DOCSLIB.ORG

Document Title: the Determination of the Physical Characteristics of an Individual from Biological Stains Author: Jack Ballantyne, Ph.D

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Document Title: the Determination of the Physical Characteristics of an Individual from Biological Stains Author: Jack Ballantyne, Ph.D The author(s) shown below used Federal funds provided by the U.S. Department of Justice and prepared the following final report: Document Title: The Determination Of The Physical Characteristics Of An Individual From Biological Stains Author: Jack Ballantyne, Ph.D. Document No.: 223978 Date Received: September 2008 Award Number: 2005-MU-BX-K075 This report has not been published by the U.S. Department of Justice. To provide better customer service, NCJRS has made this Federally- funded grant final report available electronically in addition to traditional paper copies. Opinions or points of view expressed are those of the author(s) and do not necessarily reflect the official position or policies of the U.S. Department of Justice. THE DETERMINATION OF THE PHYSICAL CHARACTERISTICS OF AN INDIVIDUAL FROM BIOLOGICAL STAINS FINAL REPORT January 16 2007 Department of Justice, National Institute of Justcie Award Number: 2005-MU-BX-K075 (1 September 2005- 31 December 2007) Principal Investigator: Jack Ballantyne, Ph.D. Associate Professor Department of Chemistry Associate Director for Research National Center for Forensic Science 4000 Central Boulevard, Bldg#5 University of Central Florida Orlando, FL 32816-2366 Phone: (407) 823 4440 Fax: (407) 823 2252 e-mail: [email protected] This document is a research report submitted to the U.S. Department of Justice. This report has not been published by the Department. Opinions or points of view expressed are those of the author(s) and do not necessarily reflect the official position or policies of the U.S. Department of Justice. EXECUTIVE SUMMARY 1. It is now a matter of routine for the forensic scientist to obtain the genetic profile of an individual from DNA recovered from a biological stain deposited at a crime scene. Potential contributors of the stain must either be known to investigators (i.e. a developed suspect) or the questioned profile must be searched against a database of DNA profiles such as those maintained in the CODIS National DNA database. However, in those instances where there is no developed suspect and no match is obtained after interrogation of appropriate DNA databases, the DNA profile per se presently provides no meaningful information to investigators, with the notable exception of gender determination. In these situations it would be advantageous to the investigation, if additional probative information could be obtained from the biological stain. A useful biometric that could provide important probative information, and one that may be amenable to molecular genetic analysis, is the biological age of an individual. The ability to provide investigators with information as to whether a DNA donor is a newborn, infant, toddler, child, adolescent, adult, middle-aged or elderly individual could be useful in certain cases, particularly those involving young children such as kidnappings or in providing additional intelligence during terrorist investigations. Currently no validated molecular assays exist for age determination. 2. In the the work described herein we investigated whether determination of an individual’s age is feasible in dried physiological stains. We sought to identify a number of potential RNA ‘molecular clocks’ that could provide investigators with information as to whether a DNA donor is a newborn, infant, toddler, child, adolescent, adult, middle-aged individual or old-aged 2 This document is a research report submitted to the U.S. Department of Justice. This report has not been published by the Department. Opinions or points of view expressed are those of the author(s) and do not necessarily reflect the official position or policies of the U.S. Department of Justice. individual. The strategy was to identify genes that are differentially expressed (at the RNA level) during the various phases of human development. Also, since progressive reduction in telomere length in somatic tissues appears to be correlated with the ‘biological age’ of the cell we examined whether such telomere length changes were detectable in dried bloodstains. 3. The specific aims of the project were as follows: Aim 1. To identify and develop sensitive assays for genes which are expressed in an age- specific manner in dried physiological stains. Aim 1A Identify human developmentally-regulated genes that are expressed at the RNA level in blood and/or saliva in an age specific manner Aim 1B Determine the abundance, stability and persistence of candidate genes identified in 1A in dried physiological stains Aim 1C Develop rapid, quantitative assays for the genes identified in 1A and 1B Aim 2. To develop sensitive assays for the determination of telomere length and to correlate the length with age using material extracted from dried physiological stains. Aim 2A Apply TRF-Southern blot technique and STELA to forensic type samples for comparison with qPCR methods Aim 2B Develop rapid and sensitive real time PCR assays for the determination of telomere length Aim 2C Using the assays developed, correlate telomere length with age in samples taken from dried biological stains 3 This document is a research report submitted to the U.S. Department of Justice. This report has not been published by the Department. Opinions or points of view expressed are those of the author(s) and do not necessarily reflect the official position or policies of the U.S. Department of Justice. 