DOCSLIB.ORG

Synthesis of UMI ( 8 Bases )

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Synthesis of UMI ( 8 Bases ) TAN TANTA CU O USLA 20180030515A1DA MATA MATA MALTA MARTINI ( 19) United States (12 ) Patent Application Publication (10 ) Pub. No. : US 2018/ 0030515 A1 Regev et al. (43 ) Pub . Date : Feb . 1 . 2018 ( 54 ) DROPLET -BASED METHOD AND Related U . S . Application Data APPARATUS FOR COMPOSITE (63 ) Continuation - in -part of application No . PCT/ SINGLE - CELL NUCLEIC ACID ANALYSIS US2015 / 049178 , filed on Sep . 9 , 2015 . ( 71) Applicants : The Broad Institute Inc ., Cambridge, (60 ) Provisional application No . 62 /048 ,227 , filed on Sep . MA (US ) ; Massachusetts Institute of 9 , 2014 , provisional application No. 62 / 146 ,642 , filed Technology , Cambridge , MA (US ) ; on Apr. 13 , 2015 . President and Fellows of Harvard College, Cambridge, MA (US ) Publication Classification (51 ) Int . CI. (72 ) Inventors : Aviv Regev , Cambridge, MA (US ) ; C120 1 /68 (2006 .01 ) Evan Zane MACOSKO , Cambridge , GO6K 19 / 06 ( 2006 . 01 ) MA (US ) ; Steven Andrew ( 2006 .01 ) MCCARROLL , Cambridge , MA (US ) ; C12N 15 / 10 Alexander K . SHALEK , Cambridge, (52 ) U . S . CI. MA (US ) ; Anindita BASU , Cambridge , CPC .. .. C12Q 1/ 6809 ( 2013. 01 ) ; C12N 15 / 1096 MA (US ) ; Christopher B . FORD , (2013 . 01 ) ; C12Q 1 /6869 ( 2013 .01 ) ; C12Q Cambridge, MA (US ) ; Hongkun 1 /6834 ( 2013. 01 ) ; G06K 19 / 06 ( 2013. 01 ) PARK , Lexington , MA (US ) ; David A . (57 ) ABSTRACT WEITZ , Bolton , MA (US ) The present invention generally relates to a combination of molecular barcoding and emulsion - based microfluidics to (21 ) Appl. No. : 15 / 453 ,405 isolate , lyse , barcode , and prepare nucleic acids from indi (22 ) Filed : Mar. 8 , 2017 vidual cells in a high - throughput manner . Synthesis of UMI ( 8 bases) 8 rounds of synthesis • Millions of the same cell barcode per bead • 48 differentmolecular barcodes (UMIS ) per bead Patent Application Publication Feb . 1 , 2018 Sheet 1 of 24 US 2018 / 0030515 A1 edo 90 FIG . 1 Patent Application Publication Feb . 1 , 2018 Sheet 2 of 24 US 2018 / 0030515 A1 SMTA CBC MBC 112 bp 8 bp FIG . 2A * W **** * * * *** * * * **** * * * * * * ??? ** *** ** * * * * * * * * *** * RR FIG . 2B Patent Application Publication Feb . 1, 2018 Sheet 3 of 24 US 2018/ 0030515 A1 * * * * * rrrrrrrr , ? ?istree ? … ? ?? … ? Patent Application Publication Feb . 1 , 2018 Sheet 4 of 24 US 2018 / 0030515 A1 * * ** * ** *** * * * . * * * .. * *. * * * .* * * . * * . * . * *. * * . .. .. .. * XXXS . .. 9 , - . WWW XXX X X X X ting .. .. .. Lar ;*. W401036WM3 *primero * * . * . * . * ** * * * * * * * * * * * * *. * . * . .* . .. " W " . *. .. .. .. DOC ost OTICIAS SO Cara SiccoleCROTECTION ammato.5 To C Togg Become P GeoG Patent Application Publication Feb . 