Copyright Ó 2010 by the Genetics Society of America DOI: 10.1534/genetics.109.112086

Alternative Splicing Modulates Ubx Protein Function in Drosophila melanogaster

Hilary C. Reed,* Tim Hoare,† Stefan Thomsen,‡ Thomas A. Weaver,† Robert A. H. White,† Michael Akam* and Claudio R. Alonso‡,1 *Department of Zoology, University of Cambridge, Cambridge CB2 3EJ, United Kingdom, †Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge CB2 3DY, United Kingdom and ‡School of Life Sciences, University of Sussex, Brighton BN1 9QG, United Kingdom Manuscript received November 13, 2009 Accepted for publication December 17, 2009

ABSTRACT The Drosophila Hox gene Ultrabithorax (Ubx) produces a family of protein isoforms through alternative splicing. Isoforms differ from one another by the presence of optional segments—encoded by individual exons—that modify the distance between the homeodomain and a cofactor-interaction module termed the ‘‘YPWM’’ motif. To investigate the functional implications of Ubx alternative splicing, here we analyze the in vivo effects of the individual Ubx isoforms on the activation of a natural Ubx molecular target, the decapentaplegic (dpp) gene, within the embryonic mesoderm. These experiments show that the Ubx isoforms differ in their abilities to activate dpp in mesodermal tissues during embryogenesis. Furthermore, using a Ubx mutant that reduces the full Ubx protein repertoire to just one single isoform, we obtain specific anomalies affecting the patterning of anterior abdominal muscles, demonstrating that Ubx isoforms are not functionally interchangeable during embryonic mesoderm development. Finally, a series of experiments in vitro reveals that Ubx isoforms also vary in their capacity to bind DNA in presence of the cofactor Extradenticle (Exd). Altogether, our results indicate that the structural changes produced by alternative splicing have functional implications for Ubx protein function in vivo and in vitro. Since other Hox genes also produce splicing isoforms affecting similar protein domains, we suggest that alternative splicing may represent an underestimated regulatory system modulating Hox gene specificity during fly development.

OX genes are key genetic elements for the de- mechanisms underlying their specificity of action within H velopment of most animals. They encode a family developmental units, such as the individual segments of transcriptional regulators that trigger different in the insects. The problem could be stated as follows: developmental programs at specific coordinates along given that from very early in development all cells within the antero-posterior body axis of animals (McGinnis each segment are allocated a unique Hox ‘‘code’’(Lewis and Krumlauf 1992; Alonso 2002; Pearson et al. 1978), all the morphogenetic complexity internal to the 2005). In addition to their crucial developmental roles, segment must be derived from a relatively simple Hox the biological relevance of Hox genes is further em- input, leading to the question of how Hox activities phasized by the fact that changes in the expression and could be subspecified at the cellular level during the function of Hox genes are associated with the emer- progressive development of segments. Combinatorial gence of new structures during animal evolution, control by different Hox genes acting on overlapping suggesting that genetic variation affecting Hox gene target tissues may be one of the mechanisms used to activity may have been causal to the generation of increase regulatory complexity (Struhl 1982); how- morphological diversity (Lewis 1978; Holland and ever, in many cases Hox gene products were shown Garcia-Fernandez 1996; Carroll et al. 2001; Galant to compete with each other to take control of a devel- and Carroll 2002; Hughes and Kaufman 2002; oping segment (Gonzalez-Reyes and Morata 1990; Ronshaugen et al. 2002; Pearson et al. 2005). Gonzalez-Reyes et al. 1990; Lamka et al. 1992; Akam In spite of their generality and importance for animal 1998), arguing for the existence of other mechanisms development and evolution, many aspects of Hox gene for Hox specificity. Cell-specific ‘‘cofactors’’ able to mod- function remain unclear. One of them concerns the ulate Hox transcriptional functions in individual cells could also provide an important contribution to the specificity of Hox genes (Mann 1995; Mann and Chan Supporting information is available online at http://www.genetics.org/ 1996). Nonetheless, to date, only a very limited number cgi/content/full/genetics.109.112086/DC1. of Hox cofactors have been identified, making it 1Corresponding author: John Maynard Smith Bldg., School of Life Sciences, University of Sussex, Brighton BN1 9QG, United Kingdom. difficult to explain how complex morphogenetic path- E-mail: [email protected] ways, which rely on the orchestrated behavior of

Genetics 184: 745–758 (March 2010) 746 H. C. Reed et al. thousands of cells, could be obtained from such a products with variation in the architecture of the linker simple Hox/cofactor molecular code. Also, the intricate region, the protein segment that separates the homeo- cis-regulatory regions controlling Hox gene transcrip- domain from the hexapeptide motif. Nonetheless, the tional patterns as well as the existence of microRNA- functional effects that splicing may have on the modu- dependent regulatory mechanisms could also contribute lation of Hox gene function have only been partly ex- to Hox gene specificity during development. Alternative plored (Alonso and Wilkins 2005). Ubx is expressed splicing, a mechanism able to generate different mRNAs in a specific region along the antero-posterior axis of from a single gene (Smith and Valcarcel 2000; Matlin the Drosophila body: the posterior thorax and anterior et al. 2005; Wang and Burge 2008), may also play an abdomen (principally parasegments 5 and 6), where it important role, and here we use the Drosophila Hox gene determines segment-specific characteristics of many Ultrabithorax (Ubx) to study to what extent alternative different cell lineages, including epidermis, central splicing contributes to the diversification of Ubx function and peripheral nervous system, and mesodermal tissues during Drosophila development. (Morata and Kerridge 1981; Struhl 1984; Akam and Proteins encoded by all Hox genes share a common Martinez-Arias 1985; Akam et al. 1985; Beachy et al. DNA-binding unit, the homeodomain (McGinnis et al. 1985; White and Wilcox 1985). Ubx splicing isoforms 1984a,b; Scott and Weiner 1984), comprising three differ from one another by the presence or absence of a-helices, with helices 2 and 3 forming a helix-turn-helix three short optional peptides (9–17 residues) encoded motif (Chan and Mann 1993; Branden and Tooze by small exons (termed b, M1, and M2 modules) that 1999). Interestingly, outside this conserved domain, separate the Ubx 59 exon (encoding the hexapeptide) Hox proteins of different classes show little obvious from the 39 exon, which encodes the homeodomain similarity, other than a few conserved modules. One of (Figure 1) (O’Connor et al. 1988; Kornfeld et al. 1989). these modules is a cofactor-interaction motif termed the Ubx isoforms are generated by a mechanism of resplic- ‘‘YPWM’’ or ‘‘hexapeptide’’ motif (Chang et al. 1995; ing (Hatton et al. 1998) that is affected by the rate at Johnson et al. 1995). Although during development which Ubx transcripts are elongated by RNA pol II (de la Hox proteins are likely to function in concert with suites Mata et al. 2003); the factors involved in Ubx splicing of auxiliary factors (see Gebelein et al. 2004), so far the include the products of the Drosophila genes virilizer, Hox cofactors studied most extensively are the Pbc fl(2)d, and crooked neck (Burnette et al. 1999). Immu- family of transcription factors. This family includes the nohistochemical staining demonstrates that each iso- Drosophila protein Extradenticle (Exd) and its verte- form has a specific spatiotemporal pattern of expression brate (i.e., Pbx) and nematode (i.e., Ceh-20) relatives (Lopez and Hogness 1991). There is also some in- (Flegel et al. 1993; Rauskolb et al. 1993; Chang et al. dication that the phosphorylation pattern of the iso- 1995; Popperl et al. 1995; Liu and Fire 2000). These are forms may be distinct and developmentally regulated members of the three-amino-acid loop extension (TALE) (Lopez and Hogness 1991). class of homeodomain proteins. Crystallographic and To what extent the different isoforms have different NMR studies demonstrate that Exd/Pbx proteins offer a biological functions remains unclear. One study, which hydrophobic pocket where the Hox hexapeptide is focuses on a Ubx mutation (UbxMXI7) that blocks forma- inserted, providing a fine example of ‘‘lock and key’’ tion of several isoforms, concluded that the different binding (Passner et al. 1999; Sprules et al. 2003). The isoforms are of little biological significance (Busturia affinity of Hox proteins for certain DNA targets is et al. 1990). However, further investigation of the UbxMXI7 modulated through cooperative interactions with Pbc phenotype combined with studies using heat-shock proteins (Chan et al. 1994; van Dijk and Murre 1994). ectopic expression have reported that isoforms have Many examples indicate that cofactor interactions in- unique functions in defining tissue differentiation and crease the specificity of function of Hox proteins (Mann therefore are not interchangeable (Mann and Hogness and Chan 1996; Graba et al. 1997; Mann and Affolter 1990; Subramaniam et al. 1994). A comparative study 1998). The subcellular location of Exd—whether nuclear provides further evidence suggesting that the isoforms or cytoplasmic—is controlled by specific interactions are functionally distinct: Bomze and Lopez (1994) with another protein, Homothorax (Hth) (Aspland showed that the pattern of optional exon use and the and White 1997; Rieckhof et al. 1997; Pai et al. 1998; differential expression of the isoforms in different tissues Abu-Shaar et al. 1999), which also has vertebrate are similar in Drosophila species that diverged at least 60 counterparts (the Meis or Prep proteins) (Mercader million years ago. In spite of this, and perhaps due to the et al. 1999). Hth has been shown to bind DNA in a contradictions between these latter studies and the complex with Exd and Hox partners and is believed to be earlier work, most recent studies have assumed that another factor refining Hox specificity toward particular alternative splicing is not significant to Ubx function: targets (Mann and Affolter 1998; Ryoo and Mann when testing the participation of Ubx in a given de- 1999; Ryoo et al. 1999; Van Auken et al. 2002). velopmental process, the current standard practice is to In Drosophila melanogaster, alternative splicing controls ignore the effects of alternative splicing altogether and the expression of several Hox genes generating protein test only one of the Ubx alternative splicing isoforms. Hox Alternative Splicing 747

Figure 1.—Alternative spliced modules in Dro- sophila Hox proteins. For the four proteins Ultrabi- thorax (Ubx), Antennape- dia (Antp), Proboscipedia (Pb), and Labial (Lab), dif- ferential splicing modifies the structure of the linker region (red) that separates the DNA-binding module (green) from the hexapep- tide, an Exd interaction motif (purple). The inset details the protein isoforms generated from the Ubx gene through the inclu- sion/exclusion of alterna- tive exons, i.e., the ‘‘b’’ element (b) and microex- ons 1 (M1) and 2 (M2) that separate the hexapeptide (Hx) from the homeodomain (HD). Each isoform has a specific pattern of expression that is conserved across evolutionarily distant Drosophila species (Bomze and Lopez 1994). The diagram is approximately to scale, but in the inset, the size of the microexons is exaggerated.