4. We screened 319 potential age specific mRNA biomarkers (messenger RNA transcripts) and identified 7 that appeared to be expressed in an age-dependent in dried bloodstains for human biological age determination. These include: a. HBG1n1 (expressed at elevated levels in newborns). b. HBG1n2 (expressed at elevated levels in newborns). c. HBG2n2 (expressed at elevated levels in newborns). d. HBG2n3 (expressed at elevated levels in newborns). e. HBE1 (expressed at elevated levels in newborns). f. COL1A2 (expressed at elevated levels in younger individuals (<12 years)) g. IGFBP3 (expressed at elevated levels in post-pubertal individuals (>12 years)). 5. Duplex real-time PCR assays were designed and developed for two of the newborn-specific biomarkers (HBG1n1 and HBG2n3) that incorporate a housekeeping gene (the ribosomal protein S15) as an internal positive control (IPC). Individual qRT-PCR assays were developed to measure both of these transcripts in forensic specimens. Adjustment of the primer concentrations in the qRT-PCR reaction permitted the establishment of two temporally delimited assays, one of which was specific to blood from newborns 4-months or under (≤4 months) and the other to newborns who were hours old (<24 hours). Both assays may be useful in a variety of child kidnapping, assault and criminal abortion investigations with the latter (<24 hours) being of particular use for those cases involving hospital abductions. A series of specificity performance checks carried out on the qRT-PCR assays revealed that the HBG(1/2)n transcripts appear to be restricted to blood from newborns in the human (or at least, primate) lineage. The assays appear to be sensitive and robust enough for forensic use in that only a few cell equivalents of total 4 This document is a research report submitted to the U.S. Department of Justice. This report has not been published by the Department. Opinions or points of view expressed are those of the author(s) and do not necessarily reflect the official position or policies of the U.S. Department of Justice. RNA are required (i.e. 50 pg) and >100ng of total RNA is recoverable from typical sized (50-μl) bloodstains. The sensitivity of the assay is thus 50-500 cells assuming 0.1-1.0 pg total RNA per cell. The newborn blood-specific transcripts were detectable at least up to 15 months in the dried state. 6. A triplex real-time PCR assay has been designed and developed for two other age specific biomarkers (COL1A2 and IGFBP3) that also includes the housekeeping gene S15. The conditions of the assay are such that the relative expression of these three transcripts differs in an age dependent manner. Consequently the triplex qRT-PCR assay can be used to categorize bloodstain donors as likely originating from an individual belonging to one of four different age classes, namely 1 hour-3 months, 4 months-4 years, 5 -18 years and > 18 years. The triplex appears to have a high level of species specificity being confined to primates. The assay appears to be sensitive and robust enough for forensic use in that as little as 3 ng of input DNA can be used. The assay can be used to predict the bloodstain donor’s age in stains left at room temperature for up to 18 months. 7. We were unable to demonstrate a correlation between telomere length and age in dried bloodstains using a variety of different analytical approaches. 5 This document is a research report submitted to the U.S. Department of Justice. This report has not been published by the Department. Opinions or points of view expressed are those of the author(s) and do not necessarily reflect the official position or policies of the U.S. Department of Justice. ABSTRACT The ability to determine the physical characteristics of an individual depositing a bloodstain at a crime scene would be an invaluable tool to investigators, akin to eyewitness information. One useful biometric that may be amenable to molecular genetic analysis is the biological age of an individual. In theory it may be possible to determine patterns of gene expression that are age-specific thus permitting the distinction between tissue sample originating from a individuals of different ages (e.g. newborn, adolescent, middle-age or elderly). We have discovered two novel isoforms of gamma hemoglobin messenger RNA, designated HBG1n and HBG2n, which exhibit an extremely restricted pattern of gene expression, being confined to newborn individuals. Multiplex qRT-PCR assays incorporating these novel mRNAs have been designed, tested and evaluated for their potential forensic use.