1 , 2018 Sheet 5 of 24 US 2018 / 0030515 A1 H r . :. W Ova FIG . 4 Patent Application Publication Feb . 1, 2018 Sheet 6 of 24 US 2018/ 0030515 A1 . … … … Patent Application Publication Feb . 1 , 2018 Sheet 7 of 24 US 2018 / 0030515 A1 x . WS3 . 9owBogue0100WIN WO Www Big B e .. .. .. .. * * * * ** * * ** * . .. .. .. i wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww 0 2000 4000 6000 8000 90000 92000 Number of transcript HUMAN FIG 6 : Drop - Seq . Patent Application Publication Feb . 1, 2018 Sheet 8 of 24 US 2018/ 0030515 A1 FIG . 7A ? … … SS : : : 23 ?? SS : … … … … … www . FIG .7B FIG . 70 FIG . 7D Patent Application Publication Feb . 1 , 2018 Sheet 9 of 24 US 2018 / 0030515 A1 FB. 8A 4 : 29 Suscrow * Vook MAX 2 . 0008804 SHA 4 . * soos 7 . K UR * * YOxx Siap 8 x WWW * s * * * * * * * in Edm o do is STARE - 3 - 6 8 - 8 po - aid* • Eenso FIG . 8B Microfluidic device Gel Barcoded Bercutedocas Niers Sample sequencing road pašr Read 1 Read 2 Droplet Ceis Omation * * Ces UANL Gene identity Barcode FIG . 8C Car Breidevo un . ONA 50- Lp Markica ) * ** * * * ** * * * * * . V . O X * * 14cskco SEATS . SKCC6C & C socom . .cox 2Cell3 nowiorytare . .. : ; * . 2203X CTO Wiscovoro . : : : : : : : : : : WW W 57AGS : 01 . - . 0297776 ) oorwxxx . .. 10 ABR Cogni uoque mis 44444:: 2 . .. Pecenswer . cre DNA 28grsment to Accaccer : 75770: 302E2 SENE i 2 * * * * * * * * * genom and soup COTTA ! 40047. .. GONCA os sah gane 672NWAST . 273666 ! eus x re8 28 ngen al SENE 2 : 27 X X X Mi . .. 44 YAXW30 *30 ! roor. .Kocour innnnnnnnnnnn GENE 3 90 WOONK3 .. sace WMCW010014 . 1144CC COMC . - .. - . CAN Aww 1978 Cigole digital 030276015733XAVIE . : - ) WONGANCE . , x5: 5 . sexgroseros matrix : GENEX 2 COSTA cicer070 ! . 70YALST w a SOD . .. 3679 GoTELi s ax & Co WWWXX. GRO ! 11 . C ARTIQ . Celt 75WM X414 , . TV sinirini . ???? Ng8905 o mintyses 61 76005TE) ( kousqx09 3 Bis } FIG . 3D Patent Application Publicati0ll Feb . 1 , 2018 Sheet 10 Of 24 US 2018/ 0030515 Al FIG , 9A ? FIG . 9B ? FIG. 96 ??????? ? ? ? ? ? ? ? ? ? ?? ? ? ?? ?? ???? ? ????????? ? ? ? ? ?. .???? ? ? ? ? ? ? ? ? ? ? ? .- - - ???? 3 : : ? ? ? ? ? ? ? ? ? ? ? v????ww ? ? ? ? - ? ? ? ; -; ? ?- ?:.-' - ? ? ??????????????????????? ?????????????????????? . ????????? ? ? ? FIG . 9F FIG . 9F ??????????? ? ? ? ? ? ?? ? ? ? ? ? ? ? ? ? ? ? ? ? ? . - . " . ' ? ? ? ? ? ?????? ; . « ? ? ????? ? ???? ? ? ? ? ? ? ? ? ? ? ? ? ? ?? ? ?? ? ? ? ? ?? ? ? ? ? ? . ???? ? ? ?? .? .??? . .? .? .? ?? ? .? ?? - ? ? ? ? ? ? ? ? -????????????? ? ?? ? ? ? ?? ? ? ? ? ?? ? . ? ?????????????????? ???? .??? .??? ??. ? ?? ? ? ? ? ? ? ?? ? ? ? ? ? ? ? ? ? ? ? ? ? ??? ; ? ? ? ? ; ; ? - .. ?? . ? ? ? ? ? ? ? . ? .? -i' ? ? ? ? ????? *(. ?