Here we reexamine the problem of the functional spec- expression in all mesodermal cells from stage 9 to 12, and 24B- ificity of Ubx proteins. First, by using the UAS/Gal-4 Gal4 initiates expression in cardiac and somatic mesoderm at mediated induction technique (Brand and Perrimon stage 10/11 and continues from that point onward through- out development (Liu et al. 2008a)], dpp674LacZ (Capovilla 1993), we look at the ability of the isoforms to activate a et al. 1994), and UbxMX17/TM6 (Busturia et al. 1990), which natural Ubx molecular target, the decapentaplegic gene was a kind gift from Gines Morata. (dpp)(Capovilla et al. 1994), in a specific tissue: the Manipulation of fly embryos, RNA in situ hybridizations, embryonic mesoderm. Second, using the UbxMXI7 mu- and immunostainings: All fly stocks were cultured at 25°. tant, in which the full spectrum of splicing isoforms is Embryo collections were carried out on apple juice plates supplemented with fresh live yeast. For immunodetection, reduced to one single Ubx protein (produced within embryos were fixed/devitellinized in a heptane/formalde- the normal developmental expression domain of Ubx hyde mix following standard protocols. Ubx protein was and at endogenous levels), we observe anomalies in the detected using the FP3.38, anti-Ubx antibody. Expression of patterning of anterior abdominal muscles. Third, we lacZ reporter constructs was detected by commercial anti-b test the performance of Ubx proteins in in vitro DNA- galactosidase antibody (Molecular Probes, Eugene, OR). Enzymatic activity from secondary antibodies was visualized binding experiments using a Ubx–Exd composite DNA using a Vectastain Elite ABC Kit following manufacturer’s target element. Our results show that alternative splic- instructions (Vector Laboratories, Burlingame, CA). Connec- ing modulates Ubx specificity and function in vivo and tin immunolabeling was performed as in Meadows et al. alters basic Ubx biochemical properties in vitro. On the (1994). In situ hybridization for dpp was perfomed following autz feifle basis of these findings we discuss the role of alternative the protocol of T and P (1989), using pNB- 40.decapentaplegic as template (a gift from Robert Ray, origi- splicing as a post-transcriptional regulatory process nally subcloned by Nick Brown), which includes a 3.5-kb dpp affecting Hox gene function during fly development. fragment; in situs for slouch were performed as in Gould and White (1992), using S59 cDNA as template [kindly provided by Manfred Frasch (Dohrmann et al. 1990)]. MATERIALS AND METHODS Protein expression and quantification: Ubx cDNAs were modified to encode wild-type and mutagenized full-length Genetic engineering and fly lines: Site-directed mutagene- Ubx isoforms Ia and IVa and subcloned in pGEM-T Easy. A sis was carried out by splicing by overlap extension (SOE) as pRSET plasmid (Invitrogen, Carlsbad, CA) carrying an Exd previously described (Higuchi et al. 1988). Starting DNA full-length wild-type cDNA was obtained from Simon Aspland. materials were kindly provided by S. Greig (pKSUbxIb) and Ubx and Exd proteins were prepared from T7 or SP6 pro- R. Weinzierl (PMR100 versions of Ubx isoforms Ia, IIa, IIb, IVa, moters, using the TnTcoupled in vitro transcription and trans- and IVb). Final PCR products were gel purified, cloned into lation system (Promega) in the presence of small amounts of the pGEM-Teasy cloning vector (Promega, Madison, WI), and [35S]methionine (Amersham, Piscataway, NJ). This weak label- subcloned into the pUAST vector (Brand and Perrimon 1993). ing approach provided a convenient and reliable strategy UAS-Ubx constructs were transformed into Drosophila em- for the quantification of each protein batch (see below). For bryos using standard P-element-mediated germline transfor- each isoform, 12% PAGE electrophoresis of labeled proteins mation techniques (Rubin and Spradling 1982; Spradling demonstrated the synthesis of a product of appropriate and Rubin 1982). Other fly stocks employed in this study have size (supporting information, Figure S4 A). Quantification been described previously: 24B-Gal4 (Brand and Perrimon of the 35S-labeled proteins was carried out in a PhosphorIm- 1993), twist-Gal4 (Greig and Akam 1993) [twi Gal4 drives ager Scanner Unit (BAS-2500), using Image Reader Software 748 H. C. Reed et al.

(Fujifilm). Signal values corresponding to each protein band and D. We defined 100% binding as the values of the UbxIVa were determined by profile scanning using Mac BAS image WT trendline at 1.5 protein units (i.e., the highest protein analysis software (Fujifilm). These values were transformed concentration point of UbxIVa WT in our experimental to comparable protein units by normalization for the number interval). All other values in Figure 6, B–D, were normalized of methionine residues present in each isoform. All protein to this calibration. samples were aliquoted and kept at À80° until use. Electrophoretic mobility shift assays: Single-strand oligo- nucleotides for a Hox-Exd composite element were commer- cially synthesized (Sigma Genosys). Sequences for each strand RESULTS were Hox-Exd/A 59 TTAGCGATGATTTATTGCCTCCTT 39 and Hox-Exd/B 59 TTAAGGAGGCAATAAATCATCGCT 39. Function of Ubx proteins in vivo: Reading Ubx outputs Oligonucleotides were resuspended in distilled water,annealed, modulated by alternative splicing in ectopic expression ex- and labeled with the Klenow fragment of DNA pol I (New periments: To test the function of Ubx proteins in vivo,we England Biolabs, Beverly, MA) and [a-32P]dATP (6000 Ci/mmol) engineered P-element constructs with Ubx coding se- (from Amersham). Labeled oligos were purified from un- quences placed under the control of the yeast UAS incorporated nucleotides using molecular filtration columns (Microspin G-25 columns; Pharmacia, Piscataway, NJ). Proteins promoter. The resulting transgenes were therefore used in binding experiments were labeled at very low specific inducible by the yeast transcriptional activator Gal-4 activity, quantified as explained above, and used in DNA- (Brand and Perrimon 1993). binding experiments. Control experiments with unlabeled To corroborate that each line was able to produce 35 DNA probes demonstrated that the weak signals from S- Ubx protein and to test the extent to which each line was labeled proteins were beyond the detection limit in our binding experiments, producing results indistinguishable inducible by Gal-4, we performed a control experiment from those obtained with unlabeled ‘‘cold’’ proteins. There- with the potent ectodermal Gal-4 driver 69B. UAS-Ubx fore, in these conditions, we had absolute certainty on the pro- transgenic lines were crossed to the 69B-Gal4 line and tein units present in each binding reaction, without affecting the resulting embryos were labeled with FP3.38 anti-Ubx the readout of our DNA-binding experiments. Apart from this antibody. Embryos from all of the UAS-Ubx lines ex- important difference, conditions for the DNA-binding assay were similar to those previously described (Galant and pressed Ubx protein throughout the ectoderm. To con- Carroll 2002). In brief, 5 ml of reticulocyte lysate reaction firm that all Ubx protein variants were functional, we mixture (containing Exd and/or Ubx in different amounts) compared cuticle preparations of these embryos (not was incubated on ice, with nonspecific competitor p[dIdC] shown) and looked at the development of the midgut m (1 mg per reaction) in 13 gel shift buffer [10 m Tris-Cl (pH structures after ectopic expression of all Ubx isoforms in 7.5), 75 mm NaCl, 1 mm EDTA, 6% glycerol, 3 mm spermidine, 1mm DTT] for 15 min. Independently of the protein com- the mesoderm (see below). All constructs transformed bination analyzed, the total volume of lysate was kept constant T3 denticle belts to an abdominal identity following in all reactions. The double-stranded, end-labeled DNA probe misexpression in the ectoderm and blocked formation (10,000–15,000 cpm) was incubated with each protein mixture of the anterior midgut constriction following expres- for 15 min on ice. For competition experiments, unlabeled sion in the mesoderm (Figure 2). oligonucleotides at different molarities were added prior to In the embryonic mesoderm, Ubx is expressed from the addition of the probe. The total reaction volume was 20 ml. Reactions were analyzed in 6% polyacrylamide gels to resolve parasegment 6 to parasegment 12. Within this domain, protein–DNA complexes through retardation of 32P-labeled Ubx functions in several mesodermally derived tissues, DNA. Gels were dried and exposed to PhosphorImager plates including the visceral mesoderm, the somatic muscula- (MS2040 Fujifilm) and quantified as indicated above (see ture, the heart, and the fat body (Bienz and Tremml protein expression). Signal values corresponding to each 1988; Michelson 1994; Ponzielli et al. 2002). In the protein–DNA complex were determined by profile scanning using Mac BAS image analysis software (Fujifilm). Background visceral mesoderm, Ubx is expressed only in paraseg- levels were substracted and signal values for the different ment 7 (PS7), where it activates the expression of its complexes were imported into Excel:Mac (Microsoft Excel). In direct target decapentaplegic (dpp)(Bienz and Tremml Figure 6A values were used to generate a simple column chart. 1988; Capovilla et al. 1994; Manak et al. 1994; Sun et al. The maximum binding activity detected in the experiment 1995). Expression of dpp is required for the correct (i.e., UbxIVa WT, 1.5 protein units) was considered as 100%, ienz and all other values were expressed as a percentage of this formation of the second midgut constriction (B and maximum value (% of Max). In Figure 6, B–D, signal values for Tremml 1988). dpp is not expressed in the other me- ternary complexes were also expressed as % of Max and were sodermal derivatives of PS7 (e.g., somatic mesoderm). subsequently used to generate scatter plots. A linear regression Systematic molecular dissection of the dpp genomic re- was calculated for each family of values corresponding to dif- gion has revealed that a 674-bp fragment of this region is ferent amounts of each Ubx isoform. Linear equations for these trendlines are displayed at the bottom of each panel. sufficient to drive the expression of a b-galactosidase Slope values in these equations are treated in the text as ap- reporter construct in a pattern that resembles that of proximations for the affinity constants of the different [isoforms] dpp in PS7 of the visceral mesoderm (Capovilla et al. (as one component) for [Exd/DNA] (as the second compo- 1994; Sun et al. 1995) (Figure 3). Since Ubx binds this nent). To facilitate the comparison across charts, we pooled sequence and the integrity of the Ubx sites is required together the values for UbxIVa WT from the experiments in apovilla Figure 6, B and C, plotted the average values for each protein for its in vivo expression (C et al. 1994), this frag- concentration, and obtained a trendline. We did the same with ment constitutes one of the best-characterized in vivo the binding values for UbxIa WT in experiments in Figure 6, B molecular targets of Ubx. Importantly, the activation of Hox Alternative Splicing 749

