regulatory networks in the tissue of interest and, potentially, the identity of the trans-acting regulator can be inferred. One caveat in all these analyses, however, is that co-inheritance of expression, behavior, and DNA sequence does not necessarily imply a causal relationship: a given transcript linking to a behavioral QTL could be part of a reactive suite of expression changes responding to a change in physiological state, rather than mediating the effect of the locus on behavior.

To implement these analysis strategies in our study of itch and mechanical pain, we tested first for cases in which a variant at a given locus modulated expression of a gene encoded nearby (cis-eQTL). A survey across all genes in the genome revealed 1,625 with evidence for cis-eQTLs (data not shown). To mine these variant loci for a relationship to itch, we focused on the region of chromosome 2 at which markers had exhibited the strongest co-inheritance with itch and

49

mechanical pain (Figure 3A). At this locus, Ppig, Lrp2, Fastkd1, and Ccdc173 all showed evidence for cis-regulatory variation across BXD lines (Figure 3B). To assess whether variants in each gene in turn modulated its own expression, we measured allele-specific expression in F1 hybrids that were generated from a cross between BL6 and DBA parental strains. Since in these F1 individuals, the alleles of a given gene from both parents are in the same nuclear environment, any differences in their expression levels must be the result of sequence variation acting in cis rather than effects from any soluble factors, which in the absence of regulatory variants hard-wired on the DNA strand would impinge in trans on both alleles in the same manner. Allele-specific quantitative PCR detected differential expression between BL6 and DBA alleles of Lrp2 and Fastkd1, suggesting that DNA sequence variants were driving the expression levels for these two genes (Figure 3C). We did not detect significant differential expression between the two alleles of Ppig (Figure 3C), and we identified no variants in the genomic sequence of BL6 and DBA for Ccdc173. Together, these data highlight Lrp2 and Fastkd1 as the genes with the strongest evidence for cis- regulatory variation in the region of chromosome 2 showing linkage to itch and mechanical pain. Each represents a candidate case in which DNA sequence variation on chromosome 2 modulates expression of the respective gene, with potential relevance to somatosensory behavior.

We next set out to investigate whether variants that mapped to itch and mechanical pain could be functioning as master regulators of suites of unlinked genes. For this purpose, we carried out trans-eQTL mapping to identify transcripts whose expression levels were co-inherited across BXD lines with genotype at our behavioral QTL. This search revealed 382 transcripts whose expression levels linked to the behavioral QTL on chromosome 2 (Table 1). We found that for 232 of these trans-linking transcripts, expression levels were positively correlated with chroloquine-evoked itch behavior across the BXD lines (Figure 4A), and the remainder were negatively correlated with itch behavior (Figure 4C). The former were enriched for annotations in membrane excitability and neuronal/synaptic signal transmission (Figure 4B), and the latter were annotated in the immunological response to external stimuli (Figure 4D). These data are consistent with either of two possible models, which are not mutually exclusive: variants on chromosome 2 underlying itch and mechanical pain response could exert their effect through changes in expression of some of these suites of genes, and/or some expression changes linking to the chromosome 2 locus could be an indirect response to changes in cellular state resulting from the variants there.

We next sought to generate testable inferences of the mechanisms by which variants at the chromosome 2 locus could govern changes across BXD mouse strains gene expression. For this purpose we focused on the Fastkd1 gene, which had exhibited evidence for cis-regulatory change in our eQTL mapping and measurements of allele-specific expression in F1 hybrids (Figure 3). FASTKD1 was recently reported as a regulatory of the activity of of the transcription factor

50

complex NF-κB171. Although NF-κB has been most extensively studied for its role in immune cell survival and response to infection, recent work has also characterized NF-κB as a regulator in sensory neurons172,173. We thus formulated a model in which natural variants in Fastkd1 could govern differences in NF-κB activity among BXD strains, which would in turn give rise to perturbed expression of NF-κB targets in DRG neurons. Under this scenario, NF-κB targets would be over-represented among the transcripts whose expression showed linkage to the chromosome 2 QTL (containing Fastkd1) that we had mapped to itch and mechanical pain. To test this notion, we used publicly available measurements of the occupancy of RELA, a major protein component of the NF-κB transcriptional complex, in a human immortalized lymphocyte cell line. We first analyzed the mouse transcripts showing trans-linkage to the chromosome 2 QTL whose expression levels were positively correlated with chloroquine-evoked itch (Figure 4A), the set whose gene functions were enriched for neuronal transmission functions (Figure 4B); the human orthologs of these genes were robustly enriched for RELA occupancy relative to a permutation null (Figure 5A). A second analysis, of transcripts showing trans-linkage to chromosome 2 whose expression was negatively correlated with itch, detected no such enrichment (Figure 5B). These data serve as a first line of evidence that NF-κB mediates the effect of natural variation on chromosome 2 on expression of neuronal transmission genes in DRG neurons and, potentially, somatosensory behavior.

Discussion

In this chapter, we took advantage of natural variation in itch and mechanical pain behaviors to generate hypotheses about genomic regions and gene regulatory networks underlying variation in these behavioral traits. We identified behavioral QTL and found that one such locus, on chromosome 2, linked to expression levels of genes encoded nearby (Lrp2, Ppig, Fastkd1, and Ccdc173) as well as genes encoded at unlinked locations, with functions in neurite outgrowth, neuronal excitation, and immune function.

Our data leave open the question of what the causal variant is at each of the two loci that we have mapped to behavioral and gene expression variation. The chromosome 2 locus lends itself best to the effort to generate such hypotheses, given that we have the most data about this QTL. One compelling candidate in this region is Lrp2 (low density lipoprotein receptor-related protein-2, also known as megalin). LRP2 is a multi-ligand binding receptor found in the plasma membrane of many absorptive epithelial cells and various neuronal cell types, including DRG. This receptor has been well-characterized in epithelial cells for its roles in internalizing and directing macromolecules into the degradation pathway. In DRG, studies have shown that Lrp2 is required for injury-driven axonal sprouting174 and neurite outgrowth175. This observation is interesting since one of the hallmark characteristics of various chronic itch conditions including atopic dermatitis is abnormal neurite outgrowth, and histological studies demonstrate

51

neuronal hyperinnervation at the skin. Thus a plausible model is one in which variation in Lrp2 between BXD strains mediates differences in itch and/or pain behaviors by virtue of changes in innervation. There is also some evidence that LRP2, upon internalization, can act as a regulatory factor affecting expression of downstream genes176, dovetailing with our observation of transcripts showing linkage to the Lrp2 locus. As Lrp2 knockouts have been reported and studied177,178, an exciting future line of research will be to examine sensory neuron-specific Lrp2 knockout animals for differences in neuronal morphology innervating the skin layers as well as behavior deficits in itch and pain.

