Signaling Pathways Coupled to Melatonin Receptor MT1 in Gastric Smooth Muscle

Home , Melanopsin, Melatonin receptor

Virginia Commonwealth University VCU Scholars Compass

Theses and Dissertations Graduate School

2010

Rashad Ahmed Virginia Commonwealth University

Follow this and additional works at: https://scholarscompass.vcu.edu/etd

Part of the Physiology Commons

Downloaded from https://scholarscompass.vcu.edu/etd/2192

This Thesis is brought to you for free and open access by the Graduate School at VCU Scholars Compass. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. Signaling Pathways Coupled to Melatonin Receptor MT1

in Gastric Smooth Muscle

A thesis submitted in partial fulfillment of the requirements for the degree of Masters of Science at Virginia Commonwealth University.

Rashad Ahmed Bachelor of Arts in Government and Politics, University of Maryland College Park, 2007

Director: S. Murthy Karnam, Ph.D. Professor, Department of Physiology and Biophysics

Virginia Commonwealth University Richmond, Virginia January 2010

1 Acknowledgements

I would like to thank the people who made this possible:

My family for their endless support.

My friends for the continual encouragement and support, Sally Fayed, Jen Kim, Othman

Alshboul and John Chung.

Dr. Sunila Mahavadi for her unwavering support, insightful advice, and able guidance in lab.

Dr. Vijay Lyall and Shobha Mummalaneni for their assistance in the Ca 2+ measurements and Dr. Mohammed Khaleduzzaman in RT-PCR studies.

My committee members, Dr. John Grider and Dr. Imad Damaj for their cooperation and assistance throughout this process.

Dr. Jay Kuemmerle for providing insightful suggestions and guidance during weekly lab meetings.

Finally, I would like to thank Dr. S. Murthy Karnam for all the help and providing profound support and direction to make this project possible.

TABLE OF CONTENTS

Acknowledgments………………………………………………………….……………..2

List of Figures……………………………………………………………………………. 5

Abstract……...………………………………………………………………...………….6

Chapter A INTRODUCTION…………………………………………………………… 8

1- Melatonin Synthesis in Pineal Gland…………………...………………………8

2- Melatonin Synthesis in Gastrointestinal Tract...…...………………………….11

3- The Role of Melatonin in Circadian Rhythm ………………………………...13

4- Melatonin receptor signaling………………………………………………….15

5- Effects of Melatonin in Gastrointestinal Tract………………………………..17

6- Gastric Motility……………………………………………………………….20

Chapter B METHODS………………………………………………………………….. 23

1- Collection of Tissue…………………………………………………………...23

2- Preparation of dispersed gastric smooth muscle cells……………………….. 23

3- Preparation of cultured gastric smooth muscle cells……………………….…24

4- Expression of MT1 in smooth muscle cells by RT-PCR………………….....24

5- Expression of MT1 in smooth muscle cells by Western Blot………....….…25

6- Identification of G proteins coupled to MT1………………………………….26

3 7- Phosphoinositide (PI)-specific phospholipase C (PLC-β) activity…….…….27

8- Measurement of Ca 2+ release………………………………………………….28

9- Measurement of contraction in dispersed smooth muscle cells………………28

10- Materials……………………………………………………………………..29

11- Statistics Analysis……………………………………………………………30

Chapter C RESULTS………………………………………………………………...…. 31

1- Expression of MT1 in gastric smooth muscle……………………………… 31

2- Identification of G-proteins coupled to MT1 receptors in smooth muscle…..31

3- Signaling pathways activated by MT1 in gastric smooth muscle……………32

Chapter D DISCUSSION………………………………………………………….…… 58

Chapter E REFERENCES……………………………………………………………. ..65

Vita……………………………………………………………………………………….76

List of Figures

Figure 1: Expression of MT1 receptors in gastric smooth muscle cells………………... 37

Figure 2: Partial nucleotide sequence of MT1-R receptors from rabbit gastric muscle cells……………………………………….. ……………………………………………39

Figure 3: Activation of G i1 proteins by melatonin in dispersed muscle cells…………..41

Figure 4: Activation of G i2 proteins by melatonin in dispersed muscle cells…………..43

Figure 5: Activation of G i3 proteins by melatonin in dispersed muscle cells…………..45

Figure 6: Activation of G s proteins by melatonin in dispersed muscle cells……………47

Figure 7: Activation of Gq proteins by melatonin in dispersed muscle cells…………..49

Figure 8: Concentration-response curve for the stimulation of melatonin-induced PLC-β activity in dispersed gastric muscle cells………………………………………………..51

Figure 9. Inhibition of melatonin-stimulated PLC-β activity by G αq miniene………..53

Figure 10: Melatonin-induced increase in cytosolic Ca 2+ in single muscle cells………..55

Figure 11: Melatonin-induced muscle contraction in dispersed gastric muscle cells….50

Figure 12: Pathways mediating muscle contraction by melatonin……………………...64

5 Abstract

Signaling Pathways Coupled to Melatonin Receptor MT1a in

Gastric Smooth Muscle

Rashad Ahmed, B.S.

A thesis submitted in partial fulfillment of the requirements for the degree of Masters of Science at Virginia Commonwealth University.

Virginia Commonwealth University, 2009.

Director: S. Murthy Karnam, Ph.D. Professor, Department of Physiology and Biophysics

The Melatonin, a close derivative of serotonin, is involved in physiological regulation of circadian rhythms. In the gastrointestinal (GI) system, melatonin exhibits endocrine, paracrine and autocrine actions and is implicated in the regulation of GI motility.

Generally, melatonin actions oppose the stimulatory actions of serotonin on motility.

However, it is not known whether melatonin can also act directly on GI smooth muscle cells. The aim of the present study was to determine the expression of melatonin receptors in smooth muscle and identify their signaling pathways. Muscle cells were isolated from rabbit distal stomach by enzymatic digestion, filtration and centrifugation and cultured in

DMEM-10. Expression of melatonin receptors, MT 1 and MT 2, was determined by RT-

PCR and Western blot. G protein activity was measured by melatonin-induced increase in

Gα binding to [ 35 S]GTP γS. Phosphoinositide (PI)-specific phospholipase C (PLC-β) activity was measured by ion-exchange chromatography. Cytosolic Ca 2+ was measured in

6 fura-2 loaded cells and muscle contraction was measured by scanning micrometry. In cultured gastric smooth muscle cells MT 1 was detected by RT-PCR and western blot.

Melatonin activated G αq, but not G αs, Gαi1 , G αi2, or G αi3 . Consistent with activation of

2+ Gαq, melatonin stimulated PLC-β activity (PI hydrolysis), increased cytosolic Ca , and elicited muscle contraction. Stimulation of PLC-β activity was blocked by the expression of G αq minigene and contraction was blocked by the PLC-β inhibitor, U73122. We conclude that gastric smooth muscle cells express receptors for melatonin (MT 1) coupled

2+ to G q. The receptors mediate stimulation of PLC-β activity and increase in cytosolic Ca , and elicit muscle contraction.

7 A-INTRODUCTION

Melatonin (N-acetyl-5-methoxytrypatmine), a derivative of 5-hydroxytryptomin

(serotonin) and an endogenous signal of darkness, is an important component of the body’s

internal time-keeping system and regulates diverse physiological processes such as diurnal

rhythm and gastrointestinal secretions and motility. Melatonin is also an effective

antioxidant, which scavenges free radicals and upregulates several antioxidant enzymes,

and anti apoptotic signaling molecules. Although melatonin is synthesized in many organs,

the major source of circulating melatonin is the pineal gland.

1- Melatonin Synthesis in Pineal Gland

Melatonin synthesis has been well investigated in the pineal gland. The amino acid tryptophan, the primary precursor of melatonin, is absorbed frommet the circulation into the gland [1]. The uptake process relies on transport mechanisms to cross the blood-brain barrier [1]. Tryptophan then converts to 5-hydroxytryptophan by tryptophan-5- hydroxylase, an enzyme found in mitochondria requiring a pteridine cofactor [1]. The reaction is rate-limiting in the formation of serotonin, and this enzyme is limited to only serotoninforming tissue. The rate of reaction is directly related to the amount of tryptophan. Manual administration of large amounts tryptophan results in increased formation of serotonin [1]. Decarboxylation of 5-hydroxytryptophan results in the formation of serotonin (5-hydroxytryptamine), and is conducted by aromatic amino acid decarboxylase, a cytoplasmic enzyme [1]. This enzyme has broad specificity and is widely distributed in tissue requiring pyricoxal phosphate as a cofactor. Interestingly, constant light appears to have a stimulatory effect on this process[1]. The next step in melatonin synthesis is N-acetylation of serotonin. Arylalkylamine - N-acetyltransferase (AA-NAT),

8 the enzyme responsible for this reaction, uses acetyl co-enzyme A as a cofactor. NAT is

present in many tissues and is likely a rate limiting step in melatonin synthesis [1]. The

final step is O-methylation of N-acetylserotonin by hydroxyindole-O-methyltrasnferase

(HIOMT). HIOMT transfers a methyl group from S-adenosyl methionine (SAM). \ AA-

NAT and HIOMT are the key enzymes in melatonin synthesis [2].

Synthesis of melatonin is mainly seen at night and relates to the peak of AA-NAT activity [3]. Recently, studies indicated that the main factor in regulating rhythmic and light-induced changes in AA-NAT activity is the steady-state level of AA-NAT proteins, which in turn reflects the balance of its synthesis and degradation [4]. These processes can be regulated by distinct mechanisms and the significance of each of them is species specific [5]. In humans, nocturnal synthesis of melatonin in the pineal gland is mainly controlled by the central circadian clock, located in the hypothalamic suprachiasmatic nucleus [6]. The circadian clock stimulates norepinephrine release from dense pineal sympathetic fibers. Norepinephrine elevates the intracellular cAMP concentration via β- adrenergic receptors and activates the cAMP-dependent protein kinase A, the essential pathway for the regulation of AA-NAT synthesis and activity. In some mammals, cAMP/protein kinase A protects the enzyme from degradation [7]. Therefore pinealocytes constantly produce AA-NAT from continuously available AA-NAT mRNA. This protein immediately undergoes proteasomal proteolysis during the day, in the absence of noradrenergic stimulation. On the other hand, nocturnal elevation of the cAMP level causes phosphorylation of AA-NAT via protein kinase protecting the enzyme from degradation. Hence, increases of intracellular concentrations of AA-NAT are incongruence with increases in enzyme activity. In rodents, the cAMP/protein kinase pathway induces

9 transcriptional activation of the AA-NAT gene, the primary mechanism initiating

melatonin biosynthesis. In contrast, the importance of a transcriptional regulation of the

AA-NAT gene for melatonin production in humans is questionable [8]. Thus, analysis of

pineal tissue, taken from regular autopsies, showed significant rhythm for the correlation

between time of death and both AA-NAT activity and melatonin content, while AA-NAT

and HIOMT mRNA, as well as HIOMT activity showed no diurnal rhythm [8]. Although

dominant mechanisms for the generation of rhythmic melatonin synthesis in the human

pineal gland remain to be clarified, it is generally accepted that AA-NAT is alternating

melatonin synthesis with photoperiodic variation in duration, while the level of HIOMT

activity may tune the seasonal magnitude of hormone production [9, 10].

The rhythmical production of melatonin in the pineal gland accurately reflects

environmental light conditions; light exposure can significantly suppress nocturnal

melatonin secretion [11]. It has been reported that theses non-visual effects of light are

mediated by the retinohypothalamic tract, a distinct neural pathway mediating the

regulation of melatonin production by light [12, 13], which is initiated in the photoreceptor

system. The mammalian eyes perceive light and dark cycles which entrain the neural

activity of the suprachiasmatic nucleus, and alter the rhythmic secretion of melatonin from

the pineal gland [14]. However, it has been shown recently that rod and cone photoreceptors of the retina do not participate in this pathway [15]. In effect, light at a wavelength of 555 nm, providing a peak effect on the visual system [16], suppresses melatonin synthesis in healthy humans approximately four times less than monochromatic light at 505 nm [14].The visual photoreceptors conducting these effects remain unknown

[14]. Moreover, light-induced melatonin suppression and circadian entrainment have been

10 demonstrated in humans with specific color vision deficiencies [17] or complete visual blindness [18]. These studies suggest that melatonin biosynthesis is controlled, at least in part, by photoreceptors that differ from the known visual photoreceptors [14]. Recent studies on various vertebrate species identified several new molecules that may serve as circadian photopigments. These pigments include opsin- based molecules (e.g. vertebrate ancient opsin [19], melanopsin [20] and peropsin [21] ) as well as non-opsin molecules

(bilirubin [22] and cryptochrome [14, 23] ). Among these new photopigments, only melanopsin has been discovered in the human neural retina [24]. Consequently, the diurnal rhythmical production of melatonin is controlled by diverse mechanisms characterized by highly adaptive plasticity regulatory mechanisms, most of which need to be further studied and researched.