also ectopic activation posterior to PS7, but in this region the different Ubx isoforms differ noticeably in their effects. With Ubx I and II (in both variants ‘‘a’’ and ‘‘b’’) dpp-lacZ expression posterior to PS7 is absent or weak, detected in scattered cells that occasionally form an expression ring, and delayed in its appearance (Figure 3). These isoforms never activate the reporter in the most posterior part of the midgut visceral mesoderm (Figure 3). In contrast, UbxIVa and to a lesser degree Ubx IVb activate dpp-lacZ strongly and throughout both anterior and posterior parts of the midgut visceral mesoderm (Figure 3). Comparing the activation abilities of Ubx proteins at a slightly later stage in development reveals another isoform-specific effect. By stage 13, in wild-type embryos, dpp-lacZ is expressed in two distinct regions of the visceral mesoderm: (i) an anterior domain, where the gastric caeca will later form, and (ii) in a more posterior Figure 2.—Function of ectopically expressed Ubx pro- region where it is activated by the endogenous Ubx gene teins in the mesoderm. Embryos were stained for b-gal pro- (Figure 3). Ectopic expression of Ubx isoforms I and II duced from a dpp-lacZ construct, which by stage 15 outlines activates dpp-lacZ in only these two sets of cells, at ec- the forming gut tube. (A) Wild-type embryo displaying the topic positions along the anterior posterior axis (Figure three embryonic midgut constrictions (C1–C3, red arrow- 3). However, Ubx IV isoforms (both a and b) also activate heads). (B) 24B-Gal4/UAS-UbxIa embryo. Note that the for- mation of the anterior midgut constriction is abnormal dpp-lacZ in the somatic musculature, a tissue where nei- (asterisk, blue bracket) while the second and third constric- ther dpp nor dpp-lacZ is normally expressed (Figure 3). tions are normal (C2 and C3). All Ubx protein isoforms from Several lines of evidence argue against the possibility all our transgenic lines produced the same morphological dis- that the activation of dpp-lacZ in posterior gut regions tortion. (Embryos are shown in dorsal view, with anterior end and the somatic mesoderm is due to higher induced to the left.) protein levels in isoform IV lines. First, four indepen- dent transgenic lines for UbxIVa drive extensive expres- dpp is specific to Ubx. Abd-A, a Hox protein more sion of dpp-lacZ in the somatic mesoderm (including posteriorly expressed, represses dpp in parasegments one that shows rather low levels of protein; see lane 8–12 of the visceral mesoderm (Immergluck et al. 1990; IVa2 in Figure S1), while none of eight independent Hursh et al. 1993). dpp activation by Ubx is also specific UbxIa lines do so. Second, although Western blot to the visceral mesoderm. Ubx does not activate dpp in experiments with Ubx antibodies show that the various most other mesodermal derivatives where it is expressed UAS-Ubx lines achieve protein expression levels that (e.g., somatic muscle, fat body, etc.). differ appreciably, the in vivo abilities to activate the dpp- To test isoform functions in vivo, we examined the lacZ reporter do not correlate with these fluctuations in ability of various Ubx proteins to activate a dpp reporter protein level (see Figure S1). Third, confocal microscopy element that contains the 674-bp dpp fragment, from analysis of 24B-driven UbxIa and UbxIVa lines (Figure here on referred to as dpp-lacZ. S2) that displayed similar expression levels in Western All Ubx isoforms were expressed throughout the blot experiments confirmed that these lines indeed mesoderm, using the mesodermal driver line 24B-Gal4 achieve comparable levels of Ubx protein, although they (Brand and Perrimon 1993). All isoforms activated display the isoform-specific patterns of dpp-lacZ discussed dpp-lacZ in the visceral mesoderm (Figure 3), indicating above. Fourth, overexpression of UbxIa using a com- that every one of the isoforms is capable of direct tran- bination of two effective mesodermal drivers (24B-Gal4 scriptional activation and able to recognize a mesoderm- and twist-Gal4) does not lead to activation of dpp-lacZ out- specific target. side the visceral mesoderm (see Figure S3). Altogether, Ectopic dpp-lacZ expression is first seen at stage 11. No these observations strongly support the conclusion that detectable ectopic Ubx is present prior to stage 11 when the differences in target gene activation represent real driven by 24B-Gal4, in agreement with the previously differences between the Ubx proteins assayed here and reported onset for 24B-Gal4 driver activity (Brand and not just variations in the level of Ubx protein expression. Perrimon 1993). This is the stage when dpp-lacZ is first We then moved on to examine the ability of the Ubx seen in PS7 in wild-type embryos (Figure 3). proteins to regulate the expression of the endogenous With all of the isoforms, there is strong ectopic ex- dpp gene. Given that the dpp-lacZ experiments described pression of dpp-lacZ anterior to PS7, extending to the above indicate that the greatest functional differences anterior limit of the midgut visceral mesoderm. There is exist between isoforms I and IV, we decided to focus on 750 H. C. Reed et al.

Figure 3.—Isoform-specific functions of Ubx proteins during embryonic develop- ment. b-Gal immunostain- ing is shown of stage 11 (A–G) and stage 13 (H–K) fly embryos carrying a dpp- lacZ reporter construct. (A and H) Wild-type control embryos where dpp-lacZ is activated in a subregion of the midgut corresponding to parasegment 7 (PS7, bracket). In stage 13 em- bryos (H), signal can also be seen in the primordium of the gastric caeca (visceral mesoderm PS4, labeled PS4) and in the faint rings of PS9 (PS9). (B–G) Effects of Ubx protein expression driven by 24B-Gal4 on the activation of the dpp-lacZ reporter. Isoforms Ia (B), IIa (C), Ib (E), and IIb (F) display similar abilities to activate dpp throughout the midgut visceral mesoderm from parasegment 2 to 7 and in two rather weak rings located approximately on PS9. Notably, isoforms IVa (D) and less strongly, isoform IVb (G) are able to activate dpp-lacZ throughout the midgut visceral mesoderm in a region that extends from parasegment 2 posteriorly to at least parasegment 12 (see dotted lines). By stage 13, isoforms I and II continue to activate the dpp reporter in the midgut visceral mesoderm (I and J, respectively) while isoforms IV (K) are also able to activate the lacZ construct in thesomaticmusculature(arrows).Thesquarebracket indicates the approximate region of reporter expression in control embryos. Labels at the bottom left corner of each panel indicate the Ubx isoform expressed in each case. I–K show the effects of isoforms ‘‘a’’ only. Variants ‘‘b’’ for each isoform yield comparable results to their ‘‘a’’ counterparts (not shown). [Embryos are shown in lateral view (A–G) or dorsal view (H–K) always with anterior end to the left.] the analysis of these two forms, expressing them in the both target systems indicate that (i) UbxIa and UbxIVa embryonic mesoderm and looking at the resulting are able to override normal dpp repression anterior to patterns of endogenous dpp transcription using RNA PS7 and (ii) there is an intrinsic ability of UbxIVa to in situ hybridization. These experiments revealed activate dpp transcription in locations posterior to PS7. that each Ubx isoform had specific abilities to control However, under UbxIVa regulation expression of the the expression of the endogenous dpp gene (Figure 4). endogenous dpp endogenous gene is always confined to In wild-type stage 13 embryos, dpp is expressed in the the correct tissue—the visceral mesoderm—in contrast visceral mesoderm in a discrete domain corresponding to the ability of UbxIVa to activate the dpp-LacZ reporter to PS7 (Figure 4A); expression is also detectable in a in the somatic mesoderm. We also note a discrepancy in smaller domain in the gastric caeca primordium (PS4). the timing of the regulatory effects specific to UbxIVa: When UbxIa is ectopically expressed in the mesoderm, activation of the dpp-LacZ construct in areas posterior to the expression domain of dpp extends anteriorly within PS7 is detectable by stage 11 (Figure 3D); however, at the visceral mesoderm all the way to PS4 (Figure 4B). this stage endogenous dpp expression seems normal and Notably, UbxIa is unable to activate endogenous dpp confined to visceral mesoderm PS7. The inability of transcription in regions posterior to its normal expres- UbxIVa to override normal tissue specificity on the dpp sion domain in PS7, showing a sharp posterior bound- endogenous gene might be the consequence of cis- ary (Figure 4B). Generalized expression of UbxIVa in regulatory elements located outside the dpp674 frag- the mesoderm is—like that of UbxIa—able to extend ment being able to maintain a repressed transcriptional the dpp expression domain to regions anterior to PS7 state in spite of the ectopic Ubx regulatory input. (Figure 4C); notably, this isoform is also able to activate Reading Ubx outputs modulated by alternative splicing dpp transcription posterior to PS7 (Figure 4C). In sum, during normal development: Our experiments above we conclude that UbxIa and UbxIVa are able to regulate clearly indicate that the different alternative splicing the transcription of the dpp gene in an isoform-specific isoforms of Ubx are not equivalent in their abilities to fashion. This could partly be due to the differential regulate a natural downstream molecular target of Ubx, abilities of the individual isoforms to compete efficiently in vivo, during Drosophila embryogenesis. Nonetheless, with the products of the posterior Hox gene, Abdominal- on the basis of these experiments alone, it is difficult A (Abd-A) on target regulation (see discussion below). to assess the extent to which the different Ubx forms Comparison of the activation profiles of the dpp-lacZ generated by alternative splicing perform isoform- reporter and the endogenous dpp gene under ectopic specific functions during normal development. expression of Ubx splicing isoforms reveals similarities Therefore, to further advance our functional models but also some differences. For instance, we note that on the role played by alternative splicing on the specificity Hox Alternative Splicing 751

Figure 4.—Regulation of the endogenous dpp gene by Ubx splicing isoforms in the visceral mesoderm. (A) Wild-type expression of dpp mRNA as judged by RNA in situ hybridization (stage 13 embryos). A dis- crete domain of dpp ex- pression is detected in the visceral mesoderm PS7 (represented along the an- tero-posterior axis by an orange rectangle). (B) Reg- ulation of dpp mRNA expression following generalized expression of UbxIa in the mesoderm as driven by twist-Gal4. Note (i) the existence of an anteriorly extended expression domain of dpp mRNA in this condition (blue rectangle) and (ii) the discrete pos- terior boundary of the UbxIa-induced dpp expression domain with no detectable dpp mRNA signal posterior to PS7. (C) dpp mRNA expression after UbxIVa expression in the mesoderm (driven by twist-Gal4). Note (i) the extended domain of dpp ex- pression anterior to PS7 (blue rectangle) and (ii) a patchy but significant upregulation of dpp mRNA in the visceral mesoderm posterior to PS7 (gray rectangle). (All embryos are oriented with their anterior end to the left; embryos on the top are shown in dorsal view, and bottom embryos are in lateral view.)