Fastkd1 is another gene at the chromosome 2 locus that represents an intriguing potential candidate, at which variation could influence somatosensory behavior and/or DRG gene expression. Fastkd1 is a member of the Fas-activated serine/threonine kinase domain containing family, members of which have been shown to regulate energy balance of mitochondria under stress conditions and serve as biomarkers for endodermal cancer179,180. Recently, FASTKD1, FASTKD2, and FASTKD5 have been identified as RNA-binding proteins181. Though the exact biological functions of FASTDK1 as a RNA-binding protein are currently unknown, it is tempting to speculate that this protein could function as a transcriptional regulator having significant effect on expression of target genes, which ultimately could influence somatosensory behaviors. And given its effects on NF-κB171, along with our finding of NF-κB occupancy signatures at transcripts governed by variation on chromosome 2 (Figure 5), a compelling model is one in which causal variants in Fastkd1 modulate NF-κB activity. Future work, including NF-κB reporter activity assays and CLIP-seq (cross-linking immunoprecipitation followed by RNA-seq) of FASTKD1 in the DRG neurons of BXD lines, and ultimately tests of the effects of disruption of these genes on the response to pruritogens, will be necessary to evaluate their roles in DRG regulatory networks and/or behavior.

The transcripts whose expression we found to link to trans-eQTL in this study can also reveal additional novel molecular players in somatosensory behaviors. Among these include Syt2, which has been shown to be important for neurite outgrowth in PC12 cell lines182, and Cbln2, which is preferentially expressed at synapses in the dorsal horn and has been implicated for proper synapse formation during development183. Expression of many ion channels and receptors implicated in pain behaviors also showed linkage to chromosome 2, such as Scn8a133, Accn2184, Girk5185, Gabrb3186, and Cacna1d187, as did expression of modulatory proteins such as Cntnap2106,107, Mtap2188, Spnb4189, Limk2190, and Faah2. In addition, immune response-related genes, such as Il10rb191, Ccr7192, and Fcer1g193 were identified from this analysis and suggested the novel functions for these genes in somatosensory neurons, specifically itch and pain. Dozens of unannotated and uncharacterized genes also form part of this regulon, each of which is a candidate component of the somatosensory system. Our discovery of this suite of co-regulated genes in DRG neurons underscores the

52

power of the eQTL mapping paradigm to generate new hypotheses about itch and pain molecules.

As a concluding note, we observe that although our study focused on gene regulatory events in DRG neurons, itch also involves communication between disparate cell types, including immune cells, platelets, keratinocytes, sensory neurons, and spinal interneurons9. It is likely that variation in gene expression in additional cell types is also important for modulating itch behavior. As such, another future prospect will be to carry out the analysis in multiple tissues, to identify yet more genes and regulatory networks that contribute to variation in somatosensory behavior. With a more complete understanding of the genetic basis of acute and chronic itch in many tissues, the promise of molecular neurogenetics will begin to bear fruit, as we use the genes we discover to develop novel anti-itch drugs and personalized therapies.

53

FIGURES AND TABLES

Figure 1. Relationship between chloroquine-evoked itch behavior and mechanical and thermal pain. In a given panel, each point reports itch behavior in one strain of the BXD mouse cross from Morita et al.20 (x-axis) and pain response (y-axis) to (A) tail clip, (B) Von Frey, (C) radiant heat, (D) hot water bath, and (E) hot plate, from Philip et al194.

54

Figure 2. Genetic mapping for somatosensory QTL. (A) Each point reports the significance (y-axis) of co-inheritance between itch, mechanical pain, and genotype at one DNA sequence marker at the indicated location (x-axis). The dashed horizontal line represents the nominal p-value corresponding to a false discovery rate of 15%. (B) The y-axis reports chloroquine-evoked itch behavior (left panel) or mechanical pain withdrawal behavior (right panel), and the x-axis reports genotype at the marker corresponding to the peak of linkage on chromosome 1 from (A); each point reports measurements from one strain of the BXD mouse cross. (C) Data are as in (B), except that the peak of linkage on chromosome 2 is analyzed.

55

Figure 3. cis-eQTL analysis of genes encoded at the chromosome 2 behavioral QTL. (A) Genes encoded near the chromosome 2 locus mapped to itch and mechanical pain in Figure 2; genotyped marker positions are marked with arrows. (B) In a given panel, the y-axis reports expression of the indicated gene measured by RNA-seq, and the x-axis reports genotype at the indicated marker corresponding to the peak of linkage on chromosome 2 from Figure 2; each point reports measurements from one strain of the BXD mouse cross. All transcripts linked to inheritance at their respective markers at a p-value corresponding to a false discovery rate of <5%. (C) In a given panel, each color reports expression of the allele from one strain of the indicated gene, relative to the reference gene Nono, in the F1 hybrid formed by mating BL6 and DBA mice; each point represents one biological replicate (RNA samples from n = 4 F1 hybrids, 3 technical replicates per RNA sample).

56

Figure 4. Transcripts showing linkage to the chromosome 2 behavioral locus are enriched for annotation in neuronal transmission and immune response. (A) Scn8a, an example of a transcript whose expression links to the chromosome 2 locus mapped to itch and mechanical pain in Figure 2, and is positively correlated with itch behavior. The y-axis reports expression measured by RNA-seq and the x-axis reports chloroquine-evoked itch; each point reports measurements from one strain of the BXD mouse cross. (B) Each row reports one Gene Ontology term enriched among transcripts whose expression links to the chromosome 2 locus and is positively correlated with itch. (C) Data are as in (A) except that Il10rb is analyzed, whose expression is negatively correlated with itch behavior. (D) Each row reports one Gene Ontology term enriched among transcripts whose expression links to the chromosome 2 locus and is negatively correlated with itch.

57

Figure 5. Transcripts showing linkage to the chromosome 2 behavioral locus are enriched for signatures of NF-κB binding. In each panel, the grey bins report the histogram of the numbers of genes (y-axis) in randomly chosen sets that exhibit signatures of binding by RELA, one of the main molecular components of the NF-κB transcriptional complex. Arrows report the number of genes with RELA binding among those whose expression links to the chromosome 2 locus mapped to itch and mechanical pain in Figure 2, and is positively correlated (A) or negatively correlated (B) with chloroquine-evoked itch behavior.

58

Table 1. Top 50 transcripts showing trans-linkage to marker rs6275559 at chromosome 2.