2- Melatonin Synthesis in Gastrointestinal Tract

In 1976, Raikhlin and Kvetnoy were one of the first to illustrate melatonin production by serotonin-rich enterochromaffine (EC) cells in the gastrointestinal tract acting as a paracrine molecule and hormone released into the portal vein [25]. Several studies revealed that gastrointestinal tract substantially contributes to the peripheral blood concentrations of melatonin. Considering the size of the gastrointestinal tract relative to the pineal gland, it has been estimated that there is 400 times more melatonin in the gut than in the pineal gland. Melatonin concentrations in the gut surpass levels in the blood

10-100 fold. Melatonin does not seem to be uniformly distributed and concentration varies in various regions of the gut. In the digestive tract, melatonin has been identified using a variety of methods including imuunocytochemical, chromatographic and

11 radioimmuonomethods. Additionally, the melatonin synthesizing enzyme is reportedly present in the gut as well as its synthesis from its precursor, serotonin, in EC cells of the intestinal mucosa. Oral application of tryptophan (150 mg/kg), a known precursor to melatonin, in rats causes a rapid elevation of circulating melatonin that was higher than that acquired after administration of this amino acid [26]. Ligation of the portal vein led elimination of the increment in plasma level of melatonin following the tryptophan application. On the other hand, plasma level of melatonin remained unaffected upon pinealectomy, suggesting the gastrointestinal tract by itself is the major source of circulating melatonin after oral tryptophan application [26]. Melatonin is present in gastrointestinal tract mucosa even under fasting conditions, yet this melatonin content in the gastrointestinal tract increases exponentially following food intake and tryptophan administration [26]. A number of other studies using immunohistochemistry and radioimmunoassay techniques, validated by HPLC [27-30] confirmed the presence of melatonin in gastrointestinal tract mucosa and indicated that enterochromaffine cells are the main source of melatonin in human gastrointestinal tract aside from the pineal gland.

Similarly, Messner, who studied the distribution of melatonin in human hepatobiliary- gastrointestinal tract, verified high concentration of melatonin in gastric and duodenal mucosa with considerable amounts of this indole excreted into the bile [31].

Furthermore, extrapineal melatonin synthesis was more or less accepted when melatonin-synthesizing enzymes, Nacetyltransferase [35] and hydroxyindole-O- methyltransferase [36] were detected in the gastrointestinal tract. Through the use of transcriptionpolymerase chain reaction, the presence of both enzymes was confirmed [37].

Additional research confirmed there are fundamental differences between pineal-produced

12 and GIT-produced melatonin. While pineal-produced melatonin acts mostly as an

endocrine substance, extrapineal-derived melatonin functions not only in endocrine, but

also in autocrine, paracrine and luminal capacity [38, 39]. There are also substantial

differences in the mode of secretion and response to food intake. Whereas nighttime levels

of melatonin in blood are mostly of pineal origin, day-time melatonin concentrations in

blood are produced mostly in the GIT [40]. Because of high levels of melatonin in the GIT

tissues and the large size of the GIT, the amount of melatonin in GIT is quite high. In

1994, Gerald Huether calculated that at any moment of the day or night, GIT contains at

least 400 times more melatonin than the pineal gland [41].

3- The Role of Melatonin in Circadian Rhythm

Melatonin signals time of day and time of year in mammals based on its pattern of

secretion, which defines ‘biological night.’ Animal studies revealed the fundamental role

of melatonin as a photoneuroendocrine transducer of information on day length.

Melatonin, by its changing duration of secretion at different day lengths (the longer the night the greater the duration of hormone secretion), is probably a universal biological signal indicating darkness [1, 42, 43]. Imposition of different day lengths in humans shows a conserved photoperiodic response, and the evidence indicates that melatonin acts as a biological signal for dawn and dusk in humans, as well as other species [44-47]. There is evidence that the timing of melatonin secretion is closely associated with the timing of sleep tendency [45, 48]. The timing of peak melatonin concentration coincides closely to the nadirs of core body temperature, alertness and performance, clearance of plasma triglycerides, and other night-time phenomena [49]. There is also evidence of melatonin’s

13 influence on glucose homeostasis [50], the immune system [51], and cardiovascular function [52].

Certainly humans sleep better during the appropriate period of melatonin secretion; yet, is this due to melatonin itself, other factors, or to the whole circadian system working in orchestra? In 1997 a study showed if melatonin is present at an abnormal phase during the day, it is strongly associated with daytime naps [53]. The significance of melatonin presence in sleep cycle can be seen by pharmacological suppression of daytime melatonin production which diminishes daytime sleepiness, and treatment with exogenous melatonin at night which restores night-time sleep [54, 55]. Pharmacological inhibition of endogenous melatonin by atenolol heightens the human phase-shifting response to light

[56]. If given at an appropriate circadian phase, exogenous melatonin can act in congruence with light and can also partially counteract light for phase-shifting [57, 58].

Therefore, melatonin’s presence modifies circadian responses. Based on these few observations, it appears the presence of melatonin hinders rapid adaptation to phase-shift as originally observed in rats [1] and that persons treated with b1 antagonists are likely to suffer less jet-lag and to adapt more readily to night work than untreated individuals. It is also reasonable to state that appropriate combinations of light and melatonin treatment should be more efficient in the changing phase than either treatment alone; however, there is little information on this subject. Although the evidence is not compelling, it has been suggested that melatonin from the digestive tract may be secreted into the blood in a circadian manner, as it is from the pineal gland. The circadian rhythm of gastrointestinal tract melatonin depends on the type of digestion each species exhibits (e.g., diurnal vs. nocturnal mon-gastric vs. ruminants).

14 4- Melatonin receptor signaling

Two mammalian subtypes of G-protein coupled melatonin receptors have been

cloned and identified, MT1 and MT2 [59, 60]. While both share generally similar binding

characteristics for 125I-melatonin, the human MT2 receptor has a lower affinity

(Kd=160pmol/l) compared to the human MT1 receptor (Kd = 20 – 40 pmol/l) [61].

However both are of high affinity and the agonist binding is guanosine triphosphate

(GTP)-sensitive [60].

There has been discussion of a third melatonin binding site, “MT3,” yet it was later characterized as the enzyme quinine reductase 2 [61]. Belonging to a group of reductastes that participate in the protection against oxidative stress, enzyme quinine reductase prevents electron transfer reactions of quinones. Additionally, functional and ligand binding studies have shown the existence of low affinity (Kd in the 10 nm range) melatonin membrane binding sites in the preoptic area of the hypothalamus and in the medulla-pons in rats and hamsters [62-64]. Furthermore, melatonin interacts with intracellular proteins such as calmodulin , calreticulin, or tubulin and antagonizes the binding of Ca2+ to calmodulin [65-69]. These interactions are most likely related to some of the physiological effects of melatonin but critical data regarding this point have yet to be obtained.

MT1 and MT2 receptors are expressed both singly and together in various tissues of the body [70, 71, 60]. Functional MT1 receptors have been localized in the SCN [72,

60], cerebellum [73], hippocampus [74], central dopaminergic pathways [75], ovary [76], retina [77], coronary blood vessels and aorta [78, 79], liver and kidney [80], and the gallbladder [81]. Melatonin MT2 receptors are more restrictively expressed, being found

15 mainly in the brain, although their presence has also been detected in the lung, cardiac, aortic and coronary tissue, myometrium and granulosa cells, immune cells, duodenum and adipocytes [60]. The ‘‘MT3 receptor’’ is expressed in the liver, kidney, brain, heart, lung, intestine, muscle and brown adipose tissue [82].

After binding to its membrane-bound receptors, melatonin changes the conformation of the Alpha-subunit of specific intracellular G proteins. It regulates cell function via intracellular second messengers such as cAMP, calcium ions, cGMP, DAG.

PKC, and Arachidonic acid; yet, the signal transduction pathways for melatonin receptors appear to differ among varying tissues and cell types [83, 84]. Activation of G-Alpha I through the binding of melatonin to MTR1 inhibits cAMP formation, PKA activity, resulting in a decrease in CREB phosphorylation. Aside from the cAMP-dependent cascade, MTR1 can mediate a PLC-dependent signal transduction cascade directly or indirectly via G-BetaGamma subunits for phosphoinositide turnover and activate PKC.

Activation of MTR1 by melatonin also increases phosphorylation of MAPK or MEK1 and

MEK2 and ERK1/2. Interestingly, receptors themselves can modulate formation of arachidonic acid and JNKs. Comprehensive regulation of activator protein-1a, a transcription factor produced by the early gene products of c-Fos and c-Jun, has been observed by the MAPK pathways, specifically ERK1, ERK2, and JNKs.

Furthermore, melatonin also has regulatory effects on several ion channels. Binding of melatonin to MTR1 receptors potentiates vasoconstriction via blocking calcium- activated potassium channels in smooth muscle cells. The obstruction of this channel may be due to a decrease in cAMP and in phosphorylation of the calcium-activated potassium channel by PKA. In addition, melatonin directly vasoconstricts cerebral arteries through

16 inhibition of calcium-activated potassium channels. MTNR1As also couple to the GIRK

(G-protein-activated Inward Rectifier Potassium)/Kir 3 channels.

Activation of MTNR1Bs modulates levels of cAMP and cGMP. Like the case with

MTNR1A, activation of the MTNR1B by melatonin inhibits cAMP formation.

Additionally, MTNR1B activation leads to the inhibition of cGMP formation. Inhibition occurs through proteins upstream of the Guanylyl Cyclase such as NOS. In the SCN, melatonin increases PKC activity through activation of GN-AlphaQ, which activates the

PLC and DAG pathway. MT1 activation of Gq proteins has been shown to mediate calcium mobilization via activation of the inositol-specific phospholipase C (PLC) [85] and activation of protein kinase C [86]. The melatonin receptors also serve as the mediators of several other physiological responses to melatonin. These responses include

(i) phase advance of circadian rhythms in the isolated SCN, which involves PKC activation; (ii) enhancement of cell-mediated and humoral immunity; (iii) inhibition of leukocyte rolling in the microvasculature; and (iv) inhibition of proliferation of human choriocarcinoma cells, probably by delay of the G1 to S cell cycle transition. Furthermore, activation of MTR2 decreases the expression of the glucose transporter GLUT4 that in turn decreases glucose uptake in human brown adipocytes, modulates neuronal activity in the hippocampus, and mediates vasodilation in arterial beds.

5- Effects of Melatonin in Gastrointestinal Tract

Melatonin has a special importance in the gastrointestinal tract because the enterocromaffin cells of the gut are the main source of extrapineal melatonin. Melatonin modulates gastrointestinal motility, transport of ion and electrolytes and postprandial

17 sequential activation of gastrointestinal tract. Numerous studies demonstrated that melatonin exerts protective and healing effects in gastric ulcers and experimental colitis.

Direct antioxidative effect and release of endogenous prostaglandins are associated with these effects [115]. Melatonin administration at pharmacological doses decreases free radical formation and leads to substantial recovery of the major antioxidative enzymes

[39]. In addition, melatonin has pleiotropic effects on the immune system causing an enhancement of both innate and cellular immunity, which underlies its immunomodulatory role in inflammation [80]. Therapeutic potential of melatonin in the recovery of gallbladder neuromuscular function during acute cholecystitis and aging was also reported, but the exact cellular mechanism through which melatonin exerts its effects in the gallbladder are not known [116, 117].

Many factors released in the gut modulate motility and secretion. Melatonin plays a particularly important role in modulation of gastrointestinal functions reflecting the cyclic pattern of food intake. Binding to selective receptors expressed on the smooth muscles and myenteric plexus cells of gastrointestinal tract allows melatonin to have a significant influence on gastrointestinal motility. The basal mechanism underlying the gastrointestinal smooth muscle contraction is the cyclic generation of the electrical current.