Load more

Recommended publications
  • Functions of Osteocalcin in Bone, Pancreas, Testis, and Muscle
    International Journal of Molecular Sciences Review Functions of Osteocalcin in Bone, Pancreas, Testis, and Muscle Toshihisa Komori Basic and Translational Research Center for Hard Tissue Disease, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki 852-8588, Japan; [email protected]; Tel.: +81-95-819-7637; Fax: +81-95-819-7638 Received: 17 September 2020; Accepted: 10 October 2020; Published: 12 October 2020 Abstract: Osteocalcin (Ocn), which is specifically produced by osteoblasts, and is the most abundant non-collagenous protein in bone, was demonstrated to inhibit bone formation and function as a hormone, which regulates glucose metabolism in the pancreas, testosterone synthesis in the testis, / / and muscle mass, based on the phenotype of Ocn− − mice by Karsenty’s group. Recently, Ocn− − mice were newly generated by two groups independently. Bone strength is determined by bone / quantity and quality. The new Ocn− − mice revealed that Ocn is not involved in the regulation of bone formation and bone quantity, but that Ocn regulates bone quality by aligning biological apatite (BAp) parallel to the collagen fibrils. Moreover, glucose metabolism, testosterone synthesis and / spermatogenesis, and muscle mass were normal in the new Ocn− − mice. Thus, the function of Ocn is the adjustment of growth orientation of BAp parallel to the collagen fibrils, which is important for bone strength to the loading direction of the long bone. However, Ocn does not play a role as a hormone in the pancreas, testis, and muscle. Clinically, serum Ocn is a marker for bone formation, and exercise increases bone formation and improves glucose metabolism, making a connection between Ocn and glucose metabolism.
    [Show full text]
  • Immuno-Oncology Panel 1
    Immuno-Oncology panel 1 Gene Symbol Target protein name UniProt ID (& link) Modification* (56 analytes) ADA17 ADAM17 metalloprotease domain 17 P78536 *blanks mean the assay detects the ANXA1 Annexin A1 P04083 non-modified peptide sequence ANXA1 Annexin A1 P04083 ARG2 arginase, type II P78540 ATM Serine-protein kinase ATM, Ataxia telangiectasia mutated Q13315 pS2996 ATM Serine-protein kinase ATM, Ataxia telangiectasia mutated Q13315 ATM Serine-protein kinase ATM, Ataxia telangiectasia mutated Q13315 pS367 ATM Serine-protein kinase ATM, Ataxia telangiectasia mutated Q13315 C10orf54 / VISTA chromosome 10 open reading frame 54 Q9H7M9 CCL5 C-C motif chemokine ligand 5 P13501 CD14 CD14 molecule P08571 CD163 CD163 molecule Q86VB7 CD274 / PDL1 Programmed cell death 1 ligand 1 CD274 Q9NZQ7 CD33 CD33 molecule P20138 CD40/TNR5 tumor necrosis factor receptor superfamily member 5 P25942 CD40/TNR5 tumor necrosis factor receptor superfamily member 5 P25942 CD47 CD47 molecule Q08722 CD70 CD70 antigen P32970 CD74/HG2A CD74 molecule, major histocompatibility complex, class II invariant chain Q8SNA0 CEACAM8 carcinoembryonic antigen-related cell adhesion molecule 8 P31997 CX3CL1 C-X3-C motif chemokine ligand 1 P78423 CXCL10 C-X-C motif chemokine ligand 10 P02778 CXCL13 chemokine (C-X-C motif) ligand 13 O43927 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 Q86VV3 FAS/TNR6 Fas (TNF receptor superfamily, member 6) P25445 pY291 FAS/TNR6 Fas (TNF receptor superfamily, member 6) P25445 GAPDH Glyceraldehyde-3-phosphate dehydrogenase P04406 HAVCR2 hepatitis
    [Show full text]
  • Analysis of Trans Esnps Infers Regulatory Network Architecture
    Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2014 Anat Kreimer All rights reserved ABSTRACT Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer eSNPs are genetic variants associated with transcript expression levels. The characteristics of such variants highlight their importance and present a unique opportunity for studying gene regulation. eSNPs affect most genes and their cell type specificity can shed light on different processes that are activated in each cell. They can identify functional variants by connecting SNPs that are implicated in disease to a molecular mechanism. Examining eSNPs that are associated with distal genes can provide insights regarding the inference of regulatory networks but also presents challenges due to the high statistical burden of multiple testing. Such association studies allow: simultaneous investigation of many gene expression phenotypes without assuming any prior knowledge and identification of unknown regulators of gene expression while uncovering directionality. This thesis will focus on such distal eSNPs to map regulatory interactions between different loci and expose the architecture of the regulatory network defined by such interactions. We develop novel computational approaches and apply them to genetics-genomics data in human. We go beyond pairwise interactions to define network motifs, including regulatory modules and bi-fan structures, showing them to be prevalent in real data and exposing distinct attributes of such arrangements. We project eSNP associations onto a protein-protein interaction network to expose topological properties of eSNPs and their targets and highlight different modes of distal regulation.
    [Show full text]
  • Hypoxia-Induced Alpha-Globin Expression in Syncytiotrophoblasts Mimics the Pattern Observed in Preeclamptic Placentas
    International Journal of Molecular Sciences Article Hypoxia-Induced Alpha-Globin Expression in Syncytiotrophoblasts Mimics the Pattern Observed in Preeclamptic Placentas Zahra Masoumi 1,* , Lena Erlandsson 1, Eva Hansson 1, Mattias Magnusson 2, Eva Mezey 3 and Stefan R. Hansson 1,4 1 Department of Clinical Sciences Lund, Division of Obstetrics and Gynecology, Lund University, SE-22184 Lund, Sweden; [email protected] (L.E.); [email protected] (E.H.); [email protected] (S.R.H.) 2 Department of Molecular Medicine and Gene Therapy, Lund University, SE-22184 Lund, Sweden; [email protected] 3 Adult Stem Cell Section, National Institute of Dental and Craniofacial Research, National Institutes of Health, 9000 Rockville Pike, Bethesda, MD 20892, USA; [email protected] 4 Skåne University Hospital, SE-22184 Lund, Sweden * Correspondence: [email protected] Abstract: Preeclampsia (PE) is a pregnancy disorder associated with placental dysfunction and elevated fetal hemoglobin (HbF). Early in pregnancy the placenta harbors hematopoietic stem and progenitor cells (HSPCs) and is an extramedullary source of erythropoiesis. However, globin ex- pression is not unique to erythroid cells and can be triggered by hypoxia. To investigate the role of the placenta in increasing globin levels previously reported in PE, flow cytometry, histological and Citation: Masoumi, Z.; Erlandsson, immunostaining and in situ analyses were used on placenta samples and ex vivo explant cultures. L.; Hansson, E.; Magnusson, M.; Our results indicated that in PE pregnancies, placental HSPC homing and erythropoiesis were not Mezey, E.; Hansson, S.R. affected. Non-erythroid alpha-globin mRNA and protein, but not gamma-globin, were detected in Hypoxia-Induced Alpha-Globin Expression in Syncytiotrophoblasts syncytiotrophoblasts and stroma of PE placenta samples.