- ? ? ••••••• x-. ? ? ? ? ? ?? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ???? ? ? ? ? ? ? ? ? ? ? - - - - - - - ? ? ? ? ? ? ?? ? ? ? ? ??? ? ? ? - - - - - - - - - - - ???? - - . ? ? ? ? ?????????????????? . ' -' - '- ? ? . ? ???? ? ? ????? :: ? ? ? ? 4 ? ? ? ? ? ? ? ? ? ? FIG. 9D FIG . 9G Patent Application Publication Feb . 1, 2018 Sheet 11 of 24 US 2018/ 0030515 A1 FIG 10A ?????.? . …” . .… . FIG . 10B . ." ? | 3 FIG .10C " " " " " " " " " " " " " " " " " " " " neraterse ????????????????? 3 A : : Patent Application Publication Feb . 1 , 2018 Sheet 12 of 24 US 2018 / 0030515 A1 FIG . 11A FIG . 11B * WW * X XXX X :44 : : : : * * * * * * * * * 20 Rais . .XXX 3389. .. .. : sia ROX wwwwwwwwwwwww www SNS2 FIG . 11D Wix . - FIG . 110 4 * * * * * * * * * - * Li -4 : wo . -4 . .. -4 ???????????????. 4 - .. -4 li. KESK - . 4 - . 4 LucLULU - - WWWWWW* - * * XX * . * : -!* WY * se. .. is W - - - - - - - - - - - - - - - - - - - - - - - - - - - FIG . 11E WWWwwwww ** * * * * * * ** * * * ** * * * * * * * * FIG . 11F Patent Application Publication Feb . 1 , 2018 Sheet 13 of 24 US 2018/ 0030515 A1 FIG . 12A FIG . 12B ??? : ? : ???? ???? ? ?? ? ?? ??? ???? ????? ??? ??? . .* ????* ?? ?? ??? ??? ??? ?? ??? ????? ???? ?? : : * * * * * * * * ???? ???? ????? ? ?? ? ???????????????????? ? :- : :: : : : : : - : -: - :- : -: - : -: -: - : -: ????????? ??? ? ????? ?? ???? ????? . .. ??????????? ???? ???? ??? * * * * * * * ???? ?? ? ??? ? • :: ? ??????? = = = = = = ??? ? : : . .: : . .: : : . ???? : : ?????? ?? ???? ?? ?? ? -: : ?? ?? : ' ' ' ' ' ' ' ' ' ' ' ' ' ' ' ????? ?? ?? ?? ?????? ? .: ? :- : -: - : - : - : - :- ?? ? ??????? . ??? ???? . ??? ? = ??? ? ? ? ? ? ? - -- - - - - - - - - * :. ??????????????? ? ?????? . ?????? :. ???????????????????????????????????????????? : ????????? ???? : . ? . ? . ? . ?? = = = := := := := : . : ?? : . ????? ??????????? ?. ??????? ?????? ??? ?? ?????? ? .?????????????????? : :. , , ??? ??? . - - - - . ????? : . : . .. .. .? ? ?? ? ? ????? ??? ????? ?? ????? ?????????? ???? ???? ??? . :. : :. : ??? ????????? ????? ? ? ??? ?? ??? ?? ???? ?? ?? ?? ????? ???? ?? ?? ??? ??? ????? ???? ?? ????? ???? ??? ?? ? ??? ? FIG . 120 ? FIG . 12D * ?? ?? . ????? ? . * ????? ????????? ??? ????????????? * ?? ????????? ??????????? . ?????????????????????????? ????????????? ????????????????? *: ?????????????????????? ?????????.?? ????????????????? ??? ???.?. ??. ???????????????????????????? : .????.. ????????????? ???????????????? ???????????????? ??????????????????? ??? ???????? : ?????????.? : ????????????? ??? ??? ?? ????????????? ?? : ?????. ????? : ??????? : : . .. .. ?? . : FIG , 12E FIG . 126 ???? ?????? ?????????????????? ? . ?? ? ?? ? ?? ??? ?? ..