The myoelectric activity of gastrointestinal tract is comprised of two kinds of potentials – slow way and spiked activity coordinated in the myoelectric migrating complex (MMC). Internal and external autonomic nerves modulate the Interstitial Cajal’s pacesetter cells (ICC) [87]. ICC produces the basic electrical rhythm (BER) which is simply the generation of slow waves determining bowel motility.

18 Frequency of the slow wave determines the contraction/relaxation activity of the gastrointestinal smooth muscle. The intestinal pacemaker is located in the duodenal bulb, near the pylorus, and is independent from the gastric electrical activity pacemaker. The duodenal region is where the frequency and velocity of slow waves are greatest and decreases caudally [88, 89]. In the rat, the duodenal slow wave frequency ranges from 20 to 40 cycles per minute and has greater amplitude and plateau than the jejunum.

Furthermore, the BER amplitude ranges from -55 to -35 mV [90]. This electrical activity can be used as an indicator of gastro duodenal coordination because it is greatly influenced by a number of paracrine and neurocrine factors. Melatonin in the fasted state induces dramatic reduction of the irregular spike activity (ISA) on the entire intestine including phase III of the MMC. Periodicity of MMC length decreased by 50% [91]. This study revealed effects of melatonin on myoelectric activity provide strong evidence that melatonin relaxes the bowel by acting mostly on phasic contractions.

The gastrointestinal tract motility depends on a dark-light cycle. Namely, motility is activated more during daylight than during the dark period. The latest reports provided data that melatonin plays an important role in regulation of the gastrointestinal motility. In fact, it has been documented that postprandial motor response is shorter in the dark phase than in the light phase and this effect can be reversed by melatonin antagonist [92].

There is belief that endogenous melatonin act on pre and postprandial intestinal motility at night and this effect has also been observed with exogenously administered hormone. Additionally, there are findings that melatonin reinforce cyclic pattern of MMC but inhibit occurrence of irregular spike activity [91]. There is also apparent interaction between melatonin and CCK in terms of motility. Melatonin was found to reduce the

19 duration of CCK stimulatory effects on gastrointestinal smooth muscle [92]. There is speculation that melatonin is released to the lumen of proximal bowel in response to food intake and travels to the distal part. This may in part explain why the MMC pattern first reappears in the distal part of the bowel in the end period of satiety.

However, present reports are inconsistent in the matter of the melatonin’s role on gut motility. Martín at al. suggests that melatonin release induced by lipid infusion alleviate inhibitory effect of lipid related ileal break suggesting that melatonin plays a modulatory role on gastric emptying [93]. These results correspond partially with reports of Drago at al. who observed that small doses of melatonin accelerate the intestinal transit in rats. High doses reversed stimulatory effects of lower doses of melatonin indicating that intestinal melatonin receptors might mediate melatonin effects. Moreover, administered intraperitoneally melatonin increased intestinal myoelectrical activity. This effect was reversed by the competitive receptor antagonist, Luzindole, and seems to be mediated by peripheral receptors [94].

6- Gastric Motility

Gastric smooth muscle activity is responsible for two fundamental patterns of motility, mixing and propulsion. The formation of chyme, a liquefied state of partly digested food, is formed through a process of mixing, crushing, and grinding of ingested food. Subsequently, smooth muscle activity forces the chyme through the pyloric canal, into the small intestines, a process known as gastric emptying. Based on motility pattern, the stomach can be divided into two regions harboring either tonic contraction or phasic contraction.

20 The proximal stomach, composed of primarily the fundus, shows low frequency, sustained contractions that are responsible for generating a basal pressure within the stomach. Importantly, these tonic contractions also generate a pressure gradient from the stomach to small intestine and are therefore responsible for gastric emptying. Swallowing of food and consequent gastric distention inhibits contraction of this region of the stomach, allowing it to increase in volume and form a large reservoir without a significant increase in pressure. This phenomenon is called "adaptive relaxation."

The distal stomach, comprised of primarily the antrum, develops strong peristaltic waves of contraction that increase in amplitude as they propagate toward the pylorus.

These powerful contractions constitute a very effective gastric grinder; they occur about 3 times per minute in people. There is a pacemaker in the smooth muscle of the greater curvature that generates rhythmic slow waves from which action potentials and hence peristaltic contractions propagate. Gastric distention strongly stimulates this type of contraction, accelerating liquefaction and gastric emptying. The pylorus is functionally part of this region of the stomach. When the peristaltic contraction reaches the pylorus, its lumen is effectively degraded; chyme is thus delivered to the small intestine.

A study by Kasimay et al. [95] indicated that melatonin inhibit gastric motility by interacting with serotonin receptors present on the on vagal afferent fibers via vago-vagal inhibitory reflexes. Storr et al. [96, 97] has demonstrated the expression of MT1, but not

MT2 receptors using RNA isolated from the muscle layers of rat stomach and intestine.

Addition of melatonin to isolated muscle strips inhibited non-aderenergic and non- cholinergic mediated relaxations, but had an effect on exogenous nitric oxide (NO)- mediated relaxation. In synaptosomal preparations melatonin inhibited basal nNOS

21 activity. These results suggest that melatonin actions are mediated by inhibition of nNOS activity via MT1 receptors. In addition to its effect on basal nNOS activity, melatonin was shown to suppress nNOS express in rat hypoglassal nucleus following peripheral nerve injury [98], nNOS activity in rat striatum [99] and eNOS activity in rat cerebellum [100].

These studies indicate the difficulties in identifying the signaling pathways activated by melatonin in vivo and in innervated in vitro preparations. The effect of melatonin may vary in different specific regions of the gut depending on whether the activated receptor is present predominantly on smooth muscle cells or enteric neurons.

Transmitters released from the enteric neurons, in turn, modulate the intrinsic electrical and mechanical activity of the gastrointestinal smooth muscle. To avoid the confounding effects of neural activation by melatonin, the present study has characterized the receptors for melatonin and the signaling pathways to which these receptors are coupled in freshly dispersed and cultured smooth muscle cells of the gut.

22 B- METHODS

1- Collection of tissue

Rabbits were sacrificed by injection of Euthasol (100 mg/kg body weight) into the

ear vein. The stomach was rapidly removed, emptied of its contents and placed in a cold

smooth muscle buffer with the following composition: NaCl 120 mM, KCl 4 mM,

KH 2PO 4 2.6 mM, CaCl 2 2.0 mM, MgCl 2 0.6 mM, HEPES (N-2-hydroxyethylpiperazine-

N’ 2-ethanesulfonic acid) 25 mM, glucose 14 mM, and essential amino mixture 2.1%

(pH7.4)

2- Preparation of dispersed gastric smooth muscle cells

The antrum was separated from the rest of the stomach and the mucosal layer was

removed by sharp dissection. Smooth muscle cells from the circular muscle layer of the

antrum were isolated by sequential enzymatic digestion of muscle strips, filtration, and

centrifugation as described previously [101-108]. The antrum was cut into thin slices

using a Stadie-Riggs tissue slicer and then the slices were incubated for 30 min in a

smooth muscle buffer at 31 °C containing 0.1% collagenase (300 U/ml) and 0.01%

soybean trypsin inhibitor (w/v). The tissue was continuously gassed with 100% oxygen

during the entire isolation procedure. The partly digested tissues were washed twice with

50-ml of collagenase-free smooth muscle buffer and the muscle cells were allowed to

disperse spontaneously for 30 min in collagenase-free medium. Cells were harvested by

filtration through 500 m Nitex and centrifuged twice at 350 g for 10 min to eliminate broken cells and organelles. The cells were counted in a hemocytometer and it is

23 estimated that 95% of the cells excluded trypan blue. The experiments were done within

2-3 h of cell dispersion.

3- Preparation of cultured gastric smooth muscle cells

Dispersed muscle cells isolated from the antrum were resuspended in DMEM containing penicillin (200 U/ml), streptomycin (200 g/ml), gentamycin (100 g/ml),

amphotericin B (2.5 g/ml) and 10% fetal bovine serum (DMEM-10). The muscle cells

5 were plated at a concentration of 5 X 10 cells/ml and incubated at 37 °C in a CO 2

incubator. DMEM-10 medium was replaced every three days for 2-3 weeks until

confluence was attained. The muscle cells in confluent primary cultures were trypsinized

(0.5 mg trypsin/ml), re-plated at a concentration of 2.5 X 10 5 cells/ml and cultured under

the same conditions. All experiments were done on cells in the first passage. Previous

studies have determined the purity of cultured muscle cells with smooth muscle-specific

γ-actin [109]. Cultured muscle cells were starved in serum-free medium for 24 hours

before each use.

4- Expression of MT1 in smooth muscle cells by RT-PCR

Total RNA was isolated from smooth muscle cells with TRIzol® reagent

(Invitrogen) and treated with TURBO DNase (Ambion). RNA from each preparation was

reversely transcribed using the SuperScript™ II system containing 50 mM Tris–HCl (pH

8.3), 75 mM KCl, 3 mM MgCl 2, 10 mM dithiothreitol (DTT), 0.5 mM deoxynucleoside

triphosphates (dNTP), 2.5 M random hexamers and 200 units of reverse transcriptase in a 20 l reaction volume. The reactions were carried out at room temperature for 10 min

24 and at 42°C for 50 min, and terminated by heating at 70°C for 15 min. Three l of the reversely transcribed cDNA was amplified in a final volume of 50 l by PCR in standard conditions (2 mM MgCl 2, 200 M dNTP, 2.5 units Taq polymerase) with specific primers designed based on conserved sequences in human, rat and mouse cDNAs: MT1

(Forward:TTCATTGGTCTTGCAGTGGCCTCAG; Reverse:GAACATCCTTGCTGTA

CACATTGAG) and MT2: (Forward: TTGTCCACCGTGCTCATCGTCACCAC;

Reverse:TGGCCTTGCAATGCGCCTCTCCCAG). PCR for MT1 and MT2 receptors was performed for 30 cycles. For each experiment, a parallel control without reverse transcriptase was processed. The amplified PCR products were analyzed on 1.5% agarose gel containing 0.1 g/ml ethidium bromide [109].

5- Expression of MT1 in smooth muscle cells by Western Blot

Muscle cells were solubilized in Triton X-100-based lysis buffer plus protease and phosphatase inhibitors (100 g/ml PMSF, 10 g/ml aprotinin, 10 g/ml leupeptin, 30 mM sodium fluoride and 3 mM sodium vanadate). After centrifugation of the lysates at 20000 g for 10 min at 4 °C, the protein concentrations of the supernatant were determined with a

Dc protein assay kit from Bio-Rad. Equal amount of proteins were fractionated by

SDS/PAGE, and transferred on to nitrocellulose membrane. Blots were blocked in 5%

(w/v) non-fat dried milk/TBS-T [tris-buffered saline (pH 7.6) plus 0.1% Tween-20] for 1 h and then incubated overnight at 4 °C with various primary antibodies in TBS-T plus 1%

(w/v) non-fat dried milk. After incubation for 1 h with horseradish-peroxidase-conjugated corresponding secondary antibody (1:2000; 10 g/ml, Pierce) in TBS-T plus 1% (w/v) non-fat dried milk, immunoreactive proteins were visualized using SuperSignal Femto

25 maximum sensitivity substrate kit (Pierce). All washing steps were performed with TBS-

T. The protein bands were identified by enhanced chemiluminescence reagent [110-112].

6- Identification of G proteins coupled to MT1

G proteins selectively activated by melatonin was identified from the increase in

Gα binding to the [ 35 S]GTP γS (5’-O-3-thiotriphosphate) as described previously [106-

108] . Ten ml of muscle cell suspension (3 X 10 6 cells/ml) were homogenized in 20 mM

HPES medium (pH 7.4) containing 2 mM MgCl 2, 1 mM EDTA and 2 mM DTT. After centrifugation at 30,000 g for 15 min, the crude membranes were solubilized for 60 min at

4 °C in 20 mM HEPES medium (pH 7.4) containing 2 mM EDTA, 240 mM NaCl, 0.5%

CHAPS (3-[(3-cholamidopropyl) dimethylammonio]-1-pro-panesulfonate), 2 mM PMSF,

20 g/ml aprotinin, and 20 M leupetin. The membrane were incubated for 20 min at

37 °C with 60 nM [ 35 S]GTP γS in the presence or absence of melatonin (1 µM) in a solution containing 10 mM HEPES (pH 7.4), 100 M EDTA and 10 mM MgCl2. The reaction was terminated with 10 volumes of 100 mM of Tris-HCl medium (pH 8.0) containing 10 mM MgCl 2, 10 mM NaCl and 10 M GTP, and the mixture was placed in wells precoated with specific antibodies to G αq, G αi1 , G αi2 , G αi3 , and G αs. Coating with

G protein antibodies (1:1000) was done after the wells were first coated with anti-rabbit

IgG (1:1000) for 2 h on ice. After incubation for 2 h on ice, the wells were washed three times with phosphate buffer saline solution (PBS) containing 0.05% Tween-20 and the radioactivity from each well was counted by liquid scintillation. The amount of

[35 S]GTP γS bound to the activated G α subunit was expressed as counts per minute (cpm) per milligram of protein.