    [Show full text]
  • HOLOHAN-DISSERTATION-2015.Pdf (6.419Mb)
    IDENTIFYING, CHARACTERIZING AND INHIBITING THE TELOMERASE REGULATORY NETWORK APPROVED BY SUPERVISORY COMMITTEE Jerry Shay, PhD Woodring Wright, MD, PhD David Corey, PhD Rolf Brekken, PhD Melanie Cobb, PhD DEDICATION Dedicated to my parents, Mark and Tracy Holohan, as well as my siblings, Kelly Nudleman and Kyle Holohan for their support and encouragement. IDENTIFYING, CHARACTERIZING AND INHIBITING THE TELOMERASE REGULATORY NETWORK by BRODY CHRISTOPHER HOLOHAN DISSERTATION / THESIS Presented to the Faculty of the Graduate School of Biomedical Sciences The University of Texas Southwestern Medical Center at Dallas In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY The University of Texas Southwestern Medical Center at Dallas Dallas, Texas May, 2015 Copyright by Brody Christopher Holohan, 2015 All Rights Reserved ACKNOWLEDGEMENTS I would like the thank my mentors, Jerry Shay and Woodring Wright for their continuous support, advice and encouragement, as well as allowing me time and resources to pursue my ideas. They are a fantastic team, and I could not have asked for better mentors. I would also like to thank my lab-mates, particularly Dr. Andrew Ludlow, Dr. Yong Zhou, Dr. Tsung-Po Lai, Dr. Oliver Delgado, Dr. Wanil Kim, Dr. Guido Stadler, Kimberly Batten, Ryan Laranger and Neal Jones. I would also like to thank Kevin Kennon for administrative support. Without my collaborators much of this would have been impossible, so I would like to thank Dr. Tim De Meyer, Dr. Abraham Aviv, Dr. Fowzan Aklayura, Dr. Steve Hunt, Dr. Tim Spector, Dr. Massimo Mangino, Dr. Daphne Friedman and Dr. Daniel Eisenberg for their help, intellectual discussions and willingness to pursue challenenging ideas.
    [Show full text]
  • Regulates Cellular Telomerase Activity by Methylation of TERT Promoter
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 5), pp: 7977-7988 Research Paper Tianshengyuan-1 (TSY-1) regulates cellular Telomerase activity by methylation of TERT promoter Weibo Yu1, Xiaotian Qin2, Yusheng Jin1, Yawei Li2, Chintda Santiskulvong3, Victor Vu1, Gang Zeng4,5, Zuofeng Zhang6, Michelle Chow1, Jianyu Rao1,5 1Department of Pathology and Laboratory Medicine, David Geffen School of Medicine, University of California at Los Angeles, Los Angeles, CA, USA 2Beijing Boyuantaihe Biological Technology Co., Ltd., Beijing, China 3Genomics Core, Cedars-Sinai Medical Center, Los Angeles, CA, USA 4Department of Urology, David Geffen School of Medicine, University of California at Los Angeles, Los Angeles, CA, USA 5Jonsson Comprehensive Cancer Center, University of California at Los Angeles, Los Angeles, CA, USA 6Department of Epidemiology, School of Public Health, University of California at Los Angeles, Los Angeles, CA, USA Correspondence to: Jianyu Rao, email: [email protected] Keywords: TSY-1, hematopoietic cells, Telomerase, TERT, methylation Received: September 08, 2016 Accepted: November 24, 2016 Published: December 15, 2016 ABSTRACT Telomere and Telomerase have recently been explored as anti-aging and anti- cancer drug targets with only limited success. Previously we showed that the Chinese herbal medicine Tianshengyuan-1 (TSY-1), an agent used to treat bone marrow deficiency, has a profound effect on stimulating Telomerase activity in hematopoietic cells. Here, the mechanism of TSY-1 on cellular Telomerase activity was further investigated using HL60, a promyelocytic leukemia cell line, normal peripheral blood mononuclear cells, and CD34+ hematopoietic stem cells derived from umbilical cord blood. TSY-1 increases Telomerase activity in normal peripheral blood mononuclear cells and CD34+ hematopoietic stem cells with innately low Telomerase activity but decreases Telomerase activity in HL60 cells with high intrinsic Telomerase activity, both in a dose-response manner.