| : ??? ????? ??? ??? ?????? ??? ? ??? ????? ??? . : : * . * . * . * . * ? ??? ?????? ??? ? ?? ?????? ???? ???? ??? :: : ?????? ?? ???? ?? ?? ???? ??? ???? ??? ?? :: F } G . 12H FIG . 12 : .* ?? FIG . 12F ? . ?. * ???????????????: :: . ?. ::: ..? * * * : ???????????????* ??: ????????????????????? ?. ? : ??? ?????? * : * : * : * * * : : : : ?? ?? .. .. .. .. .. .. .. ? : ?? ????? ??? ??? ???? ?????? ??? ????? ??? ???? ?? ???? ?? ??? ????? ??? ?? ???? ?? ??? ? - : ???? ? ?? ?? ?? ??? ? ??? ????? Patent Application Publication Feb . 1 , 2018 Sheet 14 of 24 US 2018 /0030515 A1 > ervinroloerythroid NK cellscells ?og§ 1SNEISNE1 OYO OYO B cells • B cells T cells granulocytergranulocyto - 60 * * monocyte SNE 2 FIG . 13A Patent Application Publication Feb . 1 , 2018 Sheet 15 of 24 US 2018 / 0030515 A1 MPO AETN L32 TRAQ $ 10049 LY MNDA VCAN S10048 PS4R CSAA1 S100412 KGLUT KBHW KGKO K9441pgE NKC7 GNCY KLAC1 DARI ROGA34 NUSARI TOP24 CA1 ADX2 AMSER BEVAS BA HBAT HOWGN 1 2 3 4 5 6 78 dusters Fig . 13B Patent Application Publication Feb . 1 , 2018 _ Sheet 16 of 24 US 2018/ 0030515 A1 OO ! ! ! ??????? ! - 5 ] 50 100 C079 Fig. 13 Patent Application Publication Feb . 1 , 2018 Sheet 17 of 24 US 2018/ 0030515 A1 FIG . 14A . FIG . 14B : : : : :: : ?? ??? ? ? ? ? ? ? ? ? .. .???? ???. ?????? .. .. .. .. .. .. : . ? ?? ? ??? ??? ??? . .??? .??? . ? ? . ?????????????? ??????? : ?????????? ?????? : ??????????????????????????????????? ??????? : ?????? : : ?????????? ??? ?? ?????????????????? : . -: :
Load more

Recommended publications
  • Supplementary Materials
    DEPs in osteosarcoma cells comparing to osteoblastic cells Biological Process Protein Percentage of Hits metabolic process (GO:0008152) 29.3 29.3% cellular process (GO:0009987) 20.2 20.2% localization (GO:0051179) 9.4 9.4% biological regulation (GO:0065007) 8 8.0% developmental process (GO:0032502) 7.8 7.8% response to stimulus (GO:0050896) 5.6 5.6% cellular component organization (GO:0071840) 5.6 5.6% multicellular organismal process (GO:0032501) 4.4 4.4% immune system process (GO:0002376) 4.2 4.2% biological adhesion (GO:0022610) 2.7 2.7% apoptotic process (GO:0006915) 1.6 1.6% reproduction (GO:0000003) 0.8 0.8% locomotion (GO:0040011) 0.4 0.4% cell killing (GO:0001906) 0.1 0.1% 100.1% Genes 2179Hits 3870 biological adhesion apoptotic process … reproduction (GO:0000003) , 0.8% (GO:0022610) , 2.7% locomotion (GO:0040011) ,… immune system process cell killing (GO:0001906) , 0.1% (GO:0002376) , 4.2% multicellular organismal process (GO:0032501) , metabolic process 4.4% (GO:0008152) , 29.3% cellular component organization (GO:0071840) , 5.6% response to stimulus (GO:0050896), 5.6% developmental process (GO:0032502) , 7.8% biological regulation (GO:0065007) , 8.0% cellular process (GO:0009987) , 20.2% localization (GO:0051179) , 9.