-log -log Gene (BL6/DBA) p-value Gene (BL6/DBA) p-value expression expression Tmem176b 0.3067 0.0001 Gpr157 -0.4173 0.0011 Pgs1 -0.1590 0.0003 Gm12446 -0.8413 0.0012 Gm11847 2.4986 0.0003 Mvp 0.2237 0.0012 Gm7325 0.8221 0.0003 Fbxo6 0.2996 0.0012 Cd9 0.2561 0.0003 Wdr13 -0.1261 0.0012 Gm4353 2.5597 0.0004 Accn2 -0.3624 0.0012 Sfr1 0.2362 0.0005 Ctnna1 0.1110 0.0012 1700025G04Rik -0.1239 0.0005 Bcl7b 0.1290 0.0012 Cep55 0.7928 0.0005 Cbln2 -0.2341 0.0013 Gpr137b-ps -0.3314 0.0006 Ighmbp2 -0.2107 0.0015 Dnajc27 -0.2233 0.0006 Asphd1 -0.2160 0.0015 Shisa5 0.1911 0.0006 Apobec1 0.5699 0.0015 B4galnt4 -0.2343 0.0008 Mtap2 -0.5121 0.0015 Tmem176a 0.2856 0.0008 Inpp5b -0.1268 0.0016 Cln5 0.1588 0.0008 Rimkla -0.3697 0.0016 Cds1 -0.3418 0.0008 Ap3s2 -0.2311 0.0016 Thnsl2 -0.2209 0.0008 Aak1 -0.3438 0.0016 Ucp2 0.3917 0.0010 Spns2 -0.2185 0.0016 Stx1b -0.3323 0.0010 Tmbim6 0.1254 0.0016 Cntnap2 -0.3296 0.0010 Grik5 -0.2072 0.0016 Coro6 -0.4565 0.0010 Dip2a -0.2332 0.0016 Acsl6 -0.2996 0.0010 Sh3gl1 0.1808 0.0016 4833418N0 Syt2 -0.4614 0.0010 -0.4854 0.0017 2Rik Frs3 -0.1474 0.0010 Reep4 0.1770 0.0017 Prtn3 0.9936 0.0010 Pold2 0.1920 0.0018

59

References

1. Ikoma, A., Steinhoff, M., Ständer, S., Yosipovitch, G. & Schmelz, M. The neurobiology of itch. Nat. Rev. Neurosci. 7, 535–547 (2006). 2. Aizawa, N. et al. Inhibition of peripheral FAAH depresses activities of bladder mechanosensitive nerve fibers of the rat. J. Urol. 192, 956–963 (2014). 3. Howarth, P. H., Salagean, M. & Dokic, D. Allergic rhinitis: not purely a histamine-related disease. Allergy 55 Suppl 64, 7–16 (2000). 4. Johanek, L. M. et al. A role for polymodal C-fiber afferents in nonhistaminergic itch. J. Neurosci. 28, 7659–7669 (2008). 5. Ajayi, A. A., Oluokun, A., Sofowora, O., Akinleye, A. & Ajayi, A. T. Epidemiology of antimalarial-induced pruritus in Africans. Eur. J. Clin. Pharmacol. 37, 539–540 (1989). 6. Johanek, L. M. et al. Psychophysical and physiological evidence for parallel afferent pathways mediating the sensation of itch. J. Neurosci. 27, 7490–7497 (2007). 7. Namer, B. et al. Separate peripheral pathways for pruritus in man. Journal of Neurophysiology 100, 2062–2069 (2008). 8. Ross, S. E. Pain and itch: insights into the neural circuits of aversive somatosensation in health and disease. Curr. Opin. Neurobiol. 21, 880– 887 (2011). 9. Bautista, D. M., Wilson, S. R. & Hoon, M. A. Why we scratch an itch: the molecules, cells and circuits of itch. Nat. Neurosci. 17, 175–182 (2014). 10. Julius, D. & Basbaum, A. I. Molecular mechanisms of nociception. Nature 413, 203–210 (2001). 11. Tsunozaki, M. & Bautista, D. M. Mammalian somatosensory mechanotransduction. Curr. Opin. Neurobiol. 19, 362–369 (2009). 12. Hoon, M. A. Molecular dissection of itch. Curr. Opin. Neurobiol. 34, 61–66 (2015). 13. Han, L. et al. A subpopulation of nociceptors specifically linked to itch. Nat. Neurosci. 16, 174–182 (2013). 14. Imamachi, N. et al. TRPV1-expressing primary afferents generate behavioral responses to pruritogens via multiple mechanisms. Proc. Natl. Acad. Sci. U.S.A. 106, 11330–11335 (2009). 15. GRAHAM, D. T., GOODELL, H. & WOLFF, H. G. Neural mechanisms involved in itch, itchy skin, and tickle sensations. J. Clin. Invest. 30, 37–49 (1951). 16. Shelley, W. The Neurohistology and Neurophysiology of the Itch Sensation in Man. A. M. A. Archives of Dermatology 76, 296–323 (1957). 17. Akiyama, T., Carstens, M. I. & Carstens, E. Facial injections of pruritogens and algogens excite partly overlapping populations of primary and second-order trigeminal neurons in mice. Journal of Neurophysiology 104, 2442–2450 (2010). 18. Liu, T., Xu, Z.-Z., Park, C.-K., Berta, T. & Ji, R.-R. Toll-like receptor 7