    [Show full text]
  • Ailanthone Inhibits Non-Small Cell Lung Cancer Cell Growth Through Repressing DNA Replication Via Downregulating RPA1
    FULL PAPER British Journal of Cancer (2017) 117, 1621–1630 | doi: 10.1038/bjc.2017.319 Keywords: ailanthone; non-small cell lung cancer; DNA replication; RPA1; Chinese medicine Ailanthone inhibits non-small cell lung cancer cell growth through repressing DNA replication via downregulating RPA1 Zhongya Ni1, Chao Yao1, Xiaowen Zhu1, Chenyuan Gong1, Zihang Xu2, Lixin Wang3, Suyun Li4, Chunpu Zou2 and Shiguo Zhu*,1,3 1Laboratory of Integrative Medicine, School of Basic Medical Sciences, Shanghai University of Traditional Chinese Medicine, 1200 Cai Lun Rd, Shanghai 201203, PR China; 2Department of Internal Classic of Medicine, School of Basic Medical Sciences, Shanghai University of Traditional Chinese Medicine, 1200 Cai Lun Rd, Shanghai 201203, PR China; 3Department of Immunology and Pathogenic Biology, School of Basic Medical Sciences, Shanghai University of Traditional Chinese Medicine, 1200 Cai Lun Rd, Shanghai 201203, PR China and 4Department of Pathology, School of Basic Medical Sciences, Shanghai University of Traditional Chinese Medicine, 1200 Cai Lun Rd, Shanghai 201203, PR China Background: The identification of bioactive compounds from Chinese medicine plays a crucial role in the development of novel reagents against non-small cell lung cancer (NSCLC). Methods: High throughput screening assay and analyses of cell growth, cell cycle, apoptosis, cDNA microarray, BrdU incorporation and gene expression were performed. Results: Ailanthone (Aila) suppressed NSCLC cell growth and colony formation in vitro and inhibited NSCLC tumour growth in subcutaneously xenografted and orthotopic lung tumour models, leading to prolonged survival of tumour-bearing mice. Moreover, Aila induced cell cycle arrest in a dose-independent manner but did not induce apoptosis in all NSCLC cells.
    [Show full text]
  • Unravelling the Cellular Origin and Clinical Prognostic Markers of Infant
    Published Ahead of Print on January 24, 2019, as doi:10.3324/haematol.2018.206375. Copyright 2019 Ferrata Storti Foundation. Unravelling the cellular origin and clinical prognostic markers of infant B-cell acute lymphoblastic leukemia using genome-wide analysis by Antonio Agraz-Doblas, Clara Bueno, Rachael Bashford-Rogers, Anindita Roy, Pauline Schneider, Michela Bardini, Paola Ballerini, Gianni Cazzaniga, Thaidy Moreno, Carlos Revilla, Marta Gut, Maria G Valsecchi, Irene Roberts, Rob Pieters, Paola De Lorenzo, Ignacio Varela, Pablo Menendez, and Ronald W Stam Haematologica 2019 [Epub ahead of print] Citation: Antonio Agraz-Doblas, Clara Bueno, Rachael Bashford-Rogers, Anindita Roy, Pauline Schneider, Michela Bardini, Paola Ballerini, Gianni Cazzaniga, Thaidy Moreno, Carlos Revilla, Marta Gut, Maria G Valsecchi, Irene Roberts, Rob Pieters, Paola De Lorenzo, Ignacio Varela, Pablo Menendez, and Ronald W Stam. Unravelling the cellular origin and clinical prognostic markers of infant B-cell acute lymphoblastic leukemia using genome-wide analysis Haematologica. 2019; 104:xxx doi:10.3324/haematol.2018.206375 Publisher's Disclaimer. E-publishing ahead of print is increasingly important for the rapid dissemination of science. Haematologica is, therefore, E-publishing PDF files of an early version of manuscripts that have completed a regular peer review and have been accepted for publication. E-publishing of this PDF file has been approved by the authors. After having E-published Ahead of Print, manuscripts will then undergo technical and English editing, typesetting, proof correction and be presented for the authors' final approval; the final version of the manuscript will then appear in print on a regular issue of the journal. All legal disclaimers that apply to the journal also pertain to this production process.