    [Show full text]
  • Supplemental Table 1 Enriched Genes in Cortical Astrocytes from Aged
    Supplemental Table 1 Enriched genes in cortical astrocytes from aged and young-adult mice * Genes were present in the astrocyte module from the WGCNA analysis, and contains astrocyte enriched genes compared to microglia and oligodendrocytes # = Fold change of aged astrocyte expression over the average expression of all analyzed samples (microglia, astrocytes: young, old, with and without myelin contamination) $ ; aged = genes only present in the aged astrocyte top 1000 list (used to compare with lists from Cahoy, Lovatt, Doyle; see Fig. 4B), all = genes present in all astrocyte top 1000 lists Gene Symbol* Aged astr. (log2) Young astr.(log2) FC (aged/ aver.)# Location Ptprz1 15.37 15.02 18.76 Plasma Membrane Slc7a10 14.49 14.44 18.28 Plasma Membrane Gjb6 15.13 14.42 18.18 Plasma Membrane Dclk1 14.63 14.28 17.18 unknown Hes5 15.69 15.55 16.94 Nucleus Fgfr3 15.27 14.46 16.54 Plasma Membrane Entpd2 13.85 13.56 15.92 Cytoplasm Grin2c 14.93 14.87 15.75 Plasma Membrane Slc1a2 15.51 15.39 15.58 Plasma Membrane Fjx1 14.36 13.98 14.52 Extracellular Space Slc6a1 14.20 14.16 14.47 Plasma Membrane Kcnk1 12.93 13.49 14.43 Plasma Membrane Ppap2b 16.16 16.10 14.37 Plasma Membrane Fam20a 14.48 14.72 14.00 Extracellular Space Dbx2 13.68 13.32 13.99 Nucleus Itih3 13.93 13.93 13.94 Extracellular Space Htra1 17.12 16.91 13.92 Extracellular Space Atp1a2 14.59 14.48 13.73 Plasma Membrane Scg3 15.71 15.72 13.68 Extracellular Space F3 15.59 15.08 13.51 Plasma Membrane Mmd2 14.22 14.60 13.50 unknown Nrcam 13.73 13.88 13.47 Plasma Membrane Cldn10a 13.37 13.57 13.46
    [Show full text]
  • Role of Mitochondrial Ribosomal Protein S18-2 in Cancerogenesis and in Regulation of Stemness and Differentiation
    From THE DEPARTMENT OF MICROBIOLOGY TUMOR AND CELL BIOLOGY (MTC) Karolinska Institutet, Stockholm, Sweden ROLE OF MITOCHONDRIAL RIBOSOMAL PROTEIN S18-2 IN CANCEROGENESIS AND IN REGULATION OF STEMNESS AND DIFFERENTIATION Muhammad Mushtaq Stockholm 2017 All previously published papers were reproduced with permission from the publisher. Published by Karolinska Institutet. Printed by E-Print AB 2017 © Muhammad Mushtaq, 2017 ISBN 978-91-7676-697-2 Role of Mitochondrial Ribosomal Protein S18-2 in Cancerogenesis and in Regulation of Stemness and Differentiation THESIS FOR DOCTORAL DEGREE (Ph.D.) By Muhammad Mushtaq Principal Supervisor: Faculty Opponent: Associate Professor Elena Kashuba Professor Pramod Kumar Srivastava Karolinska Institutet University of Connecticut Department of Microbiology Tumor and Cell Center for Immunotherapy of Cancer and Biology (MTC) Infectious Diseases Co-supervisor(s): Examination Board: Professor Sonia Lain Professor Ola Söderberg Karolinska Institutet Uppsala University Department of Microbiology Tumor and Cell Department of Immunology, Genetics and Biology (MTC) Pathology (IGP) Professor George Klein Professor Boris Zhivotovsky Karolinska Institutet Karolinska Institutet Department of Microbiology Tumor and Cell Institute of Environmental Medicine (IMM) Biology (MTC) Professor Lars-Gunnar Larsson Karolinska Institutet Department of Microbiology Tumor and Cell Biology (MTC) Dedicated to my parents ABSTRACT Mitochondria carry their own ribosomes (mitoribosomes) for the translation of mRNA encoded by mitochondrial DNA. The architecture of mitoribosomes is mainly composed of mitochondrial ribosomal proteins (MRPs), which are encoded by nuclear genomic DNA. Emerging experimental evidences reveal that several MRPs are multifunctional and they exhibit important extra-mitochondrial functions, such as involvement in apoptosis, protein biosynthesis and signal transduction. Dysregulations of the MRPs are associated with severe pathological conditions, including cancer.