of Ubx function in a physiological context, we decided to cell surface molecule expressed in a subset of muscles analyze the developmental outputs obtained when only a including three abdominal-specific muscles, dorsal limited spectrum of alternative splicing products is gen- transverse 1 and ventral acute 2 and 3 (Figure 5C) erated from the Ubx locus. For this we employed a Ubx (Nose et al. 1992). It is also expressed in the four lateral mutant, termed UbxMX17 (Busturia et al. 1990), in which transverse muscles, which differ in morphology between the full spectrum of Ubx splicing isoforms is reduced to thoracic and abdominal segments (Figure 5C). The one single functional form, UbxIVa (Subramaniam et al. second marker, slouch, encodes a transcription factor 1994), due to an inversion of the M2 microexon. UbxMX17 required for the specification of a subset of muscles mutant flies express UbxIVa within the normal Ubx ex- including the abdominal-specific dorsal transverse 1 pression domain at levels that match wild-type Ubx ex- (Dohrmann et al. 1990). As shown in Figure 5, C–F, both pression levels (see Figure S5); the flies are viable and markers show clear transformations in the muscle fertile but adults show a partial transformation of halteres pattern in abdominal segments A1 and A2. Connectin into wings, a characteristic indication of malfunction in labeling reveals a lack of the dorsal transverse 1 in Ubx, and embryos have defects in the peripheral nervous segments A1 and A2 and the lateral transverse muscles system (Subramaniam et al. 1994). have a thinner thoracic-like morphology in the UbxMX17 Here we extend the work of Subramaniam et al. embryos (Figure 5, C and D). RNA in situ hybridization (1994) by examining the phenotype of UbxMX17 mutants for slouch mRNAs supports the lack of the abdominal- within a tissue directly related to our ectopic experi- specific dorsal transverse 1 in the A1 and A2 segments ments (i.e., somatic mesoderm), focusing on a subset of (Figure 5, E and F). Although the above features show a internal structures, the larval muscles, which are formed transformation of A1 and A2 toward a thoracic identity, during embryogenesis. The muscles are attached to the this transformation appears only to affect a subset of inner face of the epidermis and form a regular and muscles, as the abdominal-specific ventral acute 2 is still highly stereotyped metamerically repeated array, with present in the A1 and A2 segments in UbxMX17 embryos small but ‘‘scorable’’ differences between thoracic and (Figure 5, C and D). Overall the UbxMX17 muscle pheno- abdominal segments (Figure 5, A and B). In full loss-of- type demonstrates a failure to specify Ubx-dependent function Ubx mutants, the muscles of the abdominal abdominal features in A1 and A2, indicating the in- segments A1 and A2 are transformed toward a thoracic ability of the UbxIVa isoform to execute some specific identity, seen as a loss of abdominal-specific muscles and functions that are normally performed by other Ubx a gain of thoracic-specific ones (Hooper 1986). This isoforms. provided us with a clean testable hypothesis: if UbxIVa, Function of Ubx proteins in vitro: The experiments the only Ubx isoform made in UbxMX17 mutants, was unable above indicate that the different Ubx isoforms have to compensate for the other isoforms in the somatic isoform-specific abilities to regulate a natural molecular mesoderm of UbxMX17 embryos, then we expected a similar target in vivo. In molecular terms, such distinct target loss-of-function phenotype as described above. regulatory potentials could be dictated by differential To compare the phenotype of UbxMX17 with the wild binding profiles to DNA target sites, or by isoform- type we used two molecular markers that show segment- specific regulatory interactions between the individual specific expression in the larval muscles. Connectin is a Ubx proteins and the basal transcriptional apparatus, or 752 H. C. Reed et al.

Figure 5.—UbxMX17 phe- notype in somatic meso- derm demonstrates specific in vivo functions of the Ubx isoforms. (A and B) Sche- maticofthepatternofrel- evant Connectin-expressing muscles in (A) wild-type third thoracic (T3) segment and in (B) the abdominal segments (A1–A7) (adapted from Nose et al. 1992 and Bate 1993). LT, lateral trans- verse; DT, dorsal transverse; VA, ventral acute. (C and D) Immunolabeling of Con- nectin in stage 16 embryo flatpreps. (C) Wild type. The abdominal-specific mus- cles are indicated; asterisks in A1–A7 indicate muscle DT1 and the arrowhead in A1 indicates VA2. (D) UbxMX17. A1 and A2 show transformation toward thoracic identity with loss of DT1 and thinner thoracic-like LT muscles; asterisks indicate DT1 muscles in A3 and A4. The transformation affects specific muscles as VA2 (arrowhead in A1) is still present in A1 and A2. (E and F) In situ hybridization for slouch mRNAs on stage 14 embryo whole mounts. (E) Wild type. Expression corresponding to the dorsal muscle DT1 is present from A1 to A7 (arrowhead in A3). (F) UbxMX17.A1 and A2 (open arrowheads) lack the DT1 slouch expression (arrowhead in A3). In this embryo, ventral cells expressing slouch are also in focus. (Embryos are shown in lateral view, anterior end to the left.) by a combination of both mechanisms. To advance by an alanine tract. Mutagenesis of the hexapeptide our understanding of the mechanistic basis underlying motif has been previously shown to affect interactions Ubx protein specificity we decided to test whether the between Hox and Pbc proteins (Chang et al. 1995; different Ubx isoforms were able to bind DNA target Knoepfler and Kamps 1995). Alanine replacement con- elements with specific affinity profiles. structs were termed Ubx ‘‘ALA’’ versions. The ectopic in vivo experiments described above We tested the behavior of several DNA elements in indicate that the greatest functional differences exist our binding experiments. From these we selected a between isoforms I and IV, proteins that include and composite Hox-Exd element that includes adjacent exclude the two M microexons, respectively (see Figure head-to-tail core sites for Ubx and Exd (Figure S4 B). 1). Therefore, we focused our attention on the molec- Ubx/Exd protein complexes bind with high specificity ular analysis of these two. We employed ‘‘a’’ variants of to the Hox-Exd composite element (Figure S4, C and these two isoforms, because ‘‘b’’ forms are present only D). This element has been extensively used and vali- at low levels during normal development, whereas both dated in a number of previous studies including the isoforms Ia and IVa represent significant fractions of the crystallographic work that determined the structure of normal Ubx expression profile, in ectoderm and central the ternary complex Ubx-Exd-DNA, the testing of DNA nervous system, respectively (O’Connor et al. 1988; binding abilities of Ubx proteins from different species, Kornfeld et al. 1989). and the molecular analysis of Ubx functions during Hox protein function depends, in part, on coopera- haltere development (Passner et al. 1999; Galant and tive interactions with cofactors such as Exd, which in- Carroll 2002; Galant et al. 2002). In contrast, other crease the specificity of DNA binding. Therefore, our DNA elements, including sequences derived from the experimental approach involved quantification of Ubx dpp regulatory region, produced highly unstable bind- binding activities in the presence of Exd. All Ubx and ing patterns even when assayed in a wide range of ex- Exd proteins were produced by in vitro translation in a perimental conditions (i.e., variation in temperature, pH, rabbit reticulocyte lysate system (see materials and binding, and running buffer composition) and therefore methods). Protein qualities and amounts were deter- were not suitable for reliable binding quantification. mined by 35S labeling with methionine followed by When assayed in the absence of Exd, all Ubx isoforms PAGE analysis and quantification (Figure S4 A). Protein display only weak DNA-binding activity (Figure 6A, amounts were carefully normalized in all assays (see lanes 1–4). This binding activity increases greatly in materials and methods). the presence of Exd (Figure 6A, lanes 5–8). Exd alone To dissect the contribution of protein interaction did not produce any protein–DNA complexes in our modules (such as the hexapeptide) within the backbone assay (Figure 6A, lane 13). of different isoforms, we engineered versions of UbxIa In the presence of Exd, Ubx isoforms Ia and IVa, and and UbxIVa, in which the hexapeptide was replaced their two Ala substitution derivatives, each bind DNA at Hox Alternative Splicing 753