    [Show full text]
  • Transcriptional Signature of Accessory Cells in the Lateral Line, Using the Tnk1bp1:EGFP Transgenic Zebrafish Line Behra Et Al
    Transcriptional signature of accessory cells in the lateral line, using the Tnk1bp1:EGFP transgenic zebrafish line Behra et al. Behra et al. BMC Developmental Biology 2012, 12:6 http://www.biomedcentral.com/1471-213X/12/6 (24 January 2012) Behra et al. BMC Developmental Biology 2012, 12:6 http://www.biomedcentral.com/1471-213X/12/6 RESEARCHARTICLE Open Access Transcriptional signature of accessory cells in the lateral line, using the Tnk1bp1:EGFP transgenic zebrafish line Martine Behra1,3*, Viviana E Gallardo1, John Bradsher3, Aranza Torrado3, Abdel Elkahloun1, Jennifer Idol1, Jessica Sheehy1, Seth Zonies1, Lisha Xu1, Kenna M Shaw2,5, Chie Satou4, Shin-ichi Higashijima4, Brant M Weinstein2 and Shawn M Burgess1 Abstract Background: Because of the structural and molecular similarities between the two systems, the lateral line, a fish and amphibian specific sensory organ, has been widely used in zebrafish as a model to study the development/ biology of neuroepithelia of the inner ear. Both organs have hair cells, which are the mechanoreceptor cells, and supporting cells providing other functions to the epithelium. In most vertebrates (excluding mammals), supporting cells comprise a pool of progenitors that replace damaged or dead hair cells. However, the lack of regenerative capacity in mammals is the single leading cause for acquired hearing disorders in humans. Results: In an effort to understand the regenerative process of hair cells in fish, we characterized and cloned an egfp transgenic stable fish line that trapped tnks1bp1, a highly conserved gene that has been implicated in the maintenance of telomeres’ length. We then used this Tg(tnks1bp1:EGFP) line in a FACsorting strategy combined with microarrays to identify new molecular markers for supporting cells.
    [Show full text]
  • NBN Gene Analysis and It's Impact on Breast Cancer
    Journal of Medical Systems (2019) 43: 270 https://doi.org/10.1007/s10916-019-1328-z IMAGE & SIGNAL PROCESSING NBN Gene Analysis and it’s Impact on Breast Cancer P. Nithya1 & A. ChandraSekar1 Received: 8 March 2019 /Accepted: 7 May 2019 /Published online: 5 July 2019 # Springer Science+Business Media, LLC, part of Springer Nature 2019 Abstract Single Nucleotide Polymorphism (SNP) researches have become essential in finding out the congenital relationship of structural deviations with quantitative traits, heritable diseases and physical responsiveness to different medicines. NBN is a protein coding gene (Breast Cancer); Nibrin is used to fix and rebuild the body from damages caused because of strand breaks (both singular and double) associated with protein nibrin. NBN gene was retrieved from dbSNP/NCBI database and investigated using computational SNP analysis tools. The encrypted region in SNPs (exonal SNPs) were analyzed using software tools, SIFT, Provean, Polyphen, INPS, SNAP and Phd-SNP. The 3’ends of SNPs in un-translated region were also investigated to determine the impact of binding. The association of NBN gene polymorphism leads to several diseases was studied. Four SNPs were predicted to be highly damaged in coding regions which are responsible for the diseases such as, Aplastic Anemia, Nijmegan breakage syndrome, Microsephaly normal intelligence, immune deficiency and hereditary cancer predisposing syndrome (clivar). The present study will be helpful in finding the suitable drugs in future for various diseases especially for breast cancer. Keywords NBN . Single nucleotide polymorphism . Double strand breaks . nsSNP . Associated diseases Introduction NBN has a more complex structure due to its interaction with large proteins formed from the ATM gene which is NBN (Nibrin) is a protein coding gene, it is also known as highly essential in identifying damaged strands of DNA NBS1, Cell cycle regulatory Protein P95, is situated on and facilitating their repair [1].