60

mediates pruritus. Nat. Neurosci. 13, 1460–1462 (2010). 19. Wilson, S. R. et al. TRPA1 is required for histamine-independent, Mas- related G protein-coupled receptor-mediated itch. Nat. Neurosci. 14, 595– 602 (2011). 20. Morita, T. et al. HTR7 Mediates Serotonergic Acute and Chronic Itch. Neuron 87, 124–138 (2015). 21. Wilson, S. R. et al. The epithelial cell-derived atopic dermatitis cytokine TSLP activates neurons to induce itch. Cell 155, 285–295 (2013). 22. Sun, Y.-G. & Chen, Z.-F. A gastrin-releasing peptide receptor mediates the itch sensation in the spinal cord. Nature 448, 700–703 (2007). 23. Sun, Y.-G. et al. Cellular basis of itch sensation. Science 325, 1531–1534 (2009). 24. Mishra, S. K. & Hoon, M. A. The cells and circuitry for itch responses in mice. Science 340, 968–971 (2013). 25. Heath, W. R. & Carbone, F. R. The skin-resident and migratory immune system in steady state and memory: innate lymphocytes, dendritic cells and T cells. Nat. Immunol. 14, 978–985 (2013). 26. Meephansan, J., Tsuda, H., Komine, M., Tominaga, S.-I. & Ohtsuki, M. Regulation of IL-33 expression by IFN-γ and tumor necrosis factor-α in normal human epidermal keratinocytes. J. Invest. Dermatol. 132, 2593– 2600 (2012). 27. Nestle, F. O., Di Meglio, P., Qin, J.-Z. & Nickoloff, B. J. Skin immune sentinels in health and disease. Nat Rev Immunol 9, 679–691 (2009). 28. Marshall, J. S. Mast-cell responses to pathogens. Nat Rev Immunol 4, 787–799 (2004). 29. Lagerström, M. C. et al. VGLUT2-dependent sensory neurons in the TRPV1 population regulate pain and itch. Neuron 68, 529–542 (2010). 30. Liu, Y. et al. VGLUT2-dependent glutamate release from nociceptors is required to sense pain and suppress itch. Neuron 68, 543–556 (2010). 31. Davidson, S. & Giesler, G. J. The multiple pathways for itch and their interactions with pain. Trends Neurosci. 33, 550–558 (2010). 32. Paus, R., Schmelz, M., Bíró, T. & Steinhoff, M. Frontiers in pruritus research: scratching the brain for more effective itch therapy. J. Clin. Invest. 116, 1174–1186 (2006). 33. Ross, S. E. et al. Loss of inhibitory interneurons in the dorsal spinal cord and elevated itch in Bhlhb5 mutant mice. Neuron 65, 886–898 (2010). 34. Ross, S. E. et al. Bhlhb5 and Prdm8 form a repressor complex involved in neuronal circuit assembly. Neuron 73, 292–303 (2012). 35. Kardon, A. P. et al. Dynorphin acts as a neuromodulator to inhibit itch in the dorsal horn of the spinal cord. Neuron 82, 573–586 (2014). 36. Bourane, S. et al. Gate control of mechanical itch by a subpopulation of spinal cord interneurons. Science 350, 550–554 (2015). 37. Zhao, Z.-Q. et al. Descending control of itch transmission by the serotonergic system via 5-HT1A-facilitated GRP-GRPR signaling. Neuron 84, 821–834 (2014). 38. Spergel, J. M. & Paller, A. S. Atopic dermatitis and the atopic march. 112,

61

S118–27 (2003). 39. Smith, F. J. D. et al. Loss-of-function mutations in the gene encoding filaggrin cause ichthyosis vulgaris. Nature Genetics 38, 337–342 (2006). 40. O'Regan, G. M., Sandilands, A., McLean, W. H. I. & Irvine, A. D. Filaggrin in atopic dermatitis. 122, 689–693 (2008). 41. Sandilands, A. et al. Comprehensive analysis of the gene encoding filaggrin uncovers prevalent and rare mutations in ichthyosis vulgaris and atopic eczema. Nature Genetics 39, 650–654 (2007). 42. Boguniewicz, M. & Leung, D. Y. M. Atopic dermatitis: a disease of altered skin barrier and immune dysregulation. Immunol. Rev. 242, 233–246 (2011). 43. Jin, H., He, R., Oyoshi, M. & Geha, R. S. Animal models of atopic dermatitis. J. Invest. Dermatol. 129, 31–40 (2009). 44. Novak, N. & Leung, D. Y. M. Advances in atopic dermatitis. Curr. Opin. Immunol. 23, 778–783 (2011). 45. Hennino, A. et al. CD8+ T cells are recruited early to allergen exposure sites in atopy patch test reactions in human atopic dermatitis. J. Allergy Clin. Immunol. 127, 1064–1067 (2011). 46. Indra, A. K. Epidermal TSLP: a trigger factor for pathogenesis of atopic dermatitis. Expert Rev Proteomics 10, 309–311 (2013). 47. Sonkoly, E. et al. IL-31: a new link between T cells and pruritus in atopic skin inflammation. J. Allergy Clin. Immunol. 117, 411–417 (2006). 48. Bilsborough, J. et al. IL-31 is associated with cutaneous lymphocyte antigen-positive skin homing T cells in patients with atopic dermatitis. J. Allergy Clin. Immunol. 117, 418–425 (2006). 49. Leung, D. Y. M., Boguniewicz, M., Howell, M. D., Nomura, I. & Hamid, Q. A. New insights into atopic dermatitis. J. Clin. Invest. 113, 651–657 (2004). 50. Ostlere, L. S., Cowen, T. & Rustin, M. H. Neuropeptides in the skin of patients with atopic dermatitis. Clin. Exp. Dermatol. 20, 462–467 (1995). 51. Salomon, J. & Baran, E. The role of selected neuropeptides in pathogenesis of atopic dermatitis. J Eur Acad Dermatol Venereol 22, 223–228 (2008). 52. Kim, K. Neuroimmunological mechanism of pruritus in atopic dermatitis focused on the role of serotonin. Biomol Ther (Seoul) 20, 506–512 (2012). 53. Ruzicka, T. & Glück, S. Cutaneous histamine levels and histamine releasability from the skin in atopic dermatitis and hyper-IgE-syndrome. Arch. Dermatol. Res. 275, 41–44 (1983). 54. Spergel, J. M. et al. Epicutaneous sensitization with protein antigen induces localized allergic dermatitis and hyperresponsiveness to methacholine after single exposure to aerosolized antigen in mice. J. Clin. Invest. 101, 1614–1622 (1998). 55. Wang, G. et al. Repeated epicutaneous exposures to ovalbumin progressively induce atopic dermatitis-like skin lesions in mice. Clin. Exp. Allergy 37, 151–161 (2007).