26 7- Phosphoinositide(PI)-specific phospholipase C (PLC-βββ) activity

PI hydrolysis (PLC-β activity) was determined in freshly dispersed or cultured smooth muscle cells by measuring the formation of inositol phosphates using ion- exchange chromatography as previously described [101-103]. Ten ml of cell suspension

(2 x 10 6 cells/ml) were labeled with myo-[3H] inositol (15 Ci/ml) for 90 min at 31 °C.

Then cells were centrifuged at 350 g for 10 min to move excess [ 3H]inositol and resuspended in 10 ml of fresh medium. Lithium was added to a final concentration of 10 mM and the suspension was incubated for another 10 min. Melatonin was added to 0.5 ml of cell suspension and the mixture was incubated in a shaking water bath for 1 min.

Cultured smooth muscle cells were labeled with [ 3H]myo-inositols (0.5 Ci/ml) for 24 h in inositol-free DMEM medium. The cultures were washed with phosphate-buffered saline (PBS) and treated with anandamide (1 l) for 1 min in HEPES medium (pH 7.4).

The reaction was terminated by the addition of chloform:methanol:HCl (50:100:1 v/v/v).

After chloroform (310 l) and water (310 l) were added, the samples were vortexed and the phases were separated by centrifugation at 1000 g for 15 min. The upper aqueous phase was applied to a column containing 1 ml of 1:1 slurry of Dowex AG-1 X8 resin

(100-200 mesh in formate form) and distilled water.

The column was washed with 10 ml of water followed by 10 ml of 5 ml sodium tetraborate-60 mM ammonium formate to remove [ 3H]glycerophosphoinositol. Total inositol phosphates were eluted with 6 ml of 0.8 M ammonium formate-0.1 M formic acid. The eluates were collected into scintillation vials and counted in gel phase after addition of 10 ml of scintillant. The results were expressed as counts per minute per mg protein.

27 8- Measurement of Ca 2+ release

2+ Melatonin-induced increase in [Ca ]i was measured by fluorescence in single

smooth muscle cell loaded with fluorescent Ca 2+ dye fura 2 [113]. Dispersed muscle cells were plated on coverslips for 12 h in DMEM. After being washed with PBS, the cells were loaded with 5 µM fura 2-AM for 1 h at room temperature. The cells were visualized

through a x40 objective (ZEISS; 0.9 NA) with a Zeiss Axioskop 2 plus upright fluorescence microscope and imaged with a setup consisting of a charge coupled device camera (Imago, TILL Photonics, Applied Scientific Instrumentation, Eugene, OR) attached to an image intensifier. The cells were alternately excited at 380 and 340 nm.

The background and autofluorescence were corrected from images of a cell without the fura 2. Results are expressed as increased in 340/380 ratio.

9- Measurement of contraction in dispersed smooth muscle cells

Contraction in freshly dispersed gastric circular smooth muscle cells was determined by scanning micrometry as previously described [101-113]. An aliquot (0.4 ml) of cells containing approximately 10 4 cells/ml was treated with 1 M melatonin in the presence and absence of the PLC β inhibitor U73122 (10 M) for 30 s and the reaction was terminated with 1% acrolein at a final concentration of 0.1%. Acrolein kills and fixes cells without affecting the cell length. The resting cell length was determined in control experiments in which muscle cells were incubated with 100 l of 0.1% bovine serum albumin without the agonists. The mean lengths of 50 muscle cells treated with various agonists was measured by scanning micrometry and compared with the mean lengths of

28 untreated cells. The contractile response was expressed as the percent decrease in mean

cell length from control cell length.

10- Materials

Melatonin was purchased from Bachem (Torrance, CA). [3H]myo-inositol were obtained from PerkinElmer Life Sciences, (Boston, MA). Polyclonal antibodies to MT1,

MT2, G αi1, G αi2, G αi3, G αs, and G αq were purchased from Santa Cruz Biotechnology

(Santa Cruz, CA). Western blotting, Dowex AG-1 X 8 resin (100-200 mesh in formate form), chromatography material and protein assay kit, 15% Tris-HCl Ready Gels were obtained from Bio-Rad Laboratories (Hercules, CA); collagenase and soybean trypsin inhibitor were obtained from Worthington Biochemical (Freehold, NJ). RT- PCR primers were purchased from Integrated DNA technologies, Inc (Coralville, IA). Fura-

2/AM was obtained from Molecular Probes (Carlsbad, CA). Effectene Transfection

Reagent, QIAEX®II Gel extraction Kit and QIAprep®Spin Miniprep Kit were obtained from QIAGEN Sciences, Maryland; PCR reagents were obtained from Applied

Biosystems, Roche; SuperScript TM II Reverse Transcriptese and TOPO TA Cloning® Kit

Dual Promoter were obtained from Invitrogen, CA; EcoR I was obtained from New

England Bio Labs; Dulbecco’s modified Eagle’s medium (DMEM) was obtained from

Fisher Scientific. All other chemicals were obtained from Sigma, St. Louis, MO.

New Zealand white rabbits (weight: 4-5 lbs) were purchased from RSI

Biotechnology, Clemmons, NC and were housed in the animal facility administered by

the Division of Animal Resources, Virginia Commonwealth University. Animals were

killed by sodium pentobarbital overdose (100 mg/kg), as approved by the Institutional

29 Animal Care and Use Committee of the Virginia Commonwealth University. All

procedures were conducted in accordance with the Institutional Animal Care and Use

Committee of the Virginia Commonwealth University.

11- Statistics Analysis

The results were expressed as means + S.E. of n experiments and analyzed for statistical significance using Student’s t-test for paired and unpaired values. Each

experiment was done on cells obtained from different animals. Differences among

multiple groups were tested by using ANOVA and checked for significance using

Fisher’s protected least significant difference test. A probability of P< 0.05 was

considered significant.

30 C- RESULTS

1- Expression of MT1 in gastric smooth muscle

Specific primers for MT1 and MT2 were designed based on the conserved sequences in human, rat and mouse cDNAs. MT1, but not MT2 receptors were detected by RT-PCR on RNA extracted from cultures of gastric smooth muscle cells in first passage (Fig. 1). PCR product of the expected size (225 bp) was obtained. The isolated partial nucleotide sequence of rabbit MT1 was similar to the corresponding amino acid sequences of human (86%) and rat (83%) (Fig. 2). As shown previously [109], the use of confluent cultures of smooth muscle in first passage ensured the absence of neural,

endothelial, or interstitial cell contaminants and the presence of PCR product in cultured

muscle cells demonstrate the expression of MT1 mRNA in smooth muscle cells.

Expression of MT1 and MT2 receptor protein was examined by western blot

analysis using selective antibody to MT1 or MT2. The results demonstrate the expression

of MT1 of predicted size (36 kDa) in the homogenates of isolated smooth muscle cells

(Fig 1). Expression of MT2 was not detected in the homogenates of dispersed gastric

muscle cells.

2- Identification of G proteins coupled to MT1 receptors in smooth muscle

Studies in various tissues and cell lines suggest that MT1 receptors are coupled to

activation of G proteins, but the specific G proteins coupled to MT1 receptors in smooth

muscle has not been identified. Muscle cells membranes were incubated with [ 35 S]GTP γS

(60 nM) in the presence or absence of melatonin (1 µM) and the aliquots were added to

31 wells precoated with different G α antibodies; an increase in the binding of [ 35 S]GTP γS

complexes to a specific G α antibody reflected the activation of the corresponding G

protein. In some experiments low concentrations of GTP γS stimulated binding of

35 [ S]GTP γS to G αi2 , G αq and G αs. However, incubation of muscle membranes with

melatonin in the presence of low concentrations GTP γS caused a significant increase in

35 the binding of [ S]GTP γS selectively to G αq (392 ±45% increase above basal levels, p<

0.001, n=8), but not to G αi1, Gαi2 , G αi3 , or G αs (Figs. 3-7). These results suggest that

MT1 receptors are preferentially coupled to activation of G q in gastric smooth muscle.

Previous studies in gastric smooth muscle disclosed the presence of G αi1 , G αi2 , G αi3 ,

Gαs, and G αq and activation of G proteins in smooth muscles is receptor specific:

somatostatin sstr3 receptors are coupled to G i1 , opioid δ receptors are to G i2 , muscarinic

m2 receptors are coupled to activation of G i3 , muscarinic m3 receptors are coupled to

expression of G q and VPAC2 receptors are coupled to G s [106, 107, 111, 114].

3- Signaling pathways activated by MT1 in gastric smooth muscle

Previous studies in smooth muscle have shown that activation of G q by excitatory

neurotransmitters such as acetylcholine and substance P results in the stimulation of

phosphoinositide(PI)-specific phospholipase C (PLC-β) activity, generation of inositiol

1,4,5-trisphosphate (IP3) and IP3-dependent Ca2+ release leading to smooth muscle

contraction. The effector enzyme stimulated by G q proteins coupled to MT1 receptors

was examined by measurements of inositol formation in response to melatonin in cells

labeled with [3H]myo-inositol. As expected from the activation of G q, incubation of muscle cells with melatonin for 60 s caused an increased in inositol formation in a

32 concentration-dependent fashion with an IC 50 of 4 ±1 nM (Fig. 8). The increase was significant at 10 nM (1473 ±104 cpm/mg protein above basal levels of 896 ±101cpm/mg protein, p<0.01, n=4) and a maximal increase was obtained at 1 µM (7142 ±351 cpm/mg protein/mg protein above basal levels, p<0.001, n=4). The extent of stimulation of PLC-β activity with melatonin was similar to that obtained with other contractile agonists such as acetylcholine or substance P in gastric smooth muscle cells [111].

The G protein involved in the activation of PLC-β activity in response to melatonin was obtained by expression of G α minigenes in cultured smooth muscle cells.

The synthetic peptide corresponding to the COOH terminus of G α subunits selectively antagonized G protein activation by blocking receptor-G protein interaction [112, 113].

Minigene plasmid constructs that encode COOH-terminal peptide sequence of G αi and

Gαq were expressed to selectively block G i and G q activation, respectively. Treatment of cultured muscle cells with melatonin (1 M) caused a significant increase in PLC-β activity and the extent of stimulation was closely similar to that obtained in freshly dispersed smooth muscle cells (5867 ±980 cpm/mg protein above basal levels in cultured smooth muscle cells and 6245 ±1005 cpm/mg protein above basal levels in freshly dispersed smooth muscle cells). Expression of G αq minigene blocked PLC-β activity in response to melatonin (Fig. 9). In contrast, expression of G αi minigene had no effect on

PLC-β activity (Fig. 9). The results suggest that MT1 receptor coupled to activation of

PLC-β activity via Gαq and is consistent with the selective activation of G αq by melatonin.

33 Activation of PLC-β results in the generation of inositol 14,5-trisphosphate (IP3) and IP3-dependent Ca 2+ release from intracellular sarcoplasmic reticulum stores [114].

Consistent with the activation of G q and stimulation of PLC-β activity, addition of

melatonin to cells loaded with fura-2 resulted in an increase in cytosolic Ca 2+ (Fig. 10).

The increase in Ca 2+ was not affected by removal of extracellular Ca 2+ suggesting that the

increase is due to release of Ca 2+ from intracellular stores.