Figure 6.—Ubx in vitro interaction with Exd is isoform specific. (A) Equal amounts of different Ubx proteins were incubated in the absence (lanes 1–4) or presence of Exd (lanes 5–8). Ubx proteins alone displayed very low binding activity for the element analyzed (lanes 1–4). Exd was able to interact with all Ubx protein forms although the degree of these interactions was notably different (see below). Doubling the amount of Ubx protein in the reaction (lanes 9–12) proportionally increased the signal de- tected in ternary complexes, indicating that the differential interaction observed among Ubx proteins represents intrinsic prop- erties of the proteins rather that some other experimental limiting factor. Exd alone is not able to bind to this element in a stable manner (lane 13). The quantification of the experiment is shown to the right. (B) Wild-type UbxIVa/Exd bind the DNA probe more strongly than UbxIa/Exd. Similar amounts of UbxIa and UbxIVa were incubated in the presence of Exd and the relative amount of protein–DNA complexes was quantified (see chart). (C) Ubx ‘‘hexapeptide-independent’’ interaction with Exd on DNA is isoform specific. A similar experiment to that in B shows that for isoform UbxIVa, the elimination of the hexapeptide decreases the interaction with Exd. (D) UbxIa lacking the hexapeptide is able to interact with Exd in the presence of a DNA target. Similar amounts of UbxIa wild type (lanes 1–6) and UbxIa Ala (lanes 7–12) display a similar Exd interaction profile in the presence of a Hox-Exd element, suggesting that UbxIa possesses areas of interaction with Exd other than the hexapeptide. When compared to C, these results also indicate that the linker region is able to affect the strength of Ubx–Exd protein inter- actions on the DNA element under study. Note that the levels of relative binding in the plots shown in C and D have been nor- malized to the level of binding of wild-type proteins in experiment B (for further details please see materials and methods). a characteristic level (Figure 6A, lanes 5–8). When Ubx Using the slopes of the trendlines for each case as an protein concentrations in the assays are doubled, the approximation for the affinity constants of the different binding signals of the different isoforms increase isoforms for the Exd/DNA component, we estimate that accordingly but maintain their relative affinities (lanes the binding differences between IVa and Ia wild type are 9–12), showing that these assays are being carried in the range of four- to fivefold (see equations in Figure out under conditions where Exd protein is present in 6B). This observation indicates that in our experimental excess, and Ubx protein levels are not saturating. conditions, the linker region containing microexons To analyze these differences more precisely, we mea- M1 and M2 has a significant role in the interaction of sured the dependence of binding on Ubx protein con- Ubx–Exd protein complexes with DNA. centration for the two Ubx isoforms Ia and IVa (Figure In the case of UbxIa, replacement of the YPWM motif 6B) and for each wild-type isoform in comparison with with (Ala)4 does not appreciably affect the amount of the corresponding Ala substitution variant (Figure 6, C Ubx–Exd–DNA ternary complex formed (Figure 6D), and D). Comparison of wild-type versions of UbxIa suggesting that, for this isoform, the hexapeptide is not and UbxIVa reveals that, in the presence of Exd, UbxIVa essential for the interaction of Ubx with Exd on DNA binds DNA more strongly than UbxIa (Figure 6B). targets. However, in the case of UbxIVa, formation of 754 H. C. Reed et al. the complex is substantially reduced by 40% when specificity. The more efficient DNA binding of this the hexapeptide module is replaced (Figure 6C). These isoform (in the presence of Exd) may bypass the re- experiments suggest that the linker region plays a sig- quirement for a cofactor or displace a repressor more nificant role in mediating hexapeptide-independent effectively. interactions between Ubx and Exd on DNA targets. Recently, a quantitatively controlled study showed that the levels of Ubx protein are very important to determine the functional outcome of Ubx in vivo (Tour DISCUSSION et al. 2005). In this context, our results show that in The experiments described above indicate that the spite of significant variation across expression levels of generation of structural differences among Ubx pro- UbxIVa protein in different transgenic lines (see above), teins by alternative splicing is relevant for the functional this isoform is consistently able to produce a similar specificity of Ubx in vivo. We also see that these struc- output in terms of dpp target activation in posterior re- tural features modulate essential biochemical proper- gions. This suggests that for UbxIVa dpp target activation ties of Ubx proteins such as their DNA-binding profiles and protein concentration may relate to one another in the presence of a cofactor. in the form of a sigmoidal function (Tour et al. 2005) In vivo differences between Ubx isoforms: The dif- with a narrow protein concentration interval acting as ferential effects of Ubx in vivo are apparent in the a threshold that is crossed by all UbxIVa lines tested posterior visceral mesoderm, but not in the anterior. To here. Given that UbxIa lines achieving comparable understand this we must first note that the mechanism protein expression levels to UbxIVa lines (see Figure of dpp674 repression is different anterior and posterior S1, Figure S2, and Figure S3) were not able to activate to PS7. In the anterior visceral mesoderm, repression dpp in posterior regions of the embryo, we conclude that requires Exd, since in Exd null mutants, dpp674 is qualitative differences in Ubx protein structure as de- ectopically expressed anterior to PS7 (Rauskolb and termined by alternative splicing are causal to the ob- Wieschaus 1994). But Hox genes appear to play no role served differential behavior in target activation. in the normal repression of dpp in this region (Rauskolb The tissue-specific effects of Ubx isoform ectopic and Wieschaus 1994). The same Exd-dependent mech- expression emphasize the likely role that the splice anism may also be acting in the posterior, but it is not isoforms play in mediating specific Ubx functions in necessary, for no posterior ectopic expression is ob- different tissues. Indeed, the isoforms have different served in Exd null mutants. The posterior repression tissue distributions in embryogenesis with UbxIa ex- depends instead on the Hox protein Abd-A (Capovilla pressed predominantly in epidermis, mesoderm, and et al. 1994), which is presumably able to repress dpp674 peripheral nervous system whereas UbxIVa appears to in the absence of Exd as a cofactor. be exclusively expressed in the central nervous system All Ubx protein isoforms are able to induce dpp (Lopez and Hogness 1991). Our analysis of the UbxMX17 ectopically in the anterior, suggesting that they can mutation, which retains the full Ubx expression pattern all override the normal repression mediated by Exd. but generates only isoform UbxIVa, supports the en- However, they exert differential effects in the posterior, dogenous relevance of splice isoforms for tissue-specific where Abd-A is the controlling repressor. Abd-A has a Hox function. Although in UbxMX17 embryos UbxIVa can very similar DNA-binding specificity to that of Ubx replace the function of Ubx isoforms I and II in the (Capovilla and Botas 1998). It binds to multiple epidermis with the generation of a normal cuticle sites in the dpp674 enhancer, including those to which pattern (Busturia et al. 1990), the peripheral nervous Ubx binds. Through some of these sites it serves as an system is affected (Subramaniam et al. 1994) and here activator, but through others it acts as a repressor. With we find clear defects in the segmental specification of Ubx form Ia, the repressing effect by Abd-A is dominant somatic muscles (Figure 4). Tissue-specific isoform func- (Capovilla and Botas 1998). Our results suggest that tions may be mediated by effects on cofactor interaction Ubx form IVa is either able to compete more effectively (as discussed below) or may also involve effects on as an activator with the repressing action of Abd-A collaborative regulatory interactions between Hox pro- bound at other sites or able to displace the binding of teins and tissue-specific regulators (White et al. 2000; Abd-A at the sites where it mediates repression. Walsh and Carroll 2007). Ubx form IVa also overrides the normal specificity The roles of the hexapeptide and the linker region of the dpp-lacZ enhancer for the visceral mesoderm, in Hox/Exd interactions: The results of our in vitro activating it ectopically in the somatic mesoderm of binding studies of the Ubx/Exd element show that Ubx most trunk segments. It is not known whether the isoforms differ in their capacity to interact with DNA activity of this enhancer is normally restricted to the in the presence of the cofactor Exd. A possibility that visceral mesoderm by a required cofactor that is present emerges from these results is that different Ubx iso- only in the visceral mesoderm, by repressors present in forms display differential levels of interaction with Exd other tissues, or by both mechanisms. However, UbxIVa (in the presence of target DNA) and, accordingly, could at high levels seems able to override this normal tissue perform specific functions in vivo as a consequence to Hox Alternative Splicing 755 the distinct levels of nuclear Exd available in different sults could also be accommodated in a model in which regions of the embryo. the Ubx linker region induces a conformational change Our in vitro studies also show that ablation of the elsewhere in the Ubx protein, such that—as suggested YPWM motif has little effect on the ability of Ubx form above—the degree of interaction with Exd is affected. Ia to form a complex with Exd, but it significantly Alternatively, the regulatory potential of the Ubx pro- reduces complex formation by Ubx form IVa. tein could be affected. In particular, linker-dependent The observation that mutated forms of the Ubx conformational changes may affect the behavior of protein lacking the hexapeptide interact with Exd at critical regulatory motifs of Ubx, such as the recently all is at first sight surprising, especially in view of the studied QA motif involved in the modulation of Ubx structural studies showing that the YPWM motif pro- activities in a tissue-specific manner (Hittinger et al. vides the major contact between Hox and Exd proteins 2005) and the SSYF motif, an evolutionarily conserved bound to DNA (Passner et al. 1999). However, this motif close to the N terminus of the Ubx protein that is finding is not inconsistent with earlier work. The article involved in transcriptional activation (Tour et al. 2005). that originally described cooperative interactions be- Other reports have also emphasized that the Hox tween Ubx and Exd used Ubx proteins deleted of all linker regions are not just passive spacers. One such sequences located amino-terminal to the homeodo- study shows that mutation of the short linker region in main. These proteins therefore lacked the hexapeptide the Hox protein Abd-A specifically disables its capacity motif entirely (Chan et al. 1994) (see Figure 1). Inter- to activate wingless, a natural target gene, without af- actions with Exd that do not require the hexapeptide fecting its ability to repress dpp (Merabet et al. 2003). have also been reported in a recent study focused on When comparing cofactor and DNA-binding properties Ubx functions independent from Exd and Hth proteins of this Abd-A mutant protein with those of the wild-type (Galant et al. 2002). In addition, alanine replacement Abd-A on a repressor element of the Distalless gene of the hexapeptide does not affect the way another Hox (DllR), no differences were seen in the interaction protein (i.e., Abd-A) interacts with Exd (Merabet et al. between the mutant form of Abd-A and Exd protein; 2003). Furthermore, a recent study (Merabet et al. see Figure 1, C and D, in Merabet et al. (2003). (It is 2007) suggests that Ubx–Exd recruitment may rely not perhaps worth noting that these in vitro experiments on a single, but on several different mechanisms, some required the presence of Homothorax protein; on this of which require a short evolutionarily conserved motif particular DNA target (DllR), the formation of com- originally termed UbdA (Chan and Mann 1993). Thus, plexes with Abd-A and Exd alone was below the limit of the hexapeptide is unlikely to be the only Hox protein detection of the assay.) Another report described Ubx motif that interacts with Exd. isoform-specific functions for the repression of the Dll Crystallographic studies show that the Ubx and Exd gene (Gebelein et al. 2002). These studies suggest that homeodomains are closely adjacent, almost touching sequences within the Hox linker regions may modify the each other, the extent of this proximity being revealed trans-regulatory potential of Hox proteins without by a significant reduction in solvent-accessible surface necessarily affecting the DNA-binding properties of area within the area of putative contact (Passner et al. these proteins. Our results extend these studies, show- 1999). In addition, the distance between the Ubx rec- ing that linker regions may at times affect target gene ognition helix C terminus and the Exd recognition regulation and the DNA binding/cofactor interaction helix N terminus is just 9 A˚ , with one particular residue abilities of a Hox protein. Our binding results are of Ubx (Lys58) well positioned to form hydrogen bonds consistent with a recent study that integrates DNA- with a residue of Exd (Ser48) (Passner et al. 1999). binding tests with computational predictions of ordered Thus, regions within the Ubx homeodomain may be and disordered segments of the Ubx protein, propos- responsible for additional interactions with Exd. Se- ing that sequences outside the homeodomain can re- quences elsewhere in the proteins may also contribute duce the DNA-binding activities of the Ubx protein by to these interactions (Chan et al. 1994; Passner et al. twofold (Liu et al. 2008b). 1999). A fine combination of protein mapping and The general role of alternative splicing on Hox crystallographic studies may be required to reveal the specificity: Beyond the effects that alternative splicing structural details of such interactions. may have on modulating Hox interactions with cofac- Our experiments would be consistent with the possi- tors, other possibilities must also be considered. Given bility that the Ubx linker region itself could be a previ- that in our experiments we observe a very unstable bind- ously uncharacterized region of Ubx that makes contacts ing of the Ubx proteins to target DNA in the absence with Exd. This would be supported by experiments of of Exd, it is difficult to advance arguments regarding protein–protein interaction in yeast, which also suggest the affinities of the individual Ubx isoforms for this that the Ubx linker region could affect the interaction molecular target on firm grounds. In spite of this, given between Ubx and Exd (Johnson et al. 1995), and by that in various physiological contexts the binding of the high evolutionary conservation of these sequences Hox proteins to target sites in the absence of cofactors across phylogenetically distant species of flies. Our re- has been demonstrated (Pinsonneault et al. 1997; 756 H. C. Reed et al.