62

56. Matsuda, H. et al. Development of atopic dermatitis-like skin lesion with IgE hyperproduction in NC/Nga mice. Int. Immunol. 9, 461–466 (1997). 57. Kohara, Y. et al. A major determinant quantitative-trait locus responsible for atopic dermatitis-like skin lesions in NC/Nga mice is located on Chromosome 9. Immunogenetics 53, 15–21 (2001). 58. Vestergaard, C. et al. Overproduction of Th2-specific chemokines in NC/Nga mice exhibiting atopic dermatitis-like lesions. J. Clin. Invest. 104, 1097–1105 (1999). 59. Li, M. et al. Topical vitamin D3 and low-calcemic analogs induce thymic stromal lymphopoietin in mouse keratinocytes and trigger an atopic dermatitis. Proc. Natl. Acad. Sci. U.S.A. 103, 11736–11741 (2006). 60. Li, M. et al. Induction of thymic stromal lymphopoietin expression in keratinocytes is necessary for generating an atopic dermatitis upon application of the active vitamin D3 analogue MC903 on mouse skin. J. Invest. Dermatol. 129, 498–502 (2009). 61. Wilson, S. R. et al. The ion channel TRPA1 is required for chronic itch. J. Neurosci. 33, 9283–9294 (2013). 62. Liu, B. et al. TRPA1 controls inflammation and pruritogen responses in allergic contact dermatitis. FASEB J. 27, 3549–3563 (2013). 63. Zheng, T. et al. Transgenic expression of interleukin-13 in the skin induces a pruritic dermatitis and skin remodeling. J. Invest. Dermatol. 129, 742–751 (2009). 64. Oh, M.-H. et al. TRPA1-dependent pruritus in IL-13-induced chronic atopic dermatitis. J. Immunol. 191, 5371–5382 (2013). 65. Akinci, M. K. & Johnston, G. A. Sex differences in acute swim stress- induced changes in the binding of MK-801 to the NMDA subclass of glutamate receptors in mouse forebrain. J. Neurochem. 61, 2290–2293 (1993). 66. Hain, H. S., Belknap, J. K. & Mogil, J. S. Pharmacogenetic evidence for the involvement of 5-hydroxytryptamine (Serotonin)-1B receptors in the mediation of morphine antinociceptive sensitivity. J Pharmacol Exp Ther 291, 444–449 (1999). 67. Fillingim, R. B. et al. The A118G single nucleotide polymorphism of the mu-opioid receptor gene (OPRM1) is associated with pressure pain sensitivity in humans. J Pain 6, 159–167 (2005). 68. Sorge, R. E. et al. Genetically determined P2X7 receptor pore formation regulates variability in chronic pain sensitivity. Nat Med 18, 595–599 (2012). 69. Wieskopf, J. S. et al. The nicotinic α6 subunit gene determines variability in chronic pain sensitivity via cross-inhibition of P2X2/3 receptors. Sci Transl Med 7, 287ra72 (2015). 70. Mogil, J. S. et al. Pain sensitivity and vasopressin analgesia are mediated by a gene-sex-environment interaction. Nat. Neurosci. 14, 1569–1573 (2011). 71. Recla, J. M. et al. Precise genetic mapping and integrative bioinformatics in Diversity Outbred mice reveals Hydin as a novel pain gene. Mamm.

63

Genome 25, 211–222 (2014). 72. Goswami, S. C. et al. Molecular signatures of mouse TRPV1-lineage neurons revealed by RNA-Seq transcriptome analysis. J Pain 15, 1338– 1359 (2014). 73. Chiu, I. M. et al. Transcriptional profiling at whole population and single cell levels reveals somatosensory neuron molecular diversity. eLife Sciences 3, (2014). 74. Usoskin, D. et al. Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing. Nat. Neurosci. 18, 145–153 (2015). 75. Mollanazar, N. K., Smith, P. K. & Yosipovitch, G. Mediators of Chronic Pruritus in Atopic Dermatitis: Getting the Itch Out? Clin Rev Allergy Immunol (2015). doi:10.1007/s12016-015-8488-5 76. Matterne, U. et al. Prevalence, correlates and characteristics of chronic pruritus: a population-based cross-sectional study. Acta Derm Venereol 91, 674–679 (2011). 77. Metz, M. & Ständer, S. Chronic pruritus--pathogenesis, clinical aspects and treatment. J Eur Acad Dermatol Venereol 24, 1249–1260 (2010). 78. Garibyan, L., Rheingold, C. G. & Lerner, E. A. Understanding the pathophysiology of itch. Dermatol Ther 26, 84–91 (2013). 79. Bardin, L. The complex role of serotonin and 5-HT receptors in chronic pain. Behav Pharmacol 22, 390–404 (2011). 80. Kayser, V. et al. Mechanical, thermal and formalin-induced nociception is differentially altered in 5-HT1A-/-, 5-HT1B-/-, 5-HT2A-/-, 5-HT3A-/- and 5- HTT-/- knock-out male mice. Pain 130, 235–248 (2007). 81. Zeitz, K. P. et al. The 5-HT3 subtype of serotonin receptor contributes to nociceptive processing via a novel subset of myelinated and unmyelinated nociceptors. J. Neurosci. 22, 1010–1019 (2002). 82. Huang, J., Li, G., Xiang, J., Yin, D. & Chi, R. Immunohistochemical study of serotonin in lesions of chronic eczema. Int. J. Dermatol. 43, 723–726 (2004). 83. Soga, F., Katoh, N., Inoue, T. & Kishimoto, S. Serotonin activates human monocytes and prevents apoptosis. J. Invest. Dermatol. 127, 1947–1955 (2007). 84. Lundeberg, L. Serotonin in human allergic contact dermatitis. An immunohistochemical and high-performance liquid chromatographic study. Arch. Dermatol. Res. 291, 269–274 (1999). 85. Kerr, P. G., Argiles, A. & Mion, C. Whole blood serotonin levels are markedly elevated in patients on dialytic therapy. American journal of nephrology (1992). doi:10.1159/000168411 86. Schwörer, H., Hartmann, H. & Ramadori, G. Relief of cholestatic pruritus by a novel class of drugs: 5-hydroxytryptamine type 3 (5-HT3) receptor antagonists: effectiveness of ondansetron. Pain 61, 33–37 (1995). 87. Nordlind, K. et al. Expression of serotonergic receptors in psoriatic skin. Arch. Dermatol. Res. 298, 99–106 (2006). 88. Trapnell, C., Pachter, L. & Salzberg, S. L. TopHat: discovering splice