    [Show full text]
  • Nuclear Organization and the Epigenetic Landscape of the Mus Musculus X-Chromosome Alicia Liu University of Connecticut - Storrs, [email protected]
    University of Connecticut OpenCommons@UConn Doctoral Dissertations University of Connecticut Graduate School 8-9-2019 Nuclear Organization and the Epigenetic Landscape of the Mus musculus X-Chromosome Alicia Liu University of Connecticut - Storrs, [email protected] Follow this and additional works at: https://opencommons.uconn.edu/dissertations Recommended Citation Liu, Alicia, "Nuclear Organization and the Epigenetic Landscape of the Mus musculus X-Chromosome" (2019). Doctoral Dissertations. 2273. https://opencommons.uconn.edu/dissertations/2273 Nuclear Organization and the Epigenetic Landscape of the Mus musculus X-Chromosome Alicia J. Liu, Ph.D. University of Connecticut, 2019 ABSTRACT X-linked imprinted genes have been hypothesized to contribute parent-of-origin influences on social cognition. A cluster of imprinted genes Xlr3b, Xlr4b, and Xlr4c, implicated in cognitive defects, are maternally expressed and paternally silent in the murine brain. These genes defy classic mechanisms of autosomal imprinting, suggesting a novel method of imprinted gene regulation. Using Xlr3b and Xlr4c as bait, this study uses 4C-Seq on neonatal whole brain of a 39,XO mouse model, to provide the first in-depth analysis of chromatin dynamics surrounding an imprinted locus on the X-chromosome. Significant differences in long-range contacts exist be- tween XM and XP monosomic samples. In addition, XM interaction profiles contact a greater number of genes linked to cognitive impairment, abnormality of the nervous system, and abnormality of higher mental function. This is not a pattern that is unique to the imprinted Xlr3/4 locus. Additional Alicia J. Liu - University of Connecticut - 2019 4C-Seq experiments show that other genes on the X-chromosome, implicated in intellectual disability and/or ASD, also produce more maternal contacts to other X-linked genes linked to cognitive impairment.
    [Show full text]
  • Environmental Influences on Endothelial Gene Expression
    ENDOTHELIAL CELL GENE EXPRESSION John Matthew Jeff Herbert Supervisors: Prof. Roy Bicknell and Dr. Victoria Heath PhD thesis University of Birmingham August 2012 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT Tumour angiogenesis is a vital process in the pathology of tumour development and metastasis. Targeting markers of tumour endothelium provide a means of targeted destruction of a tumours oxygen and nutrient supply via destruction of tumour vasculature, which in turn ultimately leads to beneficial consequences to patients. Although current anti -angiogenic and vascular targeting strategies help patients, more potently in combination with chemo therapy, there is still a need for more tumour endothelial marker discoveries as current treatments have cardiovascular and other side effects. For the first time, the analyses of in-vivo biotinylation of an embryonic system is performed to obtain putative vascular targets. Also for the first time, deep sequencing is applied to freshly isolated tumour and normal endothelial cells from lung, colon and bladder tissues for the identification of pan-vascular-targets. Integration of the proteomic, deep sequencing, public cDNA libraries and microarrays, delivers 5,892 putative vascular targets to the science community.