    [Show full text]
  • Supplementary Table S1. Prioritization of Candidate FPC Susceptibility Genes by Private Heterozygous Ptvs
    Supplementary Table S1. Prioritization of candidate FPC susceptibility genes by private heterozygous PTVs Number of private Number of private Number FPC patient heterozygous PTVs in heterozygous PTVs in tumors with somatic FPC susceptibility Hereditary cancer Hereditary Gene FPC kindred BCCS samples mutation DNA repair gene Cancer driver gene gene gene pancreatitis gene ATM 19 1 - Yes Yes Yes Yes - SSPO 12 8 1 - - - - - DNAH14 10 3 - - - - - - CD36 9 3 - - - - - - TET2 9 1 - - Yes - - - MUC16 8 14 - - - - - - DNHD1 7 4 1 - - - - - DNMT3A 7 1 - - Yes - - - PKHD1L1 7 9 - - - - - - DNAH3 6 5 - - - - - - MYH7B 6 1 - - - - - - PKD1L2 6 6 - - - - - - POLN 6 2 - Yes - - - - POLQ 6 7 - Yes - - - - RP1L1 6 6 - - - - - - TTN 6 5 4 - - - - - WDR87 6 7 - - - - - - ABCA13 5 3 1 - - - - - ASXL1 5 1 - - Yes - - - BBS10 5 0 - - - - - - BRCA2 5 6 1 Yes Yes Yes Yes - CENPJ 5 1 - - - - - - CEP290 5 5 - - - - - - CYP3A5 5 2 - - - - - - DNAH12 5 6 - - - - - - DNAH6 5 1 1 - - - - - EPPK1 5 4 - - - - - - ESYT3 5 1 - - - - - - FRAS1 5 4 - - - - - - HGC6.3 5 0 - - - - - - IGFN1 5 5 - - - - - - KCP 5 4 - - - - - - LRRC43 5 0 - - - - - - MCTP2 5 1 - - - - - - MPO 5 1 - - - - - - MUC4 5 5 - - - - - - OBSCN 5 8 2 - - - - - PALB2 5 0 - Yes - Yes Yes - SLCO1B3 5 2 - - - - - - SYT15 5 3 - - - - - - XIRP2 5 3 1 - - - - - ZNF266 5 2 - - - - - - ZNF530 5 1 - - - - - - ACACB 4 1 1 - - - - - ALS2CL 4 2 - - - - - - AMER3 4 0 2 - - - - - ANKRD35 4 4 - - - - - - ATP10B 4 1 - - - - - - ATP8B3 4 6 - - - - - - C10orf95 4 0 - - - - - - C2orf88 4 0 - - - - - - C5orf42 4 2 - - - -
    [Show full text]
  • Download Validation Data
    PrimePCR™Assay Validation Report Gene Information Gene Name FAST kinase domain-containing protein 1 Gene Symbol Fastkd1 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. NM_001191738 UniGene ID Rn.226110 Ensembl Gene ID ENSRNOG00000024335 Entrez Gene ID 311112 Assay Information Unique Assay ID qRnoCEP0034063 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000036585 Amplicon Context Sequence AAAAAAAAAAACTACAGTCATGATCTGCCTGCTCCAAATATCTGTTCTCTCAGGTA GTCCATCCGTGTATCCTTCGTTGACATTGCCATGGAGTTCCA Amplicon Length (bp) 68 Chromosome Location 3:62537455-62537552 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 97 R2 0.9997 cDNA Cq 23.19 cDNA Tm (Celsius) 79 gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Fastkd1, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org.
    [Show full text]