Stimulation of PLC-β activity and increase in intracellular Ca2+ by contractile

agonists in smooth muscle leads to muscle contraction. The functional significance of

MT1 receptor-mediated stimulation of PLC-β activity and increase in cytosolic Ca 2+ was

examined by measurements of muscle contraction by scanning micrometry. Contraction

was measured as decrease in muscle cell length in response to melatonin compared to

control cell length. Treatment of muscle cells with 1 µM melatonin caused 25 ±42%

(p<0.001, n=6) decrease in cell length (control cell length 125 ±4 µm) (Fig. 11). The

extent of contraction induced by melatonin is similar to that obtained with other

contractile agonists such as acetylcholine, substance P, ATP, sphingosine 1-phosphate

(27 ±3% to 32 ±4% decrease in cell length) in smooth muscle cells [111, 112, 114].

Melatonin-induced contraction was blocked by the selective PLC-β inhibitor, U-73122

(10 M) (5 ±3% contraction in the presence of U73122) (Fig. 11). These results suggest

that contraction in response to melatonin was mediated via activation of PLC-β and

generation of IP3 and IP3-dependent Ca 2+ release.

34 In summary,

1. MT1, but not MT2 receptors are expressed in gastric smooth muscle cells.

2. MT1 receptors are coupled to activation of G q, but not G s, G i1 , G i2 and G i3

3. Melatonin induced activation of PI-specific PLC-β activity in a concentration-

dependent manner in freshly dispersed muscle cells.

4. Melatonin also stimulated PLC-β activity in cultured smooth muscle cells and the

stimulation was blocked in cells expressing G αq minigene, but not G αi minigene

5. Melatonin induced an increase in cytosolic Ca 2+ in the absence of extracellular Ca 2+ .

6. Melatonin elicited muscle contraction and the response is similar to other contractile

agonists such as acetylcholine, as shown previously. Contraction was inhibited by the

PLC-β inhibitor U73122 consistent the stimulation of PLC-β activity and increase in

intracellular Ca 2+ by melatonin.

Figure 1: Expression of MT1 receptors in gastric smooth muscle cells. A) . Total

RNA isolated from cultured (first passage) rabbit gastric muscle cells was reverse transcribed, and cDNA was amplified with specific primers for MT1 or MT2.

Experiments were done in the presence or absence of RT. PCR product with predicted size (226) was obtained in the presence of RT only with primers for MT1. B) Western blot analysis of lysates prepared from dispersed smooth muscle cells (lane 1) and cultured gastric smooth muscle cells (lane 2) of rabbit and cultured gastric smooth muscle cells of rat (lane 3). Proteins were probed with polyclonal antibodies to MT1 (1:1000) or MT2

(1:1000). A protein band corresponding to 36 kDa was obtained with only MT1 antibody.

Figure 1

RT-PCR Western Blot

MW + RT - RT 1 2 3

Figure 2. Partial nucleotide sequence of MT1-R receptors from rabbit gastric

muscle cells. The RT-PCR product from cultured rabbit gastric smooth muscle cells was sequenced.

Figure 2

TGC CAT TTG CTG GGC TCC TCT AAA CTT CAT TGG TCT TGC AGT GGC CTC AGA CCC TGT CAG CAT GGT ACC CAG AAT CCC AGA GTG GCT GTT TGT GGC TAG TTA TTA CAT GGC AAT ATT TCA ACA GCT GTC TCA ATG CAA TCA TAT ATG GAC TAC TGA ACC AGA ATT TCC GGG AGG AAT ATA GAA GAA TTA TAA TCT CAA TGT GTA CAG CAA GGA TGT TCT TTG TGG A

Figure 3. Activation of G i1 proteins by melatonin in dispersed muscle cells.

Membranes were isolated from dispersed gastric muscle cells and incubated with

[35 S]GTP γS for 20 min in the presence or absence of melatonin (1 µM). Aliquots were added to wells coated with G αi1 antibody for 2 h and bound radioactivity from each well was counted by liquid scintillation. The amount of [ 35 S]GTP γS bound to the activated Gα subunit was expressed as counts per minute (cpm) per milligram of protein. Melatonin did not induce significant increase in the binding of [ 35 S]GTP γS.G α complexes to wells coated with G αi1 antibody. Values are mean ±SEM of 4 experiments.

Figure 3

Gi1 Activation

1200 g

i )

n 1000

o 800

α α α α

g S 600

γ γ γ γ

T m 400

p G

]

(

5 200

3 [ 0

Basal GTP γγγS GTP γγγS + Melatonin

Figure 4. Activation of G i2 proteins by melatonin in dispersed muscle cells.

Membranes were isolated from dispersed gastric muscle cells and incubated with

[35 S]GTP γS for 20 min in the presence or absence of melatonin (1 µM). Aliquots were added to wells coated with G αi2 antibody for 2 h and bound radioactivity from each well was counted by liquid scintillation. The amount of [ 35 S]GTP γS bound to the activated G α

subunit was expressed as counts per minute (cpm) per milligram of protein. Melatonin

did not induce significant increase in the binding of [ 35 S]GTP γS.G α complexes to wells coated with G αi2 antibody. Values are mean ±SEM of 4 experiments.

42 Figure 4

Gi2 Activation

g 1200

)

n 1000

i e

α α α α 800

g S γ γ γ γ 600 m

T m

G 400

]

( S

[ 200

0 Basal GTP γγγS GTP γγγS

+ Melatonin

Figure 5. Activation of G i3 proteins by melatonin in dispersed muscle cells.

Membranes were isolated from dispersed gastric muscle cells and incubated with

[35 S]GTP γS for 20 min in the presence or absence of melatonin (1 µM). Aliquots were added to wells coated with G αi3 antibody for 2 h and bound radioactivity from each well was counted by liquid scintillation. The amount of [ 35 S]GTP γS bound to the activated G α subunit was expressed as counts per minute (cpm) per milligram of protein. Melatonin did not induce significant increase in the binding of [ 35 S]GTP γS.G α complexes to wells coated with G αi3 antibody. Values are mean ±SEM of 4 experiments.

Figure 5

Gi3 Activation

g 1200

)

i 1000 n

α α α α 800

γ γ γ γ 600

p G 400

]

(

3 200

[

0 Basal GTP γγγS GTP γγγS + Melatonin

Figure 6. Activation of G s proteins by melatonin in dispersed muscle cells.

Membranes were isolated from dispersed gastric muscle cells and incubated with

[35 S]GTP γS for 20 min in the presence or absence of melatonin (1 µM). Aliquots were added to wells coated with G αs antibody for 2 h and bound radioactivity from each well

was counted by liquid scintillation. The amount of [ 35 S]GTP γS bound to the activated G α

subunit was expressed as counts per minute (cpm) per milligram of protein. Melatonin

did not induce significant increase in the binding of [ 35 S]GTP γS.G α complexes to wells

coated with G αs antibody. Values are mean ±SEM of 4 experiments.

Figure 6

Gs Activation

1200 g

n i

)

i 1000

i e

α α α α 800

g S 600

γ γ γ γ

/ P

T m

p 400

] c

(

3 200 [

0 Basal GTP γγγS GTP γγγS + Melatonin

Figure 7. Activation of G q proteins by melatonin in dispersed muscle cells.

Membranes were isolated from dispersed gastric muscle cells and incubated with

[35 S]GTP γS for 20 min in the presence or absence of melatonin (1 µM). Aliquots were

added to wells coated with G αq antibody for 2 h and bound radioactivity from each well was counted by liquid scintillation. The amount of [ 35 S]GTP γS bound to the activated G α subunit was expressed as counts per minute (cpm) per milligram of protein. Melatonin induced significant increase in the binding of [ 35 S]GTP γS.G α complexes to wells coated with G αq antibody. Values are mean ±SEM of 4 experiments. ** P< 0.001

Figure 7

G Activation q

g 6000

)

i 5000 n

α α α α 4000

γ γ γ γ 3000

/ P

T m

G 2000

] c

(

5 3 1000 [

0 Basal GTP γγγS GTP γγγS +

Melatonin

Figure 8. Concentration-response curve for the stimulation of melatonin-induced

PLC-βββ activity in dispersed gastric muscle cells. Phosphoinositide-specific (PI) hydrolysis (PLC-β activity) in response to melatonin was measured in muscle cells labeled with myo-[3H]inositol. Freshly dispersed muscle cells were treated for 60 s with different concentrations of melatonin and PLC-β activity was measured as increase in water-soluble [ 3H]inositol formation. The results are expressed as [ 3H]inositol phosphate formation in counts per minute (cpm) per mg protein above basal levels (cpm/mg protein). Values are means ±SEM of 4 experiments. ** P< 0.01

Figure 8

Stimulation of PI Hydrolysis

) l 9000

t i 8000

)

o n

i 7000

t ] 6000

[

p 5000

(

i 4000

y 3000

p r 2000

( y 1000

I 0

P -12 -11 -10 -9 -8 -7 -6 -5

Melatonin (log M)

Figure 9. Inhibition of melatonin-stimulated PLC-β activity by G αααq minigene

3 Cultured gastric muscle cells labeled with myo-[ H]inositol and expressing G αq minigene, G αi minigene, or control vector were treated with melatonin (1 M) for 60 s.

Total [ 3H]inositol phosphates were separated by ion-exchange chromatography. PLC-β

activity stimulated by melatonin was abolished in cells expressing G αq minigene, but was

3 not affected in cells expressing G αi minigene. Results are expressed as total [ H]inositol

phosphate formation in cpm/mg protein. Values are means ± S.E. of four experiments.

** Significant inhibition from control response (P<0.01)

52 Figure 9

8000 Basal

)

l Melatonin

s ) 6000 o

]

[

(

i 4000

(

H 2000

Control Gαααq Gαααi minigene minigene

Figure 10. Melatonin-induced increase in cytosolic Ca 2+ in single muscle cells.

Muscle cells were loaded with 5 M fura-2 and treated with 1 M melatonin in the

absence of extracellular Ca 2+ . The cells were alternately excited at 380 nm and 340 nm.

The background and autofluorescence were corrected from images of a cell without the fura 2. Results are expressed as 340/380 ratio and an increase in ratio reflects an increase in cytosolic Ca 2+ . The figure shows results obtained from 38 cells.

54 Figure 10

Increase in Cytosolic Ca 2+

1.5

1.4

1.3

1.2

340/380 340/380 Ratio 1.1

1.0

1M Melatonin 1M Melatonin 0.9 0 500 1000 1500 2000

Milli seconds

Figure 11. Melatonin-induced muscle contraction in dispersed gastric muscle cells.

Contraction of muscle cells was measured as decrease in basal cell length in response to

melatonin (1 M). Muscle cells (0.5 ml cell suspension) were treated with melatonin (1

M) in the presence or absence of U73122 (10 M). The mean length of 50 muscle cells was measured by scanning micrometry and was compared with the length of untreated muscle cells. The contractile response was expressed as the percent decrease in the mean cell length from control cell length. Melatonin induced a significant decrease in cell muscle length that was blocked by the PLC-β inhibitor, U73122 (10 M). Values are

means ±SEM of 6-8 experiments.

56 Figure 11

Muscle contraction

) 35

g 30 n

n 25 l

c t 20 c

a i

t e 15 n

e C 10

c e 5

( 0 Melatonin + U73122

57 D- DISCUSSION

Melatonin release from pineal gland displays a circadian rhythmic pattern with the increased release during nighttime and decreased release during the daytime.

Melatonin is also released from serotonin-rich enterochromaffin cells in the gut, but the release does not exhibit a pronounced circadian rhythm but seems to depend on the nutritional state. Melatonin regulates rhythmic changes in gastrointestinal motility.

Several in vitro studies in isolated muscle strips demonstrated that the actions of melatonin are complex and involve both direct and indirect effects on smooth muscle including antagonistic relationship between serotonin and melatonin [95-100, 115-121].

The present study characterized the signaling pathways mediated by melatonin receptors in gastric smooth muscle cells using biochemical, molecular and functional methods. The results demonstrate the expression of MT1, but not MT2 receptors in gastric smooth muscle cells and their ability to stimulate PLC-β activity, increase intracellular Ca 2+ and induce smooth muscle contraction.