Pederson et al. 2000), it is pertinent to suggest that Abu-Shaar, M., H. D. Ryoo and R. S. Mann, 1999 Control of the alternative splicing might also be influencing Hox DNA nuclear localization of Extradenticle by competing nuclear im- port and export signals. Genes Dev. 13: 935–945. binding independently from cofactor interactions, at Akam, M., 1998 Hox genes, homeosis and the evolution of segment the level of changing DNA-binding affinities of the identity: no need for hopeless monsters. Int. J. Dev. Biol. 42: individual isoforms for their target DNAs. This possibil- 445–451. Akam, M. E., and A. Martinez-Arias, 1985 The distribution of ity would be suitable for experimental investigation in Ultrabithorax transcripts in Drosophila embryos. EMBO J. 4: the physiological context of Drosophila adult append- 1689–1700. kam artinez rias einzierl ilde age development, as Ubx is known to act independently A , M. E., A. M -A ,R.W and C. D. W , 1985 Function and expression of ultrabithorax in the Drosoph- from cofactors during the development of these struc- ila embryo. Cold Spring Harbor Symp. Quant. Biol. 50: 195–200. tures (Rauskolb et al. 1995; Abu-Shaar and Mann Alonso, C. R., 2002 Hox proteins: sculpting body parts by activating 1998; Azpiazu and Morata 1998; Casares and Mann localized cell death. Curr. Biol. 12: R776–R778. Alonso, C. R., and A. S. Wilkins, 2005 The molecular elements that 1998, 2000). underlie developmental evolution. Nat. Rev. Genet. 6: 709–715. Examples from other Drosophila Hox genes further Aspland, S. E., and R. A. White, 1997 Nucleocytoplasmic localisa- support a more general role of differential splicing in tion of extradenticle protein is spatially regulated throughout de- velopment in Drosophila. Development 124: 741–747. the diversification of Hox function during develop- Azpiazu, N., and G. Morata, 1998 Functional and regulatory inter- ment, affecting protein modules outside the Ubx linker actions between Hox and extradenticle genes. Genes Dev. 12: region discussed above. For instance, genetic dissection 261–273. Bate, M., 1993 The mesoderm and its derivatives, pp. 1013–1090 in of the Abd-B gene demonstrated the existence of two The Development of Drosophila melanogaster, edited by M. Bate and distinct gene functions, originally termed morphoge- A. Martinez-Arias. Cold Spring Harbor Laboratory Press, Cold netic (m) and regulatory (r) (Casanova et al. 1986; Spring Harbor, NY. asanova hite uziora c innis Beachy, P. A., S. L. Helfand and D. S. Hogness, 1985 Segmental C and W 1987). K and M G distribution of bithorax complex proteins during Drosophila de- (1988) and Zavortink and Sakonju (1989) cloned the velopment. Nature 313: 545–551. spectrum of mRNAs derived from the Abd-B locus and Bienz, M., and G. Tremml, 1988 Domain of Ultrabithorax expres- revealed a family of Abd-B transcripts generated by dif- sion in Drosophila visceral mesoderm from autoregulation and exclusion. Nature 333: 576–578. ferential promoter use, which, in turn, leads to different Bomze, H. M., and A. J. Lopez, 1994 Evolutionary conservation of splicing variants affecting 59 sequences of the gene. Two the structure and expression of alternatively spliced Ultrabithor- ax isoforms from Drosophila. Genetics 136: 965–977. proteins products, called m and r, are produced from rand errimon elniker B , A. H., and N. P , 1993 Targeted gene expression as a the Abd-B transcripts (C et al. 1989); m differs means of altering cell fates and generating dominant pheno- from r in that it encodes an additional large glutamine- types. Development 118: 401–415. randen ooze rich amino-terminal domain. Furthermore, Kuziora B , C., and J. T , 1999 Introduction to Protein Structure. Garland, New York. (1993) showed that ectopic expression of each Abd-B Burnette, J. M., A. R. Hatton and A. J. Lopez, 1999 Trans-acting protein class leads to specific effects on the larval cuticle, factors required for inclusion of regulated exons in the Ultrabi- suggesting that the isoforms have specific developmental thorax mRNAs of Drosophila melanogaster. Genetics 151: 1517– 1529. functions. Busturia, A., I. Vernos,A.Macias,J.Casanova and G. Morata, Given that in Drosophila several Hox proteins possess 1990 Different forms of Ultrabithorax proteins generated by alternatively spliced modules modifying the distance alternative splicing are functionally equivalent. EMBO J. 9: 3551–3555. between the hexapeptide and the homeodomain (Figure Capovilla, M., and J. Botas, 1998 Functional dominance among 1), while others produce functionally different isoforms Hox genes: repression dominates activation in the regulation via differential promoter use coupled to alternative of Dpp. Development 125: 4949–4957. uziora c innis avortink Capovilla, M., M. Brandt and J. Botas, 1994 Direct regulation of splicing (K and M G 1988; Z and decapentaplegic by Ultrabithorax and its role in Drosophila mid- Sakonju 1989; Kuziora 1993), alternative splicing may gut morphogenesis. Cell 76: 461–475. truly represent a very important, yet underexplored Carroll, S. B., J. K. Grenier and S. D. Weatherbee, 2001 From DNA to Diversity. Blackwell Science, London. regulatory mechanism modulating the functional speci- Casanova, J., and R. A. White, 1987 Trans-regulatory functions in ficity of Hox proteins during development. the Abdominal-B gene of the bithorax complex. Development 101: 117–122. We thank Ron Galant for discussion of DNA-binding experiments Casanova, J., E. Sanchez-Herrero and G. Morata, 1986 Iden- and Richard Mann for Exd cDNAs. We also thank the constructive tification and characterization of a parasegment specific regula- criticisms of two anonymous reviewers whose comments improved the tory element of the abdominal-B gene of Drosophila. Cell 47: quality of this article. This work was supported by a Medical Research 627–636. Council (United Kingdom) studentship to H.C.R., by funding from Casares, F., and R. S. Mann, 1998 Control of antennal versus leg the Medical Research Council (United Kingdom) to R.A.H.W., by a development in Drosophila. Nature 392: 723–726. grant from the Wellcome Trust to M.A., and by a New Investigator Casares, F., and R. S. Mann, 2000 A dual role for homothorax in Grant from the Biotechnology and Biological Sciences Research inhibiting wing blade development and specifying proximal wing Council (nos. BB/E01173X/1 and BB/E01173X/2) to C.R.A. identities in Drosophila. Development 127: 1499–1508. Celniker, S. E., D. J. Keelan and E. B. Lewis, 1989 The molecular genetics of the bithorax complex of Drosophila: characterization LITERATURE CITED of the products of the Abdominal-B domain. Genes Dev. 3: 1424– 1436. Abu-Shaar, M., and R. S. Mann, 1998 Generation of multiple antag- Chan, S. K., and R. S. Mann, 1993 The segment identity functions onistic domains along the proximodistal axis during Drosophila of Ultrabithorax are contained within its homeo domain and leg development. Development 125: 3821–3830. carboxy-terminal sequences. Genes Dev. 7: 796–811. Hox Alternative Splicing 757