64

junctions with RNA-Seq. 25, 1105–1111 (2009). 89. Anders, S., Pyl, P. T. & Huber, W. HTSeq--a Python framework to work with high-throughput sequencing data. 31, 166–169 (2015). 90. Risso, D., Schwartz, K., Sherlock, G. & Dudoit, S. GC-content normalization for RNA-Seq data. BMC Bioinformatics 12, 480 (2011). 91. Alexa, A., Rahnenführer, J. & Lengauer, T. Improved scoring of functional groups from gene expression data by decorrelating GO graph structure. Bioinformatics 22, 1600–1607 (2006). 92. Gerhold, K. A. et al. The star-nosed mole reveals clues to the molecular basis of mammalian touch. PLoS ONE 8, e55001 (2013). 93. Brueggemann, A., George, M. & Klau, M. Ion Channel Drug Discovery and Research: The Automated Nano-Patch-ClampO Technology. Current Drug … (2004). doi:10.2174/1570163043484833 94. Hedlund, P. B. et al. No hypothermic response to serotonin in 5-HT7 receptor knockout mice. Proc. Natl. Acad. Sci. U.S.A. 100, 1375–1380 (2003). 95. Bautista, D. M. et al. TRPA1 mediates the inflammatory actions of environmental irritants and proalgesic agents. Cell 124, 1269–1282 (2006). 96. Caterina, M. J. et al. Impaired nociception and pain sensation in mice lacking the capsaicin receptor. Science 288, 306–313 (2000). 97. Tsunozaki, M. et al. A ‘toothache tree’ alkylamide inhibits Aδ mechanonociceptors to alleviate mechanical pain. J. Physiol. (Lond.) 591, 3325–3340 (2013). 98. Hampton, A. L. et al. Progression of ulcerative dermatitis lesions in C57BL/6Crl mice and the development of a scoring system for dermatitis lesions. J. Am. Assoc. Lab. Anim. Sci. 51, 586–593 (2012). 99. Yun, J.-W. et al. TRPV1 antagonist can suppress the atopic dermatitis- like symptoms by accelerating skin barrier recovery. J. Dermatol. Sci. 62, 8–15 (2011). 100. Green, A. D., Young, K. K., Lehto, S. G., Smith, S. B. & Mogil, J. S. Influence of genotype, dose and sex on pruritogen-induced scratching behavior in the mouse. Pain 124, 50–58 (2006). 101. Nair, H. K. et al. Genomic loci and candidate genes underlying inflammatory nociception. Pain 152, 599–606 (2011). 102. Kuraishi, Y., Nagasawa, T., Hayashi, K. & Satoh, M. Scratching behavior induced by pruritogenic but not algesiogenic agents in mice. European Journal of Pharmacology 275, 229–233 (1995). 103. Kuraishi, Y., Yamaguchi, T. & Miyamoto, T. Itch-scratch responses induced by opioids through central mu opioid receptors in mice. J. Biomed. Sci. 7, 248–252 (2000). 104. Liu, Q. et al. Mechanisms of itch evoked by β-alanine. J. Neurosci. 32, 14532–14537 (2012). 105. Liu, J. et al. Genetic background but not metallothionein phenotype dictates sensitivity to cadmium-induced testicular injury in mice. Toxicol. Appl. Pharmacol. 176, 1–9 (2001).

65

106. Schadt, E. E. Exploiting naturally occurring DNA variation and molecular profiling data to dissect disease and drug response traits. Curr. Opin. Biotechnol. 16, 647–654 (2005). 107. Cookson, W., Liang, L., Abecasis, G., Moffatt, M. & Lathrop, M. Mapping complex disease traits with global gene expression. Nat Rev Genet 10, 184–194 (2009). 108. Giaever, G. & Nislow, C. The yeast deletion collection: a decade of functional genomics. Genetics 197, 451–465 (2014). 109. Manteniotis, S. et al. Comprehensive RNA-Seq expression analysis of sensory ganglia with a focus on ion channels and GPCRs in Trigeminal ganglia. PLoS ONE 8, e79523 (2013). 110. Karai, L. et al. Deletion of vanilloid receptor 1-expressing primary afferent neurons for pain control. J. Clin. Invest. 113, 1344–1352 (2004). 111. Adham, N., Zgombick, J. M., Bard, J. & Branchek, T. A. Functional characterization of the recombinant human 5-hydroxytryptamine7(a) receptor isoform coupled to adenylate cyclase stimulation. J Pharmacol Exp Ther 287, 508–514 (1998). 112. Lovenberg, T. W. et al. A novel adenylyl cyclase-activating serotonin receptor (5-HT7) implicated in the regulation of mammalian circadian rhythms. Neuron 11, 449–458 (1993). 113. Tang, W. J. & Gilman, A. G. Type-specific regulation of adenylyl cyclase by G protein beta gamma subunits. Science 254, 1500–1503 (1991). 114. Schmidt, M., Dubin, A. E., Petrus, M. J., Earley, T. J. & Patapoutian, A. Nociceptive signals induce trafficking of TRPA1 to the plasma membrane. Neuron 64, 498–509 (2009). 115. Nascimento, E. B. et al. Peripheral 5-HT1B and 5-HT2A receptors mediate the nociceptive response induced by 5-hydroxytryptamine in mice. Pharmacol. Biochem. Behav. 99, 598–603 (2011). 116. Roberts, A. J. et al. Mice lacking 5-HT receptors show specific impairments in contextual learning. European Journal of Neuroscience 19, 1913–1922 (2004). 117. Brenchat, A. et al. Assessment of 5-HT(7) Receptor Agonists Selectivity Using Nociceptive and Thermoregulation Tests in Knockout versus Wild- Type Mice. Adv Pharmacol Sci 2012, 312041 (2012). 118. Brenchat, A. et al. 5-HT7 receptor activation inhibits mechanical hypersensitivity secondary to capsaicin sensitization in mice. Pain 141, 239–247 (2009). 119. Santello, M. & Nevian, T. Dysfunction of cortical dendritic integration in neuropathic pain reversed by serotoninergic neuromodulation. Neuron 86, 233–246 (2015). 120. LaMotte, R. H., Dong, X. & Ringkamp, M. Sensory neurons and circuits mediating itch. Nat. Rev. Neurosci. 15, 19–31 (2014). 121. Idzko, M. et al. The serotoninergic receptors of human dendritic cells: identification and coupling to cytokine release. J. Immunol. 172, 6011– 6019 (2004). 122. Nojima, H. & Carstens, E. 5-Hydroxytryptamine (5-HT)2 receptor