    [Show full text]
  • Unravelling the Cellular Origin and Clinical Prognostic Markers of Infant
    Published Ahead of Print on January 24, 2019, as doi:10.3324/haematol.2018.206375. Copyright 2019 Ferrata Storti Foundation. Unravelling the cellular origin and clinical prognostic markers of infant B-cell acute lymphoblastic leukemia using genome-wide analysis by Antonio Agraz-Doblas, Clara Bueno, Rachael Bashford-Rogers, Anindita Roy, Pauline Schneider, Michela Bardini, Paola Ballerini, Gianni Cazzaniga, Thaidy Moreno, Carlos Revilla, Marta Gut, Maria G Valsecchi, Irene Roberts, Rob Pieters, Paola De Lorenzo, Ignacio Varela, Pablo Menendez, and Ronald W Stam Haematologica 2019 [Epub ahead of print] Citation: Antonio Agraz-Doblas, Clara Bueno, Rachael Bashford-Rogers, Anindita Roy, Pauline Schneider, Michela Bardini, Paola Ballerini, Gianni Cazzaniga, Thaidy Moreno, Carlos Revilla, Marta Gut, Maria G Valsecchi, Irene Roberts, Rob Pieters, Paola De Lorenzo, Ignacio Varela, Pablo Menendez, and Ronald W Stam. Unravelling the cellular origin and clinical prognostic markers of infant B-cell acute lymphoblastic leukemia using genome-wide analysis Haematologica. 2019; 104:xxx doi:10.3324/haematol.2018.206375 Publisher's Disclaimer. E-publishing ahead of print is increasingly important for the rapid dissemination of science. Haematologica is, therefore, E-publishing PDF files of an early version of manuscripts that have completed a regular peer review and have been accepted for publication. E-publishing of this PDF file has been approved by the authors. After having E-published Ahead of Print, manuscripts will then undergo technical and English editing, typesetting, proof correction and be presented for the authors' final approval; the final version of the manuscript will then appear in print on a regular issue of the journal. All legal disclaimers that apply to the journal also pertain to this production process.
    [Show full text]
  • Protein Interaction Networks and Their Applications to Protein Characterization and Cancer Genes Prediction
    Ramón Aragüés Peleato Protein interaction networks and their applications to protein characterization and cancer genes prediction PhD Thesis Barcelona, May 2007 1 The image of the cover shows the happiness protein interaction network (i.e. the protein interaction network for proteins involved in the serotonin pathway) ii Protein Interaction Networks and their Applications to Protein Characterization and Cancer Genes Prediction Ramón Aragüés Peleato Memòria presentada per optar al grau de Doctor en Biologia per la Universitat Pompeu Fabra. Aquesta Tesi Doctoral ha estat realitzada sota la direcció del Dr. Baldo Oliva al Departament de Ciències Experimentals i de la Salut de la Universitat Pompeu Fabra Baldo Oliva Miguel Ramón Aragüés Peleato Barcelona, Maig 2007 The research in this thesis has been carried out at the Structural Bioinformatics Lab (SBI) within the Grup de Recerca en Informàtica Biomèdica at the Parc de Recerca Biomèdica de Barcelona (PRBB). The research carried out in this thesis has been supported by a “Formación de Personal Investigador (FPI)” grant from the Ministerio de Educación y Ciencia awarded to Dr. Baldo Oliva. A mis padres, que me hicieron querer conseguirlo A Natalia, que me ayudó a conseguir hacerlo ii TABLE OF CONTENTS TABLE OF CONTENTS................................................................................................................................... I ACKNOWLEDGEMENTS...........................................................................................................................