Chan, S. K., L. Jaffe,M.Capovilla,J.Botas and R. S. Mann, physically contacts Pbx1, and enhances DNA binding by Pbx1. 1994 The DNA binding specificity of Ultrabithorax is modu- Mol. Cell. Biol. 15: 5811–5819. lated by cooperative interactions with extradenticle, another ho- Kornfeld, K., R. B. Saint,P.A.Beachy,P.J.Harte,D.A.Peattie meoprotein. Cell 78: 603–615. et al., 1989 Structure and expression of a family of Ultrabithor- Chang, C. P., W. F. Shen,S.Rozenfeld,H.J.Lawrence,C.Largman ax mRNAs generated by alternative splicing and polyadenylation et al., 1995 Pbx proteins display hexapeptide-dependent coop- in Drosophila. Genes Dev. 3: 243–258. erative DNA binding with a subset of Hox proteins. Genes Dev. 9: Kuziora, M. A., 1993 Abdominal-B protein isoforms exhibit dis- 663–674. tinct cuticular transformations and regulatory activities when de la Mata, M., C. R. Alonso,S.Kadener,J.P.Fededa,M. ectopically expressed in Drosophila embryos. Mech. Dev. 42: Blaustein et al., 2003 A slow RNA polymerase II affects alterna- 125–137. tive splicing in vivo. Mol. Cell 12: 525–532. Kuziora, M. A., and W. McGinnis, 1988 Different transcripts of the Dohrmann, C., N. Azpiazu and M. Frasch, 1990 A new Drosophila Drosophila Abd-B gene correlate with distinct genetic sub-functions. homeo box gene is expressed in mesodermal precursor cells of EMBO J. 7: 3233–3244. distinct muscles during embryogenesis. Genes Dev. 4: 2098–2111. Lamka, M. L., A. M. Boulet and S. Sakonju, 1992 Ectopic expres- Flegel, W. A., A. W. Singson,J.S.Margolis,A.G.Bang,J.W. sion of UBX and ABD-B proteins during Drosophila embryogen- Posakony et al., 1993 Dpbx, a new homeobox gene closely re- esis: competition, not a functional hierarchy, explains phenotypic lated to the human proto-oncogene pbx1 molecular structure suppression. Development 116: 841–854. and developmental expression. Mech. Dev. 41: 155–161. Lewis, E. B., 1978 A gene complex controlling segmentation in Galant, R., and S. B. Carroll, 2002 Evolution of a transcriptional Drosophila. Nature 276: 565–570. repression domain in an insect Hox protein. Nature 415: 910–913. Liu, J., and A. Fire, 2000 Overlapping roles of two Hox genes and Galant, R., C. M. Walsh and S. B. Carroll, 2002 Hox repression the exd ortholog ceh-20 in diversification of the C. elegans post- of a target gene: extradenticle-independent, additive action embryonic mesoderm. Development 127: 5179–5190. through multiple monomer binding sites. Development 129: Liu, J., L. Qian,Z.Han,X.Wu and R. Bodmer, 2008a Spatial 3115–3126. specificity of mesodermal even-skipped expression relies on mul- Gebelein, B., J. Culi,H.D.Ryoo,W.Zhang and R. S. Mann, tiple repressor sites. Dev. Biol. 313: 876–886. 2002 Specificity of Distalless repression and limb primordia de- Liu, Y., K. S. Matthews and S. E. Bondos, 2008b Multiple intrinsi- velopment by abdominal Hox proteins. Dev. Cell 3: 487–498. cally disordered sequences alter DNA binding by the homeodo- Gebelein, B., D. J. McKay and R. S. Mann, 2004 Direct integration main of the Drosophila hox protein ultrabithorax. J. Biol. Chem. of Hox and segmentation gene inputs during Drosophila devel- 283: 20874–20887. opment. Nature 431: 653–659. Lopez, A. J., and D. S. Hogness, 1991 Immunochemical dissec- Gonzalez-Reyes, A., and G. Morata, 1990 The developmental tion of the Ultrabithorax homeoprotein family in Drosophila effect of overexpressing a Ubx product in Drosophila embryos melanogaster. Proc. Natl. Acad. Sci. USA 88: 9924–9928. is dependent on its interactions with other homeotic products. Manak, J. R., L. D. Mathies and M. P. Scott, 1994 Regulation of a Cell 61: 515–522. decapentaplegic midgut enhancer by homeotic proteins. Devel- Gonzalez-Reyes, A., N. Urquia,W.J.Gehring,G.Struhl and G. opment 120: 3605–3619. Morata, 1990 Are cross-regulatory interactions between homo- Mann, R. S., 1995 The specificity of homeotic gene function. eotic genes functionally significant? Nature 344: 78–80. BioEssays 17: 855–863. Gould, A. P., and R. A. White, 1992 Connectin, a target of home- Mann, R. S., and M. Affolter, 1998 Hox proteins meet more part- otic gene control in Drosophila. Development 116: 1163–1174. ners. Curr. Opin. Genet. Dev. 8: 423–429. Graba, Y., D. Aragnol and J. Pradel, 1997 Drosophila Hox Mann, R. S., and S. K. Chan, 1996 Extra specificity from extraden- complex downstream targets and the function of homeotic genes. ticle: the partnership between HOX and PBX/EXD homeodo- BioEssays 19: 379–388. main proteins. Trends Genet. 12: 258–262. Greig, S., and M. Akam, 1993 Homeotic genes autonomously spec- Mann, R. S., and D. S. Hogness, 1990 Functional dissection of ify one aspect of pattern in the Drosophila mesoderm. Nature Ultrabithorax proteins in D. melanogaster. Cell 60: 597–610. 362: 630–632. Matlin, A. J., F. Clark and C. W. Smith, 2005 Understanding alter- Hatton, A. R., V. Subramaniam and A. J. Lopez, 1998 Generation native splicing: towards a cellular code. Nat. Rev. Mol. Cell. Biol. of alternative Ultrabithorax isoforms and stepwise removal of a 6: 386–398. large intron by resplicing at exon-exon junctions. Mol. Cell 2: McGinnis, W., and R. Krumlauf, 1992 Homeobox genes and axial 787–796. patterning. Cell 68: 283–302. Higuchi, R., B. Krummel and R. K. Saiki, 1988 A general method McGinnis, W., R. L. Garber,J.Wirz,A.Kuroiwa and W. J. Gehring, of in vitro preparation and specific mutagenesis of DNA frag- 1984a A homologous protein-coding sequence in Drosophila ho- ments: study of protein and DNA interactions. Nucleic Acids meotic genes and its conservation in other metazoans. Cell 37: Res. 16: 7351–7367. 403–408. Hittinger, C. T., D. L. Stern and S. B. Carroll, 2005 Pleiotropic McGinnis, W., M. S. Levine,E.Hafen,A.Kuroiwa and W. J. Gehring, functions of a conserved insect-specific Hox peptide motif. Devel- 1984b A conserved DNA sequence in homoeotic genes of the opment 132: 5261–5270. Drosophila Antennapedia and bithorax complexes. Nature 308: Holland, P. W., and J. Garcia-Fernandez, 1996 Hox genes and 428–433. chordate evolution. Dev. Biol. 173: 382–395. Meadows, L. A., D. Gell,K.Broadie,A.P.Gould and R. A. White, Hooper, J. E., 1986 Homeotic gene function in the muscles of Dro- 1994 The cell adhesion molecule, connectin, and the develop- sophila larvae. EMBO J. 5: 2321–2329. ment of the Drosophila neuromuscular system. J. Cell Sci. 107(Pt. Hughes, C. L., and T. C. Kaufman, 2002 Hox genes and the evolu- 1): 321–328. tion of the arthropod body plan. Evol. Dev. 4: 459–499. Merabet, S., Z. Kambris,M.Capovilla,H.Berenger,J.Pradel Hursh, D. A., R. W. Padgett and W. M. Gelbart, 1993 Cross reg- et al., 2003 The hexapeptide and linker regions of the AbdA ulation of decapentaplegic and Ultrabithorax transcription in Hox protein regulate its activating and repressive functions. the embryonic visceral mesoderm of Drosophila. Development Dev. Cell 4: 761–768. 117: 1211–1222. Merabet, S., M. Saadaoui,N.Sambrani,B.Hudry,J.Pradel et al., Immergluck, K., P. A. Lawrence and M. Bienz, 1990 Induction 2007 A unique Extradenticle recruitment mode in the Dro- across germ layers in Drosophila mediated by a genetic cascade. sophila Hox protein Ultrabithorax. Proc. Natl. Acad. Sci. USA Cell 62: 261–268. 104: 16946–16951. Johnson, F. B., E. Parker and M. A. Krasnow, 1995 Extradenticle Mercader, N., E. Leonardo,N.Azpiazu,A.Serrano,G.Morata protein is a selective cofactor for the Drosophila homeotics: role et al., 1999 Conserved regulation of proximodistal limb axis of the homeodomain and YPWM amino acid motif in the inter- development by Meis1/Hth. Nature 402: 425–429. action. Proc. Natl. Acad. Sci. USA 92: 739–743. Michelson, A. M., 1994 Muscle pattern diversification in Drosoph- Knoepfler, P. S., and M. P. Kamps, 1995 The pentapeptide motif of ila is determined by the autonomous function of homeotic genes Hox proteins is required for cooperative DNA binding with Pbx1, in the embryonic mesoderm. Development 120: 755–768. 758 H. C. Reed et al.

Morata, G., and S. Kerridge, 1981 Sequential functions of the bi- Scott, M. P., and A. J. Weiner, 1984 Structural relationships among thorax complex of Drosophila. Nature 290: 778–781. genes that control development: sequence homology between Nose, A., V. B. Mahajan and C. S. Goodman, 1992 Connectin: a ho- the Antennapedia, Ultrabithorax, and fushi tarazu loci of Dro- mophilic cell adhesion molecule expressed on a subset of sophila. Proc. Natl. Acad. Sci. USA 81: 4115–4119. muscles and the motoneurons that innervate them in Drosoph- Smith, C. W., and J. Valcarcel, 2000 Alternative pre-mRNA splic- ila. Cell 70: 553–567. ing: the logic of combinatorial control. Trends Biochem. Sci. 25: O’Connor, M. B., R. Binari,L.A.Perkins and W. Bender, 381–388. 1988 Alternative RNA products from the Ultrabithorax domain Spradling, A. C., and G. M. Rubin, 1982 Transposition of cloned P of the bithorax complex. EMBO J. 7: 435–445. elements into Drosophila germ line chromosomes. Science 218: Pai, C. Y., T. S. Kuo,T.J.Jaw,E.Kurant,C.T.Chen et al., 1998 The 341–347. Homothorax homeoprotein activates the nuclear localization of Sprules, T., N. Green,M.Featherstone and K. Gehring, another homeoprotein, extradenticle, and suppresses eye devel- 2003 Lock and key binding of the HOX YPWM peptide to opment in Drosophila. Genes Dev. 12: 435–446. the PBX homeodomain. J. Biol. Chem. 278: 1053–1058. Passner, J. M., H. D. Ryoo,L.Shen,R.S.Mann and A. K. Aggarwal, Struhl, G., 1982 Genes controlling segmental specification in the 1999 Structure of a DNA-bound Ultrabithorax-Extradenticle Drosophila thorax. Proc. Natl. Acad. Sci. USA 79: 7380–7384. homeodomain complex. Nature 397: 714–719. Struhl, G., 1984 Splitting the bithorax complex of Drosophila. Pearson, J. C., D. Lemons and W. McGinnis, 2005 Modulating Hox Nature 308: 454–457. gene functions during animal body patterning. Nat. Rev. Genet. Subramaniam, V., H. M. Bomze and A. J. Lopez, 1994 Functional 6: 893–904. differences between Ultrabithorax protein isoforms in Drosophila Pederson,J.A.,J.W.LaFollette,C.Gross,A.Veraksa,W.McGinnis melanogaster: evidence from elimination, substitution and ectopic et al., 2000 Regulation by homeoproteins: a comparison of expression of specific isoforms. Genetics 136: 979–991. deformed-responsive elements. Genetics 156: 677–686. Sun, B., D. A. Hursh,D.Jackson and P. A. Beachy, 1995 Ultra- Pinsonneault, J., B. Florence,H.Vaessin and W. McGinnis, bithorax protein is necessary but not sufficient for full activation 1997 A model for extradenticle function as a switch that of decapentaplegic expression in the visceral mesoderm. EMBO changes HOX proteins from repressors to activators. EMBO J. J. 14: 520–535. 16: 2032–2042. Tautz, D., and C. Pfeifle, 1989 A non-radioactive in situ hybridiza- Ponzielli, R., M. Astier,A.Chartier,A.Gallet,P.Therond et al., tion method for the localization of specific RNAs in Drosophila 2002 Heart tube patterning in Drosophila requires integration embryos reveals translational control of the segmentation gene of axial and segmental information provided by the Bithorax hunchback. Chromosoma 98: 81–85. Complex genes and hedgehog signaling. Development 129: Tour, E., C. T. Hittinger and W. McGinnis, 2005 Evolutionarily 4509–4521. conserved domains required for activation and repression func- Popperl, H., M. Bienz,M.Studer,S.K.Chan,S.Aparicio et al., tions of the Drosophila Hox protein Ultrabithorax. Development 1995 Segmental expression of Hoxb-1 is controlled by a highly 132: 5271–5281. conserved autoregulatory loop dependent upon exd/pbx. Cell Van Auken, K., D. Weaver,B.Robertson,M.Sundaram,T.Saldi 81: 1031–1042. et al., 2002 Roles of the Homothorax/Meis/Prep homolog Rauskolb, C., and E. Wieschaus, 1994 Coordinate regulation of UNC-62 and the Exd/Pbx homologs CEH-20 and CEH-40 in downstream genes by extradenticle and the homeotic selector C. elegans embryogenesis. Development 129: 5255–5268. proteins. EMBO J. 13: 3561–3569. van Dijk, M. A., and C. Murre, 1994 Extradenticle raises the DNA Rauskolb, C., M. Peifer and E. Wieschaus, 1993 Extradenticle, binding specificity of homeotic selector gene products. Cell 78: a regulator of homeotic gene activity, is a homolog of the 617–624. homeobox-containing human proto-oncogene pbx1. Cell 74: Walsh, C. M., and S. B. Carroll, 2007 Collaboration between 1101–1112. Smads and a Hox protein in target gene repression. Develop- Rauskolb, C., K. M. Smith,M.Peifer and E. Wieschaus, ment 134: 3585–3592. 1995 Extradenticle determines segmental identities through- Wang, Z., and C. B. Burge, 2008 Splicing regulation: from a parts out Drosophila development. Development 121: 3663–3673. list of regulatory elements to an integrated splicing code. RNA Rieckhof, G. E., F. Casares,H.D.Ryoo,M.Abu-Shaar and R. S. 14: 802–813. Mann, 1997 Nuclear translocation of extradenticle requires White, R. A., and M. Wilcox, 1985 Distribution of Ultrabithorax homothorax, which encodes an extradenticle-related homeodo- proteins in Drosophila. EMBO J. 4: 2035–2043. main protein. Cell 91: 171–183. White, R. A., S. E. Aspland,J.J.Brookman,L.Clayton and Ronshaugen, M., N. McGinnis and W. McGinnis, 2002 Hox pro- G. Sproat, 2000 The design and analysis of a homeotic re- tein mutation and macroevolution of the insect body plan. Na- sponse element. Mech. Dev. 91: 217–226. ture 415: 914–917. Zavortink, M., and S. Sakonju, 1989 The morphogenetic and Rubin,G.M.,andA.C.Spradling, 1982 Genetic transformation of regulatory functions of the Drosophila Abdominal-B gene are Drosophila with transposable element vectors. Science 218: 348–353. encoded in overlapping RNAs transcribed from separate pro- Ryoo, H. D., and R. S. Mann, 1999 The control of trunk Hox spec- moters. Genes Dev. 3: 1969–1981. ificity and activity by Extradenticle. Genes Dev. 13: 1704–1716. Ryoo,H.D.,T.Marty,F.Casares,M.Affolter andR.S.Mann, 1999 Regulation of Hox target genes by a DNA bound Homothor- ax/Hox/Extradenticle complex. Development 126: 5137–5148. Communicating editor: T. C. Kaufman