The evidence for the coupling of MT1 receptors to G q-dependent stimulation of

PLC-β activity and to elicit muscle contraction was based on a combination of experimental strategies.

(i) mRNA and protein expression of MT1 was demonstrated in cultured muscle cells by RT-PCR and in isolated muscle cells by western blot. MT2 receptors are not detected by RT-PCR or western blot analysis, raising the possibility that the expression of these proteins is either absent or not abundant in these cells. The selective expression of

MT1 receptors in smooth muscle cells of the gut is consistent with their expression in

58 other cells types of the gut. Receptors for melatonin have been identified in the gut of

several species. Storr et al [96, 97] has demonstrated the expression of MT1, but not MT2

receptors using RNA isolated from the muscle layers of stomach and intestine. The

distribution of melatonin receptors through the gut seems to vary with species [122, 123)

and their density as well as their affinity for the ligand may vary over the photoperiod

[124].

(ii) The MT1 receptors are coupled to activation of G q. Selective activation of G q

was demonstrated using [ 35 S]GTP γS and subtype-selective G protein antibodies.

35 [ S]GTP γS.G α complexes activated by melatonin bound selectively to G αq antibodies reflecting activation of G q proteins. No melatonin induced increase in the binding to

35 Gαi1 , G αi2 , G αi3 , or G αs antibodies to [ S]GTP γS could be detected. Studies in various cell lines suggest that MT1 are coupled to both PTx-sensitive and PTx–insensitive G proteins [83, 115]. Our studies demonstrate that MT1 receptors are coupled to PTX- insensitive G q protein. The coupling of MT1 to G proteins likely depends on the cell type and the relative abundance of G protein subtype.

(iii) Melatonin caused an increase in PLC-β activity (PI hydrolysis) in a concentration-dependent fashion. The extent of increase was similar to that obtained with other G q-coupled receptors (e.g., muscarinic m3 receptors) in gastric smooth muscle cells. Previous studies in these muscle cells have shown that receptors coupled to both

Gq and G i proteins stimulate PI hydrolysis via distinct PLC-β isoforms. G q coupled receptors such as muscarinic m3, sphingosine-1-phosphate 2 (S1P2), endothelin ETA, purinergic P2Y2, and NPY2 are coupled to stimulation of PI hydrolysis via G αq- dependent PLC-β1 isozyme, whereas G i3 -coupled m2, P2Y2, and adenosine A1

59 receptors, G i1 -coupled somatostatin sst3 receptors, G i2 -coupled opioid, , κ, δ receptors,

and G i1/2 -coupled S1P2 receptors are coupled to stimulation of PI hydrolysis via G βγi -

dependent PLC-β3 isozyme [106-108, 112]. Thus, P2Y2 and S1P2 receptors are coupled

to stimulation of PI hydrolysis via both Gαq-dependent PLC-β1 isozyme and G βγi-

dependent PLC-β3 isozyme. Although all four PLC-β isozymes are expressed in the

smooth muscle of the gut, neither PLC-β2 nor PLC-β4 is activated [104]. PLC-β1 is

activated via binding of its COOH-terminal tail, a characteristic feature of PLC-β

isozymes, to G αq, whereas PLC-β3 is activated via binding to its NH2-terminal

pleckstrin homology (PH) domain to G βγi. Phosphatidylinositol 4,5-bisphosphate (PIP 2)

is the predominant phosphoinositide substrate hydrolyzed by both PLC-β1 and PLC-β3

isozyme, resulting in the generation of diacylglycerol, an activator of protein kinase C

2+ (PKC) and inositol 1,4,5-trisphosphate (IP 3), a diffusible Ca -mobilizing messenger.

The specific G proteins involved in the stimulation of PLC-β activity by

melatonin was examined using minigene approach. Previous studies have shown that the

COOH-terminus of G protein α subunits is critical in mediating receptor-G protein

interaction and peptides corresponding to COOH-terminus serve as competitive inhibitors

of receptor-G protein interaction [112, 113]. The minigene plasmid vectors were

designed to express the COOH-terminal peptide sequences of various G α subunits after transfection into cells. In gastric muscle cells transfection of minigene plasmid constructs that encode oligonucleotide sequences corresponding to G αq completely

blocked the activation of PLC-β activity by melatonin. The results provide evidence that

60 MT1 receptors are coupled to stimulation of PLC-β activity via G q and this is consistent with the selective activation of G q.

(iv) Melatonin, as other Gq-coupled receptors, induced an increase intracellular

Ca 2+ in single muscle cells. The increase in Ca 2+ was not affected by removal extracellular Ca 2+ suggesting that the source of Ca 2+ was intracellular. This is consistent with the activation of PLC-β activity which results in the generation of Ca 2+ mobilizing messenger IP3.

(v) Consistent with the stimulation of PLC-β activity and increase in intracellular

Ca 2+ in response to melatonin, addition of melatonin to dispersed gastric muscle cells elicited rapid (30 s) muscle contraction. Contraction was blocked by the PLC-β inhibitor

U73122. The extent of muscle contraction was similar to the other contractile agonists such as acetylcholine and substance P [108, 111]. In smooth muscle of the gut, various

Gq protein-coupled receptor agonists initiate contraction by increasing cytosolic Ca 2+ via

IP3-dependent Ca 2+ release from sarcoplasmic Ca 2+ stores. The sarcoplsmic Ca 2+ stores contain high-affinity IP3 receptors and release Ca 2+ in response to increase in cytosolic

IP3 levels. Three types IP3 receptors, IP3R-I, IP3 R-II and IP3 R-III, have been cloned.

Although smooth muscle of the gut expresses both IP3 R-I and IP3 R-II, only IP3 R-I is involved in Ca 2+ -release in response to receptor activation [110]. The increase Ca 2+ and the binding of Ca 2+ to calmodulin results in the stimulation of Ca 2+ /calmodulin-dependetn

19 myosin light chain (MLC) kinase activity and phosphorylation of MLC20 at Ser , a prerequisite for initiation of actomyosin interaction and muscle contraction [114].

Studies by Lucchelli et al [118] also demonstrated direct contractile effect of melatonin in gastrointestinal smooth muscle. These studies demonstrated that melatonin

61 and its analogues induced contractile responses in guinea pig isolated proximal colon in a

concentration-dependent manner. The rank of agonist potency was: 2-indomelatonin>6-

chloromelatonin>N-acetyl-5-HT>5-MCA-NAT>melatonin, an order typical for MT2

receptors. However, prazosin, an α-adrenoreceptor antagonist possessing moderate/high affinity for melatonin MT2 sites had no effect on melatonin-induced contractions. While the rank order of agonist potencies would suggest the participation of MT2 receptors, the ineffectiveness of prazosin on melatonin-induced contractions suggests to the contrary.

The lack of MT1 selective anatagonists precluded the conclusion of implicating MT1 receptors. Melatonin responses were also resistant to atropine and tetradotoxin suggesting a direct effect on muscle cells.

In contrast to contractile effect, studies by Storr et al [96, 97] have demonstrated that addition of melatonin to isolated gastric and intestine muscle strips caused inhibition of NANC-mediated muscle relaxation via MT1 receptors. These studies indicate the difficulties in identifying the signaling pathways activated by melatonin in innervated muscle strips. The effect of melatonin may vary in different species and different regions of the gut depending on whether the activated receptor is present predominantly on smooth muscle cells or enteric neurons. Our studies provide evidence for the involvement of MT1 receptors in melatonin-induced contraction is isolated muscle cell devoid of neural elements.

In summary, the present study demonstrated that gastric smooth muscle cells express receptors (MT1) for melatonin preferentially coupled to G q. These receptors are coupled to stimulation of PLC-β activity and Ca 2+ release from intracellular stores resulting in muscle contraction (Fig. 12).

Figure 12. Pathway mediating muscle contraction by melatonin. In gastric smooth

muscle, melatonin interacts with MT1 receptors, which is coupled to stimulation of

phosphoinositide-specific phospholipase C (PLC-β) via Gq. Stimulation of PLC-β activity results in the generation of inositol 1,4,5-trisphosphate (IP3) and IP3-dependent

Ca 2+ release leading to muscle contraction.

63 Figure 12

E- References

1. Arendt J. Melatonin and the mammalian pineal gland. London: Chapman Hall; 1995.

2. Axelrod J, Weissbach H: Enzymatic O-methylation of N-acetyl-serotonin to melatonin. Science 1960; 131: 1312–1318.

3. Falcón J, Gallarneau K, Weller JL, Galit Chen BR, Coon SL, Klein DC: regulation of arylalkylamine N-acetyltranferase-2 (AANAT2, 2.3.1.87) in the fish pineal organ: evidence for a role of proteasomal proteolysis. Endocrinology 2001; 142: 1804–1813.

4. Gastel JA, Roseboom PH, Rinaldi PA, Weller JL, Klein DC: Melatonin production: proteasomal proteolysis in serotonin N-acetyltransferase regulation. Science 1998; 279: 1358–1360.

5. Klein DC, Baler R, Roseboom PH, Weller JL, Bernard M, Gastel JA, Zatz M, Iuvone PM, Begay V, Falcon J, Klei DC, Baler R, Roseboom PH: The molecular basis of the pineal melatonin rhythm: regulation of serotonin N-acetylation; in Lydic R, Baghdoyan H (eds): Handbook of Behavioral State Control: Cellular and Molecular Mechanisms. Boca Raton, CRC, 1998, vol 4, pp 45–59.

6. Barinaga M: How the brain’s clock gets daily enlightenment. Science 2002; 295: 955– 957.

7. Schomerus C, Korf HW: Mechanisms regulating melatonin synthesis in the Mammalian pineal organ. Ann NY Acad Sci 2005; 1057: 372–383.

8. Ackermann K, Bux R, Rub U, Korf HW, Kauert G, Stehle JH: Characterization of human melatonin synthesis using autoptic pineal tissue. Endocrinology 2006; 147: 325–3242.

9. Garidou ML, Bartol I, Calgari C, Pevet P, Simonneaux V: In vivo observation of a nonnoradrenergic regulation of Arylalkylamine N-acetyltransferase gene expression in the rat pineal complex. Neuroscience 2001; 105: 721–729.

10. Ribelayga C, Pevet P, Simonneaux V: HIOMT drives the photoperiodic changes in the amplitude of the melatonin peak of the Siberian hamster. Am J Physiol Regul Integr Comp Physiol 2000; 278:R1339–R1345.

11. Rollag MD, Niswender GD: Radioimmunoassay of serum concentrations of melatonin in sheep exposed to different lighting regimens. Endocrinology 1976; 98: 482–489.

12. Fukuhara C, Liu C, Ivanova TN, Chan GC, Storm DR, Iuvone PM, Tosini G: Gating of the cAMP signaling cascade and melatonin synthesis by the circadian clock in mammalian retina. J Neurosci 2004; 24: 1803–1811.

65 13. Moore RY: Organization and function of a central nervous system circadian oscillator: the suprachiasmatic hypothalamic nucleus. Fed Proc 1983; 42: 2783–2789.

14. Brainard GC, Hanifin JP, Rollag MD, Greeson J, Byrne B, Glickman G, Gerner E, Sanford B: Human melatonin regulation is not mediated by the three cone photopic visual system. J Clin Endocrinol Metab 2001; 86: 433–436.

15. Lucas RJ, Foster RG: Photoentrainment in mammals: a role for cryptochrome? J Biol Rhythms 1999; 14: 4–10.

16. Rodieck RW: The First Steps in Seeing. Sunderland, Sinauer, 1998.

17. Ruberg FL, Skene DJ, Hanifin JP: Melatonin regulation in humans with color vision deficiencies. J Clin Endocrinol Metab 1996; 81: 2980–2985.

18. Czeisler CA, Shanahan TL, Klerman EB, Martens H, Brotman DJ, Emens JS, Klein MD, Rizzo JF: Suppression of melatonin secretion in some blind patients by exposure to bright light. N Engl J Med 1995; 332: 6–11.

19. Soni BG, Foster RG: A novel and ancient vertebrate opsin. FEBS Lett 1997; 406: 279– 283.

20. Provencio I, Jiang G, De Grip WJ, Hayes WP, Rollag MD: Melanopsin: an opsin in melanophores, brain, and eye. Proc Natl Acad Sci USA 1998; 95: 340–345.