66

involvement in acute 5-HT-evoked scratching but not in allergic pruritus induced by dinitrofluorobenzene in rats. J Pharmacol Exp Ther 306, 245– 252 (2003). 123. Blardi, P. Serotonin and fluoxetine levels in plasma and platelets after fluoxetine treatment in depressive patients. Journal of Clinical Psychopharmacology 22, 131–136 (2002). 124. Cederberg, J., Knight, S., Svenson, S. & Melhus, H. Itch and skin rash from chocolate during fluoxetine and sertraline treatment: case report. BMC Psychiatry 4, 36 (2004). 125. Rausl, A., Nordlind, K. & Wahlgren, C.-F. Pruritic and vascular responses induced by serotonin in patients with atopic dermatitis and in healthy controls. Acta Derm Venereol 93, 277–280 (2013). 126. Anjaneyulu, M. & Chopra, K. Fluoxetine attenuates thermal hyperalgesia through 5-HT1/2 receptors in streptozotocin-induced diabetic mice. European Journal of Pharmacology 497, 285–292 (2004). 127. Browning, J., Combes, B. & Mayo, M. J. Long-term efficacy of sertraline as a treatment for cholestatic pruritus in patients with primary biliary cirrhosis. Am. J. Gastroenterol. 98, 2736–2741 (2003). 128. Zylicz, Z. Paroxetine in the treatment of severe non-dermatological pruritus: A randomized, controlled trial. Journal of Pain and Symptom Management 26, 1105–1112 (2003). 129. Sannicandro, T. J., Farrar, M. C. & Markowitz, J. S. Selective serotonin reuptake inhibitor-induced rash: case report and review of the literature. Pharmacotherapy 22, 516–518 (2002). 130. Warnock, J. K. & Morris, D. W. Adverse cutaneous reactions to antidepressants. American journal of clinical dermatology (2002). doi:10.2165/00128071-200203050-00005 131. Ahn, A. H. & Basbaum, A. I. Tissue injury regulates serotonin 1D receptor expression: implications for the control of migraine and inflammatory pain. J. Neurosci. 26, 8332–8338 (2006). 132. Tepper, S. J., Rapoport, A. M. & Sheftell, F. D. Mechanisms of Action of the 5-HT1B/1D Receptor Agonists. Arch Neurol 59, 1084 (2002). 133. Xie, W., Strong, J. A., Ye, L., Mao, J.-X. & Zhang, J.-M. Knockdown of sodium channel NaV1.6 blocks mechanical pain and abnormal bursting activity of afferent neurons in inflamed sensory ganglia. Pain 154, 1170– 1180 (2013). 134. Cho, H. et al. The calcium-activated chloride channel anoctamin 1 acts as a heat sensor in nociceptive neurons. Nat. Neurosci. 15, 1015–1021 (2012). 135. Kalz, F. & Fekete, Z. Studies on the mechanism of the white response and of the delayed blanch phenomenon in atopic subjects by means of Coomassie blue. J. Invest. Dermatol. 35, 135–140 (1960). 136. Abbott, F. V., Hong, Y. & Blier, P. Activation of 5-HT2A receptors potentiates pain produced by inflammatory mediators. 35, 99–110 (1996). 137. Lin, S.-Y. et al. Serotonin receptor 5-HT2B mediates serotonin-induced mechanical hyperalgesia. J. Neurosci. 31, 1410–1418 (2011).

67

138. Van Steenwinckel, J. et al. Role of spinal serotonin 5-HT2A receptor in 2‘,3’-dideoxycytidine-induced neuropathic pain in the rat and the mouse. Pain 137, 66–80 (2008). 139. Bonnet, M. P., Marret, E., Josserand, J. & Mercier, F. J. Effect of prophylactic 5-HT3 receptor antagonists on pruritus induced by neuraxial opioids: a quantitative systematic review. Br. J. Anaesth. 101, 311–319 (2008). 140. Kyriakides, K., Hussain, S. K. & Hobbs, G. J. Management of opioid- induced pruritus: a role for 5-HT3 antagonists? Br. J. Anaesth. 82, 439– 441 (1999). 141. Glass, J. D., Grossman, G. H., Farnbauch, L. & DiNardo, L. Midbrain raphe modulation of nonphotic circadian clock resetting and 5-HT release in the mammalian suprachiasmatic nucleus. J. Neurosci. 23, 7451–7460 (2003). 142. Jørgensen, H. S. Studies on the neuroendocrine role of serotonin. Dan Med Bull 54, 266–288 (2007). 143. Kim, J. J. et al. Targeted inhibition of serotonin type 7 (5-HT7) receptor function modulates immune responses and reduces the severity of intestinal inflammation. J. Immunol. 190, 4795–4804 (2013). 144. Hedlund, P. B. The 5-HT7 receptor and disorders of the nervous system: an overview. Psychopharmacology (Berl.) 206, 345–354 (2009). 145. Vanhoenacker, P., Haegeman, G. & Leysen, J. E. 5-HT7 receptors: current knowledge and future prospects. Trends Pharmacol. Sci. 21, 70– 77 (2000). 146. Cevikbas, F. et al. A sensory neuron-expressed IL-31 receptor mediates T helper cell-dependent itch: Involvement of TRPV1 and TRPA1. J. Allergy Clin. Immunol. 133, 448–460 (2014). 147. Bayer, H. et al. Serotoninergic receptors on human airway epithelial cells. Am. J. Respir. Cell Mol. Biol. 36, 85–93 (2007). 148. Kwan, K. Y., Glazer, J. M., Corey, D. P., Rice, F. L. & Stucky, C. L. TRPA1 modulates mechanotransduction in cutaneous sensory neurons. J. Neurosci. 29, 4808–4819 (2009). 149. Brandt, E. B. & Sivaprasad, U. Th2 Cytokines and Atopic Dermatitis. J Clin Cell Immunol 2, (2011). 150. Weidinger, S. et al. A genome-wide association study of atopic dermatitis identifies loci with overlapping effects on asthma and psoriasis. Hum. Mol. Genet. 22, 4841–4856 (2013). 151. Baurecht, H. et al. Genome-wide comparative analysis of atopic dermatitis and psoriasis gives insight into opposing genetic mechanisms. Am. J. Hum. Genet. 96, 104–120 (2015). 152. Paternoster, L. et al. Multi-ancestry genome-wide association study of 21,000 cases and 95,000 controls identifies new risk loci for atopic dermatitis. Nature Genetics 47, 1449–1456 (2015). 153. Ellinghaus, D. et al. High-density genotyping study identifies four new susceptibility loci for atopic dermatitis. Nature Genetics 45, 808–812 (2013).