Supporting Information http://www.genetics.org/cgi/content/full/genetics.109.112086/DC1

Alternative Splicing Modulates Ubx Protein Function in Drosophila melanogaster

Hilary C. Reed, Tim Hoare, Stefan Thomsen, Thomas A. Weaver, Robert A. H. White, Michael Akam and Claudio R. Alonso

Copyright © 2010 by the Genetics Society of America DOI: 10.1534/genetics.109.112086

2 SI H. C. Reed et al.

FIGURE S1.—Isoform expression levels do not correlate with isoform-specific functions. Levels of Ubx expression for the different Ubx isoforms detected in Western Blot experiments using the anti-Ubx FP3.38 antibody. Embryos were recovered from a 0-4 hs collection and were left to develop for further 12 hours at 25ºC (average age 12-16hs). Sampled embryos were the progeny of the cross 69B-Gal4 x UAS-Ubx (A) or 24BGal4 x UASUbx (B). All collected embryos were heterozygous for the UAS-Ubx construct and for the Gal-4 driver construct. Embryos were dechorionated in 50% bleach and transferred to a methanol/heptane mix and washed in methanol repeated times. Before use embryos were re-hydrated in 1X PBS, 0.1% Triton X- 100, counted, transferred to protein sample buffer, boiled for 10 minutes and stored at -20ºC until use. Embryo extracts were resolved in a 10% PAGE SDS gel loading a volume equivalent to ten embryos per lane. After electrophoresis, samples were electro-transferred to a nitrocellulose membrane and subjected to a standard antibody staining protocol (Alkaline Phosphatase detection). Although expression levels for the different isoforms vary across the different transgenic lines there is no correlation between expression level and isoform in vivo function as assessed by the activation pattern of the reporter gene dpp-lacZ (summarised in C; see also Fig. 3) or the endogenous dpp gene.

H. C. Reed et al. 3 SI

FIGURE S2.—Isoform expression levels do not correlate with isoform-specific functions. (A-I) Expression levels of Ubx achieved by UAS lines for different Ubx isoforms as detected by fluorescence confocal microscopy. Stage 13 embryos carrying the 24B Gal4 driver, a UAS-GFP reporter, and a UAS-Ubx isoform construct were fixed, stained for Ubx (FP3.38) and GFP proteins, and analysed by Confocal laser scanning microscopy. Embryos from Ubx Ia and Ubx IVa lines (i.e. from transgenic lines analysed in gel lanes “Ia” and “IVa2” in Supp Fig S1) were collected and stained in parallel. All pictures were captured using identical settings in both computer and microscope, therefore fluorescence intensities can be used as an estimate for expression levels. (A-C) 24B-Gal4, UAS-GFP, UAS-UbxIa embryos. (D-F) 24B-Gal4, UAS-GFP, UAS-UbxIVa embryos. (G-I) Wildtype embryos. (J-K) Quantification of Ubx levels achieved by UAS-UbxIa and UAS-UbxIVa lines when driven by the gal-4 driver 24B. Mean values of 24B-driven Ubx expression were normalised by the endogenous levels of Ubx. Embryo areas used for signal quantification are illustrated in (J). Quantification results (K) expressed as a ratio between the 24B-driven signal over the endogenous Ubx level in one CNS hemisegment indicate the absence of significant differences in the expression levels between the transgenic lines for the different splicing isoforms (Quantification was perfomed using the histogram function of Adobe Photoshop). These experiments confirm that as suggested in western blot experiments, these two transgenic lines achieve comparable expression levels of Ubx in mesodermal tissues (labelled with GFP in green) while showing a markedly different ability to activate the molecular target dpp during embryogenesis (see Fig 3). This data further supports the conclusion that qualitative differences in the structure of the proteins compared in this study are causal to the distinct activation patterns of the dpp target gene. (All embryos in ¾ ventral view oriented with anterior to the left).

4 SI H. C. Reed et al.

FIGURE S3.—Increased levels of ectopic UbxIb do not lead to the activation of dpp-lacZ in the somatic mesoderm. All embryos carry the dpp-lacZ reporter gene and were stained with an anti-β-galactosidase antibody. (A-B) Expression of dpp-lacZ at stage 13 (A) and stage 16 (B) when UbxIb is expressed throughout the mesoderm with the 24BGal-4 driver line. Little β- galactosidase expression is seen in the somatic mesoderm. (C-D). The expression of dpp-lacZ at stage 13 (C) and stage 16 (D) when UbxIb is expressed throughout the mesoderm with a combination of 24B-Gal4 and twist-Gal4 driver lines. The delivery of higher levels of UbxIb fails to activate dpp-lacZ in the somatic mesoderm. This experiment further confirms that there is no correlation between isoform expression level and in vivo function as revealed by the dpp activation patterns (see Fig. 3). (All embryos are in dorsal view, oriented with anterior to the left; SM: somatic mesoderm).

H. C. Reed et al. 5 SI

FIGURE S4.—In vitro DNA-binding assays with Ubx proteins. (A) [35S] labelled natural Ubx isoforms (see lanes Ubx Ia wt and Ubx IVa wt) and artificially engineered Ubx isoforms (lanes Ubx Ia ALA and Ubx IVa ALA) were expressed in a rabbit reticulocyte system and analysed by PAGE-SDS. Exd wild type was also expressed and analysed in the same manner (lane Exd wt). All preparations rendered products of appropriate size. Note that translation reactions without RNA program produced no visible products (lanes ‘no program’). Quantification of the [35S] signal from relevant bands was normalised by the number of methionines in each protein product and used to estimate protein units (see Materials and Methods). Molecular weight standards are indicated to the left of the panel. (B) Sequence of the Hox-Exd composite element used in DNA binding experiments. Hydrogen bonds between bases and aminoacid residues in Ubx (red) or Exd (blue) are indicated by solid lines. Core sites for each protein are also indicated (boxes). This diagram was prepared from crystallographic data and other information provided in reference (Passner et al. 1999). (C) Electrophoretic mobility shift assay (EMSA) with the Hox-Exd probe testing the specificity of protein-DNA complexes detected in our experiments. Ubx and Exd proteins were incubated with a [32P] labelled Hox-Exd double stranded oligonucleotide and the products were resolved in a low-ionic strength polyacrylamide gel. In the absence of competitor, Ubx and Exd produce a clear protein-DNA ternary complex (lane 1) of low mobility (arrow). When homologous unlabelled oligo (specific competitor) was added, the complexes detected disappear as the molarity of the competitor increases (lanes 2-4). When identical amounts of an unlabelled non-specific competitor of similar length were added to the reaction (lanes 5-7), the signal in ternary complexes remained stable, confirming that the detected DNA binding activity was specific for the labelled probe. (D) PhosphorImager quantification of the experiment shown in (C). Maximum relative binding, detected in the absence of competitor has been defined as 100%. Competition level is plotted as fold of unlabelled competitor relative to labelled probe. For further details on binding quantification please see Materials and Methods. 6 SI H. C. Reed et al.

FIGURE S5.—Ubx protein expression in wild type and UbxMX17 mutants. (A-B) Ubx protein expression in wild type (A) and UbxMX17 (B) extended germ band embryos (Stage 10). Both genotypes show the characteristic Ubx protein expression in the epidermis from PS6-PS12 with lower expression levels detected in PS5. (C-D) Ubx protein expression in wild type (C) and UbxMX17 (D) Stage 16 embryos displaying Ubx signal in the epidermis and the CNS. As in earlier stages, both genotypes show identical patterns of expression. Note that Ubx expression can be detected with very high resolution: see, for instance, that both genotypes show signal in a subset of the ventral midline cells (arrows) which contribute to the population of glial cells in the developing CNS. Ubx proteins were detected using the FP3.38 monoclonal antibody (which detects all Ubx isoforms) in parallel for both genotypes. (All embryos with anterior to the left, A-B in lateral view, C-D in ventral view).