21. Sun H, Gilbert DJ, Copeland NG, Jenkins NA, Nathans J: Peropsin, a novel visual pigment- like protein located in the apical microvilli of the retinal pigment epithelium. Proc Natl Acad Sci USA 1997; 94: 9893–9898.

22. Oren DA: Humoral phototransduction: blood is a messenger. J Neurosci 1996; 2: 207– 210.

23. Miyamoto Y, Sancar A: Vitamin B 2 –based blue-light photoreceptors in the retinohypothalamic tract as the photoactive pigments for setting the circadian clock in mammals. Proc Natl Acad Sci USA 1998; 95: 6097– 6102.

24. Provencio I, Rodriguez IR, Jiang G, Hayes WP, Moreira EF, Rollag MD: A novel human opsin in the inner retina. J Neurosci 2000; 20: 600–605.

25. Raikhlin NT, Kvetnoy IM. Melatonin and enterochromaffine cells. Acta Histochem 1976; 55: 19-24.

26. Huether G, Poegeller G, Reimer R, George A. Effect of tryptophan administration on circulating melatonin levels in chicks and rats: evidence for stimulation of melatonin synthesis and release in the gastrointestinal tract. Life Sci 1992;51: 945-953.

66 27. Kvetnoy IM, Raikhlin NT Yuzhakov VV, Ingel IE. Extrapineal melatonin and its role in neuroendocrine regulation of homeostasis. Bull Exp Biol Med 1999; 127: 329-334.

28. Raikhlin NT, Kvetnoy IM, Kadagidze ZG, Sokolov AV. Immunomorphological studies on synthesis of melatonin in enterochromaffine cells. Acta Histochem Cytochem 1978; 11: 75-77.

29. Vakkuri O, Rintamaki H, Leppaluoto J. Plasma and tissue concentrations of melatonin after midnight light exposure and pinealectomy in the pigeon. J Endocrinol 1985; 105: 263-268.

30. Bubenik GA, Pang SF, Hacker RR, Smith PS. Melatonin concentrations in serum and tissues of porcine gastrointestinal tract and their relationship to the intake and passage of food. J Pineal Res 1996; 21: 251-256.

31. Messner M, Huether G, Lorf T, Ramadori G, Schworer H. Presence of melatonin in the human hepatobiliary-gastrointestinal tract. Life Sci 2001; 69: 543-551.

32. Bubenik GA, Pang SF, Cockshut JR, et al. Circadian variation of portent arterial and venous blood levels of melatonin in pigs and its relationship to food intake and sleep. J Pineal Research 2000; 28: 9-15.

33. Ma X, Idle JR, Krausz KW, Gonzales FJ. Metabolism of melatonin by human cytochromes p450. Drug Metab Dispos 2005; 22: 489-494.

34. Pandi-Perumal SR, Srinivasan V, Maestroni GJM, Cardinali DP, Poeggeler B, Hardeland R. Melatonin nature’s most versatile biological signal? FEBS J 2006; 273: 2813- 2838.

35. Hong GX, Pang SF. N-acetyltransferase activity in the quail (Coturnix coturnix jap) duodenum. Comp Biochem Physiol 1995; 112B: 251-255. 36. Quay WB, Ma YH. Demonstration of gastrointestinal hydroxyindole- O - methyltransferase. IRCS Med Sci 1976; 4: 563.

37. Stefulj J, Hoertner M, Ghosh M et al. Gene expression of the key enzyme of melatonin synthesis in extrapineal tissue of the rat. J Pineal Res 2001; 30: 103-108.

38. Bubenik GA, Hacker RR, Brown GM, Bartos L. Melatonin concentration in luminal fluid, mucosa and muscularis of the bovine and porcine gastrointestinal tract. J Pineal Res 1999; 26: 56-63.

39. Chow PH, Lee PPN, Poon AMS, Shiu SYW, Pang SF. The gastrointestinal system: A site of melatonin paracrine action. In: Melatonin: a universal photoperiodic signal with diverse action (Tang PL, Pang SF, Reiter RJ, eds.), Basel Switzerland, Karger, 1997, pp 123-132.

67 40. Huether G, Poeggeler G, Reimer R, George A. Effect of tryptophan administration on circulating melatonin levels in chicks and rats: evidence for stimulation of melatonin synthesis and release in gastrointestinal tract. Life Sci 1992; 51: 945-953.

41. Huether G. The contribution of extrapineal sites of melatonin to circulating melatonin levels in higher vertebrates. Experientia 1994; 49: 665-670.

42. Goldman, B.D. (2001). Mammalian photoperiodic system: formal properties and neuroendocrine mechanisms of photoperiodic time measurement. J. Biol. Rhythms 16:283–301.

43. Malpaux, B., Migaud, M., Tricoire, H., Chemineau, P. (2001). Biology of mammalian photoperiodism and the critical role of the pineal gland and melatonin. J. Biol. Rhythms 16:336–347.

44. Arendt, J. (1999). Is melatonin a photoperiodic signal in humans? Adv. Exp. Med. Biol. 460:417–424.

45. Vondrasova-Jelinkova, D., Hajek, I., Illnerova, H. (1999). Adjustment of the human melatonin and cortisol rhythms to shortening of the natural summer photoperiod. Brain Res . 816:249–253.

46. Wehr, T.A. (1991). The durations of human melatonin secretion and sleep respond to changes in daylength (photoperiod). J. Clin. Endocrinol. Metab . 73:1276–1280.

47. Wehr, T.A. (2001). Photoperiodism in humans and other primates: evidence and implications. J. Biol. Rhythms 16:348–364. 48. Dijk, D.J., Cajochen, C. (1997). Melatonin and the circadian regulation of sleep initiation, consolidation, structure, and the sleep EEG . J. Biol. Rhythms 12:627–635.

49. Rajaratnam, S.M., Arendt, J. (2001). Health in a 24-h society. Lancet 358:999–1005.

50. Fleur, S.E., Kalsbeek, A., Wortel, J., van der Vliet, J., Buijs, R.M. (2001). Role for the pineal and melatonin in glucose homeostasis: pinealectomy increases night-time glucose concentrations . J. Neuroendocrinol . 13:1025–1032.

51. Maestroni, G.J. (1998). The photoperiod transducer melatonin and the immune- hematopoietic system. J. Photochem. Photobiol . B 43:186–192.

52. Scheer, F.A., Van Montfrans, G.A., van Someren, E.J., Mairuhu, G., Buijs, R.M. (2004). Daily nighttime melatonin reduces blood pressure in male patients with essential hypertension. Hypertension 43: 192–197.

53. Lockley, S.W., Skene, D.J., Tabandeh, H., Bird, A.C., Defrance, R., Arendt, J. (1997b). Relationship between napping and melatonin in the blind. J. Biol. Rhythms 12:16–25.

68 54. De Leersnyder, H., De Blois, M.C., Claustrat, B., Romana, S., Albrecht, U., Von Kleist- Retzow, J.C., Delobel, B., Viot, G., Lyonnet, S., Vekemans, M., Munnich, A. (2001a). Inversion of the circadian rhythm of melatonin in the Smith-Magenis syndrome. J. Pediatr . 139:111–116.

55. De Leersnyder, H., de Blois, M.C., Vekemans, M., Sidi, D., Villain, E., Kindermans, C., Munnich, A. (2001b). Beta(1)-adrenergic antagonists improve sleep and behavioural disturbances in a circadian disorder, Smith-Magenis syndrome. J Med. Genet . 38:586– 590.

56. Deacon, S., English, J., Tate, J., Arendt, J. (1998). Atenolol facilitates light-induced phase shifts in humans. Neurosci. Lett . 242:53–56.

57. Deacon, S., Arendt, J. (1996b). Adapting to phase shifts, II. Effects of melatonin and conflicting light treatment. Physiol. Behav. 59:675–682.

58. Wirz-Justice, A., Krauchi, K., Cajochen, C., Danilenko, K.V., Renz, C., Weber, J.M. (2004). Evening melatonin and bright light administration induce additive phase shifts in dim light melatonin onset. J. Pineal Res . 36:192–194.

59. Reppert, S.M., Weaver, D.R., Ebisawa, T., 1994. Cloning and characterization of a mammalian melatonin receptor that mediates reproductive and circadian responses. Neuron 13, 1177–1185. 60. Dubocovich, M.L., Markowska, M., 2005. Functional MT1 and MT2 melatonin receptors in mammals. Endocrine 27, 101–110.

61. Nosjean, O., Ferro, M., Coge, F., Beauverger, P., Henlin, J.M., Lefoulon, F., Fauchere, J.L., Delagrange, P., Canet, E., Boutin, J.A., 2000. Identification of the melatonin- binding site MT3 as the quinone reductase 2. J. Biol. Chem. 275, 31311– 31317.

62. Zisapel, N., Laudon, M., 1982. Dopamine release induced by electrical field stimulation of rat hypothalamus in vitro: inhibition by melatonin. Biochem. Biophys. Res. Commun. 104, 1610–1616.

63. Laudon, M., Nir, I., Zisapel, N., 1988. Melatonin receptors in discrete brain areas of the male rat. Impact of aging on density and on circadian rhythmicity. Neuroendocrinology 48, 577–583.

64. Anis, Y., Nir, I., Zisapel, N., 1989. Diurnal variations in melatonin binding sites in the hamster brain: impact of melatonin. Mol. Cell. Endocrinol. 67, 121–129.

65. Benitez-King, G., Anton-Tay, F., 1993. Calmodulin mediates melatonin cytoskeletal effects. Experientia 49, 635–641. 66. Macias, M., Escames, G., Leon, J., Coto, A., Sbihi, Y., Osuna, A., Acun˜a-Castroviejo, D., 2003. Calreticulin-melatonin. An unexpected relationship. Euro. J. Biochem. 270, 832–840.

67. Cardinali, D.P., Freire, F., 1975. Melatonin effects on brain. Interaction with microtubule protein, inhibition of fast axoplasmic flow and induction of crystalloid and tubular formations in the hypothalamus. Mol. Cell Endocrinol. 2, 317–330.

68. Melendez, J., Maldonado, V., Ortega, A., 1996. Effect of melatonin on beta-tubulin and MAP2 expression in NIE-115 cells. Neurochem. Res. 21, 653–658.

69. Benitez-King, G., 2006. Melatonin as a cytoskeletal modulator: implications for cell physiology and disease. J. Pineal Res. 40, 1–9.

70. Reppert, S.M., Godson, C., Mahle, C.D., Weaver, D.R., Slaugenhaupt, S.A., Gusella, J.F., 1995. Molecular characterization of a second melatonin receptor expressed in human retina and brain: the Mel1b melatonin receptor. Proc. Natl. Acad. Sci. U.S.A. 92, 8734– 8738.

71. Reppert, S.M., Weaver, D.R., Ebisawa, T., 1994. Cloning and characterization of a mammalian melatonin receptor that mediates reproductive and circadian responses. Neuron 13, 1177–1185. 72. Liu, C., Weaver, D.R., Jin, X., Shearman, L.P., Pieschl, R.L., Gribkoff, V.K., Reppert, S.M., 1997. Molecular dissection of two distinct actions of melatonin on the suprachiasmatic circadian clock. Neuron 19, 91–102.

73. Al Ghoul, W.M., Herman, M.D., Dubocovich, M.L., 1998. Melatonin receptor subtype expression in human cerebellum. Neuroreport 9, 4063–4068.

74. Savaskan, E., Olivieri, G., Meier, F., Brydon, L., Jockers, R., Ravid, R., Wirz-Justice, A., Muller-Spahn, F., 2002a. Increased melatonin 1a-receptor immunoreactivity in the hippocampus of Alzheimer’s disease patients. J. Pineal Res. 32, 59–62.

75. Uz, T., Arslan, A.D., Kurtuncu, M., Imbesi, M., Akhisaroglu, M., Dwivedi, Y., Pandey, G.N., Manev, H., 2005. The regional and cellular expression profile of the melatonin receptor MT1 in the central dopaminergic system. Brain Res. Mol. Brain Res. 136, 45– 53.

76. Clemens, J.W., Jarzynka, M.J., Witt-Enderby, P.A., 2001. Down-regulation of MT1 melatonin receptors in rat ovary following estrogen exposure. Life Sci. 69, 27–35.

77. Scher, J., Wankiewicz, E., Brown, G.M., Fujieda, H., 2002. MT1 melatonin receptor in the human retina: expression and localization. Investig. Ophthalmol. Vis. Sci.43, 889– 897.

78. Ekmekcioglu, C., Haslmayer, P., Philipp, C., Mehrabi, M.R., Glogar, H.D., Grimm, M., Leibetseder, V.J., Thalhammer, T., Marktl, W., 2001a. Expression of the MT1 melatonin receptor subtype in human coronary arteries. J. Recept. Signal. Transduct. Res. 21, 85– 91.

79. Ekmekcioglu, C., Haslmayer, P., Philipp, C., Mehrabi, M.R., Glogar, H.D., Grimm, M., Thalhammer, T., Marktl, W., 2001b. 24 h variation in the expression of the MT1 melatonin receptor subtype in coronary arteries derived from patients with coronary heart disease. Chronobiol. Int. 18, 973–985.

80. Naji, L., Carrillo-Vico, A., Guerrero, J.M., Calvo, J.R., 2004. Expression of membrane and nuclear melatonin receptors in mouse peripheral organs. Life Sci. 74, 2227– 2236.

81. Aust, S., Thalhammer, T., Humpeler, S., Jager, W., Klimpfinger, M., Tucek, G., Obrist, P., Marktl, W., Penner, E., Ekmekcioglu, C., 2004. The melatonin receptor subtype MT1 is expressed in human gallbladder epithelia. J. Pineal Res. 36, 43–48.

82. Nosjean, O., Nicolas, J.P., Klupsch, F., Delagrange, P., Canet, E., Boutin, J.A., 2001. Comparative pharmacological studies of melatonin receptors: MT1, MT2 and MT3/QR2. Tissue distribution of MT3/QR2. Biochem. Pharmacol. 61, 1369–1379.

83. von Gall, C., Stehle, J.H., Weaver, D.R., 2002. Mammalian melatonin receptors: molecular biology and signal transduction. Cell Tissue Res. 309, 151–162.

84. Witt-Enderby, P.A., Bennett, J., Jarzynka, M.J., Firestine, S., Melan, M.A., 2003. Melatonin receptors and their regulation: biochemical and structural mechanisms. Life Sci. 72, 2183–2198.

85. Brydon, L., Roka, F., Petit, L., de Coppet, P., Tissot, M., Barrett, P., Morgan, P.J., Nanoff, C., Strosberg, A.D., Jockers, R., 1999. Dual signaling of human Mel1a melatonin receptors via Gi2, Gi3, and Gq/11 proteins. Mol. Endocrinol. 13, 2025–2038.

86. McArthur AJ, Hunt AE, Gillette MU 1997 Melatonin action and signal transduction in the rat suprachiasmatic circadian clock: activation of protein kinase C at dusk and dawn. Endocrinology 138:627–634

87. Langton P. Ward SM. Carl A., Novell MA, Sanders KM. Spontaneous electrical activity of interstitial cells of Cajal isolated from canine proximal colon. Proc Natl Acad Sci USA 1989; 86, 7280-7284.

88. Sanders KM. Interstitial cells of Cajal: "Spark Plugs" of gastrointestinal motility. Motility 1996; 34: 13.

89. Komoro T, Seki K, lloriguchi K. Ultrastructural characterization of the interstitial cells of Cajal. Wiley-Liss, Inc. Arch Histol Cytol 1999; 62(4): 295-316.

90. Nowak L, Krolczyk G, ¯ urowski D, Sobocki J, Thor PJ. Gastric stimulation is effective in reversing experimental gastroparesis. Folia Med Cracov 2004; 3: 12-17.

71 91. Merle A, Delagrange P, Renard P et al. Effect of melatonin on motility pattern of small intestine inrats and its inhibition by melatonin receptor antagonist S 22153. J Pineal Res 2000; 29(2): 116-124.

92. Delagrange P, Atkinson J, Boutin JA et al. Therapeutic perspectives for melatonin agonists and antagonists . J Neuroendocrinol 2003; 15(4): 442-448.

93. Teresa Martín M, Azpiroz F, Malagelada JR. Melatonin as a modulator of the ileal brake mechanism. Scand J Gastroenterol 2005; 40(5): 559-563.

94. Drago F, Macauda S, Salehi S. Small doses of melatonin increase intestinal motility in rats. Dig Dis Sci 2002; 47(9): 1969-1974.

95. Kasimay O, Cakir B, Devseren E, and Yegen BC. Exogenous melatonin delays gastric emptying rate in rats: role of CCK2 and 5-HT3 receptors. J Physiol Pharmacol 56: 543- 553, 2005.

96. Storr M, Koppitz P, Sibaev A, Saur D, Kurjak M, Franck H, Schusdziarra V, and Allescher HD. Melatonin reduces non-adrenergic, non-cholinergic relaxant neurotransmission by inhibition of nitric oxide synthase activity in the gastrointestinal tract of rodents in vitro. J Pineal Res 33: 101-108, 2002.

97. Storr M, Schusdziarra V, and Allescher HD. Inhibition of small conductance K+ - channels attenuated melatonin-induced relaxation of serotonin-contracted rat gastric fundus. Can J Physiol Pharmacol 78: 799-806, 2000.

98. Chang HM, Ling EA, Chen CF, Lue H, Wen CY, and Shieh JY. Melatonin attenuates the neuronal NADPH-d/NOS expression in the nodose ganglion of acute hypoxic rats. J Pineal Res 32: 65-73, 2002.

99. Leon J, Macias M, Escames G, Camacho E, Khaldy H, Martin M, Espinosa A, Gallo MA, and Acuna-Castroviejo D. Structure-related inhibition of calmodulin-dependent neuronal nitric-oxide synthase activity by melatonin and synthetic kynurenines. Mol Pharmacol 58: 967-975, 2000.

100. Pozo D, Reiter RJ, Calvo JR, and Guerrero JM. Inhibition of cerebellar nitric oxide synthase and cyclic GMP production by melatonin via complex formation with calmodulin. J Cell Biochem 65: 430-442, 1997.

101. Murthy KS and Makhlouf GM. Phosphoinositide metabolism in intestinal smooth muscle: preferential production of Ins(1,4,5)P3 in circular muscle cells. Am J Physiol 261: G945-951, 1991.

72 102. Murthy KS, Grider JR, and Makhlouf GM. InsP3-dependent Ca2+ mobilization in circular but not longitudinal muscle cells of intestine. Am J Physiol 261: G937-944, 1991.

103. Hellstrom PM, Murthy KS, Grider JR, and Makhlouf GM. Coexistence of three tachykinin receptors coupled to Ca++ signaling pathways in intestinal muscle cells. J Pharmacol Exp Ther 270: 236-243, 1994.

104. Murthy KS and Makhlouf GM. Functional characterization of phosphoinositide-specific phospholipase C-beta 1 and -beta 3 in intestinal smooth muscle. Am J Physiol 269: C969-978, 1995.

105. Murthy KS and Makhlouf GM. Adenosine A1 receptor-mediated activation of phospholipase C-beta 3 in intestinal muscle: dual requirement for alpha and beta gamma subunits of Gi3. Mol Pharmacol 47: 1172-1179, 1995.

106. Murthy KS and Makhlouf GM. Opioid mu, delta, and kappa receptor-induced activation of phospholipase C-beta 3 and inhibition of adenylyl cyclase is mediated by Gi2 and G(o) in smooth muscle. Mol Pharmacol 50: 870-877, 1996.

107. Murthy KS, Coy DH, and Makhlouf GM. Somatostatin receptor-mediated signaling in smooth muscle. Activation of phospholipase C-beta3 by Gbetagamma and inhibition of adenylyl cyclase by Galphai1 and Galphao. J Biol Chem 271: 23458-23463, 1996.

108. Murthy KS and Makhlouf GM. Coexpression of ligand-gated P2X and G protein- coupled P2Y receptors in smooth muscle. Preferential activation of P2Y receptors coupled to phospholipase C (PLC)-beta1 via Galphaq/11 and to PLC-beta3 via Gbetagammai3. J Biol Chem 273: 4695-4704, 1998.

109. Teng B, Murthy KS, Kuemmerle JF, Grider JR, Sase K, Michel T, and Makhlouf GM. Expression of endothelial nitric oxide synthase in human and rabbit gastrointestinal smooth muscle cells. Am J Physiol 275: G342-351, 1998.

110. Murthy KS and Zhou H. Selective phosphorylation of the IP3R-I in vivo by cGMP- dependent protein kinase in smooth muscle. Am J Physiol Gastrointest Liver Physiol 284: G221-230, 2003.

111. Murthy KS, Zhou H, Grider JR, Brautigan DL, Eto M, and Makhlouf GM. Differential signalling by muscarinic receptors in smooth muscle: m2-mediated inactivation of myosin light chain kinase via Gi3, Cdc42/Rac1 and p21-activated kinase 1 pathway, and m3-mediated MLC20 (20 kDa regulatory light chain of myosin II) phosphorylation via Rho-associated kinase/myosin phosphatase targeting subunit 1 and protein kinase C/CPI- 17 pathway. Biochem J 374: 145-155, 2003.

73 112. Zhou H and Murthy KS. Distinctive G protein-dependent signaling in smooth muscle by sphingosine 1-phosphate receptors S1P1 and S1P2. Am J Physiol Cell Physiol 286: C1130-1138, 2004.

113. Huang J, Zhou H, Mahavadi S, Sriwai W, Lyall V, and Murthy KS. Signaling pathways mediating gastrointestinal smooth muscle contraction and MLC20 phosphorylation by motilin receptors. Am J Physiol Gastrointest Liver Physiol 288: G23-31, 2005.

114. Murthy KS. Signaling for contraction and relaxation in smooth muscle of the gut. Annu Rev Physiol 68: 345-374, 2006.

115. Thor PJ, Krolczyk G, Gil K, Zurowski D, and Nowak L. Melatonin and serotonin effects on gastrointestinal motility. J Physiol Pharmacol 58 Suppl 6: 97-103, 2007.

116. Gomez-Pinilla PJ, Camello PJ, and Pozo MJ. Effects of melatonin on gallbladder neuromuscular function in acute cholecystitis. J Pharmacol Exp Ther 323: 138-146, 2007.

117. Gomez-Pinilla PJ, Camello PJ, and Pozo MJ. Protective effect of melatonin on Ca2+ homeostasis and contractility in acute cholecystitis. J Pineal Res 44: 250-260, 2008.

118. Lucchelli A, Santagostino-Barbone MG, and Tonini M. Investigation into the contractile response of melatonin in the guinea-pig isolated proximal colon: the role of 5-HT4 and melatonin receptors. Br J Pharmacol 121: 1775-1781, 1997.

119. Poon AM, Kravtsov GM, and Pang SF. Receptor-mediated modulation of avian caecal muscle contraction by melatonin: role of tyrosine protein kinase. J Pineal Res 32: 199- 208, 2002.

120. Gomez-Pinilla PJ, Camello-Almaraz C, Moreno R, Camello PJ, and Pozo MJ. Melatonin treatment reverts age-related changes in Guinea pig gallbladder neuromuscular transmission and contractility. J Pharmacol Exp Ther 319: 847-856, 2006.

121. Reyes-Vazquez C, Naranjo-Rodriguez EB, Garcia-Segoviano JA, Trujillo-Santana JT, and Prieto-Gomez B. Apamin blocks the direct relaxant effect of melatonin on rat ileal smooth muscle. J Pineal Res 22: 1-8, 1997.

122. Poon AM, Mak AS, and Luk HT. Melatonin and 2[125I]iodomelatonin binding sites in the human colon. Endocr Res 22: 77-94, 1996.

123. Pontoire C, Bernard M, Silvain C, Collin JP, and Voisin P. Characterization of melatonin binding sites in chicken and human intestines. Eur J Pharmacol 247: 111-118, 1993.

74 124. Lee PP and Pang SF. Melatonin and its receptors in the gastrointestinal tract. Biol Signals 2: 181-193, 1993.

75 VITA

Rashad Ahmed was born on July 14 th 1984.

Rashad received a Bachelors of Arts in Government and Politics degree from University of Maryland in College Park, Maryland in 2007, after which he entered graduate school at Virginia Commonwealth University.