    [Show full text]
  • Watsonjn2018.Pdf (1.780Mb)
    UNIVERSITY OF CENTRAL OKLAHOMA Edmond, Oklahoma Department of Biology Investigating Differential Gene Expression in vivo of Cardiac Birth Defects in an Avian Model of Maternal Phenylketonuria A THESIS SUBMITTED TO THE GRADUATE FACULTY In partial fulfillment of the requirements For the degree of MASTER OF SCIENCE IN BIOLOGY By Jamie N. Watson Edmond, OK June 5, 2018 J. Watson/Dr. Nikki Seagraves ii J. Watson/Dr. Nikki Seagraves Acknowledgements It is difficult to articulate the amount of gratitude I have for the support and encouragement I have received throughout my master’s thesis. Many people have added value and support to my life during this time. I am thankful for the education, experience, and friendships I have gained at the University of Central Oklahoma. First, I would like to thank Dr. Nikki Seagraves for her mentorship and friendship. I lucked out when I met her. I have enjoyed working on this project and I am very thankful for her support. I would like thank Thomas Crane for his support and patience throughout my master’s degree. I would like to thank Dr. Shannon Conley for her continued mentorship and support. I would like to thank Liz Bullen and Dr. Eric Howard for their training and help on this project. I would like to thank Kristy Meyer for her friendship and help throughout graduate school. I would like to thank my committee members Dr. Robert Brennan and Dr. Lilian Chooback for their advisement on this project. Also, I would like to thank the biology faculty and staff. I would like to thank the Seagraves lab members: Jailene Canales, Kayley Pate, Mckayla Muse, Grace Thetford, Kody Harvey, Jordan Guffey, and Kayle Patatanian for their hard work and support.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Download Validation Data
    PrimePCR™Assay Validation Report Gene Information Gene Name FAST kinase domain-containing protein 1 Gene Symbol Fastkd1 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. NM_001191738 UniGene ID Rn.226110 Ensembl Gene ID ENSRNOG00000024335 Entrez Gene ID 311112 Assay Information Unique Assay ID qRnoCEP0034063 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000036585 Amplicon Context Sequence AAAAAAAAAAACTACAGTCATGATCTGCCTGCTCCAAATATCTGTTCTCTCAGGTA GTCCATCCGTGTATCCTTCGTTGACATTGCCATGGAGTTCCA Amplicon Length (bp) 68 Chromosome Location 3:62537455-62537552 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 97 R2 0.9997 cDNA Cq 23.19 cDNA Tm (Celsius) 79 gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Fastkd1, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org.
    [Show full text]
  • WO 2015/065964 Al 7 May 2015 (07.05.2015) W P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2015/065964 Al 7 May 2015 (07.05.2015) W P O P C T (51) International Patent Classification: (74) Agents: KOWALSKI, Thomas, J. et al; Vedder Price C12N 15/90 (2006.01) C12N 15/113 (2010.01) P.C., 1633 Broadway, New York, NY 1001 9 (US). C12N 15/10 (2006.01) C12N 15/63 (2006.01) (81) Designated States (unless otherwise indicated, for every (21) International Application Number: kind of national protection available): AE, AG, AL, AM, PCT/US2014/062558 AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, (22) International Filing Date: DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, 28 October 2014 (28.10.2014) HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, (25) Filing Language: English KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, (26) Publication Language: English PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, (30) Priority Data: SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 61/96 1,980 28 October 20 13 (28. 10.20 13) US TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. 61/963,643 9 December 2013 (09.
    [Show full text]
  • WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT (51) International Patent Classification: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, C12Q 1/68 (2018.01) A61P 31/18 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, C12Q 1/70 (2006.01) HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/US2018/056167 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (22) International Filing Date: SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 16 October 2018 (16. 10.2018) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, (30) Priority Data: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 62/573,025 16 October 2017 (16. 10.2017) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, ΓΕ , IS, IT, LT, LU, LV, (71) Applicant: MASSACHUSETTS INSTITUTE OF MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TECHNOLOGY [US/US]; 77 Massachusetts Avenue, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, Cambridge, Massachusetts 02139 (US).
    [Show full text]