68

154. Sun, L. D. et al. Genome-wide association study identifies two new susceptibility loci for atopic dermatitis in the Chinese Han population. Nature Genetics 43, 690–694 (2011). 155. Hirota, T. et al. Genome-wide association study identifies eight new susceptibility loci for atopic dermatitis in the Japanese population. Nature Genetics 44, 1222–1226 (2012). 156. Albert, F. W. & Kruglyak, L. The role of regulatory variation in complex traits and disease. Nat Rev Genet 16, 197–212 (2015). 157. Wang, X. et al. A promoter polymorphism in the Per3 gene is associated with alcohol and stress response. Transl Psychiatry 2, e73 (2012). 158. Dai, J. et al. Expression quantitative trait loci and genetic regulatory network analysis reveals that Gabra2 is involved in stress responses in the mouse. Stress 12, 499–506 (2009). 159. de Jong, S. et al. Hippocampal gene expression analysis highlights Ly6a/Sca-1 as candidate gene for previously mapped novelty induced behaviors in mice. PLoS ONE 6, e20716 (2011). 160. Harenza, J. L., Muldoon, P. P., De Biasi, M., Damaj, M. I. & Miles, M. F. Genetic variation within the Chrna7 gene modulates nicotine reward-like phenotypes in mice. Genes Brain Behav. 13, 213–225 (2014). 161. Hovatta, I. et al. Glyoxalase 1 and glutathione reductase 1 regulate anxiety in mice. Nature 438, 662–666 (2005). 162. Williams, R. et al. A common and unstable copy number variant is associated with differences in Glo1 expression and anxiety-like behavior. PLoS ONE 4, e4649 (2009). 163. Brem, R. B., Yvert, G., Clinton, R. & Kruglyak, L. Genetic dissection of transcriptional regulation in budding yeast. Science 296, 752–755 (2002). 164. Freeman, M. Feedback control of intercellular signalling in development. Nature 408, 313–319 (2000). 165. Brandman, O. & Meyer, T. Feedback loops shape cellular signals in space and time. Science 322, 390–395 (2008). 166. Yvert, G. et al. Trans-acting regulatory variation in Saccharomyces cerevisiae and the role of transcription factors. Nature Genetics 35, 57– 64 (2003). 167. Schifano, E. D., Li, L., Christiani, D. C. & Lin, X. Genome-wide association analysis for multiple continuous secondary phenotypes. Am. J. Hum. Genet. 92, 744–759 (2013). 168. Eden, E., Navon, R., Steinfeld, I., Lipson, D. & Yakhini, Z. GOrilla: a tool for discovery and visualization of enriched GO terms in ranked gene lists. BMC Bioinformatics 10, 48 (2009). 169. Davidson, S., Zhang, X., Khasabov, S. G., Simone, D. A. & Giesler, G. J. Relief of itch by scratching: state-dependent inhibition of primate spinothalamic tract neurons. Nat. Neurosci. 12, 544–546 (2009). 170. Liu, X.-Y. et al. Unidirectional cross-activation of GRPR by MOR1D uncouples itch and analgesia induced by opioids. Cell 147, 447–458 (2011). 171. Gewurz, B. E. et al. Genome-wide siRNA screen for mediators of NF-κB

69

activation. Proc. Natl. Acad. Sci. U.S.A. 109, 2467–2472 (2012). 172. Sun, T. et al. Alleviation of neuropathic pain by intrathecal injection of antisense oligonucleotides to p65 subunit of NF-kappaB. Br. J. Anaesth. 97, 553–558 (2006). 173. Saleh, A. et al. Normalization of NF-κB activity in dorsal root ganglia neurons cultured from diabetic rats reverses neuropathy-linked markers of cellular pathology. Exp. Neurol. 241, 169–178 (2013). 174. Leung, J. Y. K. et al. Metallothionein promotes regenerative axonal sprouting of dorsal root ganglion neurons after physical axotomy. Cell. Mol. Life Sci. 69, 809–817 (2012). 175. Fleming, C. E., Mar, F. M., Franquinho, F., Saraiva, M. J. & Sousa, M. M. Transthyretin internalization by sensory neurons is megalin mediated and necessary for its neuritogenic activity. J. Neurosci. 29, 3220–3232 (2009). 176. Spuch, C., Ortolano, S. & Navarro, C. LRP-1 and LRP-2 receptors function in the membrane neuron. Trafficking mechanisms and proteolytic processing in Alzheimer's disease. Front Physiol 3, 269 (2012). 177. Leheste, J. R. et al. Megalin knockout mice as an animal model of low molecular weight proteinuria. Am. J. Pathol. 155, 1361–1370 (1999). 178. König, O. et al. Estrogen and the inner ear: megalin knockout mice suffer progressive hearing loss. 22, 410–417 (2008). 179. Simarro, M. et al. Fast kinase domain-containing protein 3 is a mitochondrial protein essential for cellular respiration. Biochem. Biophys. Res. Commun. 401, 440–446 (2010). 180. Colas, E. et al. Molecular markers of endometrial carcinoma detected in uterine aspirates. Int. J. Cancer 129, 2435–2444 (2011). 181. Baltz, A. G. et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol. Cell 46, 674–690 (2012). 182. Fukuda, M. & Mikoshiba, K. Expression of synaptotagmin I or II promotes neurite outgrowth in PC12 cells. Neuroscience letters (2000). doi:10.1016/S0304-3940(00)01585-8 183. Yang, M., Cagle, M. C. & Honig, M. G. Identification of cerebellin2 in chick and its preferential expression by subsets of developing sensory neurons and their targets in the dorsal horn. J. Comp. Neurol. 518, 2818– 2840 (2010). 184. Bohlen, C. J. et al. A heteromeric Texas coral snake toxin targets acid- sensing ion channels to produce pain. Nature 479, 410–414 (2011). 185. Mark, M. D. & Herlitze, S. G-protein mediated gating of inward-rectifier K+ channels. Eur. J. Biochem. 267, 5830–5836 (2000). 186. Chen, J. T.-C. et al. Presynaptic GABAergic inhibition regulated by BDNF contributes to neuropathic pain induction. Nat Commun 5, 5331 (2014). 187. Fossat, P. et al. Knockdown of L calcium channel subtypes: differential effects in neuropathic pain. J. Neurosci. 30, 1073–1085 (2010). 188. Sandoz, G. et al. Mtap2 is a constituent of the protein network that regulates twik-related K+ channel expression and trafficking. J. Neurosci. 28, 8545–8552 (2008). 189. Ho, T. S.-Y. et al. A hierarchy of ankyrin-spectrin complexes clusters

70

sodium channels at nodes of Ranvier. Nat. Neurosci. 17, 1664–1672 (2014). 190. Li, Y. et al. LIMK-dependent actin polymerization in primary sensory neurons promotes the development of inflammatory heat hyperalgesia in rats. Science Signaling 7, ra61 (2014). 191. Reyes-Gibby, C. C. et al. Symptom clusters of pain, depressed mood, and fatigue in lung cancer: assessing the role of cytokine genes. Support Care Cancer 21, 3117–3125 (2013). 192. Biber, K. & Boddeke, E. Neuronal CC chemokines: the distinct roles of CCL21 and CCL2 in neuropathic pain. Front Cell Neurosci 8, 210 (2014). 193. Zhang, G. et al. Fcγ receptor-mediated inflammation inhibits axon regeneration. PLoS ONE 9, e88703 (2014). 194. Philip, V. M. et al. High-throughput behavioral phenotyping in the expanded panel of BXD recombinant inbred strains. Genes Brain Behav. 9, 129–159 